2012 SSAT PLENARY PRESENTATION

Predicting Recurrence of C. difficile Colitis Using Bacterial

Virulence Factors: Binary Toxin Is the Key
David B. Stewart & Arthur Berg & John Hegarty
Received: 20 April 2012 / Accepted: 11 October 2012 / Published online: 20 October 2012
#2012 The Society for Surgery of the Alimentary Tract
Abstract
Background Recurrent Clostridium difficile colitis is common, yet the ability to predict recurrence is poorly developed.
Methods Patients 18 years of age treated at our institution for C. difficile of any severity were consecutively enrolled. C.
difficile colitis was defined as symptoms of colitis with a positive PCR stool test. Each bacterial isolate was studied for
virulence factors: tcdC mutations via PCR; the presence of genes for toxins A, B, and binary toxin using restriction fragment
length polymorphism; and identification of ribotype 027 by PCR. Chi-squared tests, t tests, and logistic and linear regression
were used to determine which virulence factors predicted recurrence.
Results Sixty-nine patients (male, 57 %) were studied, with a mean age of 6413 years. Twenty-one (30 %) patients were
initially diagnosed as outpatients. There was no difference (p>0.05) between virulence factors among inpatients and
outpatients. The presence of a binary toxin gene was the single virulence factor independently associated with recurrence
(p00.02). The combination of a tcdC mutation with binary toxin gene resulted in the highest odds of recurrence (OR, 5.3;
95 % CI, 3.526.09).
Conclusion Binary toxin gene is a predictor of recurrent infection. Its presence may require longer antibiotic regimens in an
effort to lower already elevated recurrence rates.
Keywords Clostridiumdifficile
.
Recurrence
.
Binary
toxin
.
Virulence
Introduction
The recent state of Clostridium difficile infection (CDI) is
characterized by both conceptual upheaval and frequent shifts
in the collective understanding of its pathophysiology.
1
This
flux is attributable to rapid changes in disease patterns toward
a higher incidence and prevalence of C. difficile colitis
(CDC),
2,3
coupled with more frequent occurrences of fulmi-
nant CDC which,
4,5
contrary to past disease behavior, now
more regularly requires surgical intervention as a stopgap to
failing medical therapy. While death from CDC is an uncom-
mon sequela, a commonplace adverse outcome involves re-
current CDC (RCDC). It is estimated that a minimum of 20
30 % of CDC patients will develop at least one recurrent
episode, with an incidence that approaches 5065 % subse-
quent to the first recurrence.
6,7
RCDC often requires extended
periods of treatment, which exposes patients to lengthy and
expensive courses of antibiotics which may ultimately prove
inadequate toward eradicating the infection.
8
Several patient-related and environmental risk factors for
both primary and recurrent C. difficile infection have been
suggested, such as the absence of proper hand-washing
among health care providers
9
as well as the injudicious use
of broad spectrum antibiotics.
10
More recently, the Food and
Drug Administration released a warning
11
that the use of
proton-pump inhibitors may promote CDI, which may
prove to have implications for RCDC as well. Despite these
and other associations, the ability to actually predict CDC
disease course, including recurrence of infection, from clin-
ical factors alone remains merely provisional.
This manuscript was presented at the SSAT Plenary Session III at the
May 2012 Digestive Disease Week Meeting in San Diego, CA, USA.
D. B. Stewart (*)
:
A. Berg
:
J. Hegarty
Department of Surgery, Penn State College of Medicine,
500 University Drive, H137,
Hershey, PA 17033, USA
e-mail: dstewart@hmc.psu.edu
J Gastrointest Surg (2013) 17:118125
DOI 10.1007/s11605-012-2056-6
By comparison to purely clinical research, much less
information is available to explain how bacterial genetics
and toxin profiles might influence the clinical progression of
CDC, including the ontogeny of recurrent infections. In
particular, whether there is a difference in recurrence rates
as influenced by the presence of the relatively recently
discovered binary toxin is completely unknown. While there
is currently a heightened interest in the molecular biology of
C. difficile, the determinative influences of alleged bacterial
virulence factors compared to more commonly appealed to
clinical factors, and the interplay between bacterial and
patient characteristics, is at present an underdeveloped sche-
ma. In terms of correlating bacterial factors with RCDC,
there is almost no previous research to guide clinical
decisions.
The aim of the present study was to characterize how C.
difficile virulence factors studied from non-duplicated
patient-derived stool samples correlated with the incidence
of RCDC.
Materials and Methods
This study was performed solely at the authors institution
and with the Institutional Review Board (IRB) approval.
The study is linked to an IRB-approved C. difficile tissue
bank of one of the authors (DS), which collects C. difficile-
positive clinical stool samples from inpatients and outpa-
tients 18 years of age or older who consent to the use of their
specimen for scientific research.
Bacterial Isolates All C. difficile isolates were cultured and
cryopreserved from patient-derived stool samples which
were sent to our institutions clinical microbiology labora-
tory for testing. The presence of the C. difficile gene for
toxin A (tcdA) was confirmed through the use of a loop-
mediated isothermal DNA amplification technique, as part
of each patients clinical evaluation for CDC.
Reference C. difficile strains representing ribotypes 021
and 078 (both NAP7 and NAP8 variants) were kindly pro-
vided by Dr. Brandi Limbago (Centers for Disease Control
and Prevention, Atlanta, GA, USA) in order to verify iden-
tification of C. difficile for all PCRs subsequently
performed.
Isolation of C. difficile C. difficile-positive stool samples
were shocked in 95 % alcohol for 30 min followed by
culture using CDC anaerobe and phenylethyl alcohol anaer-
obe agars (Remel, Lenexa, KS) containing 5 % sheep blood,
under anaerobic conditions (85 % N
2
, 10 % CO
2
, 5 % H
2
)
using an Anoxomat system. Presumptive C. difficile isolates
were identified by their characteristic malodor, characteristic
colony morphology, and by chartreuse fluorescence under
exposure to a Woods lamp. These isolates were then sub-
cultured on CDC anaerobe 5 % sheep blood agar. Isolated
colonies were then biochemically identified using RapID
ANA II panels (Remel, Lenexa, KS). Positive C. difficile
isolates were tested for susceptibility to metronidazole and
vancomycin by the Etest method (bioMrieux, Durham,
NC). Etest strips were positioned directly on the agar surface
and were incubated at 37 C for 48 h. The minimum inhib-
itory concentration (MIC) (in micrograms per milliliter) for
metronidazole and vancomycin was measured at the ellipse
of inhibited growth. Isolates were then stored and suspended
in trypticase soy broth (BBL Becton Dickinson, Franklin
Lakes, NJ) containing 15 % glycerol at 80 C.
DNA Extraction Bacterial genomic DNAwas purified from
washed bacterial cell pellets obtained from plate cultures
following a 48-h period of anaerobic growth at 37 C. DNA
was extracted using the UltraClean Microbial DNA isolation
kit (MO-BIO, Carlsbad, CA) and was checked for concen-
tration and purity with a NanoDrop 2000 spectrophotometer
(Thermo Scientific, Wilmington, DE).
Detection of Binary Toxin Gene Primers Tim6, Struppi6,
cdtBpos, and cdtBrev (Table 1) were used for multiplex
amplification of the binary toxin gene (CDT) as well as
the C. difficile-specific gene cdd3. Cycle conditions con-
sisted of 35 cycles of denaturation for 30 s at 94 C,
annealing for 45 s at 50 C, with extension for 1 min at
72 C, followed by a final extension cycle for 5 min at 72
C. PCR products were separated by electrophoresis on
1.5 % TrisacetateEDTA (TAE) agarose gels and were
assessed following ethidium bromide staining.
Toxinotyping Isolates were toxinotyped for the major toxins
using primers A3C, A4N, B1C, and B2N (Table 1) as de-
scribed by Rupnik,
12
with modified cycling conditions. The
first 3 kb of the toxin B gene (B1) and 3 kb of the C-terminal
region of the toxin A gene (A3) were amplified by PCR
using cycle conditions consisting of 40 cycles of denatur-
ation for 5 s at 95 C, annealing for 5 s at 48 C, and with
extension for 3 min at 72 C, followed by a final extension
cycle for 7 min at 72 C. Toxin fragments B3 and A1 were
confirmed on 1 % TAE agarose gels at 6 V/cm for 1 h and
were then subsequently digested by restriction enzymes
HincII, AccI, and EcoRI at 37 C for 3 h. Restriction
patterns defining the toxinotypes were determined by final
electrophoresis on 1.5 % TAE agarose gels at 8 V/cm for 2 h
followed by ethidium bromide staining.
PCR Ribotyping Genetic variations between isolates were
further characterized by 16S23S rRNA intergenic spacer
PCR performed using the method outlined by Stubbs.
13
PCR products were separated on 2.5 % MetaPhor agarose
J Gastrointest Surg (2013) 17:118125 119
gels (Lonza, Allendale, NJ) at 150 V in 0.5 chilled Tris
borateEDTA (TBE) buffer for 4 h followed by ethidium
bromide staining. Ribotypes were determined by compari-
son of gel electrophoresis banding patterns to reference
strains.
tcdC Deletions Large deletions in the negative regulator of
toxin production (tcdC) protein were identified as described
by Spigaglia and Mastrantoni,
14
with slight modifications.
Primers tcdC1 and tcdC2 (Table 1) were used to amplify a
250-bp region of the tcdC gene. PCR was carried out in 20-
L reactions containing HotStar Plus master mix (Qiagen,
Valencia, CA) containing 1.5 mM MgCl
2
, 10 pmol of pri-
mers, and 1 ng genomic DNA. The DNA template was
denatured at 95 C for 5 min, and DNA was amplified for
35 cycles consisting of denaturation for 30 s at 94 C,
annealing for 30 s at 52 C, and extension for 30 s at
72 C. Reactions were terminated following a final exten-
sion step for 4 min at 72 C. tcdC deletions were identified
by electrophoresis on 2.5 % TBE agarose gels at 7.5 V/cm
for 3 h and visualized by ethidium bromide staining.
Clinical Data Each patient enrolled in the tissue bank also
provided consent for review of their medical record. For all
patients, age, gender, ethnicity, and the presence of comor-
bidities were recorded. A Charlson Comorbidity Scale
(CCS)
15
score was calculated for both inpatients and out-
patients, as was a measurement of the severity of each
patients CDC using the guidelines from the Infectious Dis-
eases Society of America (IDSA) criteria
16
as listed in
Table 2. Clinical data collected included whether or not
hospital admission was required at any time during the
treatment of CDC, whether hospital admission was for
CDC, whether hospital admission was to an unmonitored
setting versus an intensive care unit (ICU), and whether
inpatients required transfer to the ICU after initial admission
for the treatment of CDC. Whether the patient was using
proton-pump inhibitors (PPI) prior to their CDC diagnosis
was also recorded.
Recurrent CDC was defined as two consecutive positive
C. difficile stool studies no closer than 21 days apart. Out-
comes of interest were the development of at least one
episode of RCDC, the number of episodes of RCDC for
patients with recurrent infections, and the need for hospital
admission during the treatment of any episode of RCDC.
Chi-squared tests, t tests, analysis of variance (ANOVA),
and logistic and linear regression were used to evaluate the
relationship between bacterial and patient factors and out-
comes of interest.
Results
Summary information is provided for study subjects in
Table 3, stratified based on those patients who did and did
not experience RCDC. A total of 69 non-duplicate isolates
Table 1 Primers used for PCR testing of C. difficile isolates
Primer 53 sequence Target Size(s) (bp) Reference
Tim6 TCCAATATAATAAATTAGCATTCCA cdd3 622 Stubbs et al.
26
Struppi6 GGCTATTACACGTAATCCAGATA
cdtBpos CTTAATGCAAGTAAATACTGAG cdtB 510
cdtBrev AACGGATCTCTTGCTTCAGTC
tcdC1 GCACCTCATCACCATCTTC tcdC 196250 Spigaglia and Mastrantonio
14
tcdC2 TGGTTCAAAATGAAAGACGAC
16S CTGGGGTGAAGTCGTAACAAGG 16S (1,4451,466; 3 end) 200700 Stubbs et al.
13
23S GCGCCCTTTGTAGCTTGACC 23S (20 to 1; 5 end)
A3C TATTGATAGCACCTGATTTATATACAAG A3 fragment of tcdA 3,100 Rupnik et al.
12
A4N TTATCAAACATATATTTTAGCCATATATC
B1C AGAAAATTTTATGAGTTTAGTTAATAGAAA B1 fragment of tcdB 3,100
B2N CAGATAATGTAGGAAGTAAGTCTATAG
Table 2 Infectious Disease So-
ciety of America criteria to cat-
egorize severity of C. difficile
infection
Episode Severity Clinical definition
Initial Mild or moderate WBC <15,000 and serum creatinine <1.5baseline
Severe WBC 15,000 or serum creatinine 1.5baseline
Severe (complicated) Ileus, hypotension/shock, megacolon
First recurrence Same as above
Second recurrence Same as above
120 J Gastrointest Surg (2013) 17:118125
were studied, with 28 (41 %) patients experiencing at least one
episode of RCDC. There was no statistically significant dif-
ference (p>0.05) between patients with and without RCDC
based on age, gender, ethnicity, or CCS. Based on IDSA
classification for severity of CDI, those patients experiencing
at least one recurrence of CDC had a higher proportion of
patients with severe and severe (complicated) CDC compared
to patients without RCDC, though these differences were not
statistically significant. There was no difference (p00.12) in
the incidence of PPI therapy between patients with and with-
out recurrences. Patients who did not experience RCDC had a
higher incidence of systemic hypertension (p00.03) and dia-
betes (p00.04) while having a lower incidence of coronary
artery disease (p00.04) compared to patients with RCDC. Of
the 69 study patients, 48 (70 %) received inpatient care during
their first episode of CDC. Of these 48 patients, 20 (42 %)
patients had a primary admission diagnosis of CDC. Ten of
the 20 patients required admission to the ICU upon their
admission to the hospital (RCDC, six versus no RCDC,
four; p00.14), and 5 of these 20 patients required transfer
to the ICU after their admission to the hospital (RCDC,
four versus no RCDC, one; p00.07). There was no differ-
ence between those with and without RCDC regarding the
proportion of patients initially managed as outpatients for
their index episode of CDC (p00.06). None of the patients
in the study population required colectomy or died from
CDC. Approximately 22 % of the entire study population
had received either extended spectrum penicillins such as
amoxicillin/clavulanic acid, or a quinolone, within 60 days
of their index episode of CDC, with no difference (p00.34)
noted in the incidence of previous antibiotic use between
the two groups.
Table 3 Characteristics of 69
patients with C. difficile colitis
Characteristic No RCDC (n041) RCDC (n028) Significance
(p value)
Mean age (years) 6211 669 0.85
Gender (male) 35 (85 %) 16 (57 %) 0.08
Caucasian ethnicity 39 (95 %) 24 (86 %) 0.10
Charlson comorbidity score 2.80.8 3.20.7 0.07
IDSA severity
Mild/moderate 25 (61 %) 10 (36 %) 0.06
Severe 13 (32 %) 15 (54 %) 0.07
Severe (complicated) 3 (7 %) 3 (10 %) 0.07
Use of proton-pump inhibitors 30 (73 %) 21 (75 %) 0.12
Comorbidities
Systemic hypertension 35 (85 %) 15 (53 %) 0.03
Diabetes 25 (61 %) 13 (46 %) 0.04
Coronary artery disease 15 (37 %) 17 (60 %) 0.04
COPD 7 (17 %) 5 (18 %) 0.23
Obesity (BMI >30) 30 (73 %) 20 (71 %) 0.98
Chronic renal disease 8 (20 %) 10 (36 %) 0.07
Outpatient management during index CDC episode 10 (24 %) 11 (39 %) 0.06
Admitting service
Medicine 37 (90 %) 20 (71 %) 0.76
Surgery 4 (10 %) 8 (29 %)
Table 4 Bacterial virulence
factors and correlation with re-
current C. difficile colitis
Virulence factor Incidence
within study
population
(n069)
Association
with recurrence
(p value)
Association with
need for admission
for first CDC episode
(p value)
Association
with admission
for RCDC
(p value)
Toxin A 61 (88 %) 0.56 0.92 0.78
Toxin B 66 (96 %) 0.73 0.96 0.60
Binary toxin gene (CDT) 42 (61 %) 0.02 0.04 0.02
tcdC mutation 39 (56 %) 0.18 0.07 0.04
Ribotype 027 26 (38 %) 0.32 0.13 0.02
J Gastrointest Surg (2013) 17:118125 121
Table 4 presents the results of a univariate analysis of
bacterial virulence factors correlated with the occurrence
of at least one episode of RCDC. The majority of C.
difficile isolates harbored at least one virulence factor,
with 63 % harboring at least two virulence factors and
with 48 % having three or more virulence traits. Out of
all bacterial virulence factors, only the presence of the
binary toxin gene (CDT) predicted a recurrent episode of
CDC (p00.02). Neither ribotype 027 (p00.32), mutations
of the tcdC gene (p00.18) nor the presence of genes for
toxins A (p00.56) and B (p00.73) was associated with
RCDC. The presence of the CDT gene (p00.04) was the
only bacterial virulence factor associated with hospital
admission for CDC treatment during the index episode
of CDC. The presence of the CDT gene was found in
100 % of the PCR ribotype 027 strains (n026) as well
as in 100 % of the PCR ribotype 078 strains (n07),
being absent in ribotypes 001 (n03), 014 (n01), 017
(n01), and in several previously unreported strains
(HMC 1117).
A total of 28/69 (40 %) patients developed at least one
episode of RCDC. Among the RCDC patient group, the
mean number of recurrences was 2.01.8 (range, 16). Of
these RCDC patients, the presence of the CDT gene (p0
0.02) and the presence of a tcdC mutation (p00.04) or PCR
ribotype 027 (p00.02) were each associated with need for
admission to the hospital specifically for the treatment of
RCDC. Based on multivariable logistic regression, the com-
bination of tcdA and tcdB with the presence of the binary
toxin gene resulted in a higher odds of RCDC (odds ratio
(OR), 3.1; 95 % confidence interval (CI), 2.973.33), with a
mean number of RCDC episodes of 1.41.2. The combina-
tion of a tcdC mutation with the presence of the binary toxin
gene resulted in the highest odds of RCDC (OR, 5.3; 95 %
CI, 3.526.09) and was associated with the highest mean
number of recurrent episodes of infection (mean, 2.70.6).
Among the entire study population, the mean MIC
for vancomycin was 0.650.75 gmL
1
while the mean
MIC for metronidazole was 0.20.2 gmL
1
. There
was no difference in MICs between those with RCDC
and those without recurrent infection (vancomycin: p0
0.87; metronidazole: p00.94) nor was there a difference
in MICs for patients treated as inpatients (p00.99) and
outpatients (p00.53) for their index episode of CDC.
Based on ANOVA, there was no statistically significant
difference (p00.23) in the use metronidazole, vancomy-
cin, or the use of dual-agent therapy with both anti-
biotics between the RCDC and no RCDC groups
(Table 5).
Discussion
Binary toxin was only recently discovered, being first de-
scribed by Popoff in a 1988 description of a female patient
with CDC.
17
Further interest in the toxin has only developed
in the past several years, and due to this latent attention,
there is a smaller body of literature describing the structure,
biology, and function of this toxin. While toxins A and B are
members of a toxin family known as the large clostridial
toxins,
18
which collectively have a molecular mass of 250 to
308 kDa and which are encoded by genes within the path-
ogenicity locus (PaLoc),
19
CDT is encoded by a region
remote to the PaLoc and is a member of the iota-like
subclass of the clostridial binary toxin family.
20
Unlike
toxins A and B, whose mechanism of action involves trans-
ferring a glucose moiety from UDP-glucose to a family of
small GTPases such as Rho, Rac, and CDC42,
21
binary
toxin acts as an actin-ADP-ribosylating toxin, transferring
an ADP moiety from NADP/NADPH to G-actin, thus pre-
venting its normal polymerization into F-actin which leads
to the disruption of the cytoskeleton, cellular dehydration,
and cell death.
22,23
CDT consists of two components, CDTa
and CDTb, the former being an enzymatically active unit
and the latter being an inert transporter that aids the active
component in crossing the cellular membrane.
24
There has
been no scientific inquiry as to how binary toxin might
promote recurrent disease, as the association between CDT
and recurrence is a novel concept.
There are several previously described characteristics
attributed to CDT which, due to a paucity of clinically
oriented research with this toxin, are not firmly established
Table 5 Analysis of variance
comparing the choice of antibi-
otics during the index episode of
CDC (p00.23)
Antibiotic regimen during index CDC episode CDC without recurrence
(n041)
Patients who developed
RCDC (n028)
Oral metronidazole 22 (54 %) 16 (57 %)
Oral metronidazole with non-CDC antibiotics 5 (12 %) 4 (14 %)
Intravenous metronidazole 9 (22 %) 3 (11 %)
Oral vancomycin 3 (7 %) 4 (14 %)
Oral or intravenous metronidazole with oral
vancomycin
1 (2.5 %) 1 (3.5 %)
Oral vancomycin with non-CDC antibiotics 1 (2.5 %) 0
122 J Gastrointest Surg (2013) 17:118125
as typical for CDT and which are challenged by the present
study. While it is often cited that the prevalence of the CDT
gene ranges between 6 and 12.5 %
25,26
in the present study,
the prevalence was much higher, being identified in 61 % of
isolates. It is possible that there are regional variations in the
prevalence of both ribotype and toxinotype among C. diffi-
cile isolates, and if this was the case, then accurate measure-
ment of the prevalence of virulence factors would require a
multi-institutional effort with geographically diverse sour-
ces of bacteria to provide an accurate assessment. The same
phenomenon would also apply regarding the preponderance
of ribotype 027, frequently referenced as the hyperviru-
lent form of C. difficile. While previous reports
3,4
have
described this type of C. difficile as an epidemical strain,
suggesting that its emergence in an institution precedes
outbreaks of particularly fulminant forms of infection, in
the present study, 38 % of the isolates were of this ribotype.
It is noteworthy that none of the 027 patients in this study
required colectomy or died from CDC and that this ribotype
was not a univariate predictor of recurrent infection. This
suggests that, in some institutions, ostensibly notorious
ribotypes such as 027 are actually quite common causes of
CDC as opposed to representing a periodically encountered
variant and that disease behavior may not be accurately,
mechanistically viewed from the sole vantage point of al-
legedly epidemical ribotypes. Other studies have reached
similar conclusions, where predicting virulence has not been
successful with such factors as tcdC mutations or ribotype.
27
The fact that, in the present study, the so-called virulence
factors were not associated with fulminant colitis would
suggest that their mere presence is perhaps necessary but
not sufficient to produce severe forms of CDC. Though
previously published data on CDC have often considered
recurrence to be characteristic of virulent infections, sur-
geons may wish to distinguish between virulence, defined
as severe forms of colitis, and recurrence as reflecting an
infection that is difficult to eradicate. This difference in
parlance is important to recognize in order to avoid ambi-
guities between the surgical, infectious disease and molec-
ular biological literature on CDC.
Much concern has recently been expressed regarding the
possible etiologic role of PPI therapy in the development of
CDC.
28
Though the provocating effect of PPI therapy to-
ward development of CDC has not been a universal
observation,
29
the issue of whether PPIs promote recurrent
CDC is even less clear. A recent case-control study by Kim
and colleagues identified PPI therapy as the only clinical
factor associated with RCDC, without providing any infor-
mation regarding bacterial toxin typing or genetic factors.
30
In contradistinction, the present study demonstrated no sig-
nificant difference in rates of RCDC based on the presence
of PPI therapy. Though it is commonly assumed that acid
suppression is the principal manner through which this class
of medications promotes CDC,
31
there is almost no infor-
mation available regarding the direct effect that PPIs may
have on either the colon or C. difficile. This is in keeping
with the burgeoning yet seminal area of current interest in C.
difficile research focused on identifying those environmental
factors affecting bacterial behavior within the large intestine.
As an example of the importance of environmental cues on
the behavior of C. difficile, preliminary evidence
32
has sug-
gested that antibiotics may have direct effects promoting
growth and the production of toxins in C. difficile apart
from disturbances to the microbiome caused by these anti-
biotics. Further research on the effects of PPIs, antibiotics,
and other medications on the colon, commensal bacteria and
C. difficile is necessary to understand the risks these medi-
cations may pose.
Conclusion
The presence of the binary toxin gene in C. difficile is an
independent predictor of recurrent CDI, which is a finding that
has not been previously reported. The combination of the
binary toxin gene and mutations in the tcdCgene is associated
with 430 % higher odds of recurrent CDI. C. difficile isolates
which produce binary toxin may require longer antibiotic
regimens in an effort to lower already elevated recurrence
rates within the general CDC patient population.
References
1. Bartlett JG, Perl TM. The new Clostridium difficilewhat does it
mean? N Engl J Med 2008;353(23):2503-05.
2. Dallal RM, Harbrecht BG, Boujoukas AJ, et al. Fulminant
Clostridium difficile: an underappreciated and increasing cause of
death and complications. Ann Surg 2002;235(3):363-372.
3. Pepin J, Valiquette L, Alary ME, et al. Clostridium difficile-asso-
ciated diarrhea in a region of Quebec from 1991 to 2003: a
changing pattern of disease severity. CMAJ 2004;171(5):466-472.
4. Warny M, Pepin J, Fang A, et al. Toxin production by an emerging
strain of Clostridium difficile associated with outbreaks of severe
disease in North America and Europe. Lancet 2005;366:1079-84.
5. McDonald LC, Killgore GE, Thompson A, et al. An epidemic,
toxin gene-variant strain of Clostridium difficile. N Engl J Med
2005;353:2433-41.
6. McFarland LV, Surawicz CM, Rubin M, et al. Recurrent
Clostridium difficile disease: epidemiology and clinical character-
istics. Infect Control Hosp Epidemiol 1999;20:43-50.
7. McFarland LV, Elmer GW, Surawicz CM. Breaking the cycle:
treatment strategies for 163 cases of recurrent Clostridium difficile
disease. Am J Gastroenterol 2002;97(7):1699-75.
8. McFarland LV, Surawicz CM, Rubin M, Fekety R, et al. Recurrent
Clostridium difficile disease: epidemiology and clinical character-
istics. Infect Control Hosp Epidemiol 1999;43-50.
9. Jabbar U, Leischner J, Kasper D, Gerber R, et al. Effectiveness of
alcohol-based hand rubs for removal of Clostridium difficile spores
from hands. Infect Control Hosp Epidemol 2010;31(6):565-70.
J Gastrointest Surg (2013) 17:118125 123
10. Stevens V, Dumyati G, Fine LS, Fisher SG, van Wijngaarden E.
Cumulative antibiotic exposures over time and the risk of
Clostridium difficile infection. Clin Infect Dis 2011;53(1):42-8.
11. FDA U.S. Food and Drug Administration. Accessed on 4/2/2012;
http://www. fda.gov/Safety/MedWatch/SafetyInformation/
SafetyAlertsforHumanMedicalProducts/ucm290838.htm
12. Rupnik M, Avesani V, Janc M, von Eichel-Streiber C, Delme M.
A novel toxinotyping scheme and correlation of toxinotypes with
serogroups of Clostridium difficile isolates. J Clin Microbiol
1998;36(8):2240-7.
13. Stubbs SL, Brazier JS, ONeill GL, Duerden BI. PCR targeted to
the 16S-23S rRNA gene intergenic spacer region of Clostridium
difficile and construction of a library consisting of 116 different
PCR ribotypes. J Clin Microbiol 1999;37:461-63.
14. Spigaglia P, Mastrantonio P. Molecular analysis of the pathogenic-
ity locus and polymorphism in the putative negative regulator of
toxin production (TcdC) among Clostridium difficile clinical iso-
lates. J Clin Microbiol 2002;40(9):3470-5.
15. Charlson ME, Pompei P, Ales KL, MacKenzie CR. A new method
of classifying prognostic comorbidity in longitudinal studies: de-
velopment and validation. J Chronic Dis 1987;40:373-83.
16. Cohen SH, Gerding DN, Johnson S, et al. Clinical practice guide-
lines for Clostridium difficile infection in adults: 2010 update by
the Society for Healthcare Epidemiology of America (SHEA) and
the Infectious Diseases Society of America (IDSA). Infect Control
Hosp Epidemiol 2010;31:431-55.
17. Popoff MR, Rubin E, Gill DM, Boquet P. Actin-specific ADP-
ribosyltransferase produced by a Clostridium difficile strain. Infect
Immun 1988;56:2299-306.
18. Thelestram M, Chaves-Olarte E. Cytotoxic effects of the
Clostridium difficile toxins. Cur Top Microbiol Immunol
2000;250:85-96.
19. Rupnik M, Grabnar M, Geric B. Binary toxin producing
Clostridium difficile strains. Anaerobe 2003;9:289-294.
20. Barth H, Aktories K, Popoff MR, Stiles BG, et al. Binary bacterial
toxins: biochemistry, biology, and applications of common
Clostridium and Bacillus mechanism of ADP ribosylating toxins.
FEBS J 2006;273:4579-4593.
21. Sundriyal A, Roberts AK, Ling R, McGlashan J, et al. Expression,
purification and cell cytotoxicity of actin-modifying binary toxin
from Clostridium difficile. Protein Expr Purif 2010;74:42-48.
22. Vandekerckhove J, Schering B, Barmann M, et al. Clostridium
perfringens iota toxin ADP ribosylates skeletal muscle actin in
Arg-177. FEBS Lett 1987(225):48-52.
23. Reuner KH, Presek P, Boschek CB, et al. Botulinum C2 toxin
ADP-ribosylates actin and disorganizes the microfilament network
in intact cells. Eur J Cell Biol 1987;43:134-140.
24. Davies AH, Roberts AK, Shone CC, Acharya KR. Super toxins
from a super bug: structure and function of Clostridium difficile
toxins. Biochem KJ 2011;436:517-526.
25. Geric B, Johnson S, Gerding DN, Grabnar M et al. Frequency
of binary toxin genes among Clostridium difficile strains that
do not produce large clostridial toxins. J Clin Microbiol
2003;41:5227-32.
26. Stubbs S, Rupnik M, Gilbert M, Brazier J, et al. Production of actin
specific ADP-ribosyltransferase (binary toxin) by strains of
Clostridium difficile. FEMS Microbiol Lett 2000;186:307-312.
27. Goldenberg AD, French GL. Lack of association of tcdC type and
binary toxin status with disease severity and outcome in toxigenic
Clostridium difficile. J Infect 2011;62(5):355-362.
28. McCarthy DM. Adverse effects of proton pump inhibitor
drugs: clues and conclusions. Curr Opin Gastroenterol
2010;26:624-631.
29. Naggie S, Miller BA, Zuzak KB, et al. A case-control study of
community-associated Clostridium difficile infection: no role for
proton pump inhibitors. Am J Med 2011;124(3):276.e1-276.e7.
30. Kim YG, Graham DY, Jang BI. Proton pump inhibitor use and
recurrent Clostridium difficile-associated disease. J Clin
Gastroenterol 2012;46(5):397-400.
31. Dial S, Delaney JA, Barkun AN, et al. Use of gastric acid-
suppressive agents and the risk of community-acquired
Clostridium difficile-associated disease. JAMA 2005;294:2989-
95.
32. Dupuy B, Govind R, Antunes A, Matamouros S. Clostridium
difficile toxin synthesis is negatively regulated by TcdC. J Med
Microbiol 2008;57:685-689.
Discussant
Dr. Sekar Dharmarajan (St. Louis, MO): Thank you Mr. Chairman.
While the surgical literature is replete with studies that correlate clin-
ical patient factors with morbidity, need for surgery, and mortality from
C. difficile infection, Dr. Stewart and colleagues have taken the novel
and thought-provoking approach of characterizing bacterial virulence
factors and correlating these with morbidity from C. difficile in the
form of recurrent infection. I have three broad areas of comments/
questions.
The first surrounds the definition of recurrent C. difficile colitis. The
authors define recurrent C. difficile infection as two consecutive pos-
itive C. difficile stool samples no closer than 21 days apart. Without a
negative intervening sample, how do we know this is recurrent C.
difficile infection as opposed to persistent C. difficile infection, as we
know that C. difficile is notoriously difficult to eradicate? Specifically,
do you have any data on how far apart temporally the positive stool
samples were in the patients with recurrent C. difficile? More interest-
ingly, do you have any data on the bacteriology of the recurrent C.
difficile isolates to see how they are compared to the original isolate?
The second area is with regard to the broader generalizability or
applicability of the study. As the authors state in their manuscript, the
prevalence of the binary toxin gene in this study was five- to tenfold
higher than that previously reported in the literature. Similarly, ribotype
027, which has been found in previous studies to be hypervirulent, was
not associated with any morbidity or mortality in the present study. Is it
possible that, while binary toxin is the key to predicting recurrent
infection at Hershey, these factors may differ institution to institution?
Finally, the last area is with regard to patient or host factors that
certainly must contribute to morbidity and mortality from C. difficile
infection. While the present study found no clinical factors that pre-
dicted recurrent infection, I wonder if the authors have plans or could
comment on studying the interaction of patient genotypes at genetic
loci that may render susceptibility to infection with bacterial virulence
factors on morbidity from C. difficile. Similarly, as the authors com-
ment in their manuscript, the host microbiome has become an increas-
ingly important area of research in determining outcomes from a
variety of disease processes, and I wonder if the authors had any
comment on their plans to study this.
Thank you for the opportunity to review your extremely well-
written manuscript.
Selection Bias: There is no patient with fulminant C. difficile colitis
as defined by need for surgery or death.
Closing Discussant
Dr. David B. Stewart: I would like to thank the SSAT for the
opportunity to present our research, and I would also like to express
my gratitude to Dr. Dharmarajan for being willing to serve as a
discussant for our presentation.
124 J Gastrointest Surg (2013) 17:118125
Dr. Dharmarajans first point is perhaps the most critical issue
which he raised as a discussant. There are no consensus-based defi-
nitions, for all research endeavors on the topic, which define recurrent
C. difficile colitis (RCDC) in any scientifically meaningful manner.
This lack of standardization would potentially allow for an inflated
estimate of RCDC, if the time interval between two consecutive CDC
episodes was diminished to a great enough degree. In fact, in reviewing
the literature which deals with recurrent C. difficile, the reader will
encounter both heterogeneity in the definition of recurrence as well as a
degree of arbitrariness which includes extremely short time intervals
(<10 days) as well as criteria that range from clinical symptoms of
diarrhea to tests confirming the presence of toxigenic C. difficile. In our
case, it seemed appropriate to set the definition of RCDC at a point at
least far enough after the diagnosis of the index episode to allow for the
standard course of 1014 days of antibiotics to be completed. We then
allowed for an additional week of time to elapse in order to better
ensure that we avoided collapsing recurrence into persistence. While
our approach is not universal in acceptance, we believe it is fair and
that it has a conceptual appeal given what we have described. Further,
our recurrence rates fall into the same general range as those previously
published in larger studies.
There are no data available to currently guide the definition of when
persistence ends and recurrence begins, and so there are no data
available to answer the issue of temporal relationships for persistence
or recurrence. In part, this very relevant question will not be answered
until we have large C. difficile registries that can provide, at minimum,
regional epidemiologic information regarding endemic ribotypes and
virulence characteristics. Such resources do not exist in this country,
though they do exist in seminal forms in Canada.
The issue related to whether a recurrent episode of CDC is due to a
different ribotype is something our group will be focusing on in the
future. There are no relevant data on this topic currently available,
though the issue is critical. Our group has unpublished data which
demonstrate that C. difficile responds to drugs such as proton-pump
inhibitors in a ribotype-dependent manner, such that some ribotypes
will produce more toxins in the presence of PPIs and some will express
toxin genes to a lesser degree. Some are actually unaffected by PPIs. If
this is confirmed in larger studies, it will introduce an additional
complexity in understanding C. difficile and in how environmental
cues, including the drugs we use to eradicate the organism, may lead
to different clinical outcomes. There is a biologic basis for such
phenomena, and in the same manner that we push for personalized
medicine with respect to diseases like cancer, we need personalized
microbiology to a much greater degree than is presently available.
The second comment deals with whether those bacterial genetic
signatures that were associated with higher rates of recurrence in our
study might not be relevant in a different population of C. difficile.
Until our findings are prospectively evaluated in a multiregional fash-
ion, then this concern will not be definitively addressed. However, the
idea that binary toxin would negatively affect clinical outcomes in
CDC has scientific plausibility, given that previous reports have sug-
gested that this is a more potent form of toxin.
Dr. Dharmarajans last comment deals with how host factors,
including other microorganisms within the gut, may influence the
behavior of C. difficile. The issue of the gut microbiome is cer-
tainly the hot topic of our day in microbiology, and for good
reason. However, our understanding of the microbiome concept is
currently so piecemeal that the more we learn, the less we know.
There is at least one publication from several years ago which
demonstrated a higher rate of RCDC when the human subject
was found to harbor certain single nucleotide polymorphisms in
the gene for IL-8, though this publication used a definition for
recurrence, which may have lent toward artificially higher recur-
rence rates. Our own group is now using metabolomics to study
how different environmental elements within the gut, such as vary-
ing levels of electrolytes and micronutrients, might affect transcrip-
tional control of virulence genes in C. difficile. We have also begun
obtaining rectal swabs on CDC patients in order to study the
mRNA present in the organism at the time the sample is obtained,
in an effort to study the transcriptome and how differential gene
expression is associated with clinical outcomes such as recurrence,
fulminant colitis, and death from CDC.
One final commentthese were consecutively enrolled patients
which were presented in our study. Though none of our study patients
required colectomy or died, there were patients with severe CDC based
on the IDSA classification schema. Surgical intervention for CDC,
while much more common than in previous eras, is still relatively
infrequent, which makes studying this particular patient group more
difficult when attempting to obtain informed consent for a stool sample
is required and when the patient is critically ill.
J Gastrointest Surg (2013) 17:118125 125