Sie sind auf Seite 1von 11

DNA, RNA & Protein Synthesis Web Practice

Multiple Choice
Identify the choice that best completes the statement or answers the question.
____

____

1. Which of the following would be least likely to happen as a result of a mutation in a person's skin cells?
a. skin cancer
b. reduced functioning of the skin cell
c. no change in functioning of the skin cell
d. the person's offspring have mutated skin
2. Which series is arranged in order from largest to smallest in size?
a. chromosome, nucleus, cell, DNA, nucleotide
b. cell, nucleus, chromosome, DNA, nucleotide
c. nucleotide, chromosome, cell, DNA, nucleus
d. cell, nucleotide, nucleus, DNA, chromosome

Figure 12-2

____

____

____

____

3. In which part of the cell does this process shown in Figure 12-2 take place?
a. in the nucleus
c. at the ribosomes
b. in food vacuoles
d. on the chromosome
4. Structure III in Figure 12-2 represents a(n) ____.
a. gene
c. codon
b. amino acid
d. DNA molecule
5. The process illustrated in Figure 12-2 is called ____.
a. translation
c. monoploidy
b. replication
d. transcription
6. Which of the structures in Figure 12-2 are composed of RNA?
a. II and IV
c. I and V
b. III and IV
d. III and V

Help Wanted
Positions Available in the genetics industry. Hundreds of entry-level openings for
tireless workers. No previous experience necessary. Must be able to transcribe code
in a nuclear environment.
Accuracy and Speed vital for this job in the field of translation. Applicants must
demonstrate skills in transporting and positioning amino acids. Salary
commensurate with experience.
Executive Position available. Must be able to maintain genetic continuity through
replication and control cellular activity by regulation of enzyme production. Limited
number of openings. All benefits.
Supervisor of production of proteinsall shifts. Must be able to follow exact
directions from double-stranded template. Travel from nucleus to the cytoplasm is
additional job benefit.
Table 12-1

____

7. Applicants for the fourth job of the Help Wanted ad in Table 12-1, "Supervisor," could qualify if they were
____.
a. DNA
b. mRNA

____

8. Applicants for the third job of the Help Wanted ad in Table 12-1, "Executive Position," could qualify if they
were ____.
a. DNA
b. mRNA

____

c. tRNA
d. rRNA
c. tRNA
d. rRNA

9. A DNA segment is changed from-AATTAG- to -AAATAG-. This is a ____.


a. frameshift mutation
c. insertion
b. substitution
d. deletion

Figure 12-3

____

10. What type of mutation has occurred in Figure 12-3?


a. substitution
c. lethal

b. frameshift
____

____

d. insertion

11. What will be the result of the mutation in Figure 12-3?


a. it will have no effect on protein function
b. only one amino acid will change
c. nearly every amino acid in the protein will be changed
d. translation will not occur
12. A particular sequence of parent DNA has four purine bases and two pyrimidine bases. According to basepairing rules, which of the following sequences could be formed during replication?
a. two cytosine, two adenine, two thymine
b. two cytosine, two adenine, two uracil
c. two adenine, two thymine, one guanine, one cytosine
d. two adenine, two guanine, two cytosine

____

13. You are a medical researcher trying to create a new antibiotic that will interfere with bacterial DNA
replication without harming the eukaryotic host. You have found several chemicals that prevent DNA from
unwinding and separating. Which of the following is the best chemical to use?
a. a chemical that blocks uracil use
b. a chemical that cannot pass into the cell nucleus
c. a chemical that is neutralized by cytoplasm
d. a chemical that works only in the presence of histones

____

14. This is a template DNA sequence: 3'AATCGC5'. This is a partially-completed mRNA strand transcribed
from the DNA template: 3'GCGA5'. What is the next nucleotide that RNA polymerase will attach?
a. A
c. T
b. C
d. U

____

15. You have a building toy set consisting of parts that can be connected together. You are going to use it to
model a piece of DNA. You have decided that each part of DNA will be represented by a different type of
toy piece. You have chosen the following four pieces so far: adenine = large red cube; guanine = large
green cube, thymine = small orange cube; cytosine = small blue cube. How many other types of pieces do
you need to represent the remaining parts of a section of DNA?
a. 0
c. 2
b. 1
d. 4

____

____

____

____

16. What DNA sequence would be opposite the template DNA that reads ATTGACCAT
a. TUUCTGGTU
c. TAACTGGTA
b. UAACUGGUA
d. TAACTGGUA
17. Where does the process of transcription occur in a eukaryotic cell?
a. ribosome
c. cytoplasm
b. nucleus
d. golgi body
18. What types of macromolecules aid the processes of replication and transcription?
a. lipids
c. ATP
b. carbohydrates
d. enzymes
19. If the DNA codon is CTA, what would the t-RNA anticodon be?
a. CUA
c. CTA
b. GAU
d. CUT

Figure 12-4

____

20. Which of the following is a possible codon for Leucine?


a. UUU
c. AUU
b. CUC
d. UCG

Completion
Complete each statement.
21. Changes to a proteins amino acid sequence can change its ____________, as in the example of a
substitution in hemoglobin.

Short Answer
22. Describe the process of replication.
23. What is the difference between a codon and an anticodon?
24. Why is tRNA important in translation?

Figure 12-4

25. Use the genetic code (Figure 12-4) to find the start codon in this mRNA sequence and write the sequence of
amino acids this mRNA would translate into. READ THE QUESTION CAREFULLY!
CUGACGAUGCUCAACGGCAUAUAACGCGAG

Problem
26. In Figure 12-5, use the letter P to label all of the phosphate groups. Use an S to label all the sugar
molecules. For labeling the nitrogen bases, use a T for thymine and a C for cytosine. Guanine and adenine
have been filled in for you. Circle and label a codon. Circle and label a nucleotide.

Figure 12-5

DNA, RNA & Protein Synthesis Web Practice


Answer Section
MULTIPLE CHOICE
1. ANS: D
Skin cells are somatic cells, so the mutation is not passed on to the persons offspring.
Feedback
A
B
C
D

Are you picking the least likely event?


Think about the difference between body cells and germ cells.
Did you consider all types of mutations?
That's correct!

PTS: 1
NAT: LS_2c
2. ANS: B

DIF: Bloom's Level B


STA: III.3.3
TOP: 12-11

REF: 349

Nucleotides are the subunits of nucleic acids like DNA. DNA coils around histone proteins to form
chromosomes, which are contained in the nucleus of a cell.
Feedback
A
B
C
D

Chromosomes are in the nucleus.


That's correct!
Check page 329.
What is a chromosome made of?

PTS: 1
NAT: LS_1c
3. ANS: C

DIF: Bloom's Level B


TOP: 12-3

REF: 329 | 332

The process of translation takes place at the ribosomes.


Feedback
A
B
C
D

This process happens after messenger RNA leaves the nucleus.


Where does messenger RNA go when it leaves the nucleus?
That's correct!
Chromosomes are made up of DNA and proteins.

PTS: 1
NAT: LS_1c
4. ANS: B

DIF: Bloom's Level C


TOP: 12-6

REF: 338

A tRNA molecule carries a specific amino acid corresponding to the anticodon of that tRNA molecule.
Feedback
A
B
C

What is the definition of a gene?


That's correct!
You're on the right track, but the anticodon is located somewhere else on this molecule.

DNA does not have uracil as one of its bases.

PTS: 1
NAT: LS_1c
5. ANS: A

DIF: Bloom's Level C


TOP: 12-6

REF: 338

Translation is the process by which the mRNA template is used to form polypeptides.
Feedback
A
B
C
D

That's correct!
Page 334 shows replication.
Check the definition of monoploidy.
Is any DNA involved in the pictured process?

PTS: 1
NAT: LS_1c
6. ANS: A

DIF: Bloom's Level B


TOP: 12-6

REF: 338

The mRNA template and the tRNA molecule are the only RNA structures. I is an anticodon composed of
nucleotide bases, III is a polypeptide, and V is an amino acid.
Feedback
A
B
C
D

That's correct!
Only one of these is made of RNA.
What is an anticodon?
These are related to each other, but they are not made of RNA.

PTS: 1
NAT: LS_1c
7. ANS: B

DIF: Bloom's Level C


TOP: 12-6

REF: 336 | 338

mRNA is formed from the template strand of DNA, and it carries the code from the nucleus to the
ribosomes.
Feedback
A
B
C
D

Does DNA leave the nucleus?


That's correct!
tRNA carries amino acids.
Look at page 336.

PTS: 1
NAT: LS_1c
8. ANS: A

DIF: Bloom's Level B


TOP: 12-6

REF: 336

DNA is the genetic material that replicates and is passed along when a cell divides. DNA controls the
production of enzymes and other proteins.
Feedback
A
B
C
D

That's correct!
Does mRNA replicate?
tRNA carries amino acids.
Check page 333 for clues.

PTS: 1
NAT: LS_1c
9. ANS: B

DIF: Bloom's Level D


STA: III.3.2
TOP: 12-1

REF: 326333

The number and identities of the bases in the two sequences are the same except for the substitution of an
adenine molecule for a thymine.
Feedback
A
B
C
D

A frameshift mutation changes the number of bases in the sequence.


That's correct!
Do the two sequences contain the same number of bases?
Check page 346 for the definition of a deletion.

PTS: 1
DIF:
NAT: LS_2a | LS_2c
10. ANS: B

Bloom's Level A
STA: III.3.3

REF: 345
TOP: 12-11

Deleting a nucleotide causes a frameshift mutation, since the codons following the deletion will code for
different amino acids than the original sequence.
Feedback
A
B
C
D

Check the definition of a point mutation on page 345.


That's correct!
How do you know what effects the mutation has on the whole organism?
A protein is simply a polypeptide, or chain of amino acids.

PTS: 1
DIF:
NAT: LS_2a | LS_2c
11. ANS: C

Bloom's Level A
STA: III.3.3

REF: 346
TOP: 12-11

Since the reading frame is shifted one place, all amino acids after the deletion will be different from the
original sequence.
Feedback
A
B
C
D

Protein function is determined by the sequence of amino acids in the protein.


Look closely at the codons that follow the mutation.
That's correct!
Do you see a stop codon?

PTS: 1
DIF:
NAT: LS_2a | LS_2c
12. ANS: A

Bloom's Level B
STA: III.3.3

REF: 346
TOP: 12-11

According to base-pairing rules, the number of purine bases formed must match the number of pyrimidine
bases in the parent sequence.
Feedback
A
B
C
D

That's correct!
Does uracil occur in DNA?
Count the number of purine bases.
Review base pairing rules on page 329.

PTS: 1
NAT: LS_2a
13. ANS: B

DIF: Bloom's Level E


STA: III.3.1
TOP: 12-2

REF: 329330 | 333

The only chemical that will prevent bacterial replication without interfering with eukaryotic replication is
one that cannot enter the eukaryotic nucleus.
Feedback
A
B
C
D

Does DNA contain uracil?


That's correct!
Both bacteria and eukaryotic cells have cytoplasm.
Bacterial chromosomes don't have histones.

PTS: 1
NAT: IS_1e
14. ANS: D

DIF: Bloom's Level E


TOP: 12-3

REF: 335

The mRNA strand is being transcribed from the DNA in a right-to-left order. The corresponding base pair
to adenine is uracil in RNA.
Feedback
A
B
C
D

Is the mRNA being formed from left-to-right or from right-to-left?


Review base pairing on page 329.
You're on the right track.
That's correct!

PTS: 1
DIF:
NAT: LS_1c | LS_2a
15. ANS: C

Bloom's Level D
TOP: 12-7

REF: 337

The only pieces still needed represent a sugar and a phosphatethe order of those pieces determines the
direction of the strand.
Feedback
A
B
C
D

16.
17.
18.
19.
20.

A nucleotide is made of one phosphate, one sugar, and one base.


A sugar and a phosphate group are two different molecules.
That's correct!
What is the difference between the 3-prime strand and the 5-prime strand?

PTS:
NAT:
ANS:
ANS:
ANS:
ANS:
ANS:

COMPLETION

1
LS_2a
C
B
D
A
B

DIF:
TOP:
PTS:
PTS:
PTS:
PTS:
PTS:

Bloom's Level D
12-2
1
1
1
1
1

REF: 331

21. ANS:
shape/function/stability
Even a single change in the amino acid sequence can change how the protein folds.

PTS: 1
NAT: LS_2c

DIF: Bloom's Level B


STA: III.3.3
TOP: 12-11

REF: 347

SHORT ANSWER
22. ANS:
First, DNA helicase unwinds and separates the double-stranded DNA molecule like a zipper unzipping.
The weak hydrogen bonds between the complementary nucleotides break and the two DNA strands
separate. Then free nucleotides attach to the exposed nucleotides of the DNA strands, catalyzed by DNA
polymerase. From one DNA molecule there are now two DNA molecules. Each one of the DNA
molecules has a strand from the original DNA and one new strand.

PTS: 1
NAT: LS_2a
23. ANS:

DIF: Bloom's Level B


STA: III.3.1
TOP: 12-4

REF: 333335

A codon is a three-base code for a specific amino acid. An anticodon is a tRNA triplet of nitrogen bases that
bonds to a complementary codon on the messenger RNA.

PTS: 1
NAT: LS_1c
24. ANS:

DIF: Bloom's Level B


TOP: 12-6

REF: 338

Transfer RNA brings an amino acid to the ribosome in the process of translating the mRNA code into a
protein.

PTS: 1
NAT: LS_1c
25. ANS:

DIF: Bloom's Level A


TOP: 12-6

REF: 338

CUG ACG AUG CUC AAC GGC AUA UAA CGC GAG
Met Leu Asn Gly Ile STOP

PTS: 1
NAT: LS_1c
PROBLEM
26. ANS:
See Solution 12-6.

DIF: Bloom's Level C


TOP: 12-8

REF: 328

PTS: 1
DIF:
NAT: LS_1c | LS_2a

Bloom's Level C
TOP: 12-2

REF: 329330 | 338