Microbiological Research 165 (2010) 695705

Development of real-time PCR technique for the

estimation of population density of Pythium
intermedium in forest soils
Mingzhu Li
a,
, Masako Senda
b
, Tsutomu Komatsu
c
, Haruhisa Suga
d
,
Koji Kageyama
b
a
The United Graduate School of Agriculture Science, Gifu University, Gifu 501-1193, Japan
b
River Basin Research Center, Gifu University, Gifu 501-1193, Japan
c
Hokkaido Kamikawa Agricultural Experiment Station, Pippu, Kamikawa, Hokkaido 078-0397, Japan
d
Life Science Research Center, Gifu University, Gifu 501-1193, Japan
Received 7 October 2009; received in revised form 14 November 2009; accepted 21 November 2009
KEYWORDS
Pythium interme-
dium;
Real-time PCR;
SYBR Green;
Internal transcribed
spacer regions;
DNA extraction
Summary
Pythium intermedium is known to play an important role in the carbon cycling of cool-
temperate forest soils. In this study, a fast, precise and effective real-time PCR
technique for estimating the population densities of P. intermedium from soils was
developed using species-specic primers. Specicity was conrmed both with
conventional PCR and real-time PCR. The detection limit (sensitivity) was determined
and amplication standard curves were generated using SYBR Green II uorescent dye.
A rapid and accurate assay for quantication of P. intermedium in Takayama forest soils
of Japan was developed using a combination of a new DNA extraction method and PCR
primers were developed for real-time PCR. And the distribution of P. intermedium in
forest soil was investigated with both soil plating method and the developed real-time
PCR technique. This new technique will be a useful tool and can be applied to practical
use for studying the role of Pythium species in forest and agricultural ecosystems.
& 2009 Elsevier GmbH. All rights reserved.
Introduction
The population dynamics of Pythium species have
traditionally been studied by some variation of the
soil dilution plating method using a selective
medium (Ali-Shtayeh et al., 1986; Conway, 1985;
Mircetich and Kraft, 1973) followed by the ob-
servation of morphological characteristics to iden-
tify the individual isolates to species (Van der
Plaats-Niterink, 1981). However, these time-ho-
nored techniques have some serious limitations,
www.elsevier.de/micres
0944-5013/$ - see front matter & 2009 Elsevier GmbH. All rights reserved.
doi:10.1016/j.micres.2009.11.010

Corresponding author. Tel./fax: 81 0582932063.

E-mail address: mingzhu_li@green.gifu-u.ac.jp (M. Li).
not the least of which is misidentication.
Molecular approaches have been increasingly used
to identify Pythium spp., including restriction frag-
ment length polymorphisms (Chen, 1992), nucleic
acid hybridization (Klassen et al., 1996), polymerase
chain reaction (PCR) (Wang and Chang, 2003),
enzyme-linked immunosorbent assay (ELISA), and
nucleotide sequencing (Levesque and de Cock, 2004).
Nuclear ribosomal DNA (rDNA) is an important
substrate for PCR detection of fungi, bacteria, and
nematodes (Szalanski et al., 1997; Bridge et al.,
1998; McCartney et al., 2003; Chilvers et al., 2007).
The internal transcribed spacer (ITS) regions of
rDNA are particularly useful targets for fungal
species-specic primers due to their high copy
number, sequence variability and delity among
pathogen species or subspecies, and for the
convenience of being able to use universal primers
for regions anking the ITS regions (White et al.,
1990; Edel et al., 1998).
Although conventional PCR-based techniques are
very sensitive, and capable of separating many
species of Pythium, they are neither quantitative
nor useful for identication directly from soil or
plant samples (Schroeder et al., 2006). Real-time
PCR, which is based on the use of uorogenic
probes (hybridization probes or exonuclease probes
such as the TaqMan) (Nitsche et al., 1999) or dyes
(SYBRR Green I dye) (Morrison et al., 1999), relies
on measuring the intensity of a uorescent signal
that is proportional to the amount of DNA gener-
ated during the PCR amplication (Wittwer et al.,
1997), and thus can be used for accurate quanti-
cation. The SYBRR Green dye system has
the additional advantage that it does not require
the design of specic complementary probes to the
target DNA. This method is now being applied to
organisms in many different research applications,
and has been used to detect and quantify fungi
(Schnerr et al., 2001; Filion et al., 2003).
Because the PCR result relies on both the amount
and the purity of DNA extracted from environmen-
tal samples, efcient DNA extraction is crucial for
quantitative detection (Picard et al. 1992; Krsek
and Wellington 1999; Martin-laurent et al., 2001;
Liles et al., 2008; Sagova-Mareckova et al., 2008).
However, there is yet no general protocol for PCR
detection of a wide range of soil microorganisms
from soil samples (Kageyama et al., 2003).
Some knowledge of the distribution of a target
fungus in soil and the development of a sample
collection method are both required for an accu-
rate estimate of population density. However, little
research has been done using conventional soil
dilution plating methods combined with real-time
PCR for soil-borne plant pathogens.
Pythium ora commonly inhabit the soils of cool-
temperate deciduous forests in Japan (Senda and
Kageyama, 2006), with Pythium intermedium as
the predominant species. P. intermedium is an
important contributor to the carbon cycle and
seems to be a good indicator of fungal respiration
in forest soils (Tan et al., 2006). The objective of
this study was to develop a real-time PCR based
assay that would provide fast, sensitive and
quantitative detection of P. intermedium in soil.
Moreover, the applicability of the developed
technique was to be tested by comparing with the
soil plating method. Finally, the distribution of P.
intermedium in Takayama forests of Japan would
be investigated.
Materials and methods
Isolates and strain maintenance
Twelve isolates of P. intermedium and 36 isolates
of 29 other Pythium species, as well as 10 isolates
of 8 species from other genera (Table 2) were
maintained on corn meal agar.
Collection and preparation of soil
Soil samples were collected from locations
throughout Japan (Table 4). From each sampling
site, approximately 200 g of soil was collected and
stored at 5 1C. The pH was measured in 1 M
potassium chloride (Horiba D-Series Waterproof D-
52). Populations of P. intermedium were estimated
by soil dilution plating on Pythium-selective med-
ium (Morita and Tojo, 2007). An additional 100 soil
samples were collected from a mixed and cedar
forest site in Takayama, Japan in October 2008. At
each site, a 30 30 m
2
plot was laid out and
divided into 9 blocs. Four blocs were randomly
selected for sampling and 25 2 g soil samples were
collected from each bloc.
DNA extraction from mycelia
Total genomic DNA was extracted according to
the procedure of Kageyama et al. (2003). Pythium
isolates were grown in corn meal or potato
dextrose broth medium for 47 days at 25 1C to
produce a mycelial mass, which was ltered and
dried on sterilized lter paper and transferred to
10 mL of 0.2 g mL
1
skim milk (Difco, Detroit, MI),
250 mL extraction buffer (100 mM TrisHCl, pH 9.0,
40 mM EDTA), 50 mL of 10% SDS and 5 mL RNase
A (10 mg mL
1
) (Nippon Gene). 50 mL of benzyl
M. Li et al. 696
chloride was then added and the mixture was
vortexed vigorously for 1 min. After incubation at
50 1C for 30 min, 150 mL of 3 M NaOAc were added
to the suspension. The mixture was gently vortexed
and placed on ice for 15 min. This suspension was
cleared by centrifugation at 18,000g for 10 min,
and the supernatant was transferred to a new tube.
After the upper layer was re-centrifuged, the DNA
was precipitated with two volumes of 99.9%
ethanol and centrifuged at 18,000g for 20 min.
The DNA pellet was rinsed with 70% ethanol,
centrifuged at 18,000g for 5 min and vacuum-dried.
Finally, the DNA was suspended in 100 mL TE buffer
(10 mM TrisHCl, pH 7.5, 0.1 mM EDTA).
Cloning and sequencing
Amplied DNA was cloned in the pT7Blue T-
vector (Takara Bio) with a ligation kit (Takara Bio)
according to the manufacturers instructions. The
cloned ITS region was amplied using M13M4 and
M13Rv primers (Table 1). A BigDye Terminator ver.
3.1 Cycle Sequencing kit (Applied Biosystems) was
used for cycle sequencing and run on an ABI PRISM
3100 genetic analyzer (Applied Biosystems).
Primer design
A collection of Pythium ITS region sequences,
including 5 isolates of P. intermedium and 39
isolates of other 39 species (Table 2) were used to
design primers. Sequences were aligned (BioEdit
ver. 7.0.0; Inc., Isis Pharmaceuticals), and each
potential primer was analyzed for dimer and
hairpin loop structures (Primer premier ver. 5.0;
Inc., Premier Biosoft International).
Conventional PCR
Reaction mixtures contained 1 mM of each primer,
1.25 units of rTaq DNA polymerase (Takara Bio),
0.2 mM dNTP mixture, 1 PCR buffer (10 mM Tris
HCl, pH 8.3, 50 mM KCl, and 1.5 mM MgCl
2
), and
100 to 300 ng of DNA template in a total volume of
25 mL. Primers ITS1 and ITS4 (Table 1) were used to
amplify the ITS region in a DNA thermal cycler
(GeneAmp PCR System 2700, Applied Biosystems) at
94 1C for 5 min, followed by 35 cycles of denatura-
tion at 94 1C for 30 s, annealing at 65 1C for 30 s,
and extension at 72 1C for 1 min, with a nal
extension at 72 1C for 10 min. The size of the
amplicon was examined by electrophoresis in a
1.5% agarose L03 (Takara Bio) gel. Gels were
stained with ethidium bromide and photographed
under ultraviolet light.
Real-time PCR
The quantity of DNA for each sample was
determined using SYBR
s
Premix Ex Taq
TM
II (Takara
Bio) with an ABI PRISM 7000 Sequence Detection
System (Applied Biosystems) in a total volume of
50 mL containing 25 mL of SYBR
s
Premix Ex Taq
TM
II
(2 ), 20 mL of ultrapure water, 1 mL of each primer
(5 mM), 1 mL of ROX reference dye (50 ) and 2 mL
of template DNA. Real-time PCR was conducted for
10 min at 95 1C (1 cycle), followed by 30 s at 94 1C,
31 s at 65 1C and 1 min at 72 1C (40 cycles).
Specicity was examined by generating a dissocia-
tion curve after amplication. The melting curve
was obtained by programming the ABI PRISM 7000
Sequence Detection System for one cycle at 65 1C
for 10 min.
Soil DNA extraction and purication
DNA extraction as rened by Kageyama et al.
(2003) was adopted for soils by incorporating
magnetic beads purication step (MagExtractor
s

Plant Genome, Toyobo Co., Ltd., Osaka, Japan) to

purify soil DNA extracts. MagExtractor was found to
be superior to other commercial soil DNA extraction
Table 1. Primer sequence.
Primer Sequence (5
0
-3
0
) Length (bp) GC% T
m
d
(1C)
Pf002
a
GAGTTGCTTTGCTCTCGGC 19 57.9 65.1
Pr002b
a
ACACTTCACGTCTGCCACA 19 52.6 63.2
ITS1
b
TCCGTAGGTGAACCTGCGG 19 63.2 67.1
ITS4
b
TCCTCCGCTTATTGATATGC 20 45.0 61.5
M13M4
c
GTTTTCCCAGTCACGAC 17 52.9 56.1
M13Rv
c
CAGGAAACAGCTATGAC 17 47.1 50.6
a
Primers designed for specicity to Pythium intermedium.
b
Universal primers for amplication of ITS region.
c
Primers used in cloning.
d
T
m
values are calculated using nearest neighbour method.
Development of real-time PCR technique for the estimation of population density of P. intermedium 697
Table 2. Specicity of the designed primer set to Pythium intermedium and other species in conventional PCR and
real-time PCR
a
.
Working
number
Species Isolates Host/habitat Geographical
origin
Conventional
PCR
Real-
time PCR
ITS1/
ITS4
Pf002/
Pr002b
Pf002/
Pr002b
1 P. intermedium CBS221.68 Soil Rhenen,
Netherlands

2 CBS266.38 Agrostis stolonifera Den Haag,
Netherlands

3 2C5193 Riverbed soil Yamato, Gujo,
Gifu, Japan

4 MAFF305570 Soil Hokkaido, Japan ND
5 1D2S153 Forest soil Takayama, Gifu,
Japan
ND
6 1E4183 Riverbed soil Gifu, Gifu, Japan
7 1D1S123 Forest soil Takayama, Gifu,
Japan

8 1D2S011 Forest soil Takayama, Gifu,
Japan

9 1F2S011 Forest soil Takayama, Gifu,
Japan

10 CA242 Riverbed soil Aso, Kumamoto,
Japan

11 2C2S011 Forest soil Takayama, Gifu,
Japan

12 1C132 Riverbed soil Yamato, Gujo,
Gifu, Japan

13 P. aguatile 2D4S194 Forest soil Takayama, Gifu,
Japan

14 P. anandrum CBS285.31 Rheum rhaponticum USA
15 P. aphanidermatum TOc-159 Soil Gifu, Japan ND
16 P. arrhenomanes ADO-6-1 Zoysia grass Gifu, Japan ND
17 P. catenulatum MK4-10-2S Zoysia grass Gifu, Japan ND
18 P. coloratum TM321 Carrot Gifu, Japan
19 P. debaryanum 72-4 Japan ND
20 P. dimorphum CBS406.72 Pinus taeda
(Pinaceae), dead root
USA, Louisiana
21 P. graminicola MAFF425415 Soil Kumamoto,
Japan

22 P. helicoids CBS286.31 Kidny bean USA
23 P. heterothallium 1D2S021 Forest soil Takayama, Japan ND
24 2C133 Riverbed soil Yamato, Gujo,
Gifu
ND
25 P. hydnosporum MAFF305861 Soil Fukuoka, Japan ND
26 P. inatum MAFF305863 Soil Fukuoka, Japan ND
27 P. iwayamai MK1-2-18V Zoysia grass soil Gifu, Japan ND
28 P. nunn ATCC20693 Spinach Osaka, Japan
29 P. oedochilum CBS292.37 USA ND
30 P. ostracodes CBS768.73 Soil Ibiza, Spain
31 P. paroecandrum ATCC36784 Barley Greece
32 P. periilum S2-8-1S Zoysia grass Gifu, Japan ND
33 P. periplocum DK1-5-1S Zoysia grass Gifu, Japan ND
34 P. rostratum DS5-7-2S Bentgrass Gifu, Japan ND
35 MK2-1-9S Bentgrass Gifu, Japan ND
36 P. spinosum 1D1S032 Forest soil Takayama, Japan ND
37 1D3S016 Forest soil Takayama, Japan ND
38 OD231 Carrot Gifu, Japan
M. Li et al. 698
kits and was used throughout all subsequent
experiments for soil DNA extraction.
Results
Primer design and specicity for P.
intermedium
Of the seven primers initially selected, only
Pf002 and Pr002b (Table 1) were tested for delity
to P. intermedium by conventional PCR using a total
of 58 isolates representing 30 Pythium species
including P. intermedium, and 8 species from other
genera (Figure 1). ITS regions were amplied from
all tested isolates with universal primers ITS1 and
ITS4 by conventional PCR.
Specicity was conrmed in 10 isolates of
P. intermedium and 17 isolates of other species by
real-time PCR (Table 2). The isolates of P. inter-
medium (CBS221.68, CBS226.38, 2C5193, 1D2S153,
1E4183, 1D1S123, 1F2S011, CA242, 2C2S011, 1C132
and CA225) had amplied ITS regions with distinct
dissociation peaks at temperatures near 84 1C,
whereas the other Pythium species were not
amplied in real-time PCR.
Nuclear rDNA copy number
Quantication of the ITS region can only be
established if there is no appreciable variation in
rDNA copy number among
zP. intermedium isolates. Therefore, a comparison
of copy number among the P. intermedium isolates
was conducted by evaluation of Ct values (Table 3).
DNA extracted from ve isolates (CH1203,
1F3S061, 1D2S153, 2D3S021, and 1D5145) was
adjusted to a concentration of 10 ng/mL for
real-time PCR. Ct values ranged from 11.01 to
11.69 among the ve isolates (Table 3). As a further
control, amplication of DNA from four additional
isolates, CBS221.68, CBS266.38, 2C5193
and 1D1S123, at 1 ng/mL gave similar Ct values
(15.3415.54, Table 3). This small range of Ct values
Table 2. (continued )
Working
number
Species Isolates Host/habitat Geographical
origin
Conventional
PCR
Real-
time PCR
ITS1/
ITS4
Pf002/
Pr002b
Pf002/
Pr002b
39 P. sylvaticum 1D2S092 Forest soil Takayama, Japan ND
40 2B1171 Riverbed soil Yamato, Gujo,
Gifu
ND
41 OM121 Carrot Gifu, Japan
42 P. torulosum MAFF305575 Soil Hokkaido, Japan ND
43 P. ultimum Py55 Sugarbeet Hokkaido, Japan
44 Py79 Sugarbeet Hokkaido, Japan ND
45 P. vexans MS6-10-8V Forest soil Gifu, Japan
46 P. violae OPy4 Pansy Tottori, Japan ND
47 P. zingiberum UOP389 Zinger Wakayama,
Japan
ND
48 Pythium Group G Py37 Sugarbeet Hokkaido, Japan ND
49 Fusarium oxysporum f.
sp. lyopersici
FL Tomato Japan

50 Phytophthora capsici IFO30696 Cucurbia species Japan ND

51 Ph. cinnamoni IFO33183 Hypericum ND
androsaemum
52 Ph. megasperma IFO31624 Soil Nara, Japan ND
53 Plasmodiophora
brassicae
An Chinese cabbage Mie, Japan

54 Rhizoctonia solani AG
2-2 LP
97TH19-4

55 R. solani AG2-2IIIB NR4-6 ND

56 R. solani AG 2-2 LP RGR38 Japan ND
57 Verticillium albo-atrum Vaal-130303 ND
58 V. dahliae Vd84034
a
In any case of different PCR, indicates authentic amplication, indicates no amplication, and ND means not done.
Development of real-time PCR technique for the estimation of population density of P. intermedium 699
generated from normalized DNA concentrations
indicates that there are a very similar copy
number of ITS regions among P. intermedium
isolates.
Sensitivity and standard curve
Four P. intermedium isolates, CBS221.68,
CBS266.38, 2C5193 and 1D1S123, were used to
Figure 1. Specicity of the designed primer set for Pythium intermedium in conventional PCR. Isolates listed in Table 2
were used to test the specicity. M: 100bp DNA ladder.
Table 3. Sensitivity of mycelial DNA of Pythium intermedium in real-time PCR.
Isolates Origin Location Ct value
a
Detection limit
(fg)
Amplication efciency
(%)
b
10 ng 1 ng
CBS221.68 Soil Rhenen, Netherlands NT
c
15.38 10 81
CBS266.38 Agrostis
stolonifera
Den Haag, Netherlands NT
c
15.41 10 80
2C5193 Riverbed soil Yamato, Gujo, Gifu,
Japan
NT
c
15.54 10 87
1D1S123 Forest soil Takayama, Gifu, Japan NT
c
15.34 10 87
CH1203 Riverbed soil Ishii, Hita, Oita, Japan 11.10 NT
c
NT
c
NT
c
1F3S061 Forest soil Takayama, Gifu, Japan 11.31 NT
c
NT
c
NT
c
1D2S153 Forest soil Takayama, Gifu, Japan 11.69 NT
c
NT
c
NT
c
2D3S021 Forest soil Takayama, Gifu, Japan 11.12 NT
c
NT
c
NT
c
1D5145 Riverbed soil Maeno, Mino, Gifu, Japan 11.01 NT
c
NT
c
NT
c
a
Threshold cycle values (Ct) at template DNA concentrations of 10 and 1 ng. Ct: the threshold cycle for a given amplication curve
occurs at the point that the uorescent signal exceeds the value of the threshold setting. The value of threshold here is 0.200000.
b
Efciency for each isolate was calculated using the formula: E=110
(1/slope)
.
c
NT means not tested.
M. Li et al. 700
estimate detection limits (Table 3). A 1 ng to 1 fg
10-fold dilution series of template DNA for each
isolate was used for real-time PCR amplication. All
4 isolates were successfully detected at 10 fg
(Table 3). Several isolates of P. intermedium
could be detected at 1 fg of template DNA, but
amplication at this level was unreliable (data not
shown).
Standard curves were generated using a range of
DNA from 10 fg to 1 ng of 4 isolates CBS221.68,
CBS266.38, 2C5193 and 1D1S123. The slopes of the
4 isolates ranged from 3.669 to 3.932, and the
amplication efciencies of all 4 isolates were over
80% with high correlation coefcients (R
2
: A, 0.998;
B, 0.999; C, 0.995; D, 0.999). Moreover, mean Ct
values at all concentrations were very consistent,
with a correlation coefcient of 0.994 and an
amplication efciency of 84% (Figure 2).
Amplication efciencies for P. intermedium were
very high and quite similar even among isolates
from different hosts and geographical locations.
Real-time PCR for natural infested soil
samples
Eleven soil samples with different properties
were collected from elds in Gifu and Mie, Japan
(Table 4). The DNA concentration of each soil
sample was estimated by using real-time PCR. The
standard curve for DNA concentration was
generated by using a series of DNA dilutions of
P. intermedium isolate CBS221.68. The population
density of P. intermedium in each soil sample was
determined by soil dilution plating with Pythium-
selective medium.
A regression analysis was conducted for the
relationship between population density and the
DNA concentration of P. intermedium (Figure 3). It
was found that the population density was
signicantly correlated to the DNA concentra-
tion. The correlation coefcient was 0.9655. The
detection limit of the simultaneously obtained
formula was down to 12 CFU/g soil. Therefore, it
proved that the formula was quite accurate and
sensitive for the estimation of population density of
P. intermedium when the developed real-time PCR
technique and DNA extraction method were
applied.
Practical use of the developed procedure to
determine the distribution of P. intermedium
in forest soils
Three methods were used to generate the popula-
tion density estimations of P. intermedium in mixed
and cedar forest soils (Table 5). Firstly, 25 soil
samples from each of the four randomly chosen
blocs within the 3030 m
2
plot were individually
tested using real-time PCR for the population density
estimation as described above. In the mixed forest,
the population density of bloc A ranged from 0 to
1063 CFU/g soil with a mean of 171, bloc B was from
0 to 1326 CFU/g soil with a mean of 166, bloc C was
from 0 to 2044 CFU/g soil with a mean of 440, and
bloc D was from 0 to 332 CFU/g soil with a mean of
67. In the cedar forest, they were 01075 (416), 0
1249 (246), 33851 (228), and 04829 (369) CFU/g
soil. In the second method, the 25 soil samples from
each bloc were commingled and the population
density was estimated as above. In the mixed
forest, the average values of population density
were 165, 166, 325 and 76 CFU/g soil for blocs A,
B, C and D, respectively, and 349, 498, 587 and
611 CFU/g soil in the cedar forest. Third, the
population density of each bloc was estimated by
soil dilution plating. The obtained values for blocs A,
B, C and D in the mixed forest were 25, 100, 175 and
R
2
= 0.994**
E = 84%
y = -3.7891x + 26.386
10
15
20
25
30
35
40
-3 0 1 2 3 4
Combined data of four isolates
C
t
Log amount of DNA (pg)
-2 -1
Figure 2. Correlation between Ct values of real-time PCR and log amount of DNA in Pythium intermedium. The
efciency of amplication for each isolate was calculated using the formula: E=110
(1/slope)
.
Development of real-time PCR technique for the estimation of population density of P. intermedium 701
50 CFU/g soil, respectively, and 350, 400, 325 and
525 CFU/g soil in the cedar forest.
Discussion
A quantitative assay was developed for P. inter-
medium using real-time PCR and a new DNA
extraction procedure, which together allow a rapid
and accurate evaluation of P. intermedium popula-
tions from native soils.
Recently, ribosomal DNA (rDNA) genes and their
spacer sequences were reported to be reliable,
species-specic targets for PCR amplication of
fungal and bacterial nucleic acids (Vincelli and
Tisserat, 2008). An intra-specic variation of ITS
region in Pythium species complicated the primer
design. Therefore, more than ten P. intermedium
Table 4. Soil properties in this study.
Soil
samples
Location Soil
texture
a
pH
b
Mean
Ct
c
DNA
concentration
(pg/g soil)
d
Population density (CFU/g soil)
e
P. intermedium Other Pythium
species
E3 Gifu city, Gifu SCL 5 27.2 26.9 335 128
E4 Gifu city, Gifu L 5.3 29.5 9.4 95 426
02A3 Kamagahora, Gujo,
Gifu
L 4.8 22.7 306.1 1761 2833
02A4 Kamagahora, Gujo,
Gifu
L 4.8 26.6 31.9 304 989
02A5 Kamagahora, Gujo,
Gifu
L NM
f
25.0 92.2 665 2835
02F1 Kaizu, Gifu L 5.8 24.5 137.2 824 122
02F4 Kaizu, Gifu SL 4.7 28.3 15.5 207 562
SKD5 Nagasima, Mie L NM
f
24.6 89.9 606 50
Kama2 Kamagahora, Gujo,
Gifu
NM
f
NM
f
29.2 7.7 140 53
C1 Mixed forest,
Takayama, Gifu
NM
f
NM
f
30.8 3.1 40 NM
f
C7 Mixed forest,
Takayama, Gifu
NM
f
NM
f
25.7 66.9 400 NM
f
a
SCL=sandy clay loam; L=loam; SL=sandy loam; NM=not measured.
b
pH values were measured with a Horiba D-Series Waterproof pH Meter (D-52).
c
Ct values were obtained in real-time PCR with an ABI PRISM 7000 sequence detection system using SYBR Green II uorescent dye. The
threshold setting was 0.200000.
d
DNA was extracted using the KK method and puried by MagExtractors Plant Genome. DNA content was calculated from serial DNA
concentrations of pure culture.
e
The population density of Pythium species in soil was estimated using soil dilution plating.
f
NM=not measured.
y = 1.2803x - 1.3595
0
0.5
1
1.5
2
2.5
3
1 1.5 2 2.5 3 3.5
Log of soil population density (CFU / g soil)
D
N
A

c
o
n
c
e
n
t
r
a
t
i
o
n

l
o
g

(
p
g

p
e
r

g

s
o
i
l
)
R
2
= 0.9655
Figure 3. Correlation of population density (CFU/g soil) and DNA concentration detected by the real-time PCR for
Pythium intermedium in soil. Eleven soil samples from different locations with different soil properties were used.
Population densities were determined by soil dilution plating with Pythium-selective medium.
M. Li et al. 702
species from geographically different origins and
sources were used to eliminate the intra-specic
regions for designing specic primers for P. inter-
medium.
Unlike probe-based quantitative PCR that utilizes
a uorescent-labelled target-specic probe result-
ing in increased specicity and sensitivity, SYBR
Green-based quantication methods detect all
double-stranded DNA including primer dimers and
non-specic reaction products. However, a useful
feature of real-time PCR using the SYBR Green
protocol is the ability to examine the dissociation
curves of the products to verify the identity of the
product and to check the specicity (Giglio et al.,
2005). Each product formed by PCR amplication
has a distinct melting temperature based on the
length and base composition of the product.
Therefore, any dimer or non-specic amplication
can be distinguished from authentic amplicons. In
this study, positive amplication was characterized
by a melting temperature of 84 1C. The melting
temperature of one possible primer dimer was
79 1C. Therefore, non-specic amplication and
primer dimers were easily differentiated from the
authentic amplicon pool.
A high ITS region copy number increases detec-
tion sensitivity (Vincelli and Tisserat, 2008; Ka-
geyama et al., 1997). Martin (1995a, 2006)
demonstrated that there are copies of the rDNA
gene on several chromosomes in Pythium species,
suggesting the possibility of differences in copy
number among Pythium species. Intra-isolate het-
erogeneity of the ITS region in P. helicoides was also
reported by Kageyama et al. (2007). However,
Schroeder et al. (2006) demonstrated that the copy
number of nuclear rDNA was similar among isolates
in P. ultimum. In this study, Ct values generated at
the same concentration of template DNA were
similar among different P. intermedium isolates,
indicating that rDNA copy numbers will be close,
making accurate and sensitive detection of P.
intermedium possible.
Several factors can be expected to affect the
detection of a target organism in soil using real-
time PCR. High DNA binding capacity to soil particle
surfaces may inuence DNA extraction efciency
(Miller et al., 1999; Martin-Laurent et al., 2001).
The effect of co-extracted PCR inhibitors is also an
important consideration for amplication efciency
(Kontanis and Reed, 2006). Inhibitors are known to
negatively affect the PCR reaction, and even small
differences in amplication efciency will result in
dramatic differences by the end of an amplication
regime. Therefore, DNA extraction will be one of
the most important steps for detection. In this
study, we found that the KK method with purica-
tion using MagExtractor
s
Plant Genome kit was
the most effective extraction method.
A simple algorithm for calculating population
density from the product of DNA amplication was
established. By regression analysis, it was found
that the DNA concentration was signicantly
correlated with the population density of P. inter-
medium in tested soils. The results indicated that
this developed detection procedure could be
applied for practical use. In order to verify the
Table 5. Evaluation of distribution of Pythium intermedium in forest soil using real-time PCR and direct plating.
a
Sites Blocs Population density (CFU/g soil)
Real-time PCR method Soil dilution plating method
d
Mean of 25 individual
samples
b
Mean of mixed
soil samples
c
P. intermedium Other Pythium species
Mixed forest A 171 (01063) 165 (133197) 25 0
B 166 (01326) 166 (150182) 100 0
C 440 (02044) 325 (288362) 175 0
D 67 (0332) 76 (6983) 50 0
Cedar forest A 416 (01075) 349 (305393) 350 475
B 246 (01249) 498 (445551) 400 450
C 228 (33851) 587 (540634) 325 250
D 369 (04829) 611 (592630) 525 400
a
Soil samples were collected from mixed and cedar forest sites in Takayama, Japan. In each site, a square of 30 m in side length
(30 30 m
2
plot) was divided into 9 blocs. Four sampling blocs were randomly selected.
b
In each bloc, 25 soil samples were collected. The population density for each sample was estimated using real-time PCR and the
extrapolation algorithm.
c
For each block, 25 soil samples were mixed together. The population density was estimated using real-time PCR and the extrapolation
algorithm with 3 replicates.
d
The population density was estimated using soil dilution plating. The dilution ratio was 500.
Development of real-time PCR technique for the estimation of population density of P. intermedium 703
applicability of the developed procedure, the
population densities of P. intermedium in two
forests of Takayama were calculated using the
real-time PCR-based method and extrapolation
algorithm. Comparing with the value of mean of
25 individual soil samples, the population density of
the mixed soil with 25 soil samples was closer to the
value obtained by soil dilution plating method in
both forests. Although the values generated by
real-time PCR were commonly greater than the
ones generated by soil dilution plating, most likely
because dilution plating only counts living propa-
gules, whereas PCR methods count total DNA,
including that in dead propgules. Future study is
necessary to differentiate the amount of DNA
between living and dead propagules in soil (Soejima
et al. 2008).
The distribution of P. intermedium in forest soil
was evaluated based on the data of the real-time
PCR. The population density in both forests showed
high variation in each bloc of the sampling sites as
well as between the blocs, suggesting that the
distribution of P. intermedium would not be uni-
form. Although it will be difcult to estimate a
representative population density in a single site,
this sampling hurdle will be cleared by mixing the
soil samples collected from several spots in one
site. It is necessary to evaluate the sampling
number to determine a more reliable value of
population density.
Acknowledgments
This study was supported by JSPS 21st Century
COE program Satellite Ecology at Gifu University.
References
Ali-Shtayeh MS, Lim-Ho CL, Dick MW. An improved
method and medium for quantitative estimates of
populations of Pythium species from soil. Trans Br
Mycol Soc 1986;86:3947.
Bridge PD, Arora DK, Reddy DK, Elander RP, editors.
Interpretation of PCR methods for species denition.
Applications of PCR in mycology. New York: CAB
International; 1998.
Chen W. Restriction fragment length polymorphisms in
enzymatically amplied ribosomal DNAs of three
heterothallic Pythium species. Phytopathology
1992;82:146772.
Chilvers MI, du Toit LJ, Akamatsu H, Peever TL. A real-
time, quantitative PCR seed assay for Botrytis spp.
that cause neck rot of onion. Plant Dis 2007;91:
599608.
Conway KE. Selective medium for isolation of Pythium
spp. from soil. Plant Dis 1985;69:3935.
Edel V, Bridge PD, Arora DK, Reddy CA, Elander RP,
editors. Polymerase chain reaction in mycology.
Applications of PCR in mycology. New York: CAB
international; 1998 pp. 120.
Filion M, St-Arnaud M, Jabaji-Hare SH. Direct quantica-
tion of fungal DNA from soil substrate using real-time
PCR. J Microbiol Methods 2003;53:6776.
Giglio S, Monis PT, Saint CP. Legionella conrmation using
real-time PCR and SYTO9 is an alternative to current
methodology. Appl Environ Microbiol 2005;71:89448.
Kageyama K, Komatsu T, Suga H. Rened PCR protocol for
detection of plant pathogens in soil. J Gen Plant
Pathol 2003;69:15360.
Kageyama K, Ohyama A, Hyakumachi M. Detection of
Pythium ultimum using polymerase chain reaction
with species-specic primers. Plant Dis 1997;81:
11551160.
Kageyama K, Senda M, Asano T, Suga H, Ishiguro K. Intra-
isolate heterogeneity of the ITS region of rDNA in
Pythium helicoides. Mycol Res 2007;111:41623.
Klassen GR, Balcerzak M, de Cock WAM. 5S ribosomal RNA
gene spacers as species-specic probes for eight
species of Pythium. Phytopathology 1996;86:5817.
Kontanis EJ, Reed FA. Evaluation of real-time PCR
amplication efciencies to detect PCR inhibitors. J
Forensic Sci 2006;51(4):795804.
Krsek M, Wellington EMH. Comparison of different
methods for the isolation and purication of total
community DNA from soil. J Microbiol Methods
1999;39:116.
Liles MR, Williamson LL, Rodbumrer J, Torsvik V, Goodman
RM, Handelsman J. Recovery, purication, and cloning of
high-molecular-weight DNA from soil microorganisms.
Appl Environ Microbiol 2008;74:33025.
Levesque CA, de Cock WAM. Molecular phylogeny and
taxonomy of the genus Pythium. Mycol Res
2004;108:136383.
Martin FN. Electrophoretic karyotype polymorphisms in
the genus Pythium. Mycologia 1995a;87:33353.
Martin FN. Importance of selng and outcrossing in the
population biology of Pythium. Phytopathology
2006;96:S146.
Martin-Laurent F, Philippot L, Hallet S, Chaussod R,
Germon JC, Soulas G, Catroux G. DNA extraction from
soils: old bias for new microbial diversity analysis
methods. Appl Environ Microbiol 2001;67:23549.
McCartney HA, Foster SJ, Fraaije BA, Ward E. Molecular
diagnostics for fungal plant pathogens. Pest Manage
Sci 2003;59:12942.
Miller DN, Bryant JE, Madsen EL, Ghiorse WC. Evaluation
and optimization of DNA extraction and purication
procedures for soil and sediment samples. Appl
Environ Microbiol 1999;65:471524.
Mircetich SM, Kraft JM. Efciency of various selective
media in determining Pythium population in soil.
Mycopathol Mycol Appl 1973;50:15161.
M. Li et al. 704
Morita Y, Tojo M. Modications of PARP medium using
uazinam, miconazole, and nystatin for detection of
Pythium spp. in soil. Plant Dis 2007;91:15919.
Morrison TB, Ma Y, Weis JH, Weis JJ. Rapid and sensitive
quantication of Borrelia burgdorferi-infected mouse
tissues by continuous uorescent monitoring of PCR. J
Clin Microbiol 1999;37:98792.
Nitsche A, Steuer N, Schmidt CA, Landt O, Siegert W.
Different real-time PCR formats compared for the
quantitative detection of human cytomegalovirus
DNA. Clin Chem 1999;45:19327.
Picard C, Ponsonnet C, Paget E, Nesme X, Simonet P.
Detection and enumeration of bacteria in soil by
direct DNA extraction and polymerase chain reaction.
Appl Environ Microbiol 1992;58:271722.
Sagova-Mareckova M, Cermak L, Novotna J, Plhackova K,
Forstova J, Kopecky J. Innovative methods for soil DNA
purication tested in soils with widely differing
characteristics. Appl Environ Microbiol 2008;74:
29027.
Schnerr H, Niessen L, Vogel RF. Real time detection of the
Tri5 gene in Fusarium species by LightCycler PCR using
SYBR Green I for continuous uorescence monitoring.
Int J Food Microbiol 2001;71:5361.
Schroeder KL, Okubara PA, Tambong JT, Levesque CA,
Paulitz TC. Identication and quantication of patho-
genic Pythium spp. from soils in eastern Washington
using real-time polymerase chain reaction. Phyto-
pathology 2006;96:63747.
Senda, M and Kageyama, K . Pythium species in cool-
temperate forest soil. The 8th international mycolo-
gical congress, Cains, Australia, 2006.
Soejima T, Iida K, Qin T, Taniai H, Seki M, Yoshida S-I.
Method to detect only live bacteria during PCR
amplication. J Clin Microbiol 2008;46:230513.
Szalanski AL, Sui DD, Harris TS, Powers TO. Identication
of cyst nematodes of agronomic and regulatory
concern with PCR-RFLP of ITS 1. J Nematol
1997;29:25567.
Tan, BS, Senda, M and Kageyama, K . Respiration
properties of Pythium species from cool-temperate
forest soil. The 8th international mycological con-
gress, Cains, Australia, 2006.
Van der Plaats-Niterink, AJ . Monograph of the genus
Pythium. No. 21, Studies in mycology. Centraalbureau
Voor Schimmelcultures, Baarn, The Netherlands,
1981.
Vincelli P, Tisserat N. Nucleic acid-based pathogen
detection in applied plant pathology. Plant dis
2008;92(5):6609.
Wang PH, Chang CW. Detection of the low-germination-
rate resting oospores of Pythium myriotylum from soil
by PCR. Lett Appl Microbiol 2003;36:15761.
White TJ, Bruns T, Lee S, Taylor JW. Amplication and
direct sequencing of fungal ribosomal RNA genes for
phylogenetics. In: Innis MA, Gelgard DH, Sninsky JJ,
White TJ, editors. PCR protocols: 315322. A guide to
methods and applications. New York: Academic Press;
1990.
Wittwer CT, Ririe KM, Andrew RV, David DA, Gundry RA,
Balis UJ. The LightCyclerk: a microvolume multi-
sample uorimeter with rapid temperature control.
Bio-Techniques 1997;22:1761181.
Development of real-time PCR technique for the estimation of population density of P. intermedium 705