Sie sind auf Seite 1von 6

Alex Lee

BioE10 HW1
BioE 10 Homework 1


1. (_____ out of 3 points) The first procedure for synthesizing human insulin in a micro-
organism is described in Human Insulin: Seizing the Golden Plasmid from Science News
in 1978. Briefly, The A chain and B chain of human insulin were produced separately
from two different genetically engineered bacteria. The A chain was purified from one
culture, the B chain from another, and then the two chains were chemically combined
into insulin. The exact chemistry that they used is not described, but relied on the
formation of disulfide bonds between thiol groups on the A and B chains.

Explain (in 150 words or fewer, typed) why Genentech didnt genetically engineer one
strain of bacteria to produce complete insulin (like human cells do), eliminating the need
for an expensive chemical procedure which only correctly combines 10-40% of the
available A and B chains.
Insulin is a large molecule that could be very hard to produce at once. If a single bacteria were
to be used to produce complete insulin, then the plasmid containing that gene would be huge
and hard to deal with. Also with such a complicated molecule, it would be easier to make
mistakes in the production, and if mistakes were made, than production would have to come to
a complete halt. By having two different bacteria, one can fail while the other can continue to
produce either the A or B chain of insulin, unaffected by the other.
Also having two bacteria producing different chains is much more efficient. Just like how Ford
revolutionized the car industry by having production lines, having the two different chains
produced separately and then combined is faster than having a single line to produce complete
insulin.

2. (_____ out of 3 points) The following DNA sequence is for the plasmid pSB1A2-I13521.
It contains the DNA for constantly producing a red fluorescent protein in bacteria along
with a ColE1 origin of replication and a resistance gene for the antibiotic ampicillin. The
DNA is circular, so if one ran along the DNA and hit the end of the sequence, one would
find themselves back at the beginning. (The sequence of the complementary strand is
not shown.)

5-
g|aattcgcggccgcttctagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatggcttcctccgaagac
gttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaa
agttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaa|agcttacgttaaacacccggctgacatcccggactacctgaaactgtccttccc
ggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttc
ccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaag
acggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagacta
caccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagt
cgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagtagcggccgctgcagttgcaggct
tcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtga
gcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcga
aacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcg
ctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagt
ccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctac
actagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagca
gcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaagga
tcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcg
ttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagc
aataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgc
gcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcg
gttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtg
agtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaa
cgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaa
acaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatac
atatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatca
cgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctg-3

If you were to cut this plasmid with the restriction enzymes EcoRI and HindIII, indicate on
the sequence above (using a vertical slash between letters) where the DNA would be cut.


3. (_____ out of 2 points) You transform bacterial cells with the plasmid above and plate
your transformed cells on the antibiotic ampicillin and see that all of your bacterial
colonies are red (indicating the production of red fluorescent protein). What would
happen if you accidentally plated these cells on (a) plates with the antibiotic
chloramphenicol or (b) plates with no antibiotic?
Because some of the bacteria will not take in the plasmid, we have a code in the plasmid that
gives resistance to the antibiotic ampicillin. Therefore all bacteria who take in the plasmid and
start to produce fluorescent protein will survive, while the ones who did not will die. If, however,
the bacteria were put on a plate of the antibiotic chloramphenicol, they would have no
resistance and would all die. A plate with no antibiotic would include both bacteria that have and
have not absorbed the desired plasmid, which would make it difficult to isolate the ones who are
producing fluorescent protein.

4. (_____ out of 2 points) Youre on a team of bioengineers producing human growth
hormone (hGH) in bacteria. The first step is to activate the transcription of hGH by
adding arabinose to a fermenter with a saturated cell culture. The cells will produce hGH
in their periplasms for 10 hours, then purification of the hGH will begin.


The rate of hGH production will be roughly proportional to the concentration of
arabinose [A] between [A] = 0 and 1.6E-5 mol/L. In other words,

Rate of hGH production (in mol/(hr*L)) = k[A]

where k = 0.013 1/hr. What concentration of arabinose in mol/L should be added to
achieve a total production of 0.04 mol for a 2.0 liter culture?

(see work on next page)



5. (_____ out of 3 points) Find a design that failed in some way. The scale of the failure is
unimportant - it could be a massive failure of a large project with serious consequences,
or a relatively minor issue in a modest project with minor consequences. Include a
picture or quote from a source (with citation!) that describes the issue.
In the 17th Century, Sweden had become one of the most influential powers in Europe. The
King, Gustavus Adolphus, ordered that a great flagship be constructed that would serve as a
symbol of Sweden's military power. It was to be named the Vasa.
The troubles began when the King himself took personal charge of the ship's design, instead of,
well, the shipbuilders. He changed his orders often and as a result, the Vasa was built as a
small ship at first, then expanded and given different armaments. The ship was much longer
than it was supposed to be, and not wide enough. Because part of the ship had already been
built it was not possible to make further modifications. 24 pounder guns were also crowded into
the original ports for lighter 12 pounder guns, increasing the ship's weight. Also at this time,
there were no definite ways to test the center of mass or balance of sailing ships, so
experienced people were required to build powerful ships. The King was not experienced.
The Vasa set sail on her maiden voyage on the 10th of August, 1628. The gun ports were open
to fire off a salute and display its massive and impressive bronze cannons. At Tegelviken, it met
its fatal enemy: a gust of wind. Because the Vasa was so top heavy, so narrow and tall, and the
gun ports were located so low to the water line, a slight gust of wind caused the lower gun ports
to dip below the waves. As water flooded in, the Vasa lost her ability to right herself, and simply
sank. The famed flagship, the symbol of Sweden's military might, sunk on her maiden voyage in
front of a crowd of thousands of onlookers.
Later, measurements of the wreck showed that the ship could only take winds of up to 5 mph.
A tilt of only 10 degrees would have sent her under the waves.
In fact, rough testing during the construction of the ship had already indicated it was not
seaworthy. In a "lurch" test, 30 sailors ran from one side of the ship to the other while it was
being constructed. After only 3 runs they were forced to stop because the ship was rocking too
violently. The Vasa held about 120 tons of ballast; about twice that amount was needed to
sufficiently stabilize the ship, but adding more would have sent the gun ports into the water.
Despite all these problems, no one was brave enough to suggest changes to the King.
Today the Vasa sits in a museum.






http://faculty.up.edu/lulay/failure/vasacasestudy.pdf
http://en.wikipedia.org/wiki/Vasa_(ship)
In 150 words or fewer, typed, describe what steps you would take as a manager on
similar projects to prevent failures like this from happening on your watch. These steps
should be processes that the people you manage follow. (Dont just say hire better
engineers; thats a more difficult solution than you might think.)
A specific process would be this. First, come up with an idea (innovate, baby). Second,
pitch it to others from your team and people who have knowledge of what you are planning.
They will provide the feedback you need. Is it practical and useful? Third, organize teams to
start the building. Get someone on funds, someone on advertisement, someone to oversee and
make sure everyone else runs smoothly (like me, the manager). Fourth, get feedback from the
community (like what Microsoft should've done with Windows 9). Your team might have thought
it was a good idea, but will the people?


6. The density of a bacterial culture is typically determined by calculating its OD600,
which is a measure of how much 600 nm wavelength light the culture absorbs. As a
general rule, an OD600 measurement of 1.0 corresponds to ~1E9 cells/mL.

Youre working with a new bacterial strain in the lab and youre interested to find out how
quickly it grows. To begin, youve measured the OD600 of a new bacterial culture every
half hour and generated the data in this spreadsheet.

(a) (_____ out of 2 points) If this culture is experiencing exponential growth, then its
density should be described by the equation



where c(t) is the density of cells at time t in (cells/mL), c
0
is the density of cells at time 0
(or the starting density, in cells/mL), t is the current time (in minutes), and d is the
doubling time of the cells (in minutes). The doubling time is the number of minutes
required for the number of cells to double.

If this is true, then by using the logarithm rules we can show that:

log
2
[c(t)/c
0
] = t/d

Plot log
2
[c(t)/c
0
] vs. t. You should see a straight line. When you have exponential growth,
you very often find yourself linearizing the data like this by taking the logarithm of your
data.

(b) (_____ out of 2 points) Add a linear trendline (with the intercept set to 0) to your plot
from (b) and display the equation on the chart. Instructions for doing this in Excel are
available here.

It will be an equation of the form y = mx; this trendline is the best fit to your data. (It uses
a statistical process called linear regression or sometimes a least squares fit.) Use this
equation to calculate the doubling time d of your bacteria (in minutes).


0
2
4
6
8
10
12
0 100 200 300 400
log2[c(t)/c0]
log2[c(t)/c0]
Linear (log2[c(t)/c0] )
(c) (_____ out of 1 point) Has this culture reached saturation during your experiment?
Why or why not?
Not yet, because if we look at the graph, the OD600 is still exponentially increasing. If it were
near saturation then the graph would be leveling out, because there is no longer any room for
the bacteria to grow.

7. (_____ out of 2 points) Read the article California doctors used fake hardware in spine
surgeries, lawsuits say. In 150 words or fewer, typed, summarize the allegations made
against Spinal Solutions LLC and, based on your own research, describe the
demographics of a typical patient likely to be affected by the alleged wrongdoing. Include
at least one citation (which does not count towards the 150 word limit).
Spinal Solutions LLC has been accused of taking screws from the local mom-and-pop machine
shop and passing them off as legitimate FDA approved screws. The provider of the screws,
Crowder, is an older gentlemen who runs a small machine shop. He claims that he thought the
screws he was providing were prototypes, and did not know that they were being passed off as
fakes. Spinal Solutions, on the other hand, has been implicated for taking kickbacks, cash
bonuses, and other forms of bribery in exchange for taking part in the fraud and helping the
middlemen make inflated profits.
The people most likely to suffer from this are people who need spinal fusion surgery. Spinal
fusion surgery is usually recommended after extensive scans and xrays, so it might be more
well-to-do people who get spinal fusion surgery. Spinal fusion surgery is also mainly used to
cure pain, and the screws/operation itself costs a lot of money.

http://orthoinfo.aaos.org/topic.cfm?topic=A00348