The international standard ISO/TS 218721 to study the occurence of total and

pathogenic Vibrio parahaemolyticus and Vibrio cholerae in seafood:

ITS improvement by use of a chromogenic medium and PCR
Jean-Philippe Rosec
a,
, Vronique Causse
a
, Barbara Cruz
a
, Jean Rauzier
b
, Laurence Carnat
a
a
Service Commun des Laboratoires Laboratoire de Montpellier Unit Biologie, 205, rue de la croix verte, 34196 Montpellier Cedex 5, France
b
Institut Pasteur, Unit des Bactries Pathognes Entriques, Centre National de Rfrence des Vibrions et du Cholra 25, 28, rue du Docteur Roux, 75724 Paris Cedex 15, France
a b s t r a c t a r t i c l e i n f o
Article history:
Received 18 November 2011
Received in revised form 25 April 2012
Accepted 27 April 2012
Available online 12 May 2012
Keywords:
Vibrio parahaemolyticus
Vibrio cholerae
bivalve molluscs
trh gene
ISO/TS 218721
PCR
During two surveys conducted in 2008 and 2009, the culture method described in the international standard
ISO/TS 218721 was applied to the detection of Vibrio parahaemolyticus and Vibrio cholerae in 112 living bi-
valve mollusc samples, with a chromogenic medium used in addition to the TCBS agar, as second selective
isolation medium and for enumeration of V. parahaemolyticus and V. cholerae by surface inoculation. A PCR
method for detection of these 2 Vibrio species and the hemolysin genes tdh and trh, was applied in parallel.
In 2009, the survey was extended to nsh llets and crustaceans. PCR was also used for species conrmation
of characteristic colonies. The identity of the PCR products, specically targeting V. parahaemolyticus, was
checked by sequencing.
Occurrence of V. parahaemolyticus and V. cholerae isolates in living bivalve molluscs ranged from 30.4% to 32.6%
and from 1.4% to 4.7% respectively. In frozen crustaceans (2009 survey) V. parahaemolyticus and V. cholerae iso-
lates were respectively found in 45% and 10% of the samples. No V. parahaemolyticus or V. cholerae was detected
infrozensh llets, neither by the ISOmethod nor by PCR. In 2009, enteropathogenic V. parahaemolyticus (trh+)
was isolated from4 out of 43 oyster samples while the trh gene was present in V. alginolyticus strains and insam-
ples where V. parahaemolyticus was not detected (9 over 112 samples).
The ISO method failed to isolate V. parahaemolyticus in 44% to 53% of the living bivalve molluscs where PCR
detected the toxR gene specic of V. parahaemolyticus (Vp-toxR). Our results highlighted the need for a revision
of the ISO/TS 218721 standard, at least, for analysis of living bivalve molluscs, and conrmed the increasing
concern of enteropathogenic V. parahaemolyticus in French bivalve molluscs. Enrichment at 41.5 C was
questioned and some reliable solutions for the improvement of the ISO/TS 218721 method, such as the PCR
method for screening of positive samples and conrmation of colonies, were pointed out.
2012 Elsevier B.V. All rights reserved.
1. Introduction
Vibrio parahaemolyticus is one of the pathogenic Vibrio species
implicated in a large number of seafood-related outbreaks of gastro-
intestinal infections in humans, often associated with the consump-
tion of raw or undercooked seafood, particularly in Asia and North
America. Among the V. parahaemolyticus species, it is assumed that
only the strains carrying the genes tdh and/or trh, respectively
encoding the thermostable direct hemolysin (TDH) and TDH-related
hemolysin (TRH), are implicated in gastroenteritis cases and thus
considered as enteropathogenic (Nishibuchi and Kaper, 1995; Shira
et al., 1990; Zhang and Austin, 2005).
Now, the incidence of V. parahaemolyticus in shellsh and sea-
food is an increasing health concern in Europe since several studies
demonstrated the occurrence of pathogenic strains in shellsh sam-
ples (Bauer et al., 2006; Blanco-Abad et al., 2009; Robert-Pillot et al.,
2004; Martinez-Urtaza et al., 2008; Rosec et al., 2009) with some of
these strains implicated in large outbreaks (Martinez-Urtaza et al.,
2008). Moreover, several investigations previously implicated the
pandemic clone O3:K6 in outbreaks or sporadic cases in France
and Spain (Martinez-Urtaza et al., 2005; Quilici et al., 2005). Facing
this change, European legislation (Commission Regulation (EC),
2073/2005) has emphasized the need for efcient and reliable
methods for detection of V. parahaemolyticus in shellsh.
In 2005 and 2006, we analysed living bivalve molluscs with a cul-
ture method using a two-step enrichment procedure and with PCR
method targeting V. parahaemolyticus and tdh and trh genes. High in-
cidence of total and presumptive pathogenic V. parahaemolyticus as
well as important discrepancies between PCR and cultural results
were observed (Rosec et al., 2009) as other studies comparing PCR
and cultural methods did (Blanco-Abad et al., 2009; Raghunath et
al., 2009; Tyagi et al., 2009). Thus, we carried out surveys for two
International Journal of Food Microbiology 157 (2012) 189194
Corresponding author. Tel.: +33 467 04 62 08; fax: +33 467 52 75 45.
E-mail address: jean-philippe.rosec@scl.nances.gouv.fr (J-P. Rosec).
0168-1605/$ see front matter 2012 Elsevier B.V. All rights reserved.
doi:10.1016/j.ijfoodmicro.2012.04.026
Contents lists available at SciVerse ScienceDirect
International Journal of Food Microbiology
j our nal homepage: www. el sevi er . com/ l ocat e/ i j f oodmi cr o
more consecutive years (2008 and 2009) to compare the sensitivity of
different methods (culture-based method and PCR method) to detect
incidences of total and enteropathogenic strains of V. parahaemolyticus
and V. cholerae in seafood samples. The culture-based method followed
the protocol of the ISO/TS 218721 standard (Anonymous, 2007a).
Additionally, the incidence of trh and/or tdh genes was investigated
in order to determine if other Vibrio species than V. parahaemolyticus,
also harboring trh or tdh genes, were present.
2. Material and methods
2.1. Samples
All samples were collected during spring and summer when high
temperatures allowdensities of total andpathogenic V. parahaemolyticus
to increase (De Paola et al., 2003; Kelly and Stroh, 1988; Nigro et al.,
2011; Oberbeckmann et al., 2011). In 2008, 69 samples of living bivalve
molluscs were analyzed: 60 oysters, 7 clams and 2 mussels taken at the
production stage. All samples were harvested on the Languedoc shore
from April 22th to October 2nd. In 2009, the survey was extended to
oysters from the French shore and to frozen nsh and imported frozen
crustaceans: 25 and 18 oysters respectively taken at the production and
retail stage, 15 frozen shrimp originating fromtropical areas, 5 other fro-
zen crustaceans fromthe north Atlantic ocean, 11 frozen sh llets and9
sh llets from ready-to-eat frozen sushi or sashimi. All oysters were
harvested from early June to early August.
2.2. Culture method
2.2.1. V. cholerae and V. parahaemolyticus detection and identication
A ow diagram of the method is given in Fig. 1. For each sample, a
test portion of 25 g of esh and intervalvular water, according to the
ISO 68873 standard (Anonymous, 2003), was analyzed following the
procedure described in the ISO/TS 218721. Homogenization was
made with a Stomacher 400 lab blender (AES, France) in alkaline sa-
line peptone water (ASPW) made with 20 g/l NaCl and 20 g/l pep-
tone, adjusted at pH 8.6 with 5 N NaOH. Subsequent isolations were
made on TCBS agar medium (Biokar Diagnostics, France) and
ChromID Vibrio agar (bioMrieux, France) using 10 l loops. Blue-
green colonies on TCBS and pink colonies on ChromID Vibrio agar
1
25g of sample in 225ml of ASPW pH 8.6
incubation for 6 h 1 h
at 41.5C 1C or 37C 1C
(fresh products) (deep frozen products)
Isolation (10l loop) on TCBS and ChromID Vibrio agar
(second selective agar left to the choice of the laboratory)
incubation for 24h 3 h at 37C 1C
At least 5 typical colonies of V. parahaemolyticus
and V. cholerae on each medium isolation on
saline nutrient agar
Biochemical
confirmation
1
0.5 ml
(taken on surface)
Centrifugation 10000g / 10 min
Washing pellets with 1 ml 0.85%
NaCl
Centrifugation 10000g / 10 min
Resuspend pellets
in 0.25 ml Tris 10 mM pH 8.0
+ 10l protinase K (20 mg/ml)
Incubate 60C 60 min (at least and
until clear lysate) with periodic
shaking
Incubate 95C 15 min
Perform PCR reaction or
store at 20C
DNA extract
One ml of culture (taken on surface)
+ 10 ml of ASPW pH 8.6
incubation for
18h 1 h at 41.5C 1C
Fig. 1. Flow diagrams of the ISO/TS 218721 method and PCR method for detection of total and pathogenic Vibrio parahaemolyticus and V. cholera.
1
In this study biochemical con-
rmations were only carried out on PCR positive isolates.
190 J-P. Rosec et al. / International Journal of Food Microbiology 157 (2012) 189194
were considered typical of V. parahaemolyticus and isolated on saline
nutrient agar (peptone 3 g/l, NaCl 10 g/l, meat extract 5 g/l agar-agar
15 g/l, pH 7.5). Yellow colonies on TCBS and blue colonies on ChromID
Vibrio agar, were considered typical of V. cholerae and isolated on saline
nutrient agar. A maximum of 5 colonies typical of V. parahaemolyticus
and 5 colonies typical of V. cholerae, per plate of selective medium,
were tested by PCR for species conrmation. All colonies positive by
PCR for V. cholerae and V. parahaemolyticus species were tested by API
20E gallery (bioMrieux France).
2.2.2. Enumeration of V. cholerae and V. parahaemolyticus in bivalve
molluscs
Enumeration of V. cholerae and V. parahaemolyticus was made by
surface inoculation following the spreading spatula method described
in the ISO 7218 standard (Anonymous, 2007b). For each sample of
mollusc bivalve, 0.1 ml of the initial suspension in ASPW (see 2.2.1)
was spread on ChromID Vibrio agar plate in duplicate. For conrma-
tion, at least ve colonies out of the enumerated colonies considered
to be typical or similar to each of the potentially pathogenic Vibrio
spp. sought (V. cholerae, V. parahaemolyticus) were tested by PCR.
2.3. PCR protocols
V. parahaemolyticus and V. cholerae species were conrmed by PCR
specically targeting the toxR gene in V. parahaemolyticus -Vp-toxR-
(Kim et al., 1999; Rosec et al., 2009) and the V. cholerae 16 S-23 S
rRNA intergenic spacer region (Chun et al., 1999) respectively. The
detection of ctxA and ctxB genes in V. cholerae strains were performed
by the French NRC (Institut Pasteur Paris) as previously described
(Fields et al., 1992; Olsvik et al., 1993). Search for pathogenicity fac-
tors for V. parahaemolyticus (i.e. the trh and tdh genes), was per-
formed as follows.
2.3.1. DNA extraction
DNA extraction was performed directly on enrichment broth or on
isolated colonies. A owdiagramof the protocol for the DNA extraction
from second enrichment broths is given in Fig. 1. It was conducted as
previously described (Rosec et al., 2009). The DNA extracts were stored
at 20 C until PCR reactions were performed. For the DNA extraction
from isolates, a sufcient amount of isolated colonies was picked up
from saline nutrient agar and resuspended for washing in 0.5 ml of
0.85% NaCl. Then, they were pelleted by centrifugation at 10,000 g for
10 min and treated in the same manner as the enrichment broths (see
Fig. 1).
2.3.2. PCR reactions
The Vp-toxR amplications were performed in a thermal cycler
GeneAmp PCR system9700 (Applied Biosystems Applera, France).
The other amplications were performed either in the GeneAmp PCR
system 9700 (2008 survey) or in a Veriti (Applied Biosystems
Applera, France) (2009 survey) with a reaction mixture containing
1X buffer for Qbiogen Taq DNA polymerase (MP Biomedicals, France),
1.5 mM MgCl
2
, 200 M dNTP and 1U of Taq DNA polymerase for a
nal reaction volume of 50 l. Five microliters of DNA extract were
used. The parameters for amplication cycles were an initial denatur-
ation at 94 C-5 min, followed by 30 or 35 cycles of 94 C30 s/
annealing temperature30 s/72 C30 s and a nal elongation step at
72 C7 min. The primer sequences, number of cycles, and annealing
temperatures are given in Table 1.
For Vp-toxR target the lowest ampliable amount of a puried in-
ternal amplication control (IAC) was added to each reaction volume.
An external amplication control was also performed, using 16S
23S rDNA intergenic spacers (IGSs) (Lee et al., 2002) in order to check
the presence of ampliable bacterial DNA in the DNA extracts which
did not give any amplication with the other PCR reactions.
2.4. Construction of the IAC for use with toxR target amplication
The IAC was constructed and used as previously described by
Sachadyn and Kur (1998). It is amplicons of a part of pUC19 plasmid
DNA obtained by amplication with 5 over-hanging end primers
(IAC1 and IAC2). The 3 end-sequences of these primers are comple-
mentary to pUC19 sites (italic letters) whereas their 5 over-hanging
ends are identical to the diagnostic primers, R1 and R2 (underlined).
These chimeric primers were designed with the help of the free
Primer3 software (http://frodo.wi.mit.edu/primer3/input.htm), for
the sequences complementary to pUC19, and their PCR compatibility
was checked with help of OligoanAlyser 3.0 (http://www.idtdna/
analyser/Applications/OligoAnalyser). The size of the amplication
product is 431 bp.
IAC-1 : GTCTTCTGACGCAATCGTTGTTGCCGGGAAGCTAGAGTAA
IAC-2 : ATACGAGTGGTTGCTGTCATGGCTATGTGGCGCGGTATTAT
Amplication was performed with Taq DNA polymerase without
5-3exonuclease activity (Q-BioTaq Polymerase, MP Biomedicals,
France) to allowconservation of the non-hybridized 5 end sequences.
The PCR product was puried by gel electrophoresis and Qiaex gel ex-
traction kit (Qiagen) before using in Vp-toxR amplications.
2.5. Sequencing for conrmation of PCR positive results
In order to discard false-positive PCR results and conrm that Vp-
toxR PCR products originated well from V. parahaemolyticus DNA tem-
plate, 77 Vp-toxR PCR products from i) at least one Vp-toxR positive
strains per positive sample, ii) Vp-toxR+ second enrichment broths
which did not allow isolation of V. parahaemolyticus, were sequenced.
This was also done for trh genes amplicons of isolated colonies. Addition-
ally, in the 2008 survey, trh and tdh PCR products obtained with second
enrichment broths which allowed isolation of neither trh+ nor tdh+
strain, were also sequenced for conrmation of their identity. Either di-
rectly or after separation by agarose gel electrophoresis and purication
with the Qiaex II gel extraction kit (Qiagen) Vp-toxR and trh and tdh PCR
Table 1
PCR conditions and primers used for detection of Vibrio parahaemolyticus, tdh and trh genes, and V. cholera.
Target Primers Final concentration
of primers in the
reaction volume
References Number of amplication
cycles / Annealing
Temprature
Size of
amplied
product
Vp-toxR R1: GTCTTCTGACGCAATCGTTG
R2 : ATACGAGTGGTTGCTGTCATG
0.4 M Kim et al., 1999 30 cycles63 C 368 bp
tdh L-tdh : GTAAAGGTCTCTGACTTTTGGAC
R-tdh : TGGAATAGAACCTTCATCTTCACC
0.5 M Bej et al., 1999 35 cycles55 C 269 bp
trh S1: CTCTACTTTGCTTTCAGT
S2 : AATATTCTGGAGTTTCAT
0.55 M Suthienkul et al., 1995 35 cycles48 C 460 bp
ISR 16 S/23 S
(V. cholerae)
Forward=prVC-F : TTAAGCSTTTTCRCTGAGAATG
Reverse=prVCM-R : AGTCACTTAACCATACAACCCG
0.4 M Chun et al., 1999 35 cycles60 C 295 to 310 bp
IGS 16 S/23 S
(Amplication control)
16 S/23 S-F : TTGTACACACCGCCCGTC
16 S/23 S-R : CCTTTCCCTCACGGTACTG
0.2 M Lee et al., 2002 35 cycles55 C Multiple bands
191 J-P. Rosec et al. / International Journal of Food Microbiology 157 (2012) 189194
products were respectively sent to Institut Pasteur Paris (French Nation-
al Reference Center for Vibrios and cholera, FNRC-VC) or Beckman coul-
ter genomics (UK) for sequencing. The BLAST algorithm (BLASTN) was
used to search for sequence similarities at http://blast.ncbi.nlm.nih.gov/
Blast.cgi (Altschul et al., 1990), additionally subsequent alignment of
the PCR product sequences along with V. parahaemolyticus toxR gene
was achieved using the Bioedit free software version 7.0.9 downloaded
from http://www.mbio.ncsu.edu.
3. Results and discussion
3.1. Occurrence of V. cholerae and V. parahaemolyticus
No V. parahaemolyticus or V. cholerae was isolated or detected by
PCR in the 20 frozen nsh samples (Table 2).
Among the molluscs and crustaceans, V. cholerae was isolated
from 5 samples: 1 oyster in 2008, 2 oysters and 2 tropical frozen
shrimps in 2009. None of the isolated V. cholerae strains possessed
the cholera toxin genes, according to the analysis performed by the
French NRC (Institut Pasteur Paris).
V. parahaemolyticus was isolated from 21 over 69 (30.4%) and 14
over 43 (32.6%) bivalve mollusc samples in 2008 and 2009, respectively.
In frozen tropical crustaceans V. parahaemolyticus was isolated from 9
out of 20 samples (45%). No enteropathogenic V. parahaemolyticus
was isolated from crustaceans while trh positive V. parahaemolyticus
strains were found in 1 over 69 molluscs (1.4%) in 2008, and 4 over
43 molluscs (9.3%) in 2009. Our results are in accordance with
the V. parahaemolyticus occurrences recently observed in bivalve
molluscs in other European countries (Blanco-Abad et al., 2009;
Gugliandolo et al., 2010; Henigman et al., 2011; Roque et al.,
2009) but the reasons why a higher occurrence of enteropathogen-
ic V. parahaemolyticus was observed in 2009 remained unclear.
This higher occurrence could be linked to the geographical origin
of samples which was restricted to one region (Languedoc shore) in
2008. In 2010, with a sampling similar to 2009, we isolated trh posi-
tive V. parahaemolyticus strains in 12.9% of 45 oyster samples
(unpublished results). Such occurrences conrmed the concern
which was previously suspected about the presence of enteropatho-
genic V. parahaemolyticus in French bivalve molluscs in France
(Hervio-Heath et al., 2002; Quilici et al., 2005; Rosec et al., 2009).
Nevertheless, all the positive samples had V. parahaemolyticus and
V. cholerae levels below the theoretical limit of quantication of the
enumeration method (100 cfu/g). Low levels of V. parahaemolyticus
in oysters could contribute to explain that gastroenteritis outbreaks
or sporadic cases due to pathogenic V. parahaemolyticus in France
are rare (http://www.invs.sante.fr/surveillance/tiac/donnees2009/
tiac_donnees_2009.pdf; Delmas et al., 2010) even if probably
under-estimated, partly because routine microbiological analysis
of stools rarely includes testing for Vibrio species as a cause of en-
teric infections. Furthermore, the infectious dose for enteropatho-
genic V. parahaemolyticus is not precisely known and safe levels
of total or pathogenic V. parahaemolyticus in seafood for raw con-
sumption are highly variable, according to the national legislations:
b100 MPN/g in Japan (Hara-Kudo and Takatori, 2010) but b1.10
4
organisms/g in the United States of America (Yeung and Boor,
2004).
3.2. Use of ISO 218721 method and inuence of the second selective
isolation medium
Among the 40 samples where V. parahaemolyticus was isolated
with the ISO/TS 218721 method, ChromID Vibrio and TCBS media
allowed to isolate V. parahaemolyticus respectively in 35 and 18 sam-
ples. Nevertheless, if TCBS was much less efcient than ChromID Vib-
rio, it allowed isolation of V. parahaemolyticus in 5 samples 12.5% of
the positive ones- where ChromID Vibrio failed to do so. Then, we
could not recommend the use of only one specic chromogenic medi-
um(i.e. ChromIDVibrio) replacing the 2 selective media prescribed in
the current ISO 218721 protocol (TCBS which is mandatory, and a
second one left to the choice of the test laboratory).
In the 2008/2009 surveys the occurrence of V. parahaemolyticus in bi-
valve molluscs was much more higher than previously observed in our
2005/2006 surveys while the ratio of Vp-toxR positive samples were
not so different (43.9%in2005/200660.7%in2008/2009). Two maindif-
ferences inthe culture methods used in these surveys could contribute to
explain the higher ratio for cultural results observed in 2008/2009: i) in
2005/2006 the volume of the rst enrichment broth transferred in the
second one was a 10 l loop instead of 1 ml, ii) the second selective iso-
lation medium was Chromagar Vibrio instead of ChromID Vibrio. Now,
bacterial growth on ChromIDwas more abundant than growth previous-
ly oberved on Chromagar. Nevertheless, other factors could have
inuenced the results obtained with ChromID and Chromagar Vibrio
media, such as levels of V. parahaemolyticus and/or competing ora
which may vary with water temperature or salinity. Thus, comparative
trials using these two chromogenic media in parallel on the same sam-
ples should be carried out for estimating their efciencies.
3.3. Comparison between ISO/TS 218721 culture method and PCR
method
3.3.1. Sequencing results of Vp-toxR PCR products
The PCR method we used for detection and identication of V.
parahaemolyticus was previously established as reliable (Rosec et
al., 2009). Moreover, the identity of the Vp-toxR PCR products
Table 2
Detection of V. cholerae, total and pathogenic V. parahaemolyticus and V. parahaemolyticus virulence factors in seafood products by cultural and PCR methods.
2008
survey
2009
survey
Oysters
n
a
=60
Other bivalve molluscs
n=9
Oysters
n=43
Crustaceans
n=20
Fish llets
n=20
ISO/TS 21872-1
b
V. parahaemolyticus trh- / tdh- 19 1 6 9 0
V. parahaemolyticus trh+/ tdh- 1 0 4 0 0
V. alginolyticus trh+ 0 0 2 0 0
V. cholerae 1 0 2 2 0
PCR
c
Vp-toxR (without tdh and trh) 30 3 6 9 0
Vp-toxR and trh 8 0 19 0 0
Vp-toxR and tdh 1 0 0 0 0
trh (without Vp-toxR) 2 0 7 0 0
ISR 16S-23S
d
2 0 2 2 0
a
Number of samples analysed.
b
Samples fromwhichisolatedstrains were obtainedwiththe ISOmethod, identiedby PCRandconrmedby API 20Ebiochemical gallery (onlyPCRpositive strains, andat the species level).
c
Samples from which the mentioned genes were detected directly in the second enrichment broth of the ISO/TS 218721 culture method.
d
Specic of V. cholerae species.
192 J-P. Rosec et al. / International Journal of Food Microbiology 157 (2012) 189194
obtained in this study was conrmed by sequencing. In fact, all
the DNA sequences obtained from 77 Vp-toxR PCR products gave
98% to 100% homology with the corresponding sequence of toxR
gene from the ATCC 17802 V. parahaemolyticus strains. BLAST
analysis of these PCR products showed 100% homology with, at
least, one of the toxR gene sequences registered in the NCBI data-
base (http://www.ncbi.nlm.nih.gov/). Thus amplication of toxR
gene proved to be a good tool for conrming the identication
of the species V. parahaemolyticus from selected colonies, as well
as to screen the presence or absence of V. parahaemolyticus in
the second enrichment broth of the ISO/TS 218721 culture method,
as evidenced by sequencing results. It should be noted however that
this fragment was also amplied in some strains of V. alginolyticus
(results of the FNRC-VC, unpublished data).
3.3.2. Sensitivity of the ISO/TS 218721 method
V. cholerae was isolated from 5 over the 6 PCR positive samples
detected in the 112 molluscs and crustaceans we analyzed (Table 2).
Thus the ISO/TS 218721 method showed a goodrecovery of V. cholerae.
Nevertheless, in view of the small number of positive results the corre-
lation between PCR and ISO/TS 218721 methods need to be corrobo-
rated by further comparative analyses. It should also be noted that
DePaola and Hwang (1995) found a better recovery of V. cholerae O1
in oysters when the ratio of oyster tissue in initial suspension was
1:100 instead of 1:10. This ratio of 1:100 is recommended for an addi-
tional enrichment of oysters in the BAM methods for Vibrios (http://
www.fda.gov/Food/ScienceResearch/LaboratoryMethods/
BacteriologicalAnalyticalManualBAM).
In the living bivalve molluscs the ISO/TS 218721, culture method
allowed to isolate V. parahaemolyticus strains in only 22 samples over
the 43 Vp-toxR positive samples (51.6%) in 2008 and 10 over the 25
Vp-toxR positive ones (40%) in 2009. Low recoveries of enteropatho-
genic V. parahaemolyticus by culture method were also observed, with
enteropathogenic strains isolated from only 5 samples over 28
(17.9%) where trh or tdh gene was detected together with Vp-toxR
(Table 2).
On the contrary, the ISO method allowed good recovery of V.
parahaemolyticus in frozen crustaceans (Tables 2 and 3) as we
also observed in a 2010 survey (data not shown). Thus, surprising-
ly, the recovery of V. parahaemolyticus for frozen samples was
better than that for fresh samples, though the number of viable
V. parahaemolyticus in frozen samples is expected to be much
lower than in fresh samples due to freezing-thawing damage. The
good recovery of V. parahaemolyticus in frozen samples whose the
rst enrichment was incubated at 37 C, in comparison with bivalve
molluscs (fresh samples) incubated at 41.5 C (Fig. 1) supported that
rst enrichment culture of V. parahaemolyticus at 41.5 C might be too
high and possibly impede V. parahaemolyticus to reach a sufcient
level and outgrow the competing ora. It was, in fact, reported that
the highest growth temperature for V. parahaemolyticus was 43 C
(ICMSF, 1996) and Baross and Liston (1970) observed that sediment
samples incubated at 42 C yielded a higher proportional recovery of
hemolytic Vibrios though the total count was reduced. Also in favour
of the hypothesis of too severe a temperature for V. parahaemolyticus
growth, were the good recoveries of V. cholerae (Table 2), not outgrown
by competing ora and for which an even higher than 41.5 C (42 C)
temperature was established as suitable for its selective culture
(DePaola et al., 1987), unlike V. parahaemolyticus.
Nevertheless, low recoveries of V. parahaemolyticus with bivalve
molluscs are not uncommon, even with enrichment broths incubated
at 35 C or 37 C (Blanco-Abad et al., 2009; Gugliandolo et al., 2010;
Henigman et al., 2011; Nordstrom et al., 2007; Roque et al., 2009) and
we previously observed that enrichment of oysters in ASPW incubated
at 37 C for 18 h was leading to the outgrowth of V. parahaemolyticus
(data not shown). According to these results, it should be investigated
if incubation of the rst enrichment broth at 37 C instead of 41.5 C,
followed by a second enrichment still incubated at 41.5 C, could im-
prove the recovery of V. parahaemolyticus by the ISO/TS 218721
method.
3.4. Occurrence of trh gene in V. parahaemolyticus and other Vibrio spp.
in bivalve molluscs
The trh gene together with Vp-toxR gene was detected in the en-
richment broths of 8 over 69 samples (11.6%) in 2008 and of 19
over 43 samples (44.2%) in 2009.
Additionally, we found 9 over 112 molluscs samples (8%) where
trh gene was detected without Vp-toxR gene. From 2 of these 9
samples we isolated trh positive/Vp-toxR negative strains which
were identied as V. alginolyticus by API 20E gallery. Sequencing re-
sults conrmed the identity of the trh PCR products (strains and
2008 broths) showing 100% homology with, at least, one of the
trh gene sequences registered in the NCBI database. These results
conrmed that other Vibrio spp. than V. parahaemolyticus could harbour
trh gene as demonstrated in studies of Raghunath et al. (2010), Masini
et al. (2007) and Gonzalez-Escalona et al. (2006) who detected trh
gene in Aeromonas veronii, V. alginolyticus and V. harveyi. These authors
established that the trh-like genes detected in these Vibrio spp. were
highly homologous with the trh gene from V. parahaemolyticus. Sim-
ilar observation was made for tdh gene and V. mimicus, V. cholerae
and V. hollisae (Nishibuchi and Kaper, 1995). Given the occurrence
of mollusc samples where trh positive non-V. parahaemolyticus
was detected or isolated (8%), our results conrmed that trh
gene is not a relevant target for direct detection of enteropatho-
genic V. parahaemolyticus in enrichment broths -unless PCR primers
specic for V. parahaemolyticus trh gene could be designed. The trh
gene should be used with isolated colonies whose identication to V.
parahaemolyticus species was undoubtedly established.
4. Conclusion
Our work demonstrated the need for a revision of the ISO/TS
218721 standard whose efciency for detection of V. parahaemolyticus
in living bivalve molluscs was not satifactory. It questioned the temper-
ature at which the rst enrichment broth is incubated for fresh samples
(e.g. bivalve milluscs), in the current ISO/TS 218721 method. Temper-
ature decrease from 41.5 C to 37 C should be investigated in order to
improve the recovery of V. parahaemolyticus. The use of a chromogenic
medium, in combination with TCBS agar, and of species specic PCR
methods for screening of positive samples and conrmation of colonies,
could also simplify the application of the ISO/TS 218721 standard and
allow its improvement by focusing conrmation work on presumably
positive samples and colonies. This work also demonstrated that the
occurence of Vibrio spp. other than V. parahaemolyticus harbouring the
trh gene, in molluscs, was not negligible.
Table 3
Detection of V. parahaemolyticus in seafood products: correlation between culture and
PCR methods.
V. parahaemolyticus results 2008 2009
PCR / ISO/TS 21872-1 Oysters
n
a
= 60
Other bivalve
molluscs
n=9
Oysters
n=43
Crustaceans
n=20
+ / + 20 2 10 9
+ / - 20 1 15 0
- / + 0 0 0 0
- / - 20 6 18 11
+ / + : samples positive by the two methods; + / - : samples positive by PCR, negative
by culture method; - / +: samples negative by PCR, positive by culture method; - / - :
samples negative by the two methods.
a
Number of samples analysed.
193 J-P. Rosec et al. / International Journal of Food Microbiology 157 (2012) 189194
Acknowledgements
We thank Marie-Laure Quilici (French National Reference Center
for Vibrios and vibriosis) for her great help and support in this work.
Many thanks to Lucien Doljac (National Graduate School of Chemis-
try Montpellier) for its useful comments on the Englishwording of the
manuscript.
References
Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment
search tool. Journal of Molecular Biology 215, 403410.
Anonymous, 2003. ISO 68873 : 2003. Microbiology of food and animal feeding stuffs -
Preparation of test samples, initial suspension and decimal dilutions for microbio-
logical examination - Part 3: Specic rules for the preparation of sh and shery
products. International Organization for Standardization (ISO) 1, Chemin de la
Voie Creuse, case postale 56, CH-1211 Geneva 20, Switzerland.
Anonymous, 2007a. ISO/TS 218721: 2007. Microbiology of food and animal feeding
stuffs horizontal method for the detection of potentially enteropathogenic Vibrio
spp. Part 1: Detection of Vibrio parahaemolyticus and Vibrio cholerae. Internation-
al Organization for Standardization (ISO) 1, Chemin de la Voie Creuse, case postale
56, CH-1211 Geneva 20, Switzerland.
Anonymous, 2007b. ISO 7218: 2007. Microbiology of food and animal feeding stuffs.
General requirements and guidance for microbiological examinations. Internation-
al Organization for Standardization (ISO) 1, Chemin de la Voie Creuse, case postale
56, CH-1211 Geneva 20, Switzerland.
Baross, J., Liston, J., 1970. Occurrence of Vibrio parahaemolyticus and related hemolytic
Vibrios in marine environments of Washington State. Applied Microbiology 20,
179186.
Bauer, A., Ostensvik, O., Florvag, M., Ormen, O., Rorvik, L.M., 2006. Occurence of Vibrio
parahaemolyticus, V. cholerae, and V. vulnicus in Norwegian Blue Mussels (Mytilus
edulis). Applied and Environmental Microbiology 72, 30583061.
Bej, A.K., Patterson, D.P., Brasher, C.W., Vickery, M.C.L., Jones, D.D., Kaysner, C.A., 1999.
Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellsh
using multiplex PCR amplication of tl, tdh, and trh. Journal of Microbiology
Methods 36, 215225.
Blanco-Abad, V., Ansede-Bermejo, J., Rodriguez-Castro, A., Martinez-Urtaza, J., 2009. Eval-
uation of different procedures for the optimized detection of Vibrio parahaemolyticus
in mussels and environmental samples. International Journal of Food Microbiology
129, 229236.
Chun, J., Huq, A., Colwell, R.R., 1999. Analysis of 16S-23S rRNA Intergenic Spacer Region
of Vibrio cholerae and Vibrio mimicus. Applied and Environmental Microbiology 65,
22022208.
Commission Regulation (EC) No 2073/2005 of 15 November 2005 on microbiological
criteria for foodstuffs. OJ L 338, 22.12.2005, p. 1.
Delmas, G., Jourdan da Silva, N., Pihier, N., Weill, F.X., Vaillant, V., de Valk, H., 2010. Les
toxi-infections alimentaires collectives en France entre 2006 et 2008. Bulletin Epi-
dmiologique Hebdomadaire 3132, 344348.
DePaola, A., Hwang, G.C., 1995. Effect of dilution, incubation time, and temperature of en-
richment on cultural and PCR detection of Vibrio cholerae obtained from the oyster
Crassostrea virginica.
DePaola, A., Kaysner, C.A., McPhearson, R.M., 1987. Elevated temperature method for
recovery of Vibrio cholerae from oysters (Crassostrea gigas). Applied and Environ-
mental Microbiology 53, 11811182.
DePaola, A., Nordstrom, J.L., Bowers, J.C., Wells, J.G., Cook, D.W., 2003. Seasonal Abun-
dance of Total and Pathogenic Vibrio parahaemolyticus in Alabama Oysters. Applied
and Environmental Microbiology 69, 15211526.
Fields, P.I., Popovic, T., Wachsmuth, K., Olsvik, O., 1992. Use of polymerase chain reac-
tion for detection of toxigenic Vibrio cholerae O1 strains from the latin american
cholera epidemic. Journal of Clinical Microbiology 30, 21182121.
Gonzalez-Escalona, N., Blackstone, G.M., DePaola, A., 2006. Characterization of a Vibrio
alginolyticus strain, isolated from Alaskan oysters, carrying a hemolysin gene sim-
ilar to the thermostable direct hemolysin-related hemolysin gene (trh) of Vibrio
parahaemolyticus. Applied and Environmental Microbiology 72, 79257929.
Gugliandolo, C., Lentini, V., Spano, A., Maugeri, T.L., 2010. Conventional and molecular
methods to detect bacterial pathogens in mussels. Letters in Applied Microbiology
52, 1521.
Hara-Kudo, Y., Takatori, K., 2010. Contamination level and ingestion dose of foodborne
pathogens associated with infections. Epidemiology and Infection 139, 15051510.
Henigman, U., Biasizzo, M., Vadnjal, S., Kirbis, A., Toplak, I., Barlic-Maganja, D., 2011.
Detection of Vibrio parahaemolyticus in mediterranean mussels (Mytilus
galloprovincialis) in slovenia. Acta Veterinaria Hungarica 59, 155164.
Hervio-Heath, D., Colwell, R.R., Derrien, A., Robert-Pillot, A., Fournier, J.M., Pommepuy,
M., 2002. Occurrence of pathogenic vibrios in coastal areas of France. Journal of Ap-
plied Microbiology 92, 11231135.
ICMSF [International Commission on Microbiological Specications for Foods], 1996.
Microorganisms in Foods 5. Characteristics of Microbial Pathogens. Blackie Aca-
demic & Professional, London, UK.
Kelly, M.T., Stroh, E.M., 1988. Temporal relationship of Vibrio parahaemolyticus in pa-
tients and the environment. Journal of Clinical Microbiology 26, 17541756.
Kim, Y.B., Okuda, J., Matsumoto, C., Takahashi, N., Hashimoto, S., Nishibuchi, M., 1999.
Identication of Vibrio parahaemolyticus strains at the species level by PCR targeted
to the toxR gene. Journal of Clinical Microbiology 37, 11731177.
Lee, S.K.Y., Wang, H.Z., Law, S.H.W., Wu, R.S.S., Kong, R.Y.C., 2002. Analysis of the 16S-
23S rDNA intergenic spacers (IGSs) of marine vibrios for species-specic signature
DNA sequences. Marine Pollution Bulletin 44, 412420.
Martinez-Urtaza, J., Simental, L., Velasco, D., DePaola, A., Ishibashi, M., Nakaguchi,
Y., Nishibuchi, M., Carrera-Flores, D., Rey-Alvarez, C., Pousa, A., 2005. Pan-
demic Vibrio parahaemolyticus O3:K6, Europe. Emerging Infectious Diseases
11, 13191320.
Martinez-Urtaza, J., Lozano-Leon, A., Varela-Pet, J., Trinanes, J., Pazos, Y., Garcia-Martin,
O., 2008. Environmental Determinants of the Occurrence and Distribution of Vibrio
parahaemolyticus in the Rias of Galicia, Spain. Applied and Environmental Microbi-
ology 74, 265274.
Masini, L., De Grandis, G., Principi, F., Mengarelli, C., Ottaviani, D., 2007. Research and
characterization of pathogenic vibrios from bathing water along the Conero Riviera
(Central Italy). Water Research 41, 40314040.
Nigro, O.D., Hou, A., Vithanage, G., Fujioka, R.S., Steward, G.F., 2011. Temporal and Spatial
Variability in Culturable Pathogenic Vibrio spp. in Lake Pontchartrain, Louisiana, fol-
lowing Hurricanes Katrina and Rita. Applied and Environmental Microbiology 77,
53845393.
Nishibuchi, M., Kaper, J.B., 1995. Thermostable direct hemolysin gene of Vibrio
parahaemolyticus: a virulence gene acquired by a marine bacterium. Infec-
tion and Immunity 63, 20932099.
Nordstrom, J.L., Vickery, M.C., Blackstone, G.M., Murray, S.L., DePaola, A., 2007. Devel-
opment of a multiplex Real-Time PCR assay with an internal amplication control
for the detection of total and pathogenic Vibrio parahaemolyticus bacteria in oys-
ters. Applied and Environmental Microbiology 73, 58405847.
Oberbeckmann, S., Wichels, A., Wiltshire, K.H., Gerdts, G., 2011. Occurence of Vibrio
parahaemolyticus and Vibrio alginolyticus in the german bight over a seasonal
cycle. Antonie Van Leeuwenhoek 2, 291307.
Olsvik, O., Wahlberg, J., Petterson, B., Uhlen, M., Popovic, T., Wachsmuth, I.K., Fields, P.I.,
1993. Use of automated sequencing of polymerase chain reaction-generated
amplicons to identify three types of cholera toxin subunit B in Vibrio cholerae O1
strains. Journal of Clinical Microbiology 31, 2225.
Quilici, M.L., Robert-Pillot, A., Picart, J., Fournier, J.-M., 2005. Pandemic Vibrio
parahaemolyticus O3:K6 spread, France. Emerging Infectious Diseases 11,
11481149.
Raghunath, P., Karunasagar, M., Karunasagar, I., 2009. Improved isolation and detection
of pathogenic Vibrio parahaemolyticus from seafood using a new enrichment
broth. International Journal of Food Microbiology 129, 200203.
Raghunath, P., Maiti, B., Shekar, M., Karunasagar, I., Karunasagar, I., 2010. Clinical iso-
lates of Aeromonas veronii biovar veronii harbor a nonfunctional gene similar to the ther-
mostable direct hemolysin-related hemolysin (trh) gene of Vibrio parahaemolyticus.
FEMS Microbiology Letters 307, 151157.
Robert-Pillot, A., Guenole, A., Lesne, J., Delesmont, R., Fournier, J.M., Quilici, M.L., 2004.
Occurrence of the tdh and trh genes in Vibrio parahaemolyticus isolates from waters
and raw shellsh collected in two French coastal areas and from seafood imported
into France. International Journal of Food Microbiology 91, 319325.
Roque, A., Lopez-Joven, C., Lacuesta, B., Elandaloussi, L., Wagley, S., Furones, M.D., Ruiz-
Zarzuela, I., de Blas, I., Rangdale, R., Gomez-Gil, B., 2009. Detection and identica-
tion of tdh- and trh-positive Vibrio parahaemolyticus strains from four species of
cultured bivalve molluscs on the spanish mediterranean coast. Applied and Envi-
ronmental Microbiology 75, 75747577.
Rosec, J.P., Simon, M., Causse, V., Boudjemaa, M., 2009. Detection of total and pathogen-
ic Vibrio parahaemolyticus in shellsh: Comparison of PCR protocols using pR72H
or toxR targets with a culture method. International Journal of Food Microbiology
129, 136145.
Sachadyn, P., Kur, J., 1998. The construction and use of a PCR internal control. Molecular
and Cellular Probes 12, 259262.
Shirai, H., Ito, H., Hirayama, T., Nakamoto, Y., Nakabayashi, N., Kumagai, K., Takeda, Y.,
Nishibuchi, M., 1990. Molecular epidemiologic evidence for association of thermosta-
ble direct hemolysin (TDH) and TDH-related hemolysin of Vibrio parahaemolyticus
with gastroenteritis. Infection and Immunity 58, 35683573.
Suthienkul, O., Ishibashi, M., Lida, T., Nettip, N., Supavei, S., Eampokalap, B., Makino, M.,
Honda, T., 1995. Urease production correlates with possession of the trh gene in
Vibrio parahaemolyticus strains isolated in Thailand. Journal of Infectious Diseases
172, 14051408.
Tyagi, A., Saravanan, V., Karunasagar, I., Karunasagar, I., 2009. Detection of Vibrio para-
haemolyticus in tropical shellsh by SYBR green real-time PCR and evaluation of
three enrichment media. International Journal of Food Microbiology 129, 124130.
Yeung, P.S.M., Boor, K.J., 2004. Epidemiology, Pathogenesis, and Prevention of
Foodborne Vibrio parahaemolyticus Infections. Foodborne Pathogens and Disease
1, 7488.
Zhang, X.H., Austin, B., 2005. Haemolysins in Vibrio species. Journal of Applied Microbi-
ology 98, 10111019.
194 J-P. Rosec et al. / International Journal of Food Microbiology 157 (2012) 189194