Effect of storage methods on coagulant activity and quality of cardoon extracts

Journal of the Science of Food & Agriculture
Volume 88 Issue 8 , Pages 1301 - 1485 (June 2008)
Research Articles
Effect of lyophilisation, refrigerated storage and frozen storage on the coagulant activity and microbiological
quality of Cynara cardunculus L. extracts (p 1301-1306)
Luis Tejada, Montserrat Vioque, Rafael Gmez, Jos Fernndez-Salguero
Published Online: Apr 14 2008 4:50AM
DOI: 10.1002/jsfa.3193
Polycyclic aromatic hydrocarbons in smoked cheese (p 1307-1317)
Marie Suchanov, Jana Haj lov, Monika Tomaniov, Vladimr Kocourek, Lubo
Published Online: Mar 28 2008 5:08AM
DOI: 10.1002/jsfa.3198
Babi ka
Effect of inulin and Lactobacillus paracasei on sensory and instrumental texture properties of functional
chocolate mousse (p 1318-1324)
Hassa R Cardarelli, Lina C Aragon-Alegro, Joo H A Alegro, Inar A de Castro, Susana M I Saad
DOI: 10.1002/jsfa.3208
Fruit quality and volatile fraction of Pink Lady apple trees in response to rootstock vigor and partial rootzone
drying (p 1325-1334)
Riccardo Lo Bianco, Vittorio Farina, Giuseppe Avellone, Felice Filizzola, Pasquale Agozzino
DOI: 10.1002/jsfa.3210
A chemometric study of pesto sauce appearance and of its relation to pigment concentration (p 1335-1343)
Francesca Masino, Giorgia Foca, Alessandro Ulrici, Laura Arru, Andrea Antonelli
DOI: 10.1002/jsfa.3221
Effect of electrical stimulation, delayed chilling and post-mortem aging on the quality of M. longissimus dorsi
and M. biceps femoris of grass-fed steers (p 1344-1353)
Regina H Razminowicz, Michael Kreuzer, Martin RL Scheeder
DOI: 10.1002/jsfa.3222
Predictability of price of tea from sensory assessments and biochemical information using data-mining
techniques (p 1354-1362)
Sanjoy K Paul
DOI: 10.1002/jsfa.3223
Comparison of volatile emissions from undamaged and mechanically damaged almonds (p 1363-1368)
John J Beck, Bradley S Higbee, Glory B Merrill, James N Roitman
DOI: 10.1002/jsfa.3224
Cadmium accumulation in Agaricusblazei Murrill (p 1369-1375)
Jian Cheng Huang, Kai Ben Li, Ying Rui Yu, Hanwen Wu, De Li Liu
DOI: 10.1002/jsfa.3225
Comparison of postmortem changes in goose cardiac and breast muscles at 5 C (p 1376-1379)
Sy-Shyan Ho, Chia-Ying Lin, Rong-Ghi R. Chou
DOI: 10.1002/jsfa.3227
Effects of pressure toasting on in situ degradability and intestinal protein and protein-free organic matter
digestibility of rapeseed (p 1380-1384)
Arash Azarfar, Claudio S Ferreira, Jacob O Goelema, Antonius FB Van der Poel
DOI: 10.1002/jsfa.3228
Rye bread reduces plasma cholesterol levels in hypercholesterolaemic pigs when compared to wheat at similar
dietary fibre level (p 1385-1393)
Helle Nygaard Lrke, Camilla Pedersen, Marianne Asp Mortensen, Peter Kappel Theil, Torben Larsen, Knud Erik Bach
Knudsen
DOI: 10.1002/jsfa.3229
Color stability of frozen whole tilapia exposed to pre-mortem treatment with carbon monoxide (p 1394-1399)
David Mantilla, Hordur G Kristinsson, Murat O Balaban, W Steven Otwell, Frank A Chapman, Sivakumar Raghavan
DOI: 10.1002/jsfa.3230
Antioxidant activity of the ethanolic extract from the bark of Chamaecyparis obtusa var. formosana (p 14001405)
Palanisamy Marimuthu, Chi-Lin Wu, Hui-Ting Chang, Shang-Tzen Chang
DOI: 10.1002/jsfa.3231
Cloning of an alfalfa polyphenol oxidase gene and evaluation of its potential in preventing postharvest protein
degradation (p 1406-1414)
Michael L Sullivan, Ronald D Hatfield, Deborah A Samac
DOI: 10.1002/jsfa.3232
Application of surface response methodology to optimize hydrolysis of wheat gluten and characterization of
selected hydrolysate fractions (p 1415-1422)
Silvina R Drago, Rolando J Gonzlez, Mara C An
DOI: 10.1002/jsfa.3233
High-performance liquid chromatography procedure for the determination of flavor enhancers in consumer
chocolate products and artificial flavors (p 1423-1430)
Charles H Risner, Melissa J Kiser
DOI: 10.1002/jsfa.3234
Fatty acid and fat-soluble antioxidant concentrations in milk from high- and low-input conventional and organic
systems: seasonal variation (p 1431-1441)
Gillian Butler, Jacob H Nielsen, Tina Slots, Chris Seal, Mick D Eyre, Roy Sanderson, Carlo Leifert
DOI: 10.1002/jsfa.3235
Protective effect of polyphenol-rich extract prepared from Malaysian cocoa (Theobroma cacao) on glucose
levels and lipid profiles in streptozotocin-induced diabetic rats (p 1442-1447)
Azli Mohd Mokhtar Ruzaidi, Maleyki Mhd Jalil Abbe, Ismail Amin, Abdul Ghani Nawalyah, Hamid Muhajir
DOI: 10.1002/jsfa.3236
Nutritional and sensory qualities of raw meat and cooked brine-injected turkey breast as affected by dietary
enrichment with docosahexaenoic acid (DHA) and vitamin E (p 1448-1454)
Carmen Srraga, M Dolors Gurdia, Isabel Daz, Luis Guerrero, Jacint Arnau
DOI: 10.1002/jsfa.3238
Microbiological hazards involved in fresh-cut lettuce processing (p 1455-1463)
Adriano G da Cruz, Sergio A Cenci, Maria Cristina A Maia
DOI: 10.1002/jsfa.3240
Effects of nitrogen application on malt modification and dimethyl sulfide precursor production in two Japanese
barley cultivars (p 1464-1471)
Masahito Nanamori, Ryoichi Kanatani, Makoto Kihara, Kazumitsu Kawahara, Katsuhiro Hayashi, Toshihiro Watanabe,
Takuro Shinano, Mitsuru Osaki
DOI: 10.1002/jsfa.3241
Basis for the new challenges of growing broccoli for health in hydroponics (p 1472-1481)
Diego A Moreno, Carmen Lpez-Berenguer, M. Carmen Martnez-Ballesta, Micaela Carvajal, Cristina Garca-Viguera
DOI: 10.1002/jsfa.3244
Short Communications
Anti-sickling potential of Aloe vera extract (p 1482-1485)
Agunna Everest Ejele, Pascal Chukwuemeka Njoku
DOI: 10.1002/jsfa.3036
Journal of the Science of Food and Agriculture
J Sci Food Agric 88:13011306 (2008)
Effect of lyophilisation, refrigerated

storage and frozen storage on the
coagulant activity and microbiological quality
of Cynara cardunculus L. extracts
2
2
Luis Tejada,1 Montserrat Vioque,2 Rafael Gomez

and Jose Fernandez-Salguero
1 Universidad
y Nutricion
Campus de Los Jeronimos
Catolica
San Antonio, Departamento de Tecnologa de la Alimentacion
s/n 30107,
Guadalupe, Murcia, Spain
2 Universidad de Cordoba,
Departamento de Bromatologa y Tecnologa de los Alimentos, Campus de Rabanales, Edificio Darwin, 14014,
Cordoba,
Spain
Abstract
BACKGROUND: Cheese-makers have traditionally kept vegetable coagulants refrigerated until use, even though
little was known of their microbiological quality or coagulant activity during storage. This study aimed to assess
the efficacy of lyophilisation, refrigerated storage and frozen storage of fresh vegetable extract as a means of
standardising coagulant activity in terms of coagulation times, pH and microbiological quality.
RESULTS: Neither the pH nor the coagulation time of lyophilised extracts was significantly modified during
1 year; however, changes were observed following frozen storage, and more notable following refrigerated storage.
Lyophilisation of aqueous extracts prompted the destruction of most micro-organisms; low counts initially noted
for total mesophiles, lactic acid bacteria and yeasts disappeared during the first few days of storage, due to low
water activity. There was a generalised decrease in micro-organism counts during frozen storage. Refrigeration
was found to be unsuitable for storing of cardoon extract; an increase of roughly 2 log unit counts was recorded in
total mesophile, lactic acid bacteria, yeast and mould counts after 1 year of refrigerated storage.
CONCLUSION: Refrigerated storage cannot be considered a suitable method for prolonged conservation of
aqueous cardoon extract. Both lyophilisation and frozen storage of aqueous extracts proved ideal for prolonged
storage of vegetable coagulant. Lyophilisation additionally had certain advantages over frozen storage.
2008 Society of Chemical Industry
Keywords: Cynara cardunculus; powdered vegetable coagulant (PVC); refrigerated vegetable coagulant (RVC);
frozen vegetable coagulant (FVC)
INTRODUCTION
Written references dating back to Columella (De Re
Rustica, c. 50 BC) testify to the use of cardoon extracts
of the genus Cynara L. (Cynara cardunculus, Cynara
humilis, Cynara scolymus) as a milk coagulant in cheesemaking in Mediterranean countries. The increasing
consumption of cheese and the decreasing number of
calves slaughtered in the 1970s led to an increase in
the price of calf rennet, to a shortage in chymosin-rich
rennet, and to a search for alternative milk coagulants.
More recently, this shortage was exacerbated by the
outbreak of BSE in dairy cattle, which was diagnosed
in 1986 in the United Kingdom and later spread to
the rest of Europe and elsewhere. Moreover, the use
of animal rennet may be limited for religious reasons,
diet (e.g. vegetarianism) or opposition to genetically
engineered foods.1
Enzymes present in the flowers of Cynara cardunculus (cyprosins) are used in the production of some
traditional Spanish and Portuguese cheeses, replacing calf rennet. These cheeses are currently enjoying
considerable commercial success, and are increasingly
prized by the consumer for their soft, creamy texture
and their characteristic exquisite flavour, sometimes
slightly bitter but piquant.2
Three proteinases of C. cardunculus L. have been
isolated, purified, and partially characterised in terms
of activity.3 They are thus acidic proteinases belonging
to the aspartic proteinase group called cynarases or
cyprosins.4 Also, two additional aspartic proteinases
were isolated from fresh stigmas of a standard variety
of C. cardunculus grown from selected seeds, namely,
cardosins A and B.5,6
y Nutricion
Campus de Los Jeronimos
Correspondence to: Luis Tejada, Universidad Catolica

San Antonio, Departamento de Tecnologa de la Alimentacion
s/n 30107, Guadalupe, Murcia, Spain
E-mail: ltejada@pdi.ucam.edu
(Received 5 March 2007; revised version received 6 September 2007; accepted 10 September 2007)
Published online 14 April 2008; DOI: 10.1002/jsfa.3193
2008 Society of Chemical Industry. J Sci Food Agric 00225142/2008/$30.00
L Tejada et al.
Crude vegetable coagulant obtained from directly

harvested cardoons does not meet the minimum health
and hygiene standards required of any food ingredient,
because it displays high total viable germ counts, as
well as elevated concentrations of enterobacteria.7,8
In addition to this lack of food safety, use of this
natural vegetable coagulant cannot be standardised,
since flowers gathered by different pickers may well
include other cardoon species such as Centaurea
calcitrapa, Silybum marianum and Cynara humilis,
whose coagulant activity is either non-existent or very
different from that displayed by Cynara cardunculus.9
Cardoon flowers are picked and dried in the open air;
they are not specially treated, and may thus contain
impurities and fragments of brownish bracts. Other
authors10 found that drying the flowers affected the
coagulant activity of the extract obtained. There are
no standardised conditions for cutting and drying.
The coagulant activity of cardoon extracts varies
considerably as a function of variety, stage of maturity,
part of the flower used, drying time and final moisture
content.11,12 Experiments have shown that protease
mRNA increases as the flower matures, and is not
present in leaves, suggesting that gene expression is
tissue specific.4
In an attempt to surmount these obstacles, a powdered concentrate has been obtained from coagulant
enzymes from cardoon flowers.13 Lyophilisation of
the aqueous extract provides a form of vegetable
coagulant which is more manageable, stable and
hygienic, and also more readily standardised. Use
of a hygienic, standardised coagulant facilitates the
production of more uniform batches of cheese, thus
offering improved health guarantees and greater commercial and financial viability, without modifying biochemical parameters or losing the distinctive sensory
features characteristic of this type of cheese.14,15 Ewes
milk cheese has also been produced using recombinant cyprosin obtained by genetic engineering; no
significant differences have been observed between
this cheese and those made with fresh vegetable
coagulant.16
Cheese-makers have traditionally kept vegetable
coagulants under refrigeration until use, even though
little was known of their microbiological quality or
coagulant activity during storage. It has lately been
suggested that frozen storage may be suitable for
crude vegetable coagulants; this has the advantage
of allowing storage of large volumes of extract under
appropriate hygienic conditions, and ensuring both
the conservation of organoleptic features and stable
coagulant activity, thus enabling the production of
more uniform batches of cheese. There is thus a
need for research into the effect of refrigerated
and frozen storage on the coagulant activity and
microbiology quality of aqueous extracts obtained
from the C. cardunculus cardoon flower.
This study aimed to assess the efficacy of
lyophilisation, refrigerated storage and frozen storage
of fresh vegetable extract as a means of standardising
1302
coagulant activity in terms of coagulation times, pH

and microbiological quality.
MATERIALS AND METHODS

Preparation of aqueous and lyophilised cardoon
extracts
Five aqueous extracts were prepared from each of five
batches of Cynara cardunculus picked in various parts
of southern Spain, following a procedure previously
reported.17 We used 70 g of dry flowers, ground in a
mortar and soaked in water (1 L) at room temperature
for 24 h and filtered through a cheese cloth. Each of
the five extracts was divided into three parts. One
third of the extracts was lyophilised (prior freezing at
between 25 C and 35 C; lyophilisation at 413 Pa
for 2436 h), using a Thermo Savant Freeze Dryer
Modulyo D, as described previously.14
The lyophilised extract was then stored in sealed
containers at ambient temperature and away from the
light. Another second part of aqueous extracts was
placed in Eppendorf tubes and kept in refrigerated
storage at 4 C. The remaining third was placed in
Eppendorf tubes and kept stored in a chest freezer at
30 C.
Analytical determinations
The pH of the extract was measured by direct reading,
placing the combined pH electrode in the crude
aqueous extract. Lyophilised extracts were first diluted
in distilled water to 2.18% (percentage of powdered
vegetable extract obtained after lyophilisation).
Clotting activity was measured using the Berridge
method;18 the substrate for clotting tests was skimmed
milk powder reconstituted just before use (12%, w/v)
in CaCl2 10 mmol L1 solution, pH being adjusted
to 6.40 with 10% lactic acid or 0.1 mol L1 NaOH.
Activity was expressed in coagulant units (CU). The
CU unit is defined as the amount of extract required
to clot 10 mL of milk in 100 s.19
Counts were performed in the lyophilised coagulant
and in the refrigerated and frozen aqueous extracts
for aerobic bacteria, enterobacteria, lactic acid bacteria (LAB), yeast and mould, SalmonellaShigella,
Listeria, Clostridium perfringens and enterococci, using
procedures described previously.7 Coliforms were also
analysed on violet red bile agar (VRBA) incubated at
37 C for 24 h.20 For microbiological testing of crude
aqueous extract, 10 mL of the macerate obtained was
homogenised in 90 mL sterile 0.1% peptone water.
Frozen extracts were thawed in refrigerated conditions for 8 h. For lyophilised coagulant extracts, 0.2 g
of extract (equivalent to 10 mL of aqueous extract)
was dissolved in 100 mL peptone water.
Testing was performed in duplicate at 0, 30, 60, 90,
140, 200, 270 and 360 days storage.
Statistical analysis
Statistical analysis of results was performed using the
SPSS ver. 13 software package. A two-factor ANOVA
J Sci Food Agric 88:13011306 (2008)
DOI: 10.1002/jsfa
Effects of storage on quality of C. cardunculus L. extracts
was performed for storage method and storage time;

Fishers least significant difference (LSD) test was
used to compare differences between means; principal
component analysis (PCA) were performed for storage
time and type of coagulant.
RESULTS AND DISCUSSION

Effect of lyophilisation, refrigerated storage and
frozen storage on pH, and clotting activities
Mean values for pH and clotting activity of crude
aqueous extract from C. cardunculus flowers kept in
refrigerated and frozen storage, and for lyophilised
extract, are shown in Figs 1 and 2, respectively.
The changes of pH in refrigerated extracts were
highly irregular: values declined sharply at 60 days,
gradually rising thereafter to the end of the study
period (Fig. 1). A strong positive correlation was
noted between pH and most micro-organism counts,
suggesting that increased counts might be attributable
to an accumulation of alkaline substances arising
from microbial metabolism. Coagulant activity rose
progressively from the start of storage to 140 days.
Other authors21 report similar behaviour for the
clotting activity of C. cardunculus extracts kept in
refrigerated storage for 30 days. However, a marked
decline was recorded from 140 days to the end of
Figure 1. Mean values for pH of crude aqueous extract from

C. cardunculus flowers kept in refrigerated ( ) and frozen storage
( ), and for lyophilised extract ().
Figure 2. Mean values for clotting activity of crude aqueous extract

from C. cardunculus flowers kept in refrigerated () and frozen
storage ( ), and for lyophilised extract ().
J Sci Food Agric 88:13011306 (2008)

DOI: 10.1002/jsfa
the study (Fig. 2). This was probably due to elevated

microbial activity, mainly involving lactic flora (peak
counts were observed at 200 days, Table 1), to the loss
of enzyme activity of cynarases, or to the increase of
the pH. Milk pH is reported to have a great influence
on the gelation properties of plant coagulants,22,23 and
the clotting activity of chymosin appears to be more
influenced than that of cyprosins by milk pH.24
Frozen storage of aqueous extracts prompted a
slight increase in coagulant activity from 30 to
140 days. However, a significant decline was noted
from 200 days onwards with respect to other storage
periods, probably due to changes in cyprosin activity
(Fig. 2). Other authors9 noted an increase of 40 s
in clotting time for aqueous C. cardunculus extract
kept in frozen storage for 415 days. There was also
a significant increase in pH values (P < 0.05) after
140 days frozen storage in the present study.
As shown in Figs 1 and 2, lyophilisation prompted
no significant change (P < 0.05) in pH or clotting
activity after 1 years storage at ambient temperature.
This means that the lyophilisation does not affect
the cyprosin activity, without modifying its coagulant activity, becoming an adequate method for the
preservation of vegetable extracts used in the cheese
production.
Effect of lyophilisation, refrigerated storage and
frozen storage on microbiological quality
Table 1 shows average values and standard deviations
of the counts (log cfu g1 ) for the main microbial
groups in crude aqueous extracts of C. cardunculus
kept in refrigerated storage and frozen storage, and for
lyophilised extracts at 0, 30, 60, 90, 140, 200, 270
and 360 days. The results of multiple comparison of
individualised means by the LSD test are also shown.
Neither SalmonellaShigella nor Listeria were detected
in any of the extracts studied (25 mL of sample). There
was also no evidence of enterococci (10 mL of sample)
or Clostridium in any of the samples. Similar findings
were reported by Fernandez-Salguero et al.7
Time and storage method prompted a highly significant (P < 0.001) change in mean total viable,
enterobacteria, coliform, lactic acid bacteria (LAB),
yeast and mould counts. Lyophilisation of aqueous
extracts destroyed micro-organisms due to the conditions reached during processing and to low water
activity in lyophilised extracts (0.2000.275; unpublished data). Lyophilised extracts therefore comply
with the microbiological limits set down in the general
Standard regarding identity and purity for coagulants and other milk-clotting enzymes intended for
the domestic market.25 (P < 0.01).
During refrigerated storage, mean total viable,
enterobacteria, coliform, LAB, yeast and mould
counts increased significantly (P < 0.001). There
was thus a deterioration in the hygiene quality of
extracts; total mesophile, LAB, yeast and mould
counts increased by roughly 2 log units after 1 year
of refrigerated storage. Enterobacteria and coliform
1303
1304
RVC
FVC
PVC
RVC
FVC
PVC
RVC
FVC
PVC
RVC
FVC
PVC
RVC
FVC
PVC
RVC
FVC
PVC
Total viable
aj
5.80
5.80 0.76g
0a
5.21 0.52de
5.21 0.52de
0a
5.13 0.63def
5.13 0.63def
0a
4.43 0.51h
4.43 0.51h
0a
5.57 0.45g
5.57 0.45g
0a
1.29 0.14cd
1.29 0.14cd
0a
0.00g
0
6.59
4.19 0.93f
0a
6.75 0.43g
2.88 0.93c
0a
6.52 0.23g
2.26 0.88b
0a
4.59 0.49h
3.94 0.57g
0a
6.66 0.41h
4.74 0.40f
0a
1.62 0.38de
1.23 0.23cd
0a
0.79h
30
6.86
3.61 0.77e
0a
6.48 0.85fg
2.22 0.86c
0a
5.90 0.82efg
1.48 0.76b
0a
4.85 0.65h
3.20 0.71f
0a
6.88 0.34hi
3.97 0.39e
0a
2.11 0.31e
0.94 0.14c
0a
0.90h
60
2.79 1.04d
0a
4.65 1.77d
0.05 0.16a
0a
3.34 2.49c
0.21 0.45a
0a
5.89 0.81i
1.24 1.11d
0a
7.21 0.31j
1.42 0.69c
0a
3.15 0.46h
0.22 0.37ab
0a
0a
5.40 1.35de
1.25 0.73b
0a
4.86 1.47d
0.63 0.57a
0a
5.64 0.75i
2.10 0.92e
0a
7.03 0.23i
2.86 0.77d
0a
2.71 0.51f
0.54 0.48b
0a
7.60 0.8i
140
3.22 0.83de
7.41 0.83i
90
Means of the same microbial groups for each type storage in the same row without a common superscript are different (P < 0.05).
Moulds
Yeasts
Lactic acid bacteria
Coliforms
Enterobacteria
Batch
Variable
Days of storage
7.81
2.02 1.10c
0a
5.23 2.00de
0a
0a
5.01 1.98de
0a
0a
7.46 0.29j
0.71 0.92c
0a
7.21 0.11j
0.34 0.45b
0a
3.03 0.61h
0a
0a
0.46i
200
7.63
0.38 0.39b
0a
5.68 1.93ef
0a
0a
5.78 1.70efg
0a
0a
7.41 0.47j
0.13 0.28ab
0a
7.21 0.41j
0a
0a
2.94 0.88gh
0a
0a
0.39i
270
7.52 0.46i
0a
0a
5.67 2.10ef
0a
0a
5.87 1.63fg
0a
0a
7.30 0.39j
0.00 0.00a
0a
7.15 0.42j
0a
0a
2.93 1.02g
0a
0a
360
Table 1. Effect of refrigerated storage (RVC), frozen storage (FVC) and lyophilisation (PVC) on different microbial groups (log10 cfu g1 ; mean values and standard deviation) of C. cardunculus aqueous extracts
L Tejada et al.
J Sci Food Agric 88:13011306 (2008)

DOI: 10.1002/jsfa
Effects of storage on quality of C. cardunculus L. extracts
counts displayed more irregular behaviour, with

moderate increases at the end of the study period
(log 5.7 cfu g1 and log 5.9 cfu g1 , respectively). The
accumulation of substances deriving from microbial
metabolism, the changes of the pH values and
the marked proteolytic activity of proteases may
have triggered the destruction of enterobacteria and
coliforms between 60 and 140 days refrigerated
storage. Total mesophile and enterobacteria counts
at the end of storage were very similar to those
reported by other authors;7 by contrast, LAB, yeast
and mould counts were appreciably higher. Thus,
unless a microbial inhibitor is added, aqueous extracts
kept in refrigerated storage do not meet the health and
hygiene requirements laid down in current Spanish
legislation.25
In extracts kept in frozen storage (Table 1), a
generalised decline was observed in micro-organism
counts over the storage period; this was particularly
marked for enterobacteria and coliforms, which were
not detected from 200 days onwards. Total viable
and LAB showed the greatest resistance to freezing:
counts were still obtained at 270 days (log 0.4 cfu
g1 and log 0.1 cfu g1 , respectively). In contrast to
traditional assumptions, a number of authors have
reported that freezing kills certain micro-organisms,
particularly pathogens; freezing is thus recommended
as a suitable way of improving food safety.26 28
Although freezing may reduce the numbers of some
pathogens, it may not eliminate the all pathogens. In
addition, all pathogens are not equally susceptible to
freezing. Microbial destruction appears to be more
intense below pH 6 (the pH of extracts ranged from
4.77 to 5.01; Fig. 1) and in Gram-negative bacteria.
The death of micro-organisms due to freezing may be
ascribed to a number of factors, including extracellular
and intracellular ice formation, the concentration
of extracellular and intracellular solutes, and low
temperatures.28 This may account for the greater
destruction of enterobacteria and coliforms than of
LAB. Prolonged freezing of crude aqueous extract
of Cynara cardunculus improves their microbiological
quality; even after 200 days storage, the extract still
meets legal requirements.
There was no change in the general appearance of
lyophilised or frozen extracts over the storage period.
By contrast, after 60 days storage refrigerated extracts
began to show unmistakable signs of deterioration,
which became more acute over time including lumps,
deposits, opacity and anomalous odours.
Multivariate analysis
PCA was performed to determine principal components. The selection criterion factor was based on an
eigenvalue greater than 1, without any type of rotation
of the factor matrix. Figure 3 shows the variables studied in the plain defined by the first two components,
and the correlation between them. Two components
were extracted that accounted for 96.2% of total
variance. The first component, which accounted for
J Sci Food Agric 88:13011306 (2008)
DOI: 10.1002/jsfa
76.45% of total variance, was positively correlated

with all variables. Microbial counts were the variables
with the greatest differentiating effect. The second
component accounted for 18.77% of total variance,
was positively correlated with pH and clotting activity
and correlated negatively with microbial counts.
Figure 4 shows factor scores obtained by regression
in two-dimensional space. The first component
perfectly differentiated the three storage forms, and
differentiated length of the storage period for frozen
extracts over which microbial counts declined. The
second component length of the storage period for
refrigerated extracts, over which microbial counts rose.
Storage time was never differentiated for lyophilised
extract, indicating that the extract was not affected by
storage time.
Figure 3. Representation of variables studied in the plane defined by

the first two principal components.
Figure 4. Principal component analysis. Representation of extracts in

terms of two components detected.
1305
L Tejada et al.
CONCLUSIONS
Refrigerated storage cannot be considered a suitable
method for prolonged conservation of aqueous
cardoon extract, since it prompts an increase in
clotting time and microbial contamination, as well as
causing some deterioration of organoleptic properties.
Both lyophilisation and frozen storage of aqueous
extracts proved ideal for prolonged storage of
vegetable coagulant. Lyophilisation additionally had
certain advantages over frozen storage. Firstly, after
45 months frozen storage, clotting activity declined,
whereas the clotting activity of lyophilised extract
remained constant over at least 1 year. Secondly,
viable micro-organisms virtually disappeared following
lyophilisation, thus meeting current regulations,
whilst micro-organism counts were still detected in
frozen extracts after 79 months storage. Thirdly,
lyophilised extracts require less space for storage and
transport, occupying roughly 2% of the space occupied
by frozen aqueous extracts. Since lyophilisation does
not affect proteinase conformation or modify clotting
power, it is a suitable method for storing the vegetable
extracts used in cheese-making.
ACKNOWLEDGEMENTS
The authors are grateful to the Spanish Ministry of
Science and Technology for funding through Project
AGL2002-02752.
10
11
12
13
14
15
16
17
18
19
REFERENCES
1 Roseiro LB, Barbosa M, Ames JM and Wilbey RA, Cheesemaking with vegetable coagulants the use of Cynara L. for
the production of ovine milk cheeses. Int J Dairy Technol
56:7685 (2003).
2 Tejada L, Gomez
R and Fernandez-Salguero J, Sensory characteristics of ewe milk cheese made with three types of coagulant:
calf rennet, powdered vegetable coagulant and crude aqueous
extract from Cynara cardunculus. J Food Quality 30:91103
(2007).
3 Heimgartner U, Pietrzak M, Geertsen R, Brodelius P, Da
Silva Figueiredo AC and Pais MS, Purification and partial
characterization of milk clotting proteases from flowers of
Cynara cardunculus. Phytochemistry 29:14051410 (1990).
4 Cordeiro MC, Pais MS and Brodelius PE, Tissue-specific
expression of multiple forms of cyprosin (aspartic proteinase)
in flowers of Cynara cardunculus L. Physiol Plantarum
92:645653 (1994).
5 Verissimo P, Esteves C, Faro C and Pires EV, The vegetable
rennet on Cynara cardunculus L. contains two proteinases
with chymosin and pepsin-like specificities. Biotechnol Lett
17:621626 (1995).
6 Ramalho-Santos M, Verssimo P, Faro C and Pires EV, Action
on bovine s -casein of cardosins A and B, aspartic proteinases
from the flowers of the cardoon Cynara cardunculus L. Biochim
Biophys Acta 297:8389 (1996).
7 Fernandez-Salguero J, Sanchez E, Gomez

R, Mata C, Vioque M
and Tejada L, A preliminary study of microbiological quality of cardoons of genus Cynara, L. used in manufacture of traditional cheese. Milchwissenschaft 54:688690
(1999).
8 Gomez
R, Sanchez E, Vioque M, Ferreira J, Tejada L and
Fernandez-Salguero J, Microbiological characteristics of
ewes milk cheese manufactured using aqueous extracts of
1306
20
21
22
23
24
25
26
27
28
flowers from various species of cardoon Cynara L. Milchwissenschaft 56:1619 (2001).

E and Fernandez-Salguero J, Influencia de algunos
Sanjuan
por cuajo vegetal
factores sobre el tiempo de coagulacion
(Cynara sp.). Aliment Equ Tecnol 13:6973 (1994).
Martins APL, de Vasconcelos MMP and de Sousa RB, Thistle
(Cynara cardunculus L) flower as a coagulant agent for
cheesemaking Short characterization. Lait 76:473477
(1996).
Macedo A, Malcata FX and Oliveira JC, The technology,
chemistry and microbiology of Serra cheese. A Review.
J Dairy Sci 76:17251739 (1993).
Vioque M and Gomez

R, Coagulantes vegetales empleados en
de quesos tradicionales. Caracterizacion
de
la fabricacion
algunas variedades. Aliment Equ Tecnol 24:4855 (2005).
Fernandez-Salguero J, Gomez
R, Tejada L and Vioque M, A
powdered vegetable coagulant, procedure for its preparation
and their applications to cheese-making. Spanish Patent
2166719 (2003).
Fernandez-Salguero J, Tejada L and Gomez

R, Use of powdered vegetable coagulant in the manufacture of ewes milk
cheeses. J Sci Food Agr 82:464468 (2002).
Tejada L and Fernandez-Salguero J, Chemical and microbiological characteristics of ewe milk cheese (Los Pedroches)
made with a powdered vegetable coagulant or calf rennet.
Ital J Food Sci 15:125131 (2003).
Fernandez-Salguero J, Prados F, Calixto F, Vioque M, Sampaio P and Tejada L, Use of recombinant cyprosin in the manufacture of ewes milk cheese. J Agr Food Chem 51:74267430
(2003).
Fernandez-Salguero J and Sanjuan E, Influence of vegetable
and animal rennet on proteolysis during ripening in ewes
milk cheese. Food Chem 64:177183 (1999).
International Dairy Federation. Determination milk clotting
time of milk to which milk clotting enzyme has been added.
Document 110 A: Appendix A. IDF, Brussels (1987).
International Dairy Federation. Bovine rennets: Determination
of total milk-clotting activity. IDF (FIL-IDF Standard no.
157A). IDF, Brussels (1997).
American Public Health Association, Standard Methods for
the Examination of Dairy Products, 15th edition. APHA,
Washington, DC (1984).
Tavaria FK, Sousa MJ and Malcata FX. Storage and lyophilization effects of extracts of Cynara cardunculus on the degradation of ovine and caprine caseins. Food Chem 72:7988
(2001).
Esteves CL, Lucey JA, Wang T and Pires EM, Effect of pH on
the gelation properties of skim milk gels made from plant
coagulants and chymosin. J Dairy Sci 86:25582567 (2003).
Zhao J, Chen SJ and Agboola S. Characterisation of milkclotting properties of Australian cardoon (Cynara cardunculus
L.) extracts and comparison with commercial coagulants on
different substrates. Milchwissenschaft 59:5963 (2004).
Silva SV, Allmere T, Malcata FX and Andren A, Comparative
studies on the gelling properties of cardosins extracted
from Cynara cardunculus and chymosin on cows skim milk.
Int Dairy J 13:559564 (2003).
Ministerio de Sanidad y Consumo. Orden del 14 de enero de
1988. Norma general de identidad y pureza para el cuajo
y otros enzimas coagulantes de leche destinados al mercado
interior. BOE n 17, de 20.01.1988 (1988).
Tejada L, Sanchez E, Gomez

R, Vioque M and FernandezSalguero J, Effect of freezing and frozen storage on chemical
and microbiological characteristics in ewes milk cheese.
J Food Sci 67:126129 (2002).
Vasudevan P, Marek P, Daigle S, Hoagland T and Venkitanarayanan KS, Effect of chilling and freezing on survival
of Vibrio parahaemolyticus on fish fillets. J Food Safety
22:209217 (2002).
Archer DL, Freezing: an underutilized food safety technology?
Int J Food Microbiol 90:127138 (2004).
J Sci Food Agric 88:13011306 (2008)

DOI: 10.1002/jsfa
J Sci Food Agric 88:13071317 (2008)
Polycyclic aromatic
hydrocarbons in smoked cheese
1 Jana Hajslov
a,
1 Monika Tomaniova,
1 Vladimr Kocourek1 and
Marie Suchanova,
2
Lubos Babicka
1 Institute
of Chemical Technology, Prague, Faculty of Food and Biochemical Technology, Department of Food Chemistry and Analysis,
Technicka 3, 166 28 Prague 6, Czech Republic
2 Czech University of Life Sciences, Prague, Faculty of Agrobiology, Food and Natural Resources, Department of Quality of Agricultural
Products, Kamyck
a 129, 165 21 Prague 6 - Suchdol
Abstract
BACKGROUND: Polycyclic aromatic hydrocarbons (PAHs) represent a group of organic compounds containing
two or more aromatic rings. Their control in the human food chain is required due to the mutagenic and
carcinogenic potential, exhibited in vertebrates. In the present study, the occurrence of PAHs in 36 cheeses
smoked by various processes was investigated.
RESULTS: PAH concentrations (sum of 15 US EPA PAHs) found in samples smoked under controlled industrial
conditions were at level 0.11 g kg1 , whereas in home-made cheeses, the PAH content was up to 10 times higher.
A similar trend was observed for B[a]P, a marker compound representing carcinogenic PAHs. While its levels in
commercial products prepared by controlled smoking technologies were close to the limit of quantification (0.03 g
kg1 ); in household samples, the B[a]P content ranged from 0.6 to 0.9 g kg1 . Significantly higher amounts of
PAHs (up to three to six times) were found in surface layers as compared to internal parts of cheese.
CONCLUSION: Although smoked cheese is a popular food, only several papers have focused on PAH levels in
these products. This paper evaluates the contribution of different smoking technologies to PAH contamination of
several cheeses and thus can help in a risk assessment associated with their consumption. Moreover, the study
shows the concentration ratios of selected PAHs, from which the type of smoking technology can be indicated.
The results obtained in this study also supported the suggestion of the EU Scientific Committee on Food to use
benzo[a]pyrene as an indicator of the occurrence of higher-molecular mass PAHs.
Keywords: Polycyclic aromatic hydrocarbons (PAHs); smoked cheese; HPLC/FLD
INTRODUCTION
Polycyclic aromatic hydrocarbons (PAHs) constitute
a large group of organic compounds containing two or
more fused aromatic rings. PAHs occur widely in the
human environment, mainly as a result of incomplete
combustion of organic matter; for example, it may
take place during fires, in various industrial processes
or in car engines. In toxicological studies, several PAHs
have been demonstrated to be carcinogenic, and therefore they represent an issue of a great concern to health.
Although air or drinking water may be responsible
for some human exposure, the highest PAHs intake
is typically associated with the occurrence of these
hazardous chemicals in diet. Contamination of food
crops by PAHs may be caused by environmental
emissions; nevertheless, fairly high levels in some food
commodities may be due to the processing practices
such as drying and/or smoking. Also grilling, roasting
and frying are high temperature processes potentially

generating food-borne PAHs. For instance, in
barbecued meat the total PAHs were found to be
present at levels up to 164 g kg1 with benzo[a]pyrene
(B[a]P) being present at levels as high as 30 g kg1 ,
whereas in uncooked foods the average background
values are usually in the range of 101 to 1 g kg1 .1
The health risk associated with dietary PAHs has
recently been evaluated by Scientific Committee
on Food (SCF).2 In European Commission (EC)
recommendations3 the member states have been
advised to monitor 15 SCF priority PAHs together
with one additional PAH benzo[c]fluorene, recommended by the JECFA (Joint FAO/WHO Expert
Committee on Food Additives).4 The maximum levels
recently set by EC on B[a]P for smoked meat products
is 5 g kg1 ; however, no limits are given for smoked
cheese products at present.5
a,
Institute of Chemical Technology, Prague, Faculty of Food and Biochemical Technology, Department of Food Chemistry
Correspondence to: Jana Hajslov
and Analysis, Technicka 3, 166 28 Prague 6, Czech Republic
E-mail: jana.hajslova@vscht.cz
Contract/grant sponsor: Ministry of Education, Youth and Sports of the Czech Republic; contract/grant number: MSM 6046137305
(Received 13 June 2007; revised version received 26 November 2007; accepted 26 November 2007)
Published online 28 March 2008; DOI: 10.1002/jsfa.3198
M Suchanova et al.
Although smoked cheese is a popular delicacy in

many countries, only a few papers published in recent
two decades have focussed on PAH levels in these
products.6 12 As a widely used contamination marker,
carcinogenic B[a]P was determined in all the studies.
In addition to B[a]P, another 15 US EPA PAHs were
determined by Bosset et al.11 in a set of 67 smoked
cheeses. Pagliuca et al.9 reported on the occurrence
of six heavy US EPA PAHs (B[a]P, B[a]A, Chr,
B[b]F, B[k]F). The broadest spectrum of PAHs in
smoked cheeses manufactured from various types
of milk (cows, sheeps, goats) was monitored by
Guillen and Sopelana.6,7 Besides the classic analysis
of PAHs in this smoked commodity, there is also the
possibility of their head-space determination being
examined. Until now, none of studies were concerned
with determination of the whole range of SCF PAHs
in smoked cheese.
As regards analytical strategy, several approaches
for PAH isolation from smoked cheeses have been
described in literature: (1) alkaline treatment followed by liquidliquid extraction,6,10,11 (2) extraction
of freeze dried cheese by organic solvent supported
by sonication12 or (3) pressurised liquid extraction (PLE).8 Clean-up of crude extracts can be
performed using either SPE cartriges6,9 11 or gel
permeation chromatography (GPC).8 For the final
identification/quantification step, high-performance
liquid chromatography with fluorescence detection
(HPLCFLD)8 12 or gas chromatography with mass
spectrometric detection (GCMS)6,7 are mostly used.
An overview of methods employed for analysis of
PAHs in food and environmental matrices and their
relevance to control new EU regulations has been critically discussed in the recent paper by Wenzl et al.13
In the current study, a wide range of smoked cheeses
available at a Czech market has been examined for
15 PAHs. The aim was to assess the increase (if
any) of these hazardous chemicals due to the various
(industrial and household) smoking processes. In
order to document the distribution of PAHs within
the cheese, surface parts were analysed separately.
EXPERIMENTAL
Cheese samples
Altogether, 36 smoked cheese samples were analysed
in this study. Twenty-four samples of smoked
cheeses were obtained from three Czech cheese
producers (in the following text identified as cheese
companies A, B and C) and three samples from
small, private manufacturers (home-made products,
D) employing traditional household practices. Nine
samples were obtained from a common market (E).
Smoking conditions and other cheese characteristics
are summarised in Table 1. An unsmoked cheese
product (Edam) obtained from the common market
was used as the reference sample. When supplied,
samples were stored at 18 C.
1308
Chemicals and materials

The standard mixture NIST 1647d of 16 priority
PAHs: naphthalene (Naph), acenaphthene (Ace), fluorene (Fln), phenanthrene (Phe), anthracene (Ant),
fluoranthene (Flt), pyrene (Pyr), benz[a]anthracene
(B[a]A), chrysene (Chr), benzo[b]fluoranthene
(B[b]F), benzo[k]fluoranthene (B[k]F), benzo[a]
pyrene (B[a]P), dibenz[a,h]anthracene (DB[ah]A),
benzo[g,h,i]perylene (B[ghi]P) and indeno[1,2,3cd]pyrene (I[1,2,3-cd]P) dissolved in acetonitrile was
supplied by National Institute of Standards and
Technology (NIST, Gaithesburg, MD, USA). Working standard solutions (concentrations in the range
0.0160 ng mL1 ) were prepared in acetonitrile and
stored at 4 C.
Before use, all glassware was washed with detergent,
rinsed with distilled water and acetone and then dried
at 220 C.
Chloroform and acetone (analytical reagent grade,
Lach-Ner, Neratovice, Czech Republic) were redistilled in glass before use. Acetonitrile (gradient grade,
for chromatography), n-hexane (for organic trace analysis), dichloromethane (for gas chromatography; all
Merck, Darmstadt, Germany), were used as supplied.
Deionised water was obtained from Milli-Q water
purification system (Millipore, Bedford, MA, USA).
Anhydrous sodium sulfate (Penta Praha, Prague,
Czech Republic) was dried at 500 C for 5 h and
then stored in a tightly capped glass bottle.
Equipment
A laboratory blender (Waring blender, 38BL-40;
Waring Commercial, New Hartford, CT, USA) and
stainless-steel grater were used for homogenisation
of cheese samples. A Soxhlet extractor with cellulose
extraction thimbles (Filtrak, Niederschlag, Germany)
was used for sample extraction.
An automated gel permeation chromatography
(GPC) system consisting of 305 MASTER pump,
fraction collector, automatic regulator of loop 231
XLI, microcomputer (software 731 PC via RS232C),
dilutor 401C (GILSON, Paris, France) and stainless
steel column 500 8 mm i.d. packed with gel BioBeads S-X3, 200400 mesh (Bio-Rad Laboratories,
Philadelphia, USA) was used for clean-up of extracts.
A vacuum evaporator (Buchi

Rotavapor R-114 a
Waterbath B-480, Postfach, Switzerland) was used for
concentration of extracts. A high-performance liquid
chromatographic system (HPLC), Hewlett-Packard
1100 Series, composed of a quarternary pump system
with a degasser, an autosampler, a column thermostat,
a fluorescence detector (FLD) (Hewlett Packard,
Palo, Alto, CA, USA) and a Supelcosil LC-PAH
(250 mm 4.6 mm i.d.; 5 m) column with the guard
column Supelcosil LC-18 (20 mm 4.0 mm i.d.,
5 m; Supelco, Bellefonte, USA) was used for analysis
of sample extracts.
Analytical procedure
PAH analysis consisted of following steps.
J Sci Food Agric 88:13071317 (2008)
DOI: 10.1002/jsfa
J Sci Food Agric 88:13071317 (2008)

DOI: 10.1002/jsfa
Akawi
Smoked processed cheese

Jadel
Koliba-mini
Parenica
Gazdovsky ostepek
Koliba
Tizian
E29
E30
E31
E32
E33
E34
E35
E36
N/A, not applied; , information not available.
Edam
E28
Klobucik
D27
E (Samples collected from

retailed market)
Gazdovsky ostepek
D25D26
D (Household products)
Mozzarella
Edam
Jadel
Smoke processed cheese
Smoke processed cheese
Tizian
Edam
B (Industrial)
C (Industrial)
Sample
code
Cheese
commercial
name
A1A3
A4A15
A16A17
A18
A19
B20
C21C24
A (Industrial)
Category
of cheese
producer/source
Cheese
type
White cheese with smoked

flavour
Processed
Steamed
Semi-hard, steamed
Semi-hard, steamed
Semi-hard
Semi-hard, steamed
Processed
Semi-hard
Semi-hard
Semi-hard
Pasta filata
Semi-hard
White, brined, steamed
Processed, bar-shaped
Processed, bar-shaped
Processed
Semi-hard
Table 1. Overview and characteristics of the smoked cheese samples examined in this study
100
100
200
115
330
125
90
280
260
500
600
2000
1500
200
1500
1500
90
2000
Weight
of single
cheese
package (g)
43/44
54/37
48/27
48/25
50/40
50/40
45/24
43/38
56/45
50/40
50/40
50/42
56/45
54/40
42/45
42/45
45/45
57/45
Dry
matter/fat
content
(%, w/w)
N/A
4 h at 32 C, beech wood
N/A
N/A
45 h at 3638 C, smoke
from beech wood
4 h, cherry tree and beech
wood
4 h, cherry tree and beech
wood
Smoking
conditions
Liquid smoke flavouring
Friction smoke technique

Dry smoke flavouring powder
Liquid smoke flavouring
Smoke generation from
burning wood industrial
burning wood household
burning wood household
Type of
smoking
process
PAHs is smoked cheese
1309
M Suchanova et al.
Soxhlet extraction
Ten grams of homogenised cheese sample obtained
by homogenisation either of the whole sample or the
cheese rind (represented typically by 12 mm thick
surface layer) was thoroughly mixed with 25 g of
anhydrous sodium sulfate in a grinding mortar, then
placed into the extraction cellulose thimble, covered
with glass wool and inserted into the Soxhlet extractor.
Prior to use, the thimbles were pre-extracted for
2 h with an extraction solvent to minimise PAHs
procedure blank. Extraction was carried out with
170 mL of hexanedichloromethane mixture (1:1, v/v)
for 7 h (10 cycles h1 ). The Soxhlet apparatus was
covered with an aluminium foil to avoid access of
daylight (to prevent the risk of photodegradation).
The obtained extract was then carefully evaporated by
rotary vacuum evaporator at 40 C, just to dryness,
and the residue was quantitatively transferred into a
10-mL volumetric flask by chloroform.
Liquidliquid extraction of liquid smoke flavouring agent
For extraction of liquid smoke flavouring agent,
modified procedure published by Pagliuca et al.9
was used. Briefly, 10 g of sample were extracted
with 100 mL of n-hexane in a separatory funnel;
after 4 min of vigorous shaking the mixture was
allowed to separate into two phases. The lower
phase was re-extracted with 50 mL of n-hexane. This
process was repeated twice. The three combined
hexane extracts were concentrated by a rotary vacuum
evaporator at 40 C, just to dryness, and the residue
quantitatively transferred into a 10-mL volumetric
flask by chloroform.
Clean-up of crude extracts
The clean-up step (separation of lipids) was carried
out by GPC employing gel Bio-Beads S-X3. The
flow rate of the mobile phase (chloroform) was set at
0.6 mL min1 ; and the volume of sample injected onto
the GPC column was 1 mL. After discarding the first
15.5 mL of eluate, the next 15.5 mL were collected.
The purified extracts were subsequently subjected to
concentration by rotary vacuum evaporator at 40 C
just to dryness. The residue obtained after evaporation
of solvent was dissolved in 0.5 mL of acetonitrile before
the HPLCFLD determinative step; this solution was
then transferred into a 2 mL amber vial.
Identification and quantification
The HPLCFLD was carried out under the following
conditions: The high performance liquid chromatography with fluorescence detection (HPLC-FLD) was
carried out under the following conditions: gradient
elution (0 min55% acetonitrile + 45% water, 20
min100% acetonitrile, 32 min100% acetonitrile),
mobile phase flow rate 1 ml min-1, injection volume 20 l, column temperature 35 C, FLD settings
are shown in Table 2. The external standard calibration method based on peak heights was used for
quantification of PAHs.
1310
Table 2. FLD settings for PAH detection
Target PAHs
Time window
(min)
Excitation
wavelength
(nm)
Emission
wavelength
(nm)
7.210.7
10.711.1
11.112.2
12.213.2
13.214.3
14.316.0
16.019.3
19.323.6
23.625.8
25.830.5
216
240
248
248
232
236
270
250
295
248
336
320
368
404
448
384
388
430
405
484
Naph
Ace, Fln
Phe
Ant
Flt
Pyr
B[a]A, Chr
B[b]F, B[k]F, B[a]P
DB[ah]A, B[ghi]P
I[1,2,3-cd]P
Performance characteristics and quality assurance

Since suitable matrices with certified concentrations
of PAHs (CRM) are not available commercially;
spiked samples at 0.5, 5 and 10 g kg1 were analysed
within the validation study (50 L, 50 L and 100 L
of standard solution containing 100, 1000 and
1000 ng mL1 of PAHs, respectively, were carefully
incorporated into 10 g of cheese before extraction).
Recovery was obtained as a slope of dependence of the
measured values and the theoretical values (multiplied
by 100). Repeatability of method was calculated as
a relative standard deviation (RSD, %) from six
parallel measurements of cheese with native PAHs
content (0.145 g kg1 ). The overview of selected
performance characteristics is shown in Table 3.

In the first phase of our experiments, we had to decide
on a choice of optimal analytical strategy enabling
Table 3. Method performance characteristics obtained in validation
study
PAH
Naph
Ace
Fln
Phe
Ant
Flt
Pyr
B[a]A
Chr
B[b]F
B[k]F
B[a]P
DB[ah]A
B[ghi]P
I[1,2,3-cd]P
Recovery
(%)
Repeatability
(%)
Limit of detection
(g kg1 )
52
68
57
94
86
87
73
71
72
70
75
71
78
70
94
34
16
20
9
11
11
11
13
14
14
14
14
15
12
16
0.05
0.05
0.05
0.25
0.09
0.23
0.12
0.05
0.04
0.08
0.01
0.01
0.02
0.04
0.07
Repeatability was calculated as a relative standard deviation (RSD,

%), n = 6.
Limit of quantification (LOQ) was not lower than three times of LOD
level.
J Sci Food Agric 88:13071317 (2008)

DOI: 10.1002/jsfa
B[a]A

LU
240
260
2000
18
20
B[ghi]P
B[b]F
Fln
255
DB[ah]A
Naph
250
2500
22
24
1500
I[1,2,3-cd]P
245
3000
B[a]P
B[k]F
Chr
3500
Ant
Phe
LU
26
28
min
Zoom
I[1,2,3-cd]P
1000
B[ghi]P
DB[ah]A
B[a]P
B[k]F
B[b]F
B[a]A
Chr
Pyr
Flt
Ace
500
500
0
10
15
20
25
min
Figure 1. Example of an HPLCFLD sample chromatogram obtained by analysis of sample D26 (PAH concentrations: 0.0360 g kg1 ).
to obtain accurate data even at low concentration

levels of PAHs potentially occurring in smoked
cheese. Considering our experience regarding limits
of detection attainable either by GCMS employing
unit resolution mass analyser (quadrupole operated in
selected ion monitoring mode) or HPLCFLD, the
latter technique was the preferred option, because
of a better potential to detect even very low
levels of carcinogenic PAHs. An example of cheese
sample chromatogram obtained by this procedure is
demonstrated in Fig. 1.
Regarding the key analyte, B[a]P, all the quality assurance criteria required by EU Directive
2005/10/EC14 were met. Also, for most of the other
PAHs (three-, four- and five-ring) the recoveries and
repeatability of measurements were in a satisfactory
range (7094% and 916%, respectively). On the
other hand, lower recoveries (5268%) and poor
RSDs (1634%) were obtained for the most volatile
PAHs such as Naph, Ace and Fln (see Table 3). It

should be noted that these species are not a health
concern in terms of carcinogenicity and therefore no
modification of analytical procedure was carried out
since it would have increased both time and labour
demands. According to the data, results for Naph,
Ace and Acy are semi-quantitative.
PAH levels (in g kg1 ; values not corrected for
recovery) determined in the set of examined cheeses
are shown in Table 4. The sum of 12 PAHs (sum
of all target PAHs except volatiles, Naph, Ace and
Fln) and the sum of eight carcinogenic PAHs (B[a]A,
Chr, B[b]F, B[k]F, B[a]P, DB[ah]A, B[ghi]P and
I[1,2,3-cd]P) are presented in Fig. 2. The background
level obtained for the unsmoked reference sample,
relevant to the latter PAH group, is shown in this
figure as a dashed line. In commercial smoked cheese
samples (categories A, B, C and E in Table 1), the
concentrations of 12 PAHs and eight carcinogenic
Sum of 12 PAHs (g kg-1)
6
100
Sum of 12 PAHs
Sum of carcinogenic PAHs

5
80
4
60
Background level (sum of 8 carcinogenic PAHs)

40
20
1
0
E28
E29
E30
E31
E32
E33
E34
E35
E36
D25
D26
D27
C21
C22
C23
C24
B20
A1
A2
A3
A4
A5
A6
A7
A8
A9
A10
A11
A12
A13
A14
A15
A16
A17
A18
A19
Sum of carcinogenic PAHs (g kg-1)
120
Cheese code
Figure 2. PAH content in smoked cheeses (homogenate taken for analysis was prepared from the whole cheese sample, including cheese rind), for
cheese codes see Table 1. Sum of 12 PAHs = sum of Phe, Ant, Flt, Pyr, B[a]A, Chr, B[b]F, B[k]F, B[a]P, DB[ah]A, B[ghi]P and I[1,2,3-cd]P. Sum of
eight carcinogenic PAHs = sum of B[a]A, Chr, B[b]F, B[k]F, B[a]P, DB[ah]A, B[ghi]P and I[1,2,3-cd]P.
J Sci Food Agric 88:13071317 (2008)

DOI: 10.1002/jsfa
1311
M Suchanova et al.
Table 4. PAH content in smoked cheese and reference unsmoked sample (mean value, n = 3) (g kg1 )
Cheese
code
A1
A2
A3
A4
A5
A6
A7
A8
A9
A10
A11
A12
A13
A14
A15
A16
A17
A18
A19
B20
C21
C22
C23
C24
D25
D26
D27
E28
E29
E30
E31
E32
E33
E34
E35
E36
Reference
Naph
5.1
2.7
13
40
55
14
58
9.8
28
34
35
56
9.2
9.0
53
27
7.3
7.6
15
10
22
29
14
19
36
60
24
14
0.5
8.5
0.2
2.1
0.2
3.8
3.9
1.2
12.9
Ace
1.3
1.1
1.4
5.1
5.2
2.6
4.1
2.4
4.0
2.2
3.9
4.6
1.9
1.8
5.0
2.4
2.0
0.4
0.5
0.5
3.0
1.9
7.2
4.1
4.1
7.1
5.4
1.3
0.4
0.9
2.1
0.2
0.4
2.7
1.2
0.4
0.6
Fln
5.0
5.0
5.7
19
17
11
12
11
17
7
15
14
8.7
8.6
15
8.6
11
0.9
0.9
0.8
6.7
3.9
17
8.6
18
30
27
4.9
1.0
1.8
16
1.1
1.1
12
11
1.2
1.1
Phe
12
8.5
7.7
20
15
17
14
15
19
11
19
15
12
12
18
12
15
4.8
1.6
2.6
19
11
34
26
40
63
60
9.0
4.4
5.0
39
7.0
5.3
18
17
3.9
4.1
Ant
Flt
Pyr
B[a]A
Chr
1.4
1.5
0.8
1.2
1.3
0.8
1.3
1.1
0.6
3.8
2.2
1.6
4.0
1.7
1.0
2.6
2.2
1.3
2.7
1.7
0.9
2.6
2.2
1.4
3.8
2.2
1.3
1.6
1.2
0.6
3.6
2.5
1.4
2.8
2.1
1.2
2.0
1.7
0.9
1.9
1.7
0.9
3.4
2.1
1.2
1.8
1.6
0.8
3.1
1.4
0.9
0.1a 0.3a 0.4
0.1a ND 0.4
0.1a 0.3a 0.4
3.2
1.9
1.7
2.2
1.2
1.1
10.4
3.6
3.4
5.6
2.5
2.3
14
7.1
7.1
23
12
11
23
12
12
1.2
0.7
0.5
0.3
0.3a 0.3
0.3
0.3a 0.2a
8.1
5.7
3.7
0.1a 1.1
0.7
0.1a 0.9
0.5
4.7
4.3
2.8
5.6
3.6
3.1
0.3
0.1a 0.2a
0.1a 0.1a 0.4
0.08a
0.06a
0.08a
0.08a
0.08a
0.08a
0.2
0.08a
0.08a
0.2
0.08a
0.2
0.08a
0.08a
0.08a
0.08a
0.08a
0.08a
ND
ND
0.08a
0.08a
0.08a
0.2
0.2
1.3
1.9
2.2
0.08a
ND
ND
0.3
0.08a
ND
0.6
0.9
ND
ND
0.1
0.06a
0.2
0.1
0.3
0.2
0.2
0.2
0.1
0.3
0.3
0.1
0.1
0.2
0.2
0.2
ND
ND
ND
0.06a
0.06a
0.1
0.1
0.8
1.2
1.3
0.06a
0.06a
0.06a
0.3
0.06a
0.06a
0.5
0.7
0.1
ND
B[b]F
ND
ND
ND
ND
n.d
n.d
ND
ND
0.04a
ND
ND
ND
ND
ND
ND
ND
ND
0.04a
0.04a
0.1a
ND
ND
ND
0.04a
0.3
0.4
0.5
0.04a
0.04a
ND
0.04a
0.04a
ND
0.1a
0.2
0.04a
0.04a
B[k]F
B[a]P
DB[ah]A
B[ghi]P
I[1,2,3-cd]P
ND
ND
ND
0.01a
0.01a
0.02a
ND
0.01a
0.02a
ND
0.02a
ND
ND
ND
ND
ND
ND
0.01a
0.01a
0.06
ND
ND
0.02
0.04
0.2
0.3
0.3
0.01a
0.01a
0.01a
0.06
0.3
0.01a
0.07
0.1
0.02a
0.01a
0.02a
ND
ND
ND
ND
0.01a
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
0.01a
ND
ND
ND
0.01a
0.01a
0.03a
0.01a
ND
ND
ND
0.01a
ND
ND
0.01a
0.03a
0.01a
ND
ND
ND
ND
0.02a
ND
0.02a
ND
0.02a
0.02a
ND
0.06a
0.06a
0.06a
0.06a
0.02a
0.02a
ND
0.06a
0.06a
0.1
ND
ND
ND
ND
0.6
0.8
0.7
0.1
0.06a
0.06a
0.1
0.06a
0.06a
0.1
0.3
0.1
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
0.1a
ND
ND
ND
ND
0.3
0.5
0.5
ND
ND
ND
0.1a
ND
ND
ND
0.3
ND
ND
0.01a
0.01a
0.03
0.03
0.05
0.03
0.05
0.05
0.01a
0.04
0.04
0.01a
0.01a
0.03
0.02a
0.02a
0.01a
0.01a
0.07
0.01a
0.01a
0.03
0.02a
0.6
0.6
0.9
0.04
0.03
0.02a
0.1
0.03
0.02a
0.2
0.5
0.05
0.01a
Estimate; analyte concentration below limit of quantification.

ND, not detected (for LODs see Table 3).
PAHs ranged from 2.3 to 57 g kg1 and from

0.1 to 2.7 g kg1 , respectively. Significantly higher
PAHs levels were found in home-made samples
(category D), where the content of total PAHs was
in the range from 73 to 114 g kg1 and the sum of
carcinogenic PAHs ranged from 3.9 to 6.2 g kg1 .
Higher contamination of these traditional cheeses
was obviously due to deposition of PAHs-containing
solid particles on their surface. Purification of the
smoke generated within industrial process under
carefully controlled conditions allows only flavouring
compound to reach the cheese, while most of
hazardous products of wood pyrolysis are removed.
In addition to examination of the whole cheese, the
rinds of selected samples were analysed separately
(Table 5). The PAH levels (g kg1 ; values not
corrected for recovery) detected in these surface layers
(thickness, 12 mm) were three to six times higher
1312
(Fig. 3) regardless the type of smoking technique

used. Fairly lower overall contamination, similar to
background levels detected in unsmoked cheese was
found in edible parts of samples that were aromatised
either by dry smoke flavouring powder (A18) or under
the controlled pyrolysis conditions (A19). Both these
bar-shaped cheeses were coated by inedible waxy
coating, which accumulated most of PAHs (i.e. served
as contamination barrier). Compared to edible rind
(cheese layer under the waxy coating), the PAHs
content in the coating was 14 times higher; the
sum of carcinogenic PAHs even 18 times higher. In
summary, according to our estimates, in most cases,
removing the 12 mm surface layer from the smoked
cheese eliminates approximately 50100% of PAHs
detectable in particular product. These observations
are in agreement with results of study published by
Guillen and Sopelana.6
J Sci Food Agric 88:13071317 (2008)
DOI: 10.1002/jsfa
J Sci Food Agric 88:13071317 (2008)

DOI: 10.1002/jsfa
184
9.2
16
346
326
98
167
249
60
6.8
10
137
1.2
3.3
39
84
ND
A4A15
A19
B20
C21C22
C2324
D25
D26
D27
E28
E29
E30
E31
E32
E33
E34
E35
E36
24
0.8
1.0
46
61
23
28
43
12
1.3
0.4
23
0.8
1.2
15
9.2
0.2
Ace
101
1.7
2.7
267
164
108
137
191
62
3.4
2.2
120
3.3
3.9
83
66
1.6
Fln
93
6.5
8.1
148
204
244
371
339
65
20
16
270
17
20
99
85
16
Phe
28
0.3
0.4
42
58
88
132
119
17
1.0
0.7
61
0.5
0.6
29
25
0.6
Ant
Estimate; analyte concentration below limit of quantification.

ND, not detected.
A4A15; C21C22; C2324: pooled samples.
Naph
Cheese
code
Table 5. PAH content in smoked cheese rind samples (g kg1 )
8.8
1.2
0.7
11
24
47
77
51
6.5
3.4
3.1
37
2.8
3.0
19
18
3.0
Flt
7.2
1.1
0.9
8.0
23
44
75
48
5.0
3.2
2.4
25
2.3
2.4
14
14
2.4
Pyr
0.9
0.2
0.08a
0.8
1.3
8.6
14
9.4
0.5
0.2
0.3
3.0
0.2
0.2
3.6
4.4
0.2
B[a]A
0.4
0.06a
0.1
0.5
0.8
5.0
7.9
5.5
0.3
0.2
0.4
1.2
0.2
0.2
2.3
2.8
0.2
Chr
0.2
0.1a
0.04a
0.1a
0.3
1.7
2.9
2.1
0.2
0.1a
0.2
0.6
0.1a
0.1a
0.7
1.0
0.2
B[b]F
0.1
0.01a
0.01a
0.08
0.1
1.04
1.6
1.3
0.1
0.08
0.1
0.3
0.06
0.07
0.4
0.7
0.09
B[k]F
0.3
0.07
0.01a
0.2
0.5
3.4
5.4
4.4
0.3
0.4
0.1
0.7
0.08
0.08
1.2
2.1
0.1
B[a]P
0.06
0.06
0.01a
ND
ND
0.09
0.1
0.1
0.03a
ND
ND
ND
ND
ND
ND
ND
0.03a
DB[ah]A
0.1
0.1
ND
0.3
0.4
3.0
4.2
3.7
0.3
0.2
0.2
0.5
0.2
0.2
0.5
0.9
0.1
B[ghi]P
0.2
0.1a
ND
ND
0.4
1.9
2.8
2.5
ND
ND
ND
ND
ND
ND
ND
0.9
ND
I[1,2,3-cd]P
713
13
7
89
89
10
10
10
6
13
20
16
13
10
10
20
11
Rind portion taken

for analysis (% of cheese
total weight)
1313
45
40
700
Sum of 12 PAHs
Sum of carcinogenic PAHs
35
600
30
500
25
400
20
300
15
Rind E36
Rind E35
Rind E34
Rind E33
Rind E32
Rind E31
Rind E30
Rind E29
Rind E28
Rind D27
Rind D26
Rind D25
0
Rind C23-24
0
Rind C21-C22
5
Rind B20
10
100
Rind A19 (edible part)
200
Rind A4-A15
Sum of 12 PAHs (g kg-1)
800
Sum of carcinogenic PAHs (g kg-1)
M Suchanova et al.
Cheese code
Figure 3. PAH content in smoked cheese rinds (pooled samples A4A15, C21C22 and C2324), for cheese codes see Table 1. Sum of 12 PAHs
= sum of Phe, Ant, Flt, Pyr, B[a]A, Chr, B[b]F, B[k]F, B[a]P, DB[ah]A, B[ghi]P and I[1,2,3-cd]P. Sum of eight carcinogenic PAHs = sum of B[a]A, Chr,
B[b]F, B[k]F, B[a]P, DB[ah]A, B[ghi]P and I[1,2,3-cd]P.
Table 6. Comparison of B[a]P levels found in different studies
B[a]P content
(g kg1 )
0.010.88
ND0.55
<0.13.8
<0.21.7
0.030.39
0.10.75
<0.14.2
ND0.91
Subject of study/
type of sample
Commercially and home-made
smoked cheeses
Rind of commercial smoked
cheeses
Home-made smoked cheeses
Effect of different smoking
conditions on B[a]P
Effect of different smoking
conditions incl.
smoke-flavoured and liquid
flavoured cheeses on PAHs
Investigation of different smoking
conditions on B[a]P
Investigation of different smoking
conditions on PAHs
Commercially smoked cheeses
Reference
This study
6
8
8
9
10
11
12
Considering for comparison the maximum level

5 g kg1 given in EC Regulation No 1881/20065 for
B[a]P in smoked meat, we classify the contamination
as low. As shown in Table 6, concentrations of B[a]P
documented in smoked cheese from the Czech market
were comparable to levels reported for similar products
by Guillen and Sopelana6 , Garcia Falcon et al.12
Anastazio et al.10 and Pagliuca et al.9 from Spanish
and Italian markets and even lower than reported
by Bosset et al.11 for Swiss cheeses and home-made
products from Slovakia examined by Michalski and
Germuska.8
Relative abundances of individual PAH groups,
when applying classification based on the number
of fused aromatic rings (see Table 7), varied largely
among examined cheeses, reflecting differences in
1314
smoking practices, as shown in Fig. 4. Regardless

the cheese type, 7090% of total 12 PAHs were
those with three aromatic rings: Phe and Ant (i.e.
more volatile PAHs). PAHs containing four rings
typically contributed to 1020% of the total PAH
content. In unsmoked cheeses and those smoked
under the industrial conditions (friction technique
and/or controlled wood burning) carcinogenic fiveand six-ring species accounted only for 0.10.2% of
PAH content. In home-smoked products and cheeses
aromatised by liquid and/or dry smoke flavourings,
the contribution of this hazardous fraction to the
overall contamination was 212%. The analysis of
liquid smoke-flavouring agent, which was used for
sample B20 aromatisation, showed the presence of
a high total PAH concentration (182 g kg1 ), even
those carcinogenic (10 g kg1 ). PAH levels found in
the liquid smoke flavouring agent are very similar to
those published for liquid flavouring agents by Guillen
et al.15 but rather higher than those found by Pagliuca
et al.9 It should be noted that in spite of this relatively
high PAH content, only the background level was
found in the final cheese product (see Fig. 2).
Several authors in earlier studies concerned with
a similar topic reported on a correlation between
concentrations of Pyr and B[a]P in some matrices,
such as smoke flavourings,15,16 smoked cheese6,7 or
charbroiled hamburgers.17 Similarly, a relationship
between Phe/Pyr6,7 and Phe/B[a]P7 was investigated.
Table 7. PAH groups according to number of aromatic rings
Number of rings
2,3
4
5,6
PAH
Naph, Ace, Fln, Phe, Ant
Flt, Pyr, B[a]A, Chr
B[b]F, B[k]F, B[a]P, DB[ah]A, B[ghi]P,
I[1,2,3-cd]P
J Sci Food Agric 88:13071317 (2008)

DOI: 10.1002/jsfa
Dry smoke agent

Liquid smoke agent
Wood burning - household
Wood burning - industrial
Non-smoked
0
20
40
60
80
100
Relative PAHs abundance (%)

SUM of 3-ring PAHs
SUM of 4-ring PAHs
SUM of 5- and 6-ring PAHs
Figure 4. Relative abundances of individual PAH groups in tested cheeses. Data are aggregated based on the smoking technology.
Table 8. Ratios of selected PAH concentrations calculated for smoked cheese samples
PAH ratio
Smoking technology
Average
Median
Min.
Max.
Phe/Pyr
Unsmoked cheese
Friction smoke (A5A9; A11A12)
Wood burning industrial (C21C24)
Wood burning household (D25D27)
Liquid smoke (B20)
Dry smoke (A19)
11
14
11
6
7
4
10
14
11
6
7
4
8
11
10
5
12
15
11
6
Pyr/B[a]P
Unsmoked cheese
Liquid smoke (B20)
Dry smoke (A19)
Unsmoked cheese
Liquid smoke (B20)
Dry smoke (A19)
40
30
127
14
6
40
405
408
1359
79
37
160
40
30
114
13
410
382
1220
67
33
26
110
12
390
298
1117
67
45
35
170
18
431
510
1880
104
Phe/B[a]P
Samples with B[a]P content close to the limit of detection were discarded from the calculation.
According to Franklach and Warnatz,18 such relations typically should exist, since heavy PAHs are
derived through pyrosynthesis from the lighter PAHs
by addition of small units (i.e. acetylene or aryl radicals) what means that an increase of a precursor
group during the smoking is accompanied by originating of final reaction products at higher degree. This
observation could be useful for predicting the high
molecular PAH levels based on the concentrations of
lighter PAHs, whose determination is easier, due to
their higher concentrations usually presented in analysed matrices. Under these conditions, uncertainty of
measurement is lower and accuracy of data is better.
Table 8 shows concentration ratios of Phe and Pyr,
Pyr and B[a]P, and Phe and B[a]P found for each
group of cheeses (grouping based on the smoking procedure). In the case of the Phe/Pyr ratio, relatively
consistent results were obtained, both within the each
individual group and between the groups (with median
J Sci Food Agric 88:13071317 (2008)
DOI: 10.1002/jsfa
values in the range of 414), which is in a good agreement with values published by Guillen and Sopelana7
(2.412). On the other hand, as regards Pyr/B[a]P
and Phe/B[a]P concentration ratios, a distinct diversity
between individual cheese groups representing different smoking procedures was found. However, ratios
obtained within each group were relatively consistent,
at least in terms of orders of magnitude. These results
indicate that predicting the levels of high molecular
PAHs (typically carcinogenic) from the concentrations
of lighter PAHs is not a straightforward approach; nevertheless, it seems that availability of these ratios might
be useful to identify the type of smoking technology.
Similar strategy employing various PAHs ratios for
the identification of the emission sources responsible for environmental pollution was reported in some
studies.19,20
Recently, the EU Scientific Committee on Food
concluded, that B[a]P can be employed as an indicator
1315
M Suchanova et al.
Table 9. Correlations between B[a]P concentrations and other PAH
groups
PAH groups
Sum of 5- and 6-ring PAHs
Sum of 4-ring PAHs
Sum of 3-ring PAHs
Sum of 8 carcinogenic PAHs
Sum of 15 PAHs
Correlation coefficient
0.993
0.947
0.848
0.995
0.728
of occurrence and concentrations of higher-molecular

mass PAHs (from benzofluoranthenes upwards) in
food, whereas it cannot be used as an indicator
of lower-molecular mass PAHs.3 The possibility of
using this approach was demonstrated in a study by
Kazerouni et al.21 where the correlation coefficient
between concentrations of B[a]P and the sum of the
carcinogenic PAHs was 0.98, while it decreased to
0.87 when B[a]P and the total of 15 PAHs were
correlated.
Almost the same trend was obtained in our study.
A high correlation coefficient (0.995) was found
for B[a]P concentrations and the sum of eight
carcinogenic PAHs (Table 9), while the correlation
between B[a]P content and the total content of 15
PAHs was weaker (0.728).
CONCLUSIONS
In this study, we examined 36 cheese samples smoked
by various smoking technologies for the presence of
major PAHs. The conclusions based on generated data
can be summarised as follows.
Firstly, both the use of smoke flavourings and
smoking procedure achieved under industrial conditions (friction smoke and wood burning) led to only
slightly elevated PAH levels as compared to unsmoked
cheeses. Distinctly the highest PAH levels were determined in home-made smoked samples.
Secondly, the analysis of cheese rinds has shown
that the surface layers are three to six times more
contaminated by PAHs compared to the whole sample.
Their removal reduced the total PAH content by
approximately 50100%.
Thirdly, B[a]P concentrations in smoked cheese
strongly correlated with the sum of carcinogenic
PAHs, what confirmed the applicability of suggestion
of EU SCF to use this analyte as an indicator of the
carcinogenic higher-molecular PAH fraction.
Lastly, PAH profiles expressed as Pyr/B[a]P and
Phe/B[a]P concentration ratios differed according to
the smoking technology with the lowest values for
home-smoked and liquid smoke flavouring treated
cheeses. On the other hand Phe/Pyr ratios were similar
for all smoking technologies, and hence not diagnostic.
ACKNOWLEDGEMENTS
This work was a part of the research project MSM
6046137305 granted by the Ministry of Education,
Youth and Sports of the Czech Republic.
1316
REFERENCES
1 Phillips DH, Polycyclic aromatic hydrocarbons in the diet.
Mutat Res 443:139147 (1999).
2 Scientific Committee on Food. Opinion of the Scientific
Committee on Food on the risks to human health of polycyclic
aromatic hydrocarbons in food. SCF/CS/CNTM/PAH/29
Final. Health and consumer protection directorate - general,
Brussels (2002).
3 European Commission. Commission recommendation of 4
February 2005 on further investigation into the levels
of polycyclic aromatic hydrocarbons in certain foods
(2005/108/EC). Off J Eur Union 48:L34/43L34/45 (2005).
4 Joint FAO/WHO Expert Committee on Food Additives,
Evaluation of Certain Food Contaminants. Report of the 64th
meeting, Rome, 8 to 17 February 2005, No. 930. WHO,
Geneva (2006).
5 European Commission. Commission regulation (EC) No
1881/2006 of 19 December 2006 setting maximum levels
for certain contaminants in foodstuffs. Off J Eur Union
49:L364/5L364/2 (2006).
6 Guillen MD and Sopelana P, Occurrence of polycyclic aromatic
hydrocarbons in smoked cheese. J Dairy Sci 87:556564
(2004).
7 Guillen MD and Sopelana P, Headspace solid-phase microextraction as a tool to estimate the contamination of smoked
cheeses by polycyclic aromatic hydrocarbons. J Dairy Sci
88:1320 (2005).
8 Michalski R and Germuska R, The content of benzo(a)pyrene in
Slovekian smoked cheese. Polish J Food Nutr Sci 12/53:3337
(2003).
9 Pagliuca G, Gazzotti T, Zironi E, Serrazanetti GP, Mollica D
and Rosmini R, Determination of high molecular mass
polycyclic aromatic hydrocarbons in typical Italian smoked
cheese by HPLC-FLD. J Agr Food Chem 51:51115115
(2003).
10 Anastasio A, Mercogliano R, Vollano L, Pepe T and Cortesi
ML, Levels of benzo[a]pyrene (BaP) in Mozzarella di Bufala
Campana Cheese smoked according to different procedures.
J Agr Food Chem 52:44524455 (2004).
11 Bosset JO, Butikofer U, Dafflon O, Koch H, ScheuererSimonet L and Sieber R, Occurrence of polycyclic aromatic
hydrocarbons in cheese with and without a smoke flavour. Sci
Aliment 18:347359 (1998).
SM, Gonzalez Amigo S, Lage Yusty MA, Lopez
12 Garca Falcon
de Alda Villaizan MJ and Simal Lozano J, Enrichment of
benzo[a]pyrene in smoked food products and determination
by high-performance liquid chromatographyfluorescence
detection. J Chromatogr A 753:207215 (1996).
13 Wenzl T, Simon R, Kleiner J and Anklam E, Analytical methods
for polycyclic aromatic hydrocarbons (PAHs) in food and the
environment needed for new food legislation in the European
Union. Trends Anal Chem 25:716725 (2006).
14 European Commission. Commission Directive 2005/10/EC of 4
February 2005 laying down the sampling methods of analysis
for the official control of the levels of benzo[a]pyrene in
foodstuffs. Off J Eur Union 48:L34/15L34/20 (2005).
15 Guillen MD, Sopelana P and Partearroyo MA, Determination of polycyclic aromatic hydrocarbons in commercial liquid smoke flavorings of different compositions by
gas chromatography-mass spectrometry. J Agr Food Chem
48:126131 (2000).
16 Guillen MD, Sopelana P and Partearroyo MA, Polycyclic aromatic hydrocarbons in liquid smoke flavorings obtained from
different types of wood. Effect of storage in polyethylene flasks
on their concentrations. J Agric Food Chem 48:50835087
(2000).
17 Greenberg A, Hsu CH, Rothman N and Strickland PT, PAH
profiles of charbroiled hamburgers: Pyrene/B[a]P ratios and
presence of reactive PAHs. Polycyclic Aromatic Compounds
3:101110 (1993).
J Sci Food Agric 88:13071317 (2008)

DOI: 10.1002/jsfa

18 Frenklach M and Warnatz J, Detailed monitoring of PAH
profiles in sooting low-pressure acetylene flame. Comb Sci
Technol 51:265283 (1987).
19 Vasilakosa Ch, Levia N, Maggosa T, Hatzianestisb J,
Michopoulosa J and Helmisc C, Gasparticle concentration
and characterization of sources of PAHs in the atmosphere of a
suburban area in Athens, Greece. J Hazard Mater 140:4551
(2007).
J Sci Food Agric 88:13071317 (2008)

DOI: 10.1002/jsfa
20 Juany B, Zhen H, Juany G, Din H, Li X, Suo H, et al, Characterization and distribution of polycyclic aromatic hydrocarbon
in sediments of Haihe River, Tianjin, China. J Environ Sci
19:306311 (2007).
21 Kazerouni N, Sinha R, Hsu CH, Greenberg A and Rothman N,
Analysis of 200 food items for benzo[a]pyrene and estimation
of its intake an epidemiologic study. Food Chem Toxicol
39:423436 (2001).
1317
J Sci Food Agric 88:13181324 (2008)
Effect of inulin and Lactobacillus

paracasei on sensory and instrumental
texture properties of functional chocolate
mousse
H A Alegro,1 Inar A de Castro2
Hassa R Cardarelli,1 Lina C Aragon-Alegro,2 Joao
and Susana M I Saad1
1 Department
2 Department
Paulo, Av. Prof. Lineu Prestes, 580, 05508-000, Sao

Paulo, SP, Brazil
of Biochemical Technology, University of Sao
Paulo, SP, Brazil
of Food and Experimental Nutrition, University of Sao
Abstract
BACKGROUND: This study evaluated the effect of a potentially probiotic bacteria (Lactobacillus paracasei subsp.
paracasei LBC 82), added solely or together with the prebiotic ingredient inulin on instrumental texture attributes
and sensory properties of a functional chocolate mousse during storage at 4 1 C for up to 28 days.
RESULTS: The addition of Lactobacillus paracasei resulted in a firmer and more adhesive chocolate mousse. This
effect was intensified with the presence of inulin in the synbiotic formulation (5.24 N and 0.956 N, respectively,
for firmness and adhesiveness after 28 days of storage) (P < 0.05). L. paracasei population did not vary (P > 0.05)
during storage (always between 7.27 and 7.35 log cfu g1 ), both for the probiotic and the synbiotic mousses.
Synbiotic mousse differed from control and probiotic mousses during storage with respect to the color attribute.
Moreover, both probiotic and synbiotic mousses presented taste, aroma and texture perceptions which were
different from one another and from the control mousse after 14 and 21 days of storage.
CONCLUSION: The use of inulin, together with the potentially probiotic strain of Lactobacillus paracasei subsp.
paracasei, is advantageous, conferring potentially symbiotic potential to the chocolate mousse, as well as favorable
texture and sensory properties.
Keywords: inulin; Lactobacillus paracasei; sensory evaluation; texture profile analysis; chocolate mousse
INTRODUCTION
The use of foods that promote a state of well-being,
better health and reduction of the risk of diseases has
become popular as consumers become more health
conscious.1 Some good examples are foods containing
physiologically active components such as probiotics
and prebiotics. Lactobacillus casei/paracasei strains, for
instance, have been widely studied owing to their
health benefits, and applied as food probiotics.2 4
Prebiotics are dietary carbohydrates having a selective
metabolism within the gut flora thereby shifting the
community towards a more advantageous structure.5
Inulin type fructans have been widely investigated as
prebiotics and have the most extensive and widespread
evidence to support their prebiotic efficacy.6,7 Apart
from its nutritional benefits, inulin is used as an
ingredient in the formulation of new foods for fat or
sugar replacement, as a low-caloric bulking agent and

as a texturizing agent.8 The term synbiotic is used
when a product contains both probiotic and prebiotic
ingredients.9 Thus, a product containing inulin and
the probiotic L. paracasei, for instance, would fulfill
this definition.
A broad range of ready-to-eat dairy desserts is
available to the consumer, offering a wide variety of
textures, flavors and appearances.10 The nutritional
and sensory characteristics stimulate their consumption by several groups of consumers, including children
and elderly people. Variations in the characteristics of
these desserts and the interactions with their ingredients produce noticeable differences in the physical
and sensory properties of the formulated products.
These differences could influence their acceptability
by consumers.11

Paulo,
Correspondence to: Susana M I Saad, Department of Biochemical Technology, University of Sao
SP, Brazil
E-mail: susaad@usp.br
de Aperfeicoamento
Contract/grant sponsor: Coordenac ao
de Pessoal de Ensino Superior (CAPES)

de Amparo a` Pesquisa do Estado de Sao
Paulo (FAPESP; contract/grant number: 01/10055-0; 00/14681-0; 02/14185-8;
Contract/grant sponsor: Fundac ao
03/13748-1
(Received 26 June 2007; revised version received 12 December 2007; accepted 16 December 2007)
Effect of inulin and Lactobacillus paracasei on chocolate mousse properties
Sensory attributes can have different levels of

importance depending upon the type of food. Texture
makes a significant contribution to the overall food
quality, contributing more or less equally with
both flavor and appearance.12 The texture of semisolid food products is also of importance for their
acceptability.13 Texture profile analysis (TPA) is
an imitative test that mimics mastication with a
texturometer through a compressive force deformation
and has proved a valuable aid to assessing food texture.
However, care should be exercised in accepting
the results for purposes other than comparative
evaluation14 and a combination of techniques could
provide scientists with an effective tool for predicting
the commercial success of a product.15
Probiotics and inulin may influence sensory features
of foods. There are a number of studies dealing
with the isolated effects of inulin and L. paracasei
additions on the sensory properties of non-fermented
dairy desserts, including ice cream, frozen vegetarian
dessert, starch-based dairy dessert, and coconut
flan.16 20 However, reports on synbiotic dairy-based
products other than yoghurt, fermented milks, and
infant formulas are still scarce.21 23
Chocolate mousse is an aerated dairy dessert
with a stabilized foamy structure that is becoming
increasingly popular in the refrigerated dessert
market.24 The industrial production of aerated dairy
desserts is delicate, requiring knowledge of the
formation and stabilization of foam, the use of
functional ingredients (emulsifiers, stabilizers), and
the interaction and interference of process parameters
in the properties of the resulting product.25 It has
been seen as an excellent vehicle for the incorporation
of probiotics,23 and may even be improved by the
presence of inulin. Moreover, to our knowledge, the
simultaneous effects of both inulin and probiotics
on the instrumental texture and individual sensory
attributes (appearance, flavor, and texture) of this nonfermented synbiotic dairy dessert are non-existent.
Therefore, this study has aimed to evaluate a
functional chocolate mousse to which probiotic (L.
paracasei) and prebiotic (inulin) ingredients were
added, focusing on the effects of both ingredients on
instrumental texture attributes and sensory properties
during refrigerated storage (4 1 C) for up to
28 days.
MATERIAL AND METHODS

Ingredients for chocolate mousse
The following commercial ingredients were employed
for the production of chocolate mousse: whole
milk cream (25% fat, Nestle, Aracatuba, Brazil),
cocoa powder (Cacau em Po do Padre, Nestle,
Araras, Brazil), chocolate powder (Nescau, Nestle,
Araras, Brazil), unflavored gelatine powder (Oetker,
Sao Paulo, Brazil), emulsifying agent (Glintex,
Lida Mercantil, Diadema, Brazil), sucrose (Uniao,
Coopersucar Uniao, Limeira, Brazil), skimmed milk
J Sci Food Agric 88:13181324 (2008)
DOI: 10.1002/jsfa
powder (Ninho, Nestle, Ituiutaba, Brazil), and UHT

skimmed milk (Parmalat, Muriae, Brazil).
Production of chocolate mousse
Three pilot-scale chocolate mousse formulations,
denoted C (control), P (probiotic), and S (synbiotic),
were produced in triplicate. Formulations P and
S were supplemented with the potentially probiotic
microorganism L. paracasei subsp. paracasei LBC 82
(Danisco, Dange, France) and formulation S was
also supplemented with the prebiotic ingredient inulin
(Beneo GR, Orafti, Oreye, Belgium). Formulation
C was a control, prepared without the addition of
L. paracasei or inulin. The ingredients employed for
the production of the three formulations are shown in
Table 1.
Each lot of chocolate mousse was produced in
amounts to obtain 23 kg of the final product. For this
purpose, the ingredients were weighed, mixed (except
for the emulsifying agent), heated to 8085 C in a
water bath, and cooled to 40 C in an ice bath, being
continuously stirred. After reaching 40 C, L. paracasei
subsp. paracasei was added to formulations P and S, in
order to obtain concentrations of approximately 7 log
cfu g1 in the final product. Inulin was also added to
formulation S. The mixtures were homogenized and,
after the addition of the emulsifying agent, they were
blended with a domestic mixer (model Perola Plus,
Britania, Sao Jose dos Pinhais, Brazil) at 14 C in an
ice bath, for the incorporation of air, until the volume
of the mixture doubled. The resulting products were
transferred to individual plastic cups (approximately
35 g per cup), sealed with a metallic cover, and stored
at 4 1 C for up to 28 days.
Physicalchemical and compositional analysis
After one day of storage at 4 1 C, the chocolate
mousse formulations were freeze-dried, grated, and
analyzed for moisture, ash, fat, and protein. Three
Table 1. Ingredients and respective quantities (g kg1 ) employed for
the production of the three formulations of chocolate mousse studied
Trials
Ingredients
Milk cream (25% fat)
Cocoa powder
Chocolate powder
Unflavoured gelatine powder
Emulsifying agent
Sucrose
Skimmed milk powder
UHT skimmed milk
Inulin
L. paracasei LBC82
Total
279.00
25.00
10.00
12.50
12.50
110.00
39.00
512.00
1000.00
279.00
25.00
10.00
12.50
12.50
110.00
39.00
511.90
0.10
1000.00
267.90
24.00
9.60
12.00
12.00
95.10
37.40
491.80
50.10
0.10
1000.00
C, control: no addition of the probiotic microorganism or of the

prebiotic ingredient; P, Probiotic: addition of L. paracasei subsp.
paracasei LBC 82; S, synbiotic: addition of L. paracasei subsp.
paracasei LBC 82 plus the prebiotic ingredient inulin.
1319
HR Cardarelli et al.
independent determinations were made for each

formulation, in triplicate. For moisture content
determination, 5 g of the samples was submitted to
drying at 70 C under vacuum (Marconi MA030112,
Piracicaba, Brazil) for 24 h. Ash was determined
gravimetrically by heating the 2 g sample at 550 C,
until completely ashed. Protein was estimated by
measuring the nitrogen content using the Kjeldahl
method and multiplying it by a conversion factor
(6.38), after drying 5 g of mousse samples. Fat was
determined through lipid extraction with ethyl ether,
using the Soxhlet device. Carbohydrate content was
calculated by difference to achieve total content
of 1000 kg. Analytical procedures followed the
appropriate standard methods.26
Texture profile analysis
The TPA method was adapted from an application study described by Stable Micro Systems for
mousse (http://www.stablemicrosystems.com/). TPA
was determined in quintuplicate samples of the final
product (day 1), and after 7, 14, 21, and 28 days of
storage at 4 1 C, using a TA-XT2 texture analyzer
(Stable Micro Systems, Haslemere, UK). Individual
refrigerated mousse cups containing 35 g of product
were submitted to a single compression, using a 5 kg
load cell and a 25 mm diameter aluminium cylinder
probe set to penetrate to a depth of 10 mm, at 1 mm
s1 speed, and then returned to the starting point, at
the same speed. The parameters determined included
firmness and adhesiveness, using the Texture Expert
for Windows software version 1.2 (Stable Micro Systems). Firmness (N) was recorded as the height of the
force peak during the compression and adhesiveness
(N s) as the negative force area of the compression.
Probiotic viability
Viability of L. paracasei subsp. paracasei in chocolate
mousses P and S was monitored during the storage
period on duplicate samples of the final product (day
1) and after 7, 14, 21, and 28 days of storage. On
each sampling day, portions of 25 g were collected
aseptically, blended with 0.225 L of 1.00 g L1
peptone water in a Bag Mixer 400 (Interscience,
St Nom, France), and submitted to serial decimal
dilutions with the same diluent.
L. paracasei subsp. paracasei was counted by pourplating 1 mL of each dilution in DeMan-RogosaSharpe agar (MRS agar, Oxoid Ltd, Basingstoke, UK),
acidified to pH 5.4 with acetic acid, after 3 days of
anaerobic incubation (Anaerogen Anaerobic System,
Oxoid) at 37 C.27 The colonies were counted and the
results were expressed in logarithm of colony-forming
units per gram of product (log cfu g1 ).
Experimental design and statistical analysis
The experimental treatment and levels constituted
a randomized complete block design which was
replicated three times, with repeated measures at five
time points. The treatments had a factorial structure.
1320
Analysis of variance (ANOVA) for repeated measures,

followed by Tukey post hoc test, was used to determine
significant differences (P < 0.05) for the viability of
the probiotic microorganism added to formulations
P and S, for the results on the TPA and for
physicalchemical compositional analysis. Data were
analyzed using the Statistica 7.0 software (Statsoft,
Tulsa, OK, USA).
Sensory analysis
Formulations C, P, and S were submitted to sensory
evaluation, using a randomized complete block design
and employing the difference-from-control test,28 after
7, 14, and 21 days of refrigerated storage of the
products. Sensory evaluation was carried out at the
Faculty of Pharmaceutical Sciences (Sao Paulo, Brazil)
by 18 trained panelists from the Faculty, including
professors, students and staff. Sessions were carried
out in individual booths between 3:00 and 4:00 p.m.,
under fluorescent light.
Samples were presented in white plastic cups already
removed from the refrigerator, and the panel was asked
to evaluate the three-digit coded samples from three
different mousse formulations (C, P, and S, all of them
from the same replicate), using a structured scale from
0 (no difference from the control) to 7 (considerable
difference from the control), based on color, aroma,
texture, taste, and firmness of each sample compared
to the control sample. Sensory data were analyzed
by ANOVA two-way (panelists and treatment) for
each storage time (7, 14, and 21 days), followed by
the Tukey HSD post hoc test for comparison of
the treatments. Approval for the study was obtained
from the Ethics Committee of the Pharmaceutical
Science Faculty, and written consent was given by all
volunteers.

Physicalchemical and compositional analysis
The chemical composition of the three chocolate
mousse formulations is presented in Table 2. The
Table 2. Chemical compositiona of the three chocolate mousse
formulations studied
Chocolate mousse formulations

C
Ash
Fat
Protein
Total carbohydratesb
Moisture
12.20 [0.00]B 12.10 [0.00]B 11.70 [0.10]A

55.50 [0.10]B 55.70 [0.10]B 52.00 [0.30]A
54.80 [0.20]B 55.00 [0.20]B 51.80 [0.20]A
229.30 [2.90]A 229.70 [1.30]A 269.10 [1.00]B
648.10 [2.70]B 647.50 [1.40]B 615.50 [1.00]A
Mean g kg1 [SD] (n = 3).

Values obtained by difference [1000 (ash + fat + protein +
moisture)].
C, control; P, probiotic; S, synbiotic.
Different capital letters in the same line denote significant differences
(P < 0.05) between different formulations.
a
J Sci Food Agric 88:13181324 (2008)

DOI: 10.1002/jsfa
Texture profile analysis

Table 3 shows the results of the relevant instrumental texture attributes firmness and adhesiveness during the refrigerated storage of mousses.
Firmness is defined as the force required to
compress a substance between tongue and palate
and physically defined as the maximum force
required to compress the sample.14,29 Firmness was
statistically different among the formulations studied,
for all storage periods, and the synbiotic mousse
presented the highest values (5.24 N after 28 days
of storage) (P < 0.05) (Table 3). The synbiotic
mousse also presented higher total solids content
when compared to the other formulations, probably
because of the addition of inulin. This additive was
described as capable of increasing the viscosity of
food products at low concentrations.30 Similar results
were described for low-fat dry-fermented sausage
prepared with inulin. The meat product became softer
but with springiness and adhesiveness comparable to
conventional high-fat sausages.31 In the present study,
when the same formulation during the storage period
evaluated was considered, all formulations (C, P, and
S) varied significantly (P < 0.05), presenting increased
firmness throughout storage (Table 3). This finding
might be attributable to the low storage temperature
and interaction between the ingredients present in the
formulations.
Table 3. Instrumental texture attributes obtained for the chocolate
mousse formulations studied during refrigerated storage (4 1 C)
Formulations
Control
Probiotic
Synbiotic
Days of
storage
Firmness
(N)
Adhesiveness
(N s)
1
7
14
21
28
2.03 [0,05]aA
2.31 [0.02]bA
2.88 [0.08]cA
3.28 [0.07]dA
3.85 [0.06]eA
0.721 [0.030]aA
0.763 [0.026]bA
0.793 [0.022]cA
0.822 [0.020]dA
0.863 [0.015]eA
1
7
14
21
28
2.03 [0.04]aA
2.38 [0.05]bB
3.09 [0.05]cB
3.45 [0.05]dB
4.32 [0.09]eB
0.727 [0.022]aA
0.781 [0.023]bA
0.805 [0.023]bA
0.846 [0.022]cA
0.894 [0.021]dB
1
7
14
21
28
2.29 [0.04]aB
3.12 [0.06]bC
3.92 [0.06]cC
4.73 [0.08]dC
5.24 [0.05]eC
0.792 [0.030]aB
0.868 [0.028]bB
0.897 [0.028]bcB
0.928 [0.029]cdB
0.956 [0.033]dC

Mean [SD] (n = 5).
Within a column, for each day of storage, different capital letters denote
significant differences (P < 0.05) between different trials.
For each trial, within a column, different lower-case letters denote
significant differences (P < 0.05) between different days of storage.
J Sci Food Agric 88:13181324 (2008)

DOI: 10.1002/jsfa
Adhesiveness is defined as the force required

to remove the material that adheres to the
mouth generally the palate during the normal eating process and physically defined as the work
required to pull the sample away from a surface.14,29
During the storage period of mousses, the absolute
adhesiveness values increased significantly (P < 0.05).
The highest adhesiveness results were also found for
the synbiotic mousse (0.956 N after 28 days of storage) when all time points during the storage period
are considered together, followed by the probiotic and
control mousses. Inulin certainly contributed to the
increased adhesiveness of the synbiotic formulation.
This is one of the technological properties of inulin, as
previously reported by Franck.32
Results found in the present study indicated a clear
influence of both probiotic and prebiotic ingredients
on firmness and adhesiveness presented by the
products. Consequently, a firmer and more adhesive
chocolate mousse was obtained, with an intensified
effect promoted by the inulin present in the synbiotic
formulation.
Probiotic viability
L. paracasei population in the probiotic and the
synbiotic mousses did not vary (P > 0.05) during
refrigerated storage (Fig. 1). Populations were always
between 7.27 and 7.35 log cfu g1 . Similar results were
previously reported by Aragon-Alegro et al.23 Heenan
et al.18 incorporated L. paracasei ssp. paracasei into
a vegetarian frozen soy dessert and observed that
the population levels remained above 107 cfu g1
during the 6-month storage period. These authors
considered the dessert as a suitable food for the
delivery of bacterial probiotic strains, with excellent
viability and acceptable sensorial features. Helland
et al.,33 studying the growth and metabolism of four
probiotic strains (Lactobacillus acidophilus La5 and
1748, Bifidobacterium animalis Bb12, and Lactobacillus
rhamnosus GG) in puddings, found viability varying
from 8 to 9.1 log cfu g1 during 21 days of refrigerated
storage. However, survival of probiotic strains in
7.80
P
7.60
Log cfu g -1
significant variations in chemical composition (P <

0.05) observed for the synbiotic mousse were due
to the supplementation with inulin, which led to
increased total carbohydrate contents, when compared
to the control and probiotic mousses.
7.40
7.20
7.00
6.80
1
14
21
28
Storage (days)
Figure 1. Viability of Lactobacillus paracasei (mean log cfu g1 SD)
during the refrigerated storage of the chocolate mousse formulations
studied (n = 3); P, addition of Lactobacillus paracasei subsp.
paracasei LBC 82; S, addition of L. paracasei subsp. paracasei LBC
82 plus the prebiotic ingredient inulin.
1321
chocolate mousses seems to be strain-dependent, as

Borges et al.34 observed that Lactobacillus acidophilus,
microencapsulated in a calcium alginate matrix,
decreased 2 logs in chocolate mousse after 20 days
of storage.
Sensory evaluation
The sensory attributes evaluated through the
difference-from-control test are presented in Table 4.
Synbiotic mousse differed from the control and probiotic mousses with respect to the color attribute
during all the storage periods studied. Apparently,
the presence of inulin greatly interfered with panelists
perception of color. Color is an important appearance
characteristic, and its perception differs from person
to person, depending on lighting and numerous other
factors.35 Moreover, according to Rosenthal,14 color
and texture also influence perception of flavor.
The sensory panel mentioned that the flavor of
the probiotic and of the synbiotic mousses were
significantly different, when compared to the control
product after 14 days of storage (P < 0.05). When
compared to the control product, the synbiotic mousse
presented a significantly different taste during the
entire shelf-life, whereas the taste of the probiotic
mousse was different only after 14 days of storage
(P < 0.05). The panelists reported that the texture of
the probiotic and mainly of the synbiotic mousse were
different from the control mousse during the whole
experimental period (Table 4).
The sensory firmness of the synbiotic mousse
differed significantly from the control mousse during
the whole storage period (P < 0.05), similarly to what
was observed for the instrumental firmness. Tarrega
and Costell11 studied variations in the consistency
of commercial samples of Spanish natillas (a type of
semi-solid dairy dessert) and the relationships between
instrumental and sensory measurements. The authors
concluded that differences in thickness between
samples affected their acceptability by consumers,
and the samples showing intermediate values of
instrumental consistency were preferred.
Composition and structure of food systems interfere

with the perception of the oral texture of food, and
the use of gelling agents or thickeners modifies the
texture of a specific food product. However, the
textural agents might also modify flavor perception
and vice versa.36 In the present study both probiotic
and synbiotic mousses presented taste, aroma and
texture perceptions which were different from one
another and from the control mousse after 14 and
21 days of storage (Table 4). The presence of inulin in
the synbiotic mousse was probably responsible for the
markedly modified sensory perception. Buriti et al.37
also reported that fresh cream cheese containing L.
paracasei and inulin was described by the sensory panel
as having an improved sensory texture. Tarrega and
Costell19 reported that inulin increased thickness and
creaminess (texture attributes), and sweetness and
vanilla flavor (taste and aroma attributes) in fat-free
starch-based dairy desserts, especially in samples with
low starch concentrations. In another study, the same
authors have pointed out that interactions between
ingredients (milk fat and carrageenan gum) not only
influenced rheological characteristics of semi-solid
dairy desserts but also greatly affected their texture
and flavor.38
Some prior studies have dealt with the effects of
inulin and L. paracasei additions on sensory properties
of dairy desserts and reported divergent results.16 18
In the present study, the addition of L. paracasei
did not modify the taste and aroma at 7 days of
storage. Perception of differences in taste and aroma
between the probiotic and the synbiotic formulations
and the control occurred only after 14 days of storage
(Table 4). On the other hand, Favaro-Trindade
et al.,39 studying the sensory acceptability of fermented
acerola ice cream, reported that products prepared
with the traditional yogurt culture were better accepted
than those produced with probiotic cultures, although
no strange taste or aroma in the probiotic samples was
reported by the panelists.
In this study, the trained panel found differences in
the sensory attributes of the tested mousses (Table 4).
Table 4. Sensory scores for the attributes color, aroma, texture, taste and firmness obtained for the three chocolate mousse formulations studied
Sensory attributes
Color
Aroma
Taste
Texture
Firmness
Days of storage
7
14
C
0.00a
1.00a
P
1.00a
1.00a
S
3.50b
3.00b
P <0.01 <0.01
21
0.00a
1.00a
2.00b
0.02
1.00a
1.00a
1.50a
0.12
14
21
14
21
0.00a
0.00a
1.00a
0.50a
0.00a
2.00b
2.00b
2.00a
2.50b
3.00b
2.00b
2.00b
3.00b
3.50b
3.00b
0.03 <0.01 <0.01 <0.01 <0.01
14
1.00a
0.00a
1.50b
1.00b
2.50c
3.00c
0.01 <0.01
21
14
21
0.00a
1.00b
2.00c
0.04
0.00a
0.00a
1.50b
0.04
0.00a
0.00a
2.00b
0.01
0.00a
1.00a
2.00b
0.03

Values expressed by median. Score zero in the scale means no difference from the control and score seven means extremely different from the
control.
Within a column, for each day of storage, different lower-case letters denote significant differences (P < 0.05) between trials.
Values of probability (P) were obtained by ANOVA for each storage day.
1322
J Sci Food Agric 88:13181324 (2008)

DOI: 10.1002/jsfa
These differences would possibly not compromise

the acceptability of synbiotic and probiotic mousses
considering that, in a preliminary study carried
out with consumers,23 the differences in preference
between samples of control, probiotic and synbiotic
mousses after 7 days of storage were not significant.
CONCLUSIONS
The use of the potentially probiotic strain of
Lactobacillus paracasei subsp. paracasei and inulin
for the production of chocolate mousse was shown
to be advantageous, conferring symbiotic potential
to this non-fermented dairy dessert, as well as
favorable texture and sensory properties. These are
very important attributes for the functional appeal
and also quality of the product, leading to good
perspectives for its future commercial production.
Nevertheless in vivo studies are necessary to confirm
its functionality.
ACKNOWLEDGEMENTS
The authors would like to thank Coordenaca o de
Aperfeicoamento de Pessoal de Ensino Superior
(CAPES) and Fundaca o de Amparo a` Pesquisa do
Estado de Sao Paulo (FAPESP, grants 01/100550, 00/14681-0, 02/14185-8, and 03/13748-1), for
financial support and fellowships. The authors also
wish to thank Orafti Active Food Ingredients,
Clariant and Danisco for providing the inulin and
the culture employed and Prof Dr Bernadette D.G.M.
Franco for her useful suggestions.
REFERENCES
1 Mussatto SI and Mancilha IM, Non-digestible oligosaccharides:
a review. Carbohydr Polym 68:587597 (2007).
2 Itsaranuwat P, Al-haddad KSH and Robinson RK, The potential therapeutic benefits of consuming health-promoting
fermented dairy products: a brief update. Int J Dairy Technol
56:203210 (2003).
3 Medici M, Vinderola CG and Perdigon G, Gut mucosal
immunomodulation by probiotic fresh cheese. Int Dairy J
14:611618 (2004).
4 Vasquez A, Molin G, Pettersson B, Antonsson M and Ahrne S,
DNA-based classification and sequence heterogeneities in the
16S rRNA genes of Lactobacillus casei/paracasei and related
species. Syst Appl Microbiol 28:430441 (2005).
5 Gibson GR, Fibre and effects on probiotics (the prebiotic
concept). Clin Nutr Suppl 1:2531 (2004).
6 Roberfroid MB, Introducing inulin-type fructans. Br J Nutr
93:S13S25 (2005).
7 Gibson GR, Probert HM, Van Loo J, Rastall RA and Roberfroid MB, Dietary modulation of the human colonic microbiota: updating the concept of prebiotics. Nutr Res Rev
17:259275 (2005).
8 Tungland BC and Meyer D, Non digestible oligo-andpolysaccharides (dietary fiber): their physiology and role in
human health and food. Compr Rev Food Sci Food Safety
1:7392 (2002).
9 Crittenden R, Karppinen S, Ojanen S, Tenkanen M, Fager R, Matto J, et al., In vitro fermentation of cereal dietary
strom
fibre carbohydrates by probiotic and intestinal bacteria. J Sci
Food Agric 82:781789 (2002).
J Sci Food Agric 88:13181324 (2008)

DOI: 10.1002/jsfa
10 Verbeken D, Bael K, Thas O and Dewetiinck K, Interactions

between -carrageenan, milk proteins and modified starch in
sterilized dairy desserts. Int Dairy J 16:482488 (2006).
11 Tarrega A and Costell E, Colour and consistency of semi-solid
dairy desserts: instrumental and sensory measurements. J
Food Eng 78:655661 (2007).
12 Bourne M, Food Texture and Viscosity: Concept and Measurement.
Academic Press, San Diego, CA (2002).
13 Engelen L, de Wijk RA, Prinz JF, Janssen AM, van der Bilt A,
Weenen H, et al., A comparison of the effects of added saliva,
-amylase and water on texture perception in semi-solids.
Physiol Behav 78:805811 (2003).
14 Rosenthal AJ, Food texture: Measurement and Perception. Aspen,
Gaithersburg, MD (1999).
15 Kealy T, Application of liquid and solid rheological technologies
to the textural characterization of semi-solid foods. Food Res
Int 39:265276 (2006).
16 Schaller-Povolny LA and Smith DE, Sensory attributes and
storage life of reduced fat ice cream as related to inulin
content. J Food Sci 64:555559 (1999).
17 El-Nagar G, Clowes G, Tudorica M, Kuri V and Brennan CS,
Rheological quality and stability of yog-ice cream with added
inulin. Int J Dairy Technol 55:8993 (2002).
18 Heenan CN, Adams MC, Hosken RW and Fleet GH, Survival
and sensory acceptability of probiotic microorganisms in
a nonfermented frozen vegetarian dessert. LWT Food Sci
Technol 37:461466 (2004).
19 Tarrega A and Costell E, Effect of inulin addition on rheological
and sensory properties of fat-free starch-based dairy desserts.
Int Dairy J 16:11041112 (2006).
20 Correa SBM, Castro IA and Saad SMI, Probiotic potential
and sensory properties of coconut flan supplemented with
Lactobacillus paracasei and Bifidobacterium lactis, during shelf
life of the product. Int J Food Sci Technol (in press). DOI:
10.1111/j.1365-2621.2007.01585.x (2007).
21 Buriti FCA, Cardarelli HR and Saad SMI, Biopreservation
by Lactobacillus paracasei in co-culture with Streptococcus
thermophilus in potentially probiotic and synbiotic fresh cream
cheese. J Food Prot 70:228235 (2007).
22 Buriti FCA, Cardarelli HR, Filisetti TMCC and Saad SMI,
Synbiotic potential of fresh cream cheese supplemented
with inulin and Lactobacillus paracasei in co-culture with
Streptococcus thermophilus. Food Chem 104:16051610 (2007).
23 Aragon-Alegro LC, Alegro JHA, Cardarelli HR, Chiu MC and
Saad SMI, Probiotic and synbiotic chocolate mousse. LWT
Food Sci Technol 40:669675 (2007).
24 Muller-Fisher
N and Windhab EJ, Influence of process parameters on microstructure of food foam whipped in a rotor-stator
device within a wide static pressure range. Colloids Surf A
263:353362 (2005).
25 Pires MH, Sobremesas lacteas aeradas: sistemas de estabilizaca o
e tecnologia de aeraca o. Food Ingredients 6:7477 (2004).
26 Instituto Adolfo Lutz, Normas analticas do Instituto Adolfo Lutz:
metodos qumicos e fsicos para ana lise de alimentos. Sao Paulo
(1985).
27 Oliveira MN, Sodini I, Remeuf F and Corrieu G, Effect of milk
supplementation and culture composition on acidification,
textural properties and microbiological stability of fermented
milks containing probiotic bacteria. Int. Dairy J 11:935942.
28 Meilgaard M, Civille GV and Carr BT, Sensory Evaluation
Techniques. CRC Press, Boca Raton, FL (1999).
29 Szczesniak AS, Texture is a sensory property. Food Qual Prefer
13:215225 (2002).
30 Murphy O, Non-polyol low-digestible carbohydrates: food
applications and functional benefits. Br J Nutr 85:4753
(2001).
31 Mendoza E, Garca ML, Casas C and Selgas MD, Inulin as
fat substitute in low fat, dry fermented sausages. Meat Sci
57:387393 (2001).
32 Franck A, Technological functionality of inulin and oligofrutose.
Br J Nutr 87:287291 (2002).
33 Helland MH, Wicklund T and Narvhus JA, Growth and
metabolism of selected strains of probiotic bacteria in milk1323
and water-based cereal puddings. Int Dairy J 14:957965
(2004).
34 Borges JQ, Ferreira SRSS and Costa GW, Cinetica de sobrevivencia de Lactobacillus acidophilus microencapsulados em
matriz de alginato de calcio e veiculados em musse de chocolate, in Proceedings of the 19th Congresso brasileiro de ciencia e
tecnologia de alimentos, ed. by Sociedade Brasileira de Ciencia
e Tecnologia de Alimentos, Campinas (2004).
35 Pinho O, Mendes E, Alves MM and Ferreira IMPLVO, Chemical, physical, and sensorial characteristics of Terrincho ewe
cheese: changes during ripening and intravarietal comparison.
J Dairy Sci 87:249257 (2004).
36 Lethuaut L, Brossard C, Rousseau F, Bousseau B and Genot C,
Sweetnesstexture interactions in model dairy desserts: effect
1324
of sucrose concentration and the carrageenan type. Int Dairy

J 13:631641 (2003).
37 Buriti FCA, Cardarelli HR and Saad SMI, Influence of Lactobacillus paracasei and inulin on instrumental texture and
sensory evaluation of fresh cream cheese. Bras J Pharm Sci (in
press).
38 Tarrega A and Costell E, Effect of composition on the
rheological behavior and sensory properties of semisolid dairy
desserts. Food Hydrocoll 20:914922 (2006).
39 Favaro-Trindade CS, Bernardi S, Bodini RB, Balieiro JCC
and Almeida E, Sensory acceptability and stability of
probiotic microorganisms and vitamin C in fermented
acerola (Malpiguia emarginata, DC.) ice cream. J Food Sci
71:S492S495 (2006).
J Sci Food Agric 88:13181324 (2008)

DOI: 10.1002/jsfa
J Sci Food Agric 88:13251334 (2008)
Fruit quality and volatile fraction

of Pink Lady apple trees in response
to rootstock vigor and partial rootzone drying
Riccardo Lo Bianco,1 Vittorio Farina,1 Giuseppe Avellone,2 Felice Filizzola2
and Pasquale Agozzino2
1 Dipartimento
2 Dipartimento
S.En.Fi.Mi.Zo., Sezione di Frutticoltura Mediterranea, Tropicale e Subtropicale, Viale delle Scienze 11, 90128 Palermo, Italy
di Chimica e Tecnologie Farmaceutiche, Via Archirafi 32, 90123 Palermo, Italy
Abstract
BACKGROUND: Partial rootzone drying (PRD) is a novel deficit irrigation technique consisting in the alternated
wetting of only one side of the rootzone, which induces partial stomatal closure and increased water use efficiency.
The effect of PRD and rootstock vigor on Pink Lady apple fruit quality and aroma profile was studied using
solid-phase micro-extraction in headspace and gas chromatography/mass spectrometry.
RESULTS: PRD irrigation generally did not affect quality attributes, whereas it influenced the aroma of the apple
fruit. In particular, PRD improved the aroma of the fruit flesh, while it decreased the volatile fraction in the peel,
where most of the compounds are concentrated. Taking into account the relative contribution of the flesh and peel
(w/w) to the apple fruit, the volatile content of the entire fruit was increased by PRD irrigation in less vigorous
trees on M.9 rootstock, but reduced in more vigorous trees on MM.106 rootstock.
CONCLUSIONS: Differences between the two rootstocks were probably due to different ability to extract soil
water by the two types of trees. A combination of the less vigorous rootstock and PRD irrigation may induce an
improvement in the aroma composition of the apple fruit.
Keywords: apple flavor; aroma; deficit irrigation; fruit peel; gas chromatography; mass spectrometry; odor units;
rootstock vigor; volatile compounds
INTRODUCTION
Maximizing fruit production and quality with
minimum irrigation inputs is essential and regulated
deficit irrigation (DI) strategies have been shown to
induce beneficial consequences on fruit quality while
limiting shoot growth.1,2 In species like apple (Malus
domestica Borkh.), however, fruits and shoots grow
concurrently3 and water deficit usually reduces fruit
size and yields irrespective of timing.4 8 Further efforts
toward improving irrigation efficiency of grapes (Vitis
vinifera L.) in Australia has led to the development of a
novel technique partial rootzone drying (PRD) in
which only one half of the rootzone is irrigated, while
the other half is not.9 The physiological basis for
PRD is that roots in drying soil produce abscisic acid
(ABA), which is translocated to the shoots, indicating a developing soil-water deficit.10 In leaves, ABA
induces partial stomatal closure, which reduces transpiration and may increase water use efficiency. Since
the other half of the rootzone is kept well watered,
the effect on plant water potential is minimal.11 Other
metabolic and physiological processes associated with

water stress are not affected during PRD.10,12
Rootstock vigor may also alter biomass allocation
between roots and shoots,13 especially in response
to water deficit,14 and consequently affect resource
acquisition. In particular, apple trees grown on vigorous rootstocks like MM.111 show higher rootshoot
ratios than trees grown on M.913 and for this reason
may perform better under limiting water resources.
In addition, water limitation and biomass allocation
can have beneficial consequences on apple fruit
quality, such as increased flesh firmness, soluble solids,
and red peel color.15 17
Aroma volatiles are responsible for odor and
contribute to the general flavor of the fruit and
ultimately to the final perception of the apple
fruit quality by the consumer. More than 300
volatile compounds have been identified in apple
fruit, with esters accounting for 8098% of the
total fraction,18 21 and fatty acids representing the
major precursors for volatile formation during fruit
Correspondence to: Riccardo Lo Bianco, Dipartimento S.En.Fi.Mi.Zo., Sezione di Frutticoltura Mediterranea, Tropicale e Subtropicale, Viale delle Scienze 11,
90128 Palermo, Italy
E-mail: rlb@unipa.it
Contract/grant sponsor: Intramural Scientific Research Fundings of the University of Palermo
(Received 19 July 2007; revised version received 23 November 2007; accepted 17 December 2007)
RL Bianco et al.
maturation.22 Specifically, palmitic acid, stearic acid,

oleic acid, linoleic acid, and triacontane are the main
lipids detected in the apple peel at harvest,23 and
they may serve as precursors of important regulatory
(jasmonates, phosphoinositides) and volatile aroma
substances.24
Information on the effects of DI on apple volatiles
is rather scarce. Behboudian et al.25 found increased
volatile concentrations in fruit from late-season DI
but this was not confirmed in another season.17 In a
subsequent study, DI increased volatile concentration
only after apple ripening or cold storage and not at
harvest.26 In grapes, both DI and fixed PRD, but
not alternated PRD, tend to increase fruit aroma
concentrations.27 This inconsistency could be due
to different degrees of water stress developed, as
demonstrated in grapes where aroma is enhanced
by mild stress but inhibited by severe stress.28
Alternatively, different degrees of fruit maturity, which
is known to affect volatile production significantly,29
may have caused those differences.
Recent studies conducted on Braeburn, Fuji, and
Gala apples7,30,31 indicate that PRD should allow
for apple fruit quality and yields similar to those of
conventionally irrigated trees along with a significant
reduction in irrigation water. Our main objective
was to examine whether PRD, in combination with
rootstock vigor, would have beneficial or detrimental
effects on the fruit aroma profile as compared to that
of fruit from conventionally irrigated trees.
MATERIAL AND METHODS

The study was conducted near Caltavuturo (37 49 N
and 850 m a.s.l.), in central Sicily. Trees were 49
uniform 5-year-old Pink Lady apple trees, 22 grafted
on M.9 and 27 on MM.106 rootstock, and trained
to a central leader. Trees were planted in single rows
(northsouth oriented), spaced at 3.5 m between rows
and 1 m within the row, and arranged in a randomized
block design with three blocks each of three to five
trees per rootstockirrigation combination. The soil
type was a sandy clay loam (53.3% sand, 17.6%
silt, and 29.1% clay) with pH 7.3 and 1.8% active
carbonates. Soil moisture content at field capacity
was about 0.26 m3 m3 and soil water tension around
17 kPa. Trees were drip irrigated using one emitter
every 1 m and received conventional cultural care.
For the conventional irrigation treatment (CI), all
drip emitters on the line located between consecutive
trees along the row were left open so that trees were
receiving water on both north and south sides of
the rootzone. Irrigation of CI treatment supplied
220 mm of water (768 L per tree) distributed in
24 events from 15 July to 29 August. For the PRD
treatment, the drip emitter on one side of each tree
was closed and the emitter on the other side was
left open so that trees were receiving 50% of the CI
irrigation water only on one side of the rootzone.
Wet and dry sides were alternated every 23 weeks
1326
when soil water tension in the dry side reached values

of approximately 100 kPa (Fig. 1). The period of
irrigation, the interval between irrigation events, and
the duration of each event (maximum 4 h) were
adjusted to maintain soil moisture above 80% of field
capacity (50 kPa) in the rootzone of CI trees but
avoid spreading of wet areas into the dry sides of PRD
trees.
Climatic parameters and soil water tension were
recorded continuously with a Metos weather station
(Pessl, Weiz, Austria) equipped with six Watermark
sensors (one for CI and one for each side of PRD,
repeated in two blocks) positioned 50 cm away from
the drip emitter toward the aisle and at a fixed depth
of 45 cm.
Fruits were harvested on 7 November and a
subsample of 10 fruits per tree was taken to the
laboratory to determine average fresh weight, size
(height and width with a digital caliper), flesh firmness
on two peeled surfaces of each apple using a handheld pressure tester (TR di Turoni & Co., Forl`, Italy)
mounting an 11 mm plunger tip), total soluble solids
with an Atago Palette PR-32 digital refractometer
(Atago Co. Ltd, Tokyo, Japan), pH and acidity with
a Crison S compact titrator (Crison Instruments SA,
Alella, Barcelona, Spain) and expressed as grams of
malic acid per liter of juice, percentage and intensity
of peel red color (by digital image analysis after
photographing each fruit on two opposite sides), and
starch pattern index (by I2 KI staining and digital
image analysis of each stained section).
The volatile fraction was analyzed separately
on fruit peel and flesh by solid-phase microextraction technique in headspace followed by
gas chromatography/mass spectrometry (HS-SPMEGC/MS).32 Owing to the time needed for volatile
analysis and the fact that extractions were made on
fresh samples, each extraction was carried out on three
pooled fruits (one per block), and repeated five times
per irrigation treatment and rootstock. Fresh peel and
flesh were homogenized separately and 2 g of each tissue was transferred into 7 mL vials with pierceable silicone rubber septa coated with polytetrafluoroethylene
(PTFE) film. Ten microliters of 1-heptanol water solution (0.822 g mL1 ) was used as an internal standard.
Two different polydimethylsyloxane (PDMS) fibers
(PMDS-100 and 50/30 m DVB/carboxen/PDMS)
were tested in order to choose the one with the
best extraction efficiency for our samples. Selection
was based on the Fij criterion function introduced
by Zuba et al.33 and modified by Hamm et al.34 Fij
values were, respectively, 0.47 for peel and 0.33 for
flesh with the PDMS-100 fiber and 1.53 for peel and
1.66 for flesh with the DVB/carboxen/PDMS fiber.
Chromatograph separation was performed with two
different columns: a 30 m long and 0.25 mm inner
diameter fused-silica J & W DB5 capillary column
(coated with a 0.25 m thick film of 5% diphenyl95%
PDMS); and a 30 m long and 0.25 mm inner diameter
fused-silica Supelcowax-10 (Supelco, Bellafonte, PA,
J Sci Food Agric 88:13251334 (2008)
DOI: 10.1002/jsfa
Controlled irrigation and apple fruit flavor
USA) column (coated with a 0.25 m thick film of

polyethylene glycol). The best results were obtained
with a combination of DVB/carboxen/PDMS fiber and
the Supelcowax-10 column.
The vials were stirred in a water bath for
15 min at a controlled temperature (27 0.5 C)
in order to reach equilibrium. On the basis of
preliminary tests, a 15 min exposition time was
suitable for fiber saturation and for reproducibility
of the extraction procedure. Desorption time in the
chromatograph injector at 250 C was fixed at 5 min
in splitless mode. Separation was performed with a
gas chromatograph/mass spectrometer Varian Saturn3 Ion Trap System (Varian Inc., Palo Alto, CA, USA)
and the carrier gas (helium) pressure was fixed at
82.7 kPa on the column head. The transfer line and ion
trap temperature were 180 C. The gas chromatograph
was programmed for a starting temperature of 40 C
(5 min hold), a ramp of 5 C min1 and a final
temperature of 220 C (5 min hold). In the ion trap
mass spectrometer, electron ionization mode was set at
70 eV, mass range at 40400 thompson and frequency
at 3 scans s1 .
Collected data were processed with the instrument
data system and chromatographic and spectrometric
results showed excellent reproducibility (SD 4%).
Each determination was repeated three times. All
standard reagents used, namely 1-butanol, 1-hexanol,
1-heptanol, hexyl acetate, ethyl hexanoate, and 2hexen-1-ol, were purchased from Fluka (Buchs,
Switzerland).
Linear retention indices (LRI) were calculated
using Kovats equation35 and a sequence of linear
hydrocarbons from C10 to C26 . Apple volatile
compounds were identified first by a critical and
reasoned comparison with mass spectral data within
the NIST 2002 library. Subsequently, compounds
1, 3, 4, 5, 7, 10, 11, 12, 13, 22, 27, 28, 29, and
36 (listed in Tables 2 and 3) were verified on the
LRI list. In addition, compounds 8, 14, 16, 23, and
26 were compared to their related standards. Semiquantitative determination was carried out by the
method of internal standard. The calibration curve
was constructed with readings on six 1-heptanol
water solutions ranging from 1.64 to 0.10 g mL1
(R2 = 0.995); for all compounds identified in apple
headspace the relative response factor was assumed to
be 1.
Odor thresholds of 21 compounds (listed in
Tables 5 and 6) found in the literature were used to
calculate the corresponding odor units and their log10
was used to express the relative contribution of each
volatile to the formation of the final aroma.
Data of volatile compounds were reported individually and grouped by chemical class. Data of quality
attributes were analyzed by two-way analysis of variance with rootstock and irrigation as the two main
factors and block as a non-interacting factor using
SYSTAT (Systat Software Inc., Richmond, CA, USA)
procedures. Data of volatile compounds were analyzed
J Sci Food Agric 88:13251334 (2008)
DOI: 10.1002/jsfa
by two-way analysis of variance with rootstock and irrigation as the two sole factors. Means were separated
by Tukeys multiple range test at P 0.05. Multivariate linear discriminant analysis (LDA) was performed
using all peel and flesh volatile compounds to attempt
classification of treatment groups and individuate the
set of compounds that would allow for discrimination
of treatments.
RESULTS
Mean daily vapor pressure deficit before the irrigation
period ranged between 0.9 and 1.82 kPa, during the
irrigation period between 0.75 and 3.35 kPa, and
after the interruption of irrigation between 0.26 and
1.67 kPa. Frequent rainfall events during September
and throughout fruit harvest and leaf fall (over 150 mm
in 25 events) allowed for maintenance of soil moisture
levels above 80% of field capacity, which corresponds
to a soil water tension of 50 kPa, without any need
for irrigation (Fig. 1).
The PRD irrigation regime imposed in this
experiment did not induce significant differences in
plant water status or fruit yields (data not shown).
Fruit of trees grown on the M.9 rootstock exhibited
greater weight and firmness, but lower acidity than
those of trees grown on MM.106, whereas other
quality attributes were similar in both rootstocks
(Table 1). On the other hand, irrigation did not
affect fruit quality attributes, with the exception of
an increase in firmness under PRD (Table 1).
Thirty-six volatile compounds were found in
the fruit tissues of Pink Lady apple. LRI and
concentrations are reported in Tables 2 and 3 for both
rootstocks and irrigation regimes. Profiles included 29
esters, four alcohols, two terpenes, and one aldehyde.
Fruit flesh of all treatments showed a similar volatile
profile, with a few differences (Table 2). In particular,
hexyl acetate was the most abundant compound, followed by 2-methylbutyl acetate, whereas compounds
9, 17, 18, 20, 25, 30, 31, 32, 34, and 35 were generally
absent or barely detectable. Hexanal concentration
was higher in M.9 than in MM.106, whereas compounds 7, 8, 10, 11, 13, 16, 19, 23, 28, and 29 tended
to be more concentrated in PRD than in CI, regardless of the rootstock. Compounds 3 and 26 responded
differently to water regimes depending on the rootstock. Specifically, in response to PRD irrigation they
tended to increase in M.9 and to decrease in MM.106
(Table 2).
Fruit peel of all treatments also showed similar
volatile profile and significantly higher concentrations
than in the fruit flesh (Table 3). Hexyl acetate was
again the most abundant compound, followed by 2methylbutyl acetate, but in this case all compounds
were detectable. Compounds 2, 13, 20, and 29
were more concentrated in fruit peel of trees on
M.9, whereas compounds 14 and 25 were more
concentrated in fruit peel of trees on MM.106. On
the other hand, compounds 14, 16, 20, 25, and 34
1327
RL Bianco et al.
Figure 1. Soil-water tension at 45 cm of depth for conventional irrigation (CI) and partial rootzone drying (PRD) treatments. PRD north and PRD
south indicate position of sensors relative to tree trunk. Data for each line are the average of two measurements.
Table 1. Fruit quality attributes of 6-year-old Pink Lady apple trees grown on M.9 and MM.106 rootstocks and under conventional irrigation (CI)
and partial rootzone drying (PRD)
Rootstock
Irrigation
Weight (g)
Diameter (mm)
Color index
Cover color
(%)
M.9
CI
PRD
CI
PRD
197 7.80
202 18.8
181 4.30
176 10.2
71.3 3.30
73.9 2.69
71.9 0.71
69.4 1.68
n.s.
n.s.
0.94 0.003
0.94 0.006
0.93 0.004
0.94 0.004
n.s.
n.s.
91.1 1.54
90.0 2.44
90.5 1.53
94.9 1.91
n.s.
n.s.
MM.106
Rootstock effect
Irrigation effect
n.s.
Rootstock
Irrigation
M.9
CI
PRD
CI
PRD
MM.106
Rootstock effect
Irrigation effect
Firmness (kg cm2 )
Starch index
Soluble solids ( Brix)
Acidity (g L1 )
9.23 0.10
9.80 0.17
8.89 0.12
8.93 0.19
0.20 0.006
0.22 0.013
0.20 0.007
0.19 0.009
n.s.
n.s.
14.6 0.34
14.4 0.34
14.6 0.15
15.0 0.16
n.s.
n.s.
1.96 0.09
1.91 0.12
2.23 0.08
2.27 0.06
n.s.
Values are means standard error. Rootstock irrigation interaction non-significant.
tended to be more concentrated in the peel of CI

fruit than in the peel of PRD fruit, regardless of the
rootstock, while compound 29 behaved in opposite
ways depending on the rootstock (Table 3).
Volatile compounds were also grouped into four
chemical classes, namely esters, terpenes, alcohols,
and aldehydes. In the flesh, esters were the most
abundant, followed by alcohols, aldehydes, and
terpenes, while in the peel esters were followed
by terpenes, alcohols, and aldehydes, regardless of
irrigation or rootstock (Table 4). In the flesh, there was
a significant irrigation effect on terpenes and alcohols
indicating a significant increase in response to PRD,
whereas aldehydes were more concentrated in M.9
compared to MM.106, regardless of irrigation. As a
result, PRD fruit flesh tended to show a higher total
volatile concentration or content per fruit than CI
fruit.
1328
In the peel, CI fruit tended to show higher

(although non-significant) ester, alcohol, and total
volatile concentrations than PRD fruit (Table 4). On
the other hand, terpenes increased in PRD fruit of
trees on M.9 only, while aldehydes increased in CI
fruit of trees on M.9 and in PRD fruit of trees on
MM.106 (Table 4).
If flesh and peel compounds are pooled together,
the total fruit volatile fraction (g g1 ) is 143.5 (CI)
and 113.4 (PRD) for M.9, and 146.9 (CI) and 112.1
(PRD) for MM.106. This shows a general decrease of
volatile concentration in response to PRD irrigation,
specifically by 21% in M.9 and by 24% in MM.106.
On the other hand, if concentrations of CI and PRD
volatile compounds are averaged, trees on M.9 and
MM.106 show similar fruit volatile concentrations
(128.5 and 129.5 g g1 , respectively). However, since
the peel represents only approximately 10% of the
J Sci Food Agric 88:13251334 (2008)
DOI: 10.1002/jsfa

Table 2. Volatile compounds (g g1 ) in the fruit flesh of 6-year-old Pink Lady apple trees grown on M.9 and MM.106 rootstocks and under
conventional irrigation (CI) and partial rootzone drying (PRD)
M.9
MM.106
n.
LRI
Rootstock Irrigation
CI
PRD
CI
PRD
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
1041
1044
1054
1063
1080
1110
1131
1141
1151
1189
1208
1218
1232
1235
1268
1278
1283
1315
1323
1333
1341
1345
1359
1379
1405
1414
1418
1421
1433
1483
1485
1517
1616
1620
1731
1753
Ethyl butanoate
Propyl propanoate
Ethyl, 2-methylbutanoate
Butyl acetate
Hexanal
2-Methylbutyl acetate
Butyl propanoate
1-Butanol
Isobutyl butanoate
Pentyl acetate
1-Butanol, 3-methyl
Butyl butanoate
Butyl, 2-methyl butanoate
Ethyl hexanoate
Isopentyl butanoate
Hexyl acetate
2-Methylbutyhyl 2-methylbutanoate
(3E),-3-Hexenyl acetate, (E)
(3Z),-3-Hexenyl acetate, (Z)
Isopentyl 2-methylbutanoate
Hexyl propanoate
1-Hexanol
Heptyl acetate
(2E),-2-Hexenyl propionate
2-Hexen-1-ol, (Z)
Butyl hexanoate
Hexyl butanoate
Hexyl 2-methylbutanoate
(2E),-2-Hexenyl butyrate
(2E),-2-Hexenyl pentanoate
Pentyl hexanoate
Hexyl hexanoate
Butyl octanoate
-Farnesene (Z, E)
-Farnesene (E, E)
0.23
0.02
0.04b
1.82
0.15a
2.91
0.04b
0.07b
0.01
0.19b
0.12b
0.11
0.14b
0.12
0.01
4.66b
0.02
n.d.
0.06b
0.01
0.77
0.11
0.49b
2.80
n.d.
0.05ab
0.02
0.16ab
0.19b
0.01
n.d.
n.d.
0.01
n.d.
n.d.
0.03
0.27
0.05
0.12ab
1.97
0.19a
3.10
0.11a
0.11a
0.02
0.27a
0.19a
0.12
0.20ab
0.18
0.02
7.71ab
0.01
n.d.
0.09ab
0.01
1.38
0.03
1.07a
3.02
n.d.
0.11a
0.04
0.21ab
0.34ab
0.01
n.d.
n.d.
0.03
n.d.
n.d.
0.11
0.26
0.03
0.18a
1.74
0.06b
2.64
0.05b
0.05b
0.01
0.16b
0.08b
0.07
0.09b
0.14
0.01
4.65b
n.d.
0.01
0.06b
0.02
0.51
n.d.
0.52b
2.45
n.d.
0.05ab
0.02
0.10b
0.22b
0.01
n.d.
n.d.
0.02
n.d.
n.d.
0.09
0.32
0.04
0.05b
2.31
0.07b
4.51
0.11a
0.09a
0.02
0.31a
0.18a
0.13
0.29a
0.14
0.01
8.59a
0.04
n.d.
0.16a
0.02
0.84
0.09
0.96a
2.97
n.d.
0.04b
0.04
0.35a
0.46a
0.02
0.01
n.d.
0.03
n.d.
n.d.
0.09
LRI, linear retention index. Values are means of five replicates. Different letters indicate statistical differences among treatments and within each
compound (Tukeys multiple range test).
entire fruit, data of volatile content expressed in mg

per fruit show values of the same order for flesh and
peel (Table 4). In this case, if flesh and peel contents
(mg per fruit) are pooled together, the total volatile
content is 5.26 (CI) and 6.09 (PRD) for M.9, and
5.24 (CI) and 4.67 (PRD) for MM.106.
When volatile concentrations were converted into
odor units by using odor thresholds found in
the literature, aroma of both peel and flesh was
characterized predominantly by compounds 3, 6,
16, and 29 (Tables 5 and 6). On the other hand,
compounds 2, 8, 11, 26, 27, and 28 of the flesh
and compounds 8, 11, and 26 of the peel reported
log10 of odor units smaller than zero, meaning that
they did not contribute to the formation of the fruit
flavor. Total odor units were generally higher in fruit
tissues of trees on M.9 (60.4) than in those of trees
on MM.106 (51.3). In the flesh, total odor units were
J Sci Food Agric 88:13251334 (2008)
DOI: 10.1002/jsfa
higher in PRD fruit than in CI fruit (Table 5), while

an opposite trend was observed in the peel with CI
fruit showing higher odor units (Table 6).
LDA of all volatile compounds (concentration) in
fruit flesh and peel was able to separate completely
the four treatment groups (Fig. 2). Specifically, the
canonical score plot shows a greater distance between
PRD and CI in M.9 than in MM.106. In this
case, the canonical discriminant functions after a
forward step analysis included 10 flesh compounds
(1,3,14,19,20,21,22,24,25, and 28) and three peel
compounds (4, 22, and 23). LDA of flesh or peel
volatile compounds alone was not able to separate
completely all the four groups of fruit (data not
shown).
On the other hand, if we consider the 21 available
volatile compounds of fruit flesh and peel expressed as
odor units, LDA was also able to separate completely
1329
RL Bianco et al.
Table 3. Volatile compounds (g g1 ) in the fruit peel of 6-year-old Pink Lady apple trees grown on M.9 and MM.106 rootstocks and under
M9
MM106
n.
LRI
Rootstock Irrigation
CI
PRD
CI
PRD
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
1041
1044
1054
1063
1090
1110
1131
1141
1151
1189
1208
1218
1232
1235
1268
1278
1283
1315
1323
1333
1341
1345
1359
1379
1405
1414
1418
1421
1433
1483
1485
1517
1616
1620
1731
1753
Ethyl butanoate
Propyl propanoate
Ethyl, 2-methyl butanoate
Butyl acetate
Hexanal
Butyl propanoate
1-Butanol
Isobutyl butanoate
Pentyl acetate
3-Methyl 1-butanol
Butyl butanoate
Butyl, 2-methyl butanoate
Ethyl hexanoate
Isopentyl butanoate
Hexyl acetate
2-Methylbutyl 2-methylbutanoate
3-Hexenyl acetate, (E)
3-Hexenyl acetate, (Z)
Isopentyl 2-methyl butanoate
2-Hexenyl acetate, (E)
Hexyl propanoate
1-Hexanol
Heptyl acetate
2-Hexenyl propionate, (E)
2-Hexen-1-ol, (Z)
Butyl hexanoate
Hexyl butanoate
(2E),-2-Hexenyl butyrate
(2E),-2-Hexenyl pentanoate
Pentyl hexanoate
Hexyl hexanoate
Butyl octanoate
-Farnesene (Z, E)
-Farnesene (E, E)
0.98
0.26a
0.62
10.14
1.91
20.17
2.00
0.22
0.12
2.00
0.69
2.20
2.24a
0.75b
0.18
43.42a
1.29
0.14
1.74
0.43a
14.64
1.02
2.19
3.84
0.18b
0.18
2.91
2.11
13.30b
0.27
0.08
0.24
2.91
0.63a
0.72
12.11
0.79
0.13b
0.69
2.68
0.94
10.41
0.55
0.11
0.10
0.72
0.18
1.21
2.16a
0.66c
0.13
18.98c
0.25
0.05
0.81
0.16b
4.81
1.06
1.49
2.36
0.11c
0.22
2.90
2.29
15.71a
0.15
0.07
0.42
3.29
0.51a
0.83
14.83
0.87
0.11b
0.80
5.53
1.70
21.79
0.85
0.12
0.11
1.20
0.29
1.62
2.06a
0.88a
0.22
33.17b
0.27
0.09
1.16
0.14b
13.56
0.86
1.78
3.36
0.22a
0.33
2.59
2.53
9.73c
0.27
0.09
0.31
3.62
0.66a
0.71
13.09
0.59
0.08b
0.45
3.02
1.14
17.55
0.52
0.08
0.11
0.78
0.20
1.18
1.12b
0.73b
0.21
24.81b
0.57
0.08
0.69
0.09c
3.63
1.11
1.85
2.43
0.15b
0.19
2.29
2.52
7.56d
0.10
0.04
0.27
3.25
0.38b
0.48
8.69
LRI, linear retention index. Values are means of five replicates. Different letters indicate statistical differences among treatments and within each
compound (Tukeys multiple range test).
Table 4. Concentration and content per fruit of volatile compounds grouped by chemical class in the fruit flesh and peel of Pink Lady apple trees
grown on M.9 and MM.106 rootstocks and under conventional irrigation (CI) and partial rootzone drying (PRD)
Esters (g g1 ) Terpenes (g g1 ) Alcohols (g g1 ) Aldehydes (g g1 ) Total (g g1 ) Total (mg per fruit)

Flesh
M.9
MM.106
CI
PRD
CI
PRD
Rootstock effect
Irrigation effect
Peel
M.9
MM.106
Rootstock effect
Irrigation effect
CI
PRD
CI
PRD
14.6 1.7
17.6 3.1
16.1 3.1
17.7 4.0
n.s.
n.s.
0.03 0.01
0.11 0.01
0.06 0.02
0.10 0.03
n.s.
110 26
71 12
112 19
78 19
n.s.
n.s.
12.8 1.1b
19.7 1.6a
12.6 1.5b
9.2 1.4b
0.72 0.10
1.55 0.20
0.69 0.23
1.12 0.24
n.s.
0.15 0.03
0.18 0.02
0.06 0.02
0.07 0.01
n.s.
15.5 1.8
23.4 4.9
17.9 4.0
19.1 4.3
n.s.
n.s.
2.80 0.51
2.12 0.31
2.53 0.42
1.93 0.21
n.s.
n.s.
2.19 0.10a
0.72 0.15c
0.39 0.06c
1.27 0.07b
128 26
90 16
129 20
93 22
n.s.
n.s.
2.74 0.32
4.26 0.88
2.91 0.65
3.04 0.68
n.s.
n.s.
2.52 0.50
1.83 0.32
2.33 0.37
1.63 0.39
n.s.
n.s.
Values are means of five replicates standard error. In cases of non-significant interaction, only effects of main factors are reported (two-way
ANOVA; P 0.01; P 0.05; n.s., non-significant). In cases of significant interaction, different letters indicate significant differences (Tukeys
multiple range test) among groups and within chemical class and fruit tissue.
1330
J Sci Food Agric 88:13251334 (2008)

DOI: 10.1002/jsfa

Table 5. Aroma value in log10 of odor units in the fruit flesh of Pink Lady apple trees grown on M.9 and MM.106 rootstocks and under
M.9
n.
Fruit flesh
1
2
3
4
5
6
7
8
10
11
12
13
14
16
18
22
23
26
27
28
29
Ethyl butanoate
Propyl propanoate
Butyl acetate
Hexanal
Butyl propanoate
1-Butanol
Pentyl acetate
1-Butanol, 3-methyl
Butyl butanoate
Butyl, 2-methylbutanoate
Ethyl hexanoate
Hexyl acetate
Hexyl propanoate
1-Hexanol
2-Hexen-1-ol, (Z)
Butyl hexanoate
Hexyl butanoate
Odor threshold (g kg1 )

142
5743
0.144
6642
542
1145
2542
50042
544
475046
10043
1743
145
242
244
843
50042
670047
70043
25045
643
Total
MM.106
CI
PRD
CI
PRD
2.36
<0
2.63
1.44
1.48
2.42
0.23
<0
1.58
<0
0.04
0.90
2.09
3.37
<0
1.12
<0
<0
<0
<0
1.49
2.43
<0
3.07
1.48
1.57
2.45
0.65
<0
1.73
<0
0.09
1.07
2.25
3.59
0.05
0.52
0.33
<0
<0
<0
1.75
2.41
<0
3.25
1.42
1.10
2.38
0.27
<0
1.51
<0
<0
0.74
2.13
3.37
0.54
<0
0.02
<0
<0
<0
1.56
2.51
<0
2.66
1.54
1.14
2.61
0.63
<0
1.80
<0
0.10
1.23
2.15
3.63
0.24
1.05
0.28
<0
<0
0.14
1.88
21.18
23.03
14.38
17.86
Table 6. Aroma value expressed in log10 of odor units in the fruit peel of Pink Lady apple trees grown on M.9 and MM.106 rootstocks and under
M.9
n.
Fruit peel
1
2
3
4
5
6
7
8
10
11
12
13
14
16
18
22
23
26
27
28
29
Ethyl butanoate
Propyl propanoate
Butyl acetate
Hexanal
Butyl propanoate
1-Butanol
Pentyl acetate
1-Butanol, 3-methyl
Butyl butanoate
Butyl, 2-methylbutanoate
Ethyl hexanoate
Hexyl acetate
Hexyl propanoate
1-Hexanol
2-Hexen-1-ol, (Z)
Butyl hexanoate
Hexyl butanoate
Odor threshold (g kg1 )

142
5743
0.144
6642
542
1145
2542
50042
544
475046
10043
1743
145
242
244
843
50042
670047
70043
25045
643
Total
the four groups of fruit (Fig. 3), but the canonical

score plot shows a greater distance between PRD and
CI in MM.106 than in M.9. In this case, the canonical
J Sci Food Agric 88:13251334 (2008)
DOI: 10.1002/jsfa
MM.106
CI
PRD
CI
PRD
2.99
0.65
3.80
2.28
2.58
3.26
1.90
<0
2.60
<0
1.34
2.12
2.88
4.34
1.84
2.10
0.64
<0
0.62
0.93
3.35
2.90
0.35
3.84
1.61
2.27
2.98
1.35
<0
2.16
<0
1.08
2.10
2.82
3.98
1.37
2.12
0.48
<0
0.62
0.96
3.42
2.94
0.30
3.90
1.92
2.53
3.30
1.53
<0
2.38
<0
1.21
2.08
2.94
4.22
1.65
2.03
0.55
<0
0.57
1.01
3.21
2.77
0.16
3.65
1.66
2.36
3.20
1.31
<0
2.19
<0
1.07
1.82
2.86
4.09
1.60
2.14
0.57
<0
0.51
1.00
3.10
40.21
36.40
37.43
32.82
discriminant functions after a forward-step analysis

included seven flesh compounds (2, 3, 7, 13, 14, 22,
and 23) and five peel compounds (1, 6, 12, 22, and 27).
1331
RL Bianco et al.
Figure 2. Canonical score plot from linear discriminant analysis for

concentration (g g1 ) data of volatile compounds detected in fruit
flesh and peel of Pink Lady apple trees grown on M.9 and MM.106
rootstocks and under conventional irrigation (CI) and partial rootzone
drying (PRD).
Figure 3. Canonical score plot from linear discriminant analysis for

odor values (log10 of odor units) of volatile compounds detected in
fruit flesh and peel of Pink Lady apple trees grown on M.9 and
MM.106 rootstocks and under conventional irrigation (CI) and partial
rootzone drying (PRD).
DISCUSSION AND CONCLUSIONS

The PRD irrigation regime generally did not affect fruit
quality attributes of Pink Lady apples, regardless of
the rootstock. Only flesh firmness was significantly
increased by PRD, in agreement with data reported
for Fuji apples.8 Contrasting responses have been
reported by various authors concerning other quality
attributes. For example, Caspari et al.7 in Braeburn,
Einhorn and Caspari31 in Gala and Van Hooijdonk
et al.36 in Pacific Rose did not find any reduction in
fruit quality due to PRD; whereas Lombardini et al.37
and Caspari et al.30 found a significant reduction
in Fuji final fruit size. These discrepancies may
1332
be attributed to different irrigation (system, delivery

rate and timing, amounts, etc.), soil, and climate
conditions in the various field trials which may have
resulted in different degrees of water stress experienced
by the plants.
The volatile fraction was more concentrated in fruit
peel than in the flesh, and differences in the aroma
profile were mainly due to the irrigation regime rather
than to the rootstock. Our observations prove that the
apple peel is very important for fruit volatile formation.
In fact, volatile compounds in apples are primarily
synthesized in the peel after lipid and amino acid
catabolism.38,39 Lipid and amino acid concentration
in the fruit peel may therefore represent a serious
limiting factor for aroma volatile production.40
Moreover, in the fruit flesh, PRD irrigation induced
higher total volatile concentration or content than
CI irrigation. These results in part agree with
those reported by Behboudian et al.,25 who observed
that late-season DI increases volatile concentrations,
although their DI treatment is substantially different
from the PRD technique imposed in this study.
Also, volatile emissions from entire apple trees was
associated with water deficit as shown by a significant
negative correlation between rainfall and emissions of
-pinene, the monoterpene camphene, and the two
green leaf volatiles, (E)-2-hexenal and (Z)-3-hexen-1ol.41 However, the PRD treatment in our study did
not induce significant changes in plant water status,
fruit water content, starch index, or flesh firmness
compared to the CI irrigation, and the observed
increases in volatile concentrations should be due to
mechanisms other than water stress, dilutions due to
fruit water content, or degree of fruit maturation. For
example, in PRD trees, hormonal signals generated
in response to soil drying in the non-irrigated portion
of the rootzone may have some direct role in the
metabolic events that lead to fruit volatile formation,
despite the unaltered plant water status.
When flesh and peel compounds were pooled
together, the total fruit volatile fraction showed
a general decrease of volatile concentration in
response to PRD irrigation. These apparent volatile
reductions in response to PRD irrigation were
mainly due to changes in the concentration of peel
volatile compounds. However, the peel represents
approximately 10% of the entire fruit and the impact
of peel volatiles may therefore be greatly reduced if
this is taken into account. In addition, data of total
volatile content indicate that trees on rootstocks of
different vigor may respond differently to irrigation
for what concerns fruit volatiles. In particular, PRD
seems to increase total fruit volatiles of trees on M.9
but to decrease total fruit volatiles of trees on MM.106.
This is in part due to differences in fruit size between
rootstocks as in larger fruits (M.9) the flesh:peel ratio
increases and the net irrigation effect of the flesh
(PRD increasing volatiles) overcomes the effect of the
peel (PRD decreasing volatiles). Yet, data of volatile
J Sci Food Agric 88:13251334 (2008)
DOI: 10.1002/jsfa
concentration (mg g1 tissue, Table 4) show that the

PRD effect in the fruit flesh of trees on M.9 tends
to be more marked than in the fruit flesh of trees on
MM.106. Hence, the resulting opposite trends for the
two rootstocks, in addition to the fruit size component,
could also be due to a greater ability of more vigorous
trees (MM.106) to extract soil water, by exploring
larger soil volumes, compared to less vigorous trees
(M.9), which in turn reduces the intensity of rootgenerated hormonal signal.
When volatile concentrations were converted into
odor units by using odor thresholds found in
the literature, very high odor threshold values for
a few compounds prevented their contribution to
fruit flavor formation. This is true only in theory
because single odor units do not take into account
possible interactions and synergisms among volatile
compounds and with the fruit matrix, which could
change the human perception of the fruit flavor.
Nevertheless, data expressed in odor units, although
determined on only 21 volatile compounds, were
consistent with those from the total concentration
of the 36 volatiles detected.
LDA was able to separate completely the four
treatment groups when fruit volatile compounds
were expressed both in concentration or odor units.
However, for volatile concentration, LDA revealed a
stronger effect of PRD on the fruit aroma composition
of trees on M.9 than on that of trees on MM.106,
whereas, in terms of odor units, LDA indicated a
stronger effect of PRD on the fruit flavor expression
of trees on MM.106 than on that of trees on M.9. In
both cases, the flesh seems to participate more than
the peel in the differentiation of the four treatment
groups.
Our observations show that reducing water inputs
according to the PRD irrigation strategy has an impact
on the aroma of the apple fruit. In particular, it
improves the aroma of the fruit flesh, while it decreases
the volatile fraction in the peel where most of the
compounds are concentrated. As a result the volatile
concentration of the fruit as a whole is partly reduced
by PRD. If the relative contribution (in terms of
weight) of the flesh and peel to the apple fruit is
then considered, the volatile content of the entire
fruit is generally improved by PRD irrigation in less
vigorous trees on M.9 rootstock, but reduced in more
vigorous trees on MM.106 rootstock probably due to
different degrees of water stress developed by the two
types of trees. Therefore, a combination of the less
vigorous rootstock and PRD irrigation may induce an
improvement in the aroma composition of the apple
fruit.
ACKNOWLEDGEMENTS
This research was financially supported by the
Intramural Scientific Research Fundings of the
University of Palermo (ex quota 60%) for year 20042005.
J Sci Food Agric 88:13251334 (2008)
DOI: 10.1002/jsfa
REFERENCES
1 Yang J, Zhang J, Huang Z, Zhu Q and Wang L, Remobilization
of carbon reserves is improved by controlled soil-drying during
grain filling of wheat. Crop Sci 40:16451655 (2000).
2 Higgs KH and Jones HG, Water relations and cropping of apple
cultivars on a dwarfing rootstock in response to imposed
drought. J Hortic Sci 66:367379 (1991).
3 Forshey CG, Weires RW, Stanley BH and Seem RC, Dry
weight partitioning of McIntosh apple trees. J Am Soc Hortic
Sci 108:149154 (1983).
4 Lotter
J De V, Beukes DJ and Weber HW, Growth and quality
of apples as affected by different irrigation treatments. J Hortic
Sci 60:181192 (1985).
5 Ebel RC, Proebsting EL and Patterson ME, Regulated deficit
irrigation may alter apple maturity, quality, and storage life.
HortScience 28:141143 (1993).
6 Mpelasoka BS, Behboudian MH and Green SR, Water use,
yield and fruit quality of lysimeter-grown apple trees,
responses to deficit irrigation and to crop load. Irrig Sci
20:107113 (2001).
7 Caspari HW, Neal S and Alspach P, Partial rootzone drying.
A new deficit irrigation strategy for apple? Acta Hortic
646:93100 (2004).
8 Leib BG, Caspari HW, Redulla CA, Andrews PK and Jabro JJ,
Partial rootzone drying and deficit irrigation of Fuji apples
in a semi-arid climate. Irrig Sci 24:8599 (2006).
9 Dry PR and Loveys BR, Factors influencing grapevine vigour
and the potential for control with partial rootzone drying.
Aust J Grape Wine Res 4:140148 (1998).
10 Dry PR, Loveys BR, Botting DG and During

H, Effects
of partial rootzone drying on grapevine vigour, yield,
composition of fruit and use of water, in Proceedings of the
Ninth Australian Wine Industry Technical Conference; 128131
(1995).
11 Gowing DJG, Davies WJ and Jones HG, A positive root-sourced
signal as an indicator of soil drying in apple, Malus domestica
Borkh. J Exp Bot 41:15351540 (1990).
12 Dry PR, Loveys BR and During

H, Partial drying of the
rootzone of grape. I. Transient changes in shoot growth and
gas exchange. Vitis 39:37 (2000).
13 Stutte GW, Baugher TA, Walter SP and Leach DW, Rootstock
and training system affect dry-matter and carbohydrate
distribution in Golden Delicious apple trees. J Am Soc
Hortic Sci 119:492497 (1994).
14 Atkinson CJ, Policarpo M, Webster AD and Kuden AM,
Drought tolerance of apple rootstocks: Production and partitioning of dry matter. Plant Soil 206:223235 (1999).
15 Mills TM, Behboudian MH and Clothier BE, Plant water
status and fruit quality in Braeburn apples. HortScience
29:12741278 (1994).
16 Kilili AW, Behboudian M and Mills T, Water relations, photosynthesis, growth, and yield of Braeburn apples under
reduced irrigation applied at different stages of the growing
season. Gartenbauwissenschaft 61:267273 (1996).
17 Mpelasoka BS, Behboudian MH, Dixon J, Neal SM and Caspari HW, Improvement of fruit quality and storage potential
of Braeburn apple through deficit irrigation. J Hortic Sci
Biotechnol 75:615621 (2000).
18 Lopez ML, Lavilla MT, Riba M and Vendrell M, Comparison
of volatile compounds in two seasons in apples: Golden
Delicious and Granny Smith. J Food Qual 21:155166
(1998).
19 Lopez ML, Lavilla MT, Recasens I, Riba M and Vendrell M,
Influence of different oxygen and carbon dioxide concentrations during storage on production of volatile compounds by
Starking Delicious apples. J Agric Food Chem 46:634643
(1998).
20 Lavilla T, Puy J, Lopez ML, Recasens I and Vendrell M,
Relationships between volatile production, fruit quality, and
sensory evaluation in Granny Smith apples stored in different
controlled atmosphere treatments by multivariate analysis.
J Agric Food Chem 47:37913803 (1999).
1333
RL Bianco et al.
21 Echeverria G, Fuentes MT, Graell J and Lopez ML, Relationships between volatile production, fruit quality and sensory
evaluation of Fuji apples stored in different atmospheres
by means of multivariate analysis. J Sci Food Agric 84:520
(2003).
22 Fellman JK, Miller TW, Mattinson DS and Mattheis JP, Factors that influence biosynthesis of volatile flavor compounds
in apple fruits. HortScience 35:10261033 (2000).
23 Noro S, Kudo N and Kitsuwa T, Changes of lipids of Jonagold
apple peel in the harvest time. J Jpn Soc Hortic Sci 54:116120
(1985).
24 Song J and Bangerth F, Fatty acids as precursors for aroma
volatile biosynthesis in pre-climacteric and climacteric apple
fruit. Postharvest Biol Technol 30:113121 (2003).
25 Behboudian MH, Dixon J and Pothamshelty K, Plant and fruit
responses of lysimeter-grown Braeburn apple to deficit
irrigation. J Hortic Sci Biotechnol 73:781785 (1998).
26 Mpelasoka BS and Behboudian MH, Production of aroma
volatiles in response to deficit irrigation and to crop load
in relation to fruit maturity for Braeburn apple. Postharvest
Biol Technol 24:111 (2002).
27 El Ansary DO and Okamoto G, Vine water relations and quality
of Muscat of Alexandria table grapes subjected to partial
root-zone drying and regulated deficit irrigation. J Jpn Soc
Hortic Sci 76:1319 (2007).
28 Peyrot des Gachons C, Van Leeuwen C, Tominaga T, Soyer JP,
Gaudillere JP and Dubourdieu D, Influence of water and
nitrogen deficit on fruit ripening and aroma potential of Vitis
vinifera L cv Sauvignon blanc in field conditions. J Sci Food
Agric 85:7385 (2005).
29 Song J and Bangerth F, The effect of harvest date on aroma
compound production from Golden Delicious apple fruit
and relationship to respiration and ethylene production.
Postharvest Biol Technol 8:259269 (1996).
30 Caspari HW, Einhorn TC, Leib BG, Redulla CA, Andrews PK,
Lombardini L, et al, Progress in the development of partial
rootzone drying of apple trees. Acta Hortic 664:125132.
31 Einhorn T and Caspari HW, Partial rootzone drying and deficit
irrigation of Gala apples in a semi-arid climate. Acta Hortic
664:197204 (2004).
32 Vas G and Vekey K, Solid-phase microextraction: a powerful
sample preparation tool prior to mass spectrometric analysis.
J Mass Spectrom 39:233254 (2004).
33 Zuba D, Parczewski A and Reichenbacher M, Optimization of
solid phase microextraction conditions for gas chromatographic determination of ethanol and other volatile compounds in blood. J Chromatogr B 773:7582 (2002).
34 Hamm S, Lesellier E, Bleton J and Teapla A, Optimization of
headspace solid phase microextraction for gas chromatogra-
1334
35
36
37
38
39
40
41
42
43
44
45
46
47
phy/mass spectrometry analysis of widely different volatility and polarity terpenoids in olibanum. J Chromatogr A
1018:7383 (2003).
Kovats ES, Gas chromatographic characterization of organic
compounds. L Retention Index of aliphatic halides, alcohols,
aldehydes, and ketones. Helv Chim Acta 6:19151932 (1958).
van Hooijdonk BM, Dorji K and Behboudian MH, Responses
of Pacific Rose apple to partial rootzone drying and to
deficit irrigation. Eur J Hortic Sci 69:104110 (2004).
Lombardini L, Caspari HW, Elfving DC, Auvil TD and McFerson JR, Gas exchange and water relations in Fuji apple trees
grown under deficit irrigation. Acta Hortic 636:4350 (2004).
Fan X, Mattheis JP, Fellman JK and Patterson ME, Effect of
methyl jasmonate on ethylene and volatile production by
Summered apples depends on fruit developmental stage.
J Agric Food Chem 45:208211 (1997).
Rudell DR, Mattinson DS, Mattheis JP, Wyllie SG and Fellman JK, Investigations of aroma volatile biosynthesis under
anoxic conditions and in different tissues of Redchief Delicious apple fruit (Malus domestica Borkh.). J Agric Food Chem
50:26272632 (2002).
Bangerth F, Streif J, Song J and Brackmann A, Investigation
into flavor physiology in apple fruit. Acta Hortic 464:189194
(1998).
Vallat A, Gu H and Dorn S, How rainfall, relative humidity
and temperature influence volatile emissions from apple trees
in situ. Phytochemistry 66:15401550 (2005).
Flath RA, Black DR, Guadagni DG, McFadden WH and
Schultz TH, Identification and organoleptic evaluation of
compounds in Delicious apple essence. J Agric Food Chem
15:2935 (1967).
Takeoka GR, Flath RA, Mon TR, Teranishi R and Guentert M,
Volatile constituents of apricot (Prunus armeniaca). J Agric
Food Chem 38:471477 (1990).
Herrmann K, Die Aromastoffe des Obstes. Teil I: Allgemeine
Angaben zu den Aromastoffen, ihren Schwellenwerten und
ihrer Zusammensetzung. Erwerbsobstbau 33:47 (1991).
Takeoka GR, Buttery RG and Flath RA, Volatile constituents of
Asian pear (Pyrus serotina). J Agric Food Chem 40:19251929
(1992).
Karahadian C and Johnson KA, Analysis of headspace volatiles
and sensory characteristics of fresh corn tortillas made from
fresh masa dough and spray-dried masa flour. J Agric Food
Chem 41:791799 (1993).
van Gemert LJ and Nettenbreijer AH, Compilation of odour
threshold values in air and water. National Institute for Water
Supply, Voorburg, The Netherlands (1977).
J Sci Food Agric 88:13251334 (2008)

DOI: 10.1002/jsfa
J Sci Food Agric 88:13351343 (2008)
A chemometric study of pesto sauce

appearance and of its relation to pigment
concentration
Francesca Masino, Giorgia Foca, Alessandro Ulrici, Laura Arru and Andrea Antonelli
Dipartimento di Scienze Agrarie e degli Alimenti, Universita` degli Studi di Modena e Reggio Emilia, Padiglione Besta - Via Amendola 2,
42100 Reggio Emilia, Italy
Abstract
BACKGROUND: Pesto sauce is a typical example of a food matrix in which aspect is of key importance to the final
judgment of the consumer, and whose color strongly depends on the production process and on the ingredients. In
view of this, the aim of the present work is to evaluate the possibility of quantifying the variability of visual aspect
of different brands of pesto sauce, and its relation to the concentration of the main pigments.
RESULTS: Sensory evaluation of the appearance of 12 commercial pesto samples was carried out by a panel
of 16 assessors who evaluated quantitatively six visual attributes, suitably defined for the description of pesto
aspect. A quantitative estimate of the performance of the panel was carried out by means of both univariate
and multivariatemultiway chemometric tools (parallel factor analysis, PARAFAC). In addition, the relationship
between the mean sensory scores values and the concentrations of chlorophylls, pheophytins and carotenoids was
investigated by principal components analysis (PCA). Both PCA and PARAFAC showed good clustering of the
samples and a satisfactory degree of homogeneity of the assessors.
CONCLUSION: Data analysis showed that assessors fundamentally agree about the main visual characteristics of
pesto sauces, which are partly correlated with the concentration values of the main pigments.
Keywords: pesto sauce; sensory evaluation; color; chemometrics; PCA; PARAFAC
INTRODUCTION
Notwithstanding their increasing importance in the
food market, individual perceptions of sensory
attributes are frequently subjective and difficult to
estimate, because of the influence of various factors,
such as age, sex, health conditions and nutritional
habits, in addition to social and cultural traditions.
In order to reduce the effects of such factors,
several experimental methods have been optimized
to obtain significant information.1 For these reasons,
the application of sensory panels and the development
of appropriate methods to handle the sensory data are
rapidly increasing with the expansion of the processed
food industry,2 and recent surveys suggest that it will
continue in this direction in the coming years.3 5
Among all food sensory attributes, those which often
play the main role in the consumer decisions during
purchase are undoubtedly the visual characteristics,
such as color and texture, since packaging does not
permit the consumer to use senses other than sight.6 10
Also a typical Ligurian pasta sauce known as pesto
alla genovese, or simply pesto, is usually presented in
transparent pots so that the perceived quality can
be determined by its visual appearance. In the last

few years the diffusion of pesto has been increasing
rapidly all over the world and many food industries
are working to improve its preparation process.11,12 In
Italy, the production of pasta sauces is about 47 000
tons per year with a value of about 300 million, of
which 10 000 tons per year are of pesto, with a value of
about 110 million. Moreover, concerning its diffusion
throughout the world, pesto sauce is the second most
popular pasta sauce after tomato sauce.
Pesto sauce is essentially made up of mashed basil
leaves, pine nuts, cheese, olive oil, garlic and salt,
its overall aspect resembling that of minced leaves in
oil (the reader is referred to the literature13 for some
sample images). Chlorophylls are the pigments mainly
responsible for the green hue of pesto, even though oil,
cheese, pine nuts, garlic and other minor compounds
play also a role in the overall sauce appearance. In
particular, cheese and pine nuts contribute to the
white and yellow hue components, the dimensions of
their particles also being influential. In addition, pesto
sauce commonly also presents brown particles in the
green bulk. These dark hues are mainly due to the
Correspondence to: Alessandro Ulrici, Dipartimento di Scienze Agrarie e degli Alimenti, Universita` degli Studi di Modena e Reggio Emilia, Padiglione Besta Via Amendola 2, 42100 Reggio Emilia, Italy
E-mail: alessandro.ulrici@unimore.it
(Received 28 August 2007; revised version received 28 November 2007; accepted 7 January 2008)
F Masino et al.
degradation of chlorophylls a and b into the respective

brownish pheophytins, by substitution of the Mg atom
in the porphyrinic ring with two hydrogen atoms.14 17
In the industrial production different processes are
often used to enhance the shelf life of pesto sauce,
such as pasteurization or addition of small amounts
of organic acids,12 but these treatments tend to
compromise the bright green color of the untreated
product due to chlorophyll degradation.18
These characteristics of pesto color, i.e., its
inhomogeneous aspect and its strong color variability,
led us to deepen our knowledge of its aspectrelated properties by means of different approaches.
In a previous study, an automated color-based
classification algorithm was developed, which allowed
classification of different brands of pesto on the
basis of digital RGB images.13 The results obtained
showed that heterogeneous food matrices can also
be submitted to color analysis when the appropriate
data acquisition and elaboration techniques are used,
leading to very satisfactory classification models.
Moreover, in a subsequent study, the concentration
values of the main pigments of pesto sauce were
determined by analysis using high-performance liquid
chromatography (HPLC).19
In this work, with the aim of further objectively
defining the appearance of this food product, the
application of sensory analysis to a set of pesto
samples is presented. In particular, a group of
trained assessors (judges) was asked to define color
properties of a set of pesto samples using descriptive
sensory techniques.2,20 The measured scores were
then analyzed by ANOVA,21 by other univariate
approaches, and by multivariate tools. In particular,
the three-way nature of the dataset (samples
attributes judges) was analyzed by parallel factor
analysis (PARAFAC),22 24 a three-way multivariate
explorative tool. This method provided a unique
opportunity to obtain interesting indications both on
the behavior of the assessors as well as on the properties
of the different samples of pesto.
Moreover, to obtain an objective confirmation
of the dependence of visual aspect on pigment
concentration, the relationships among the mean
sensory scores values and the pigment concentrations
were also investigated by principal components
analysis (PCA).21,25
EXPERIMENTAL
Samples
Twelve different kinds of pesto sauce (samples),
indicated by letters AL, were considered in this study.
Samples from A to I, corresponding to nine different
brands (one lot for each brand), were purchased
from local markets, while the remaining samples J,
K, and L were directly supplied by a producer, and
correspond to three different lots. Details on the
different recipes were unknown, but samples AI
were subjected to pasteurization and addition of small
1336
amounts of organic acids by the producers, while

samples JL, by contrast, had added water-binding
substances to lower water activity. For each sample,
pesto sauce from two different jars was analyzed.
The content of the two jars for each sample was
mixed together and an appropriate amount (stored in
a dark place at 4 C and analyzed in the following
days) was kept for the determination of pigment
concentration. The remaining part was used to fill
three anonymous glass pots (subsamples) identified
by a numerical code, each one containing about 40 g
of pesto. Similarly to the part of sample to be used
for the determination of pigment concentrations, the
36 identical glass pots containing the subsamples
of pesto were stored in a dark place at 4 C, to
be used for the panel test sessions in the following
3 days.
Sensory analysis
Education of the panel
Sixteen judges (nine men and seven women, with
ages ranging from 24 to 55 years) indicated by
abbreviations from JUD1 to JUD16, took part
as volunteers to the panel test. The panel was
selected on the basis of general guidance26 and
their interest and delight in pesto. All assessors
had already participated in various panel sessions
on different food products in the past. For this
reason, they were trained in the senses of taste,
smell and visual appearance and also in the general
rules of sensory analysis, as reported in the standard
methods.27
Moreover, a specific training session was dedicated
to the visual appearance of pesto samples, where
the different attributes used to define aspect-related
properties of pesto sauce were discussed, using as
examples some of the anonymous pots containing the
pesto samples.
Evaluation card
The sensory evaluation consisted of a descriptive analysis carried out by evaluating different attributes on
an interval scale,1,20 using an evaluation card analogous to that reported in Fig. 1. Six sensory attributes
pertinent to color and texture of the analyzed samples were chosen, according to the discussion with
the assessors in the training section.3 The following
terms were selected to describe pesto sauce: green
hue (GH), yellow hue (YH), brown hue (BH), white
amount (WA), color homogeneity (CH), and particle size (PS). Moreover, the personal preference of
the judge (PR), which is a hedonic attribute, was
also included. Concerning this latter attribute we
are absolutely aware that hedonic scales are usually
reserved for consumer populations greater than 30
in number and ideally many times larger than that.
However, we decided to include it anyway, in order
to have just a preliminary estimate of the relation
between delight for pesto and its aspect. Moreover, it
is worth noting that multivariate analysis (PCA and
J Sci Food Agric 88:13351343 (2008)
DOI: 10.1002/jsfa
Chemometric study of pesto sauce appearance
PARAFAC) was performed both with and without

PR attribute, and the results were essentially the same
(results without PR are not reported for reasons of
conciseness).
Assessors were asked to record the intensity of each
attribute for each subsample, i.e., for each anonymous
glass pot, by placing a mark on an unstructured line
scale 10 cm long.
Evaluation sessions
Evaluation sessions were carried out in individual
sensory booths to avoid exchange of opinions
about samples. The sensory evaluation of the visual
characteristics of pesto was conducted in three
separate sessions, planned on three consecutive days.
In each session, 16 glass pots containing the pesto
sauce (12 different samples + 4 replicate samples)
were presented to the judges, following a Latin square
design25 in order to avoid any time-related effect in
the evaluation. This particular sample subdivision and
session organization was such that, at the end of the
evaluation sessions, each of the 12 pesto samples was
submitted four times to the judgment of each assessor.
The procedure adopted also allowed checking for
possible changes in the samples aspect over time.
To this end, the presence of a time (i.e., session)related effect was tested by ANOVA and results
(not reported for reasons of conciseness) indicated
that the aspect of the analyzed samples remained
essentially unchanged during the 3 days of panel test
sessions.
The visual evaluation of the samples was conducted
by the assessors without opening the glass pots,
thus avoiding use of senses other than sight during
evaluation.
Determination of pigments
In the same samples subjected to sensory evaluation, the amount of the main pigments was also
determined. In particular, the following species were
quantified: chlorophylls a and b (Chl a and Chl b);
lutein (Lut); -carotene (Car); and pheophytins a
and b (Pht a and Pht b). All pigments were determined by reverse-phase HPLC, except for Car, which
was directly quantified on the purified extract by visible spectrophotometry. For a detailed description of
the procedures adopted for extraction and quantification of pigments, also including data on pigment
concentrations, the reader is referred to the original
article.19
Data analysis
First, the performance of the panel was investigated by
one-way and two-way ANOVA. In the mixed models
the assessors were considered as a random factor, while
the samples were considered as a fixed factor.1,28,29
Moreover, to obtain an estimate of the repeatability
in the evaluation of each sample by each assessor
with respect to each attribute, a parameter named
Score% was defined. In particular, the Score%
value has been computed using the following
procedure: first, the score values obtained from
the evaluation session were autoscaled for each
judge and attribute, so that their variance for
each judge and attribute (VJUD,ATTR ) equals 1.
The variance of the four replicated score values
of each sample i obtained from each judge for
each attribute was then calculated (VJUD,ATTR,SMPLi )
and the corresponding variance ratio was defined as
follows:
FJUD,ATTR,SMPLi =
=
VJUD,ATTR
VJUD,ATTR,SMPLi
1
VJUD,ATTR,SMPLi
(1)
Then, FJUD,ATTR,SMPLi was compared with the corresponding critical value, FCRIT , and the corresponding
score value, SJUD,ATTR,SMPLi , was defined as follows:
if FJUD,ATTR,SMPLi > FCRIT ,
then SJUD,ATTR,SMPLi = 1;
Figure 1. English version of the evaluation card used for evaluation
sessions (the original version was in Italian). In the original version,
line scales were 10 cm long.
J Sci Food Agric 88:13351343 (2008)

DOI: 10.1002/jsfa
if FJUD,ATTR,SMPLi FCRIT ,
then SJUD,ATTR,SMPLi = 0.
1337
F Masino et al.
Finally, the Score% value was calculated for each

judge over each attribute as follows:
N
Score%JUD,ATTR = 100
xijk =
SJUD,ATTR,SMPLi
i=1
residual sum of squares, eijk , as defined by the following

model equation:
(2)
where N is the number of samples (12 in this case).

Thus, the Score% parameter can be related to the
ability of discriminating as many different samples as
possible, since it equals 100 when the variance of the
scores for each single sample is significantly lower than
the variance of all the scores for all the samples, i.e.,
when the range of the line scale used for evaluating
each single sample is considerably shorter than the
whole range used from the assessor for the considered
attribute.
Moreover, in order to properly account for the threeway nature of the data matrix obtained by the sensory
evaluation sessions (12 samples 7 attributes 16
judges), PARAFAC was employed.22 24 PARAFAC
is substantially an extension of PCA21,25 to three-way
data arrays and is particularly useful for exploration
of datasets presenting a three-way nature, such as
those derived from sensorial experiments. In fact, this
kind of data can be arranged in a cube-shaped array
reporting the evaluated samples in the first mode, the
sensory variables in the second mode and the judges
in the third one.
Similarly to PCA, which decomposes the information contained in the (two-way) data matrix into one
part reflecting object variation (scores) and another
part related to variables (loadings), when dealing with
a three-way array the PARAFAC model provides for
each one of the three ways (modes) a set of parameters (labeled as loadings of mode 1, 2, and 3), which
directly reflect the variability in the respective modes.
Therefore in PARAFAC, as in PCA, the variation
along each way of the dataset is described by a
restricted number of underlying latent variables or
factors. The three loading matrices that contribute to
the model are defined in a manner to minimize the
F
aif bjf ckf + eijk
(3)
f =1
where xijk represents the elements of the three-way

array X, F is the number of significant latent variables
(factors), and aif , bjf , and ckf are the elements of the
loading matrices A, B, and C, respectively.
In this way, the PARAFAC model provides
information about the variability in the modes of
interest and reveals the latent relationships among
samples, attributes and assessors. In the present study,
no pretreatment was necessary to analyze the threeway array, thus PARAFAC was applied to the raw data
matrix. Based on the clear indications given from the
core consistency plots and on other diagnostics like
residual variation and computation time,23 two factors
have been selected.
Moreover, the mean scores calculated over all the
assessors for each sample and each attribute were
analyzed together with the pigment concentration
values by PCA.
The analysis of variance was conducted by means
of the Statistics Toolbox ver. 5 (The Mathworks
Inc., Natick, MA, USA), while PCA and PARAFAC
were performed using the PLS Toolbox ver. 4
(Eigenvector Research Inc., Wenatchee, WA, USA),
both toolboxes running the Matlab 7.0 environment
(The Mathworks Inc.).

As a first screening, one-way ANOVA was carried
out to evaluate the discriminant ability of the judges.
To this end, for each assessor and each attribute the
difference among the values of the given attribute for
the different samples (between-samples variance) was
compared with the variability of repeated estimations
of the same sample (within-sample variance). For
clarity of representation, in Fig. 2 we report the
Figure 2. Values of log(F/Fcrit ) derived from the one-way ANOVA calculated for each assessor and each attribute over the different samples.
1338
J Sci Food Agric 88:13351343 (2008)

DOI: 10.1002/jsfa
logarithm of the ratio between the calculated F

values and the critical F value, log(F/Fcrit ), with Fcrit
corresponding to P = 90%. Positive log(F/Fcrit ) values
indicate significant differences among the samples
for the given attribute as evaluated by the given
judge. The general performance of the judges was
fairly similar, even if they showed different behaviors
towards the evaluated attributes. In fact, the lines
connecting the symbols of the different attributes are
frequently crossed, and there are no attributes showing
generally higher or lower values for all the assessors.
The only partial exception observed was concerning
the behavior of color homogeneity (CH) which, even
if showing positive values of log(F/Fcrit ) for all the
judges, frequently had rather low values. Judges 15 and
16 showed greater discriminant ability on the whole,
while judges 3 and 4 showed lower values. In any case,
each assessor was able to discriminate significantly
among the samples for all the attributes, except for
two subjects, who did not discriminate among the
pesto samples for the PR attribute (JUD3) and the
GH attribute (JUD4). However, since the exclusion
of JUD3 and JUD4 did not lead to significant
improvements in the global performance of the panel,
we decided to present the results of the whole sensory
dataset.
To estimate the differences among samples considering all the judges contemporarily, in order to evaluate
how much the single assessors differed in their judgments, and how much these differences varied with
varying samples, the sensory data for each attribute
were then subjected to a two-way ANOVA with samples, judges, and their interactions as effects (Table 1).
The F values highlighted statistically significant differences among the pesto samples for all the evaluated
attributes. In particular, the F values for PS, WA and
YH attributes were greater than for GH, suggesting
that, conversely to what was expected, the green hue is
not the only parameter having a remarkable effect on
the perceived quality by consumers. The F values for
the judges and for the (samples judges) interactions
were also statistically significant for all the attributes,
which is likely due to individual differences in the use
of the scale,29 including: (i) the use of different ranges
(i.e., more or less variability in the score values), (ii)
shift of the mean values (i.e., more or less generous
scoring on average) and (iii) nonlinearity (i.e., different increase in the score values with increasing values
of the given attribute). An example of this fact (or, at
least of the differences (i) and (ii)) is furnished by the
box and whiskers plot reported in Fig. 3, representing
the distribution along the sensory scale of the score
values for the GH attribute expressed by each judge.
The different judges tended to use the given scale in
a quite different manner. For example, JUD15 used
the sensory scale in a perfectly symmetric way, spreading his marks over the whole range. Also JUD9 used
approximately all the scale range but in an asymmetric
way, usually preferring marks at lower values of the
scale; on the contrary, other judges used a smaller
J Sci Food Agric 88:13351343 (2008)
DOI: 10.1002/jsfa
portion of the scale, such as JUD10, who concentrated 50% of his marks in the region between 6.5 and
7.5 cm. Similar box and whiskers plots were also been
obtained for the other sensory attributes.
When considering the differences among samples
for a given attribute by means of one- or two-way
ANOVA, the corresponding F value indicates how
different the samples are, but not how many samples
are evaluated as different. In other words, high F
values can be obtained by ANOVA even if only one
sample differs significantly from the others. Thus F
values do not furnish any indication about the number
of samples identified as different. Therefore, in order
to express the performance of the judges in terms of
their ability to separate for each attribute as many
different samples as possible, the Score% parameter
was calculated, as defined in the Data analysis
section above. Figure 4 represents the Score% values
for each judge with respect to the different attributes.
This figure shows how this measure of the judges
repeatability varies considerably from one attribute to
another. In particular, JUD15 seems to be the most
consistent, while JUD4 seems the most unreliable,
as is clearly pointed out by the solid line, which is
a mean of the Score% values for each assessor over
Table 1. Mixed analysis of variance (two-way ANOVA) results for the
seven sensory attributes (P < 0.001, except where otherwise
specified)
F values
Attributes
GH
YH
BH
WA
CH
PS
PR
a
Sample
12.36
52.60
10.51
37.18
19.75
35.72
7.31
Judge
5.20
13.68
8.25
7.61
6.66
2.71a
7.42
Interaction
6.00
2.21
4.12
3.27
2.14
2.70
4.85
P < 0.01.
Figure 3. Box and whiskers plot of the score value distribution for the
GH attribute.
1339
F Masino et al.
Figure 4. Score% values for the evaluation of each attribute by the 16 judges. The solid line (TOT) represents the mean of the Score% values for
each judge.
all the attributes. It must be underlined that these

observations partially coincide with the considerations
made for Fig. 2, indicating that these two evaluation
parameters furnish complementary information, but
are not redundant. In fact, even if the assessors with
the best and the worst overall performances coincide,
there are also cases where log(F/Fcrit ) and Score%
show different trends. For example, JUD3 gives rather
reproducible evaluations, since his Score% values are
high on average, but at the same time he does not
possess as many high F values for many attributes.
Summarizing, based on the results of one-way
ANOVA, two-way ANOVA and Score% it can be
stated that, though further training of judges could
have produced a better overall level of agreement, the
results are nevertheless sufficiently coherent.
The results obtained by univariate analysis are
surely valuable as a first screening of the sensory
data. However, more powerful multivariate analysis
methods are needed both to gain a better knowledge

about the dataset, and to consider the complex
mechanisms driving the behavior of the assessors
with respect to their interpretation of the meaning
of the attributes and to their ability to characterize
the different samples. Since the acquired dataset
presents a three-way nature, we decided to explore
the 3D array (48 samples 7 attributes 16 judges)
by means of the three-way multivariate PARAFAC
method. On the basis of different diagnostics
(including core consistency plots, residual variation
and computation time) two factors have been selected,
which explained 78.72% and 8.94% of the dataset
variance, respectively.
The scatter plot of the loadings of the two selected
factors for mode 1, i.e., the samples mode (Fig. 5),
reveals good overall repeatability in the evaluation
of the different samples, since the measures over
the four replicated subsamples are generally fairly
Figure 5. PARAFAC loadings plot for the first two factors for mode 1 (samples mode).
1340
J Sci Food Agric 88:13351343 (2008)

DOI: 10.1002/jsfa
well grouped together. Moreover, the samples can be

roughly divided into five different clusters: the largest
one composed of samples D, E, G, H and I, the second
one composed of samples J, K and L, then the cluster
of samples B and F and finally two isolated clusters
for samples A and C, respectively. In particular, the
separation of the cluster of samples J, K and L from the
others is very likely due to the fact that they are the only
samples that had not been subjected to pasteurization
and addition of organic acids.
The scatter plot of the loadings for mode 2, i.e., the
attributes mode (Fig. 6), shows that factor 1 is mainly
influenced by GH and CH, and in the second place
by BH, YH and PR. This suggests that the panel in
general preferred samples with a homogeneous aspect
and more brilliant colors (in particular, green). Factor
2 discriminates among two groups of attributes. At
positive values are located the WA, YH and PS
attributes, evidencing a certain correlation between
the attributes related to fair hues and particle size.
In fact, white and yellow are more evident in those

samples having a coarser size, where cheese and pine
nut particles are generally more visible. At negative
values of factor 2, where all the other attributes are
located, it can be seen that GH and CH are particularly
close to each other. This fact could indicate that
the judges estimated as showing a brighter green
hue those samples presenting a more homogeneous
aspect. To explain this behavior it must be considered
that, though generally pesto is composed of relatively
large particles lying in a clear oil phase, in some
cases the presence of emulsions is also possible. The
turbid aspect of the emulsified oil and water phases
could enhance the color homogeneity, contemporarily
affecting the lightness of pesto color, due to a lightscattering effect.30,31
Finally, the scatter plot of the loadings for mode
3, i.e., the judges mode (Fig. 7), shows in general a
good agreement among assessors, which all lie on the
first quadrant. Only JUD3 is partly separated from
Figure 6. PARAFAC loadings plot for the first two factors for mode 2 (attributes mode).
Figure 7. PARAFAC loadings plot for the first two factors for mode 3 (judges mode).
J Sci Food Agric 88:13351343 (2008)

DOI: 10.1002/jsfa
1341
F Masino et al.
Figure 8. Biplot of the first two principal components with the

respective explained variance reported in brackets. Circles identify
samples and plus signs identify variables.
the other judges, closer to the origin of the axes,

thus indicating a minor contribution of this judge
to the overall assessment of the analyzed samples.
As stated previously, the elimination of this assessor
from the panel has not led to significant variations in
the overall results. Therefore, these results essentially
corroborate the previous observations obtained by
univariate statistical tools, confirming an overall
sufficient agreement among judges.
PCA analysis (Fig. 8) was then applied to the
(12 samples 13 variables) autoscaled data matrix
containing the average values for the seven sensory
attributes plus the average values for the six chemical
parameters (pigment concentrations) as variables.
Only the first two principal components were found
to be significant, explaining more than 70% of the
total variance of the data matrix (49.91% for PC1
and 20.35% for PC2). The sensory attribute GH
and the chlorophyll content are located very close
together in the same quadrant of the figure, while
CH remains in the upper right quadrant together with
the PR attribute. Confirming the observations with
PARAFAC, it seems that the main contribution to
the sensory characterization of the analyzed samples is
due to green hue and color homogeneity, which exert
their positive influence on preference (GH, CH and
PR having positive values on PC1), in opposition to
fair hues and to particle size (WA, YH and PS having
negative values on PC1).
The opposite position of WA and PS with respect
to CH is the natural consequence of their opposite
effects. In fact, the larger is the particle size, the
more particles of pine nuts and cheese are visible,
and the less homogeneous in general is the product
color. Analogous considerations can be made for the
opposite position of GH with respect to YH and BH.
In the case of Car and Lut, their closeness is very
likely the consequence of the common biosynthetic
pathway, as for the Chl aChl b and Pht aPht
b couples. As could be expected, GH appears
1342
strictly correlated to the amount of Chl a and

b. Conversely, the correlations between the other
pigments (pheophytins and carotenoids) and their
hues (BH and YH) are less clear. In order to
explain this behavior, first it must be noted that
chlorophyll and carotenoid concentrations increase
contemporarily with plant growth.19 Subsequently,
the almost quantitative conversion of chlorophylls into
pheophytins in the pasteurized samples can explain
the proximity of carotenoids and pheophytins. For
the same reason, the almost opposite position of
chlorophylls with respect to pheophytins seems not
accidental. Moreover, a high amount of cheese and
pine nuts (not strictly correlated with carotenoid
content) may alter color perception as a consequence
of their white and yellow light hue, thus making YH
not strictly related to Car and Lut.
Also the interpretation of the spatial distribution
of the PCA scores seems coherent with the results
obtained from PARAFAC. In fact, Fig. 8 shows that
the three non-pasteurized pesto samples J, K, and
L, are definitely separated from the others, being
the only ones showing positive values on PC1,
which corresponds to brighter green hues, higher
chlorophyll content and higher preference by the
assessors. On the contrary, all the other samples are
positioned on the opposite hand of the plot, suggesting
evident discrimination between non-pasteurized and
pasteurized products. Similarly to what was observed
in the corresponding PARAFAC plot of Fig. 5, sample
C is positioned apart from the others, mainly for
its high WA and PS values. Samples D, E, G,
H, and I are grouped together in the PCA scores
plot as they were in the corresponding plot of
PARAFAC, but in the PCA scores plot also sample
A and, to a minor extent, sample B become part
of the cluster. Conversely, sample F shows a greater
separation from this cluster, which can be mainly
explained by its higher pheophytin content. The results
obtained from PCA analysis on the whole sensory
and compositive variables set seem therefore to be in
agreement with those gained by PARAFAC analysis
carried out on sensory attributes only.
CONCLUSIONS
The results presented suggest that a properly trained
panel of judges can furnish useful information about
aspect-related attributes of pesto sauce and about their
dependence on pigment composition which, in turn,
depends on the amount of ingredients and on the
production process.
Probably the most remarkable evidence furnished
by the present study regards the objective evaluation
of the agreement between the assessments made by the
judges and pigment composition. Notwithstanding the
significant interaction found between pesto samples
and judges, the overall evaluations are clearly coherent
and reproducible, and partially consistent with the
results obtained by chromatographic analysis of
J Sci Food Agric 88:13351343 (2008)
DOI: 10.1002/jsfa
pigments. In particular, chlorophyll content has a neat

influence on green hue which, together with color
homogeneity, seems to have a positive influence on
the general appreciation of the product. Conversely,
pheophytins and carotenoids have a negative influence
on pesto appearance, even if these pigments have only
a partial effect on the brown and yellow hues of the
product.
The strong relations between pigment concentrations and visual aspect, together with the good repeatability of the measured sensory attributes, are leading
us to continue research work in this direction, with the
aim of evaluating the possibility of quantifying visual
attributes and pigment concentrations by appropriate
multivariate digital image analysis methods.
ACKNOWLEDGEMENTS
The authors wish to gratefully thank the judges who
kindly took part in the panel test.
REFERENCES
1 Lea P, Naes T and Rodbotten M, Analysis of Variance for Sensory
Data. Wiley, New York (1997).
2 Lawless HT and Heymann H, Sensory Evaluation of Food:
Principles and Practices. Chapman & Hall, New York (1998).
3 Murray JM, Delahunty CM and Baxter IA, Descriptive sensory
analysis: past, present and future. Food Res Int 34:461471
(2001).
AM, Sensory evaluation in quality control: an overview,
4 Munoz
new developments and future opportunities. Food Qual Prefer
13:329339 (2002).
5 Sidel JL and Stone H, The role of sensory evaluation in the food
industry. Food Qual Prefer 4:6573 (1993).
6 Maga JA, Influence of color on taste thresholds. Chem Sens Flav
1:115119 (1974).
7 DuBose CN, Cardello AV and Maller O, Effects of colorants
and flavorants on identification, perceived flavor intensity and
hedonic quality of fruit-flavored beverages and cake. J Food
Sci 45:13931399 (1980).
8 Johnson J and Clydesdale FM, Perceived sweetness and redness
in colored sucrose solution. J Food Sci 47:747752 (1982).
9 Christensen CM, Effect of color on aroma, flavor and texture
judgements of foods. J Food Sci 48:787790 (1983).
10 Christensen CM, Effect of color on judgements of food aroma
and flavor intensity in young and elderly adults. Perception
14:755762 (1985).
11 Previdi MP, Vicini E, Squarcina N and Lusardi C, Aspetto
igienico-sanitario e stabilizzazione microbiologica del Pesto
Ligure. Ind Conserv 73:272277 (1997).
J Sci Food Agric 88:13351343 (2008)

DOI: 10.1002/jsfa
12 Vicini E and Previdi MP, Aspetti microbiologici del Pesto

Ligure. Ind Conserv 67:426429 (1992).
13 Antonelli A, Cocchi M, Fava P, Foca G, Franchini GC,
Manzini D, et al, Automated evaluation of food colour by
means of multivariate image analysis coupled to a waveletbased classification algorithm. Anal Chim Acta 515:313
(2004).
14 Di Cesare LF, Forni E, Viscardi D and Nani RC, Changes in
the chemical composition of basil caused by different drying
procedures. J Agric Food Chem 51:35753581 (2003).
15 Lau MH, Tang J and Swanson BG, Kinetics of textural and
colour changes in green asparagus during thermal treatments.
J Food Eng 45:231236 (2000).
16 Teng SS and Chen BH, Formation of pyrochlorophylls and
their derivatives in spinach leaves during heating. Food Chem
65:367373 (1999).
17 Forni E, Grezzi M and Polesello A, Determinazione mediante
HPLC delle clorofille e delle feofitine nei vegetali freschi e
congelati. In Proceedings of 2nd Forum Analitico HP, 2224
June (1988). Rome, pp. 7589.
18 Fabiano B, Perego P, Pastorino R and Del Borghi M, The
extension of the shelf-life of pesto sauce by a combination of
modified atmosphere packaging and refrigeration. Int J Food
Sci Technol 35:293303 (2000).
19 Masino F, Ulrici A and Antonelli A, Extraction and quantification of main pigments in pesto sauces. Eur Food Res Technol
226:569575 (2007).
20 Meilgaard M, Civille GV and Carr BT, Descriptive Analysis in
Sensory Evaluation Techniques (3rd edn). CRC Press, Boca
Raton, FL (1999).
21 OMahony M, Sensory Evaluation of Food: Statistical Methods and
Procedures. Marcel Dekker, New York (1986).
22 Bro R, PARAFAC: tutorial and application. Chemom Intell Lab
Syst 38:149171 (1997).
23 Smilde A, Bro R and Geladi P, Multi-way Analysis: Applications
in the Chemical Sciences. Wiley, Chichester (2004).
24 Henrion R, N-way principal component analysis theory,
algorithm and applications. Chemom Intell Lab Syst 25:123
(1994).
25 Massart DL, Vandenginste BGM, Buydens IMC, De Jong S,
Lewi PJ and Smeyers-Verbeke J, Handbook of Chemometrics
and Qualimetrics: Part A. Elsevier, Amsterdam (1997).
26 ISO 8586-1, (1993). Sensory analysis general guidance for the
selection, training and monitoring of assessors. Part 1: Selected
assessors (1993).
27 ISO 3972, Sensory analysis Methodology Method investigation
sensitivity of taste (1991).
28 Lundahl DS and McDaniel MR, The panelist effect fixed or
random. J Sens Stud 3:113121 (1988).
29 Naes T and Langsrud O, Fixed or random assessors in sensory
profiling? Food Qual Pref 9:145152 (1998).
30 McClements DJ, Colloidal basis of emulsion color, Curr Opin
Colloid Interface Sci 7:451455 (2002).
31 McClements DJ, Theoretical prediction of emulsion color, Adv
Colloid Interface 97:6389 (2002).
1343
J Sci Food Agric 88:13441353 (2008)
Effect of electrical stimulation,

delayed chilling and post-mortem aging
on the quality of M. longissimus dorsi and
M. biceps femoris of grass-fed steers
Regina H Razminowicz, Michael Kreuzer and Martin RL Scheeder
ETH Zurich, Institute of Animal Science, Universitatstrasse

2, CH-8092 Zurich, Switzerland
Abstract
BACKGROUND: Roughage-based low-input beef production systems are gaining increasing interest owing to the
perceived ecological advantages and potential health benefits associated with the favourable fatty acid composition
of such beef. The low plane of nutrition may on the other hand yield less tender beef by affecting growth, carcass
weight and fatness and therefore, indirectly, early post-mortem (p.m.) proteolytic enzyme activity and sarcomere
shortening. This study aimed to examine delayed chilling and electrical stimulation as promising techniques to
control early p.m. muscle metabolism in a way that improves the tenderness of beef from purely grass-fed steers
in comparison with that from steers receiving a finishing diet with concentrates.
RESULTS: Electrical stimulation decreased the pH at 1.5 and 3 h p.m. in the M. longissimus dorsi (LD) and
M. biceps femoris (BF) of the treated carcass sides as well as the maximum shear force in the LD, while delayed
chilling had no effect on pH or texture. The interactions of carcass fatness with electrical stimulation (P = 0.025)
and delayed chilling (P = 0.089) indicated more pronounced effects of the p.m. treatments on beef texture in leaner
carcasses.
CONCLUSION: Electrical stimulation, but not delayed chilling, could markedly improve pasture beef texture and
reduce the aging period needed for proper tenderisation.
Keywords: beef; electrical stimulation; chilling; tenderness; aging; pasture
INTRODUCTION
It has been argued1 that eating satisfaction depends
on a combination of pleasant flavour, juiciness and
tenderness and that all three components should be
considered for meat quality assessment. Nevertheless,
toughness seems to represent the most important cause
of consumer dissatisfaction in beef, and variability in
meat quality, particularly in texture, is regarded as a
major problem worldwide for both the meat industry
and consumers.2 Toughness depends mainly on the
amount and maturity of connective tissue in the meat
(background toughness), the myofibrillar toughness,
depending on the contraction state and fragmentation
of contractile proteins in the muscles,3 and the
interaction between these compounds. The properties
of these proteinaceous structural compounds of beef
texture and the enzymes controlling their synthesis
and degradation may depend on the breed and
genotype of the animal. For instance, a mutation
in the myostatin gene, causing the double-muscled
syndrome, improves beef tenderness.4 There are also

DNA tests for genetic markers of tenderness available.5
However, slaughter and chilling technology and aging
are further major factors influencing beef texture.
Myofibrillar toughness of meat is mainly influenced
by two types of process: development of rigor mortis
and enzymatic tenderisation during aging.6 Rapid
chilling of beef carcasses after slaughter is common
practice today in order to limit weight loss and
maintain a satisfactory microbial status, but it also
facilitates the development of myofibrillar toughness.
Since the degree of shortening of pre-rigor muscle,
which is temperature-dependent,7 is a key factor in
meat tenderness,8 it is clear that the timetemperature
relationship during rigor development has a most
profound effect on myofibrillar toughness.3
This may explain why studies comparing the palatability of beef from cattle fattened on forage- versus
concentrate-based diets have produced inconsistent
results.9,10 The outcome of such studies may well be
Correspondence to: Martin RL Scheeder, Swiss College of Agriculture, Langgasse

85, CH-3052 Zollikofen, Switzerland
E-mail: martin.scheeder@suisag.ch
The experiment was approved by the Cantonal Veterinary Office, Zug, Switzerland under approval number ZG 33/04
Contract/grant sponsor: Hermann Herzer Foundation
(Received 3 July 2007; revised version received 26 December 2007; accepted 7 January 2008)
Beef quality in grass-fed steers: effect of chilling regime and electrical stimulation
biased by interactions between the chilling regimens

applied and carcass weight and fatness. Because cerealbased (high-energy) diets often yield heavier and fatter
carcasses than forage-based diets, tenderness might
be increased as a result of decelerated post-mortem
(p.m.) temperature decline in the muscles.11 Simultaneously, enhanced early p.m. activity of proteolytic
enzymes in the muscles may additionally increase the
ultimate tenderness of beef from fatter carcasses.11,12
Reduced tenderness in relation to extensive feeding could therefore be at least partly the result of
interactions with slaughter/chilling technology. Supplementation of grass with some concentrate may
produce more tender meat,13,14 although this was not
always found,15 and no difference between pasture
beef and conventional beef obtained at the point of
sale was found in a Swiss retail study.16
Nevertheless, forage-only fattening, applied to make
use of the ecological and economic merits of extensive
(low-input) beef production on grasslands as well
as for the potential health benefits associated with
changes in the fatty acid composition of such beef,16
bears the risk of increased toughness.17 Appropriate
p.m. treatment of carcasses may help to prevent this.
Technologies to decrease myofibrillar toughness by
preventing cold shortening or reduced proteolytic
activity in the muscles include electrical stimulation
of carcasses18 and delayed chilling, either accelerating
p.m. muscle metabolism and inducing a rapid pH
decline19 or simply reducing the cooling rate.20
The hypothesis to be tested in the present investigation, therefore, was that different p.m. technologies,
namely electrical stimulation and delayed chilling,
improve the texture of beef from grass-fed animals,
particularly in lean carcasses. For this purpose, steers
fattened in a controlled feeding experiment were
employed.13 By supplementation with concentrate
during finishing of some of the animals, variation
among carcasses in fat cover was obtained. The effects
of the technologies applied were tested within animals,
with one carcass side having been exposed to either
electrical stimulation or delayed chilling and the other
side acting as the conventionally treated control.

Animals
Thirty-four Limousin-sired crossbred steers out of
Brown Swiss (n = 17) and Holstein-Friesian (n = 17)
dams were fed on a forage-only diet (grass in summer,
grass silage and hay in winter) until reaching 470 kg
live weight. During subsequent finishing up to 560 kg
(6 kg standard deviation) live weight and 560 days
(16 days) of age on average the diet was based on
a 95:5 (w/w) grass/hay mixture offered ad libitum.
Half of the steers additionally received 3 kg of cerealbased concentrate. The diets were supplemented
by a 1:1 (w/w) mixture of sodium chloride and
commercial vitamin/mineral mix at 100 g day1 per
head. Eight Brown Swiss and nine Holstein-Friesian
J Sci Food Agric 88:13441353 (2008)
DOI: 10.1002/jsfa
crossbred animals were allocated to the grass/hay-only

treatment, while nine Brown Swiss and eight HolsteinFriesian crossbreds were allocated to the concentratesupplemented feeding. The animals were housed in six
pens of six animals each and had responder-controlled
access to individual feeding places.
Slaughter process and chilling procedure
Animals were fasted for 12 h before being weighed in
the morning of the slaughter day. Within the next few
hours the animals were transported to a commercial
slaughter plant. Slaughter took place within 2 h of
departure from the farm. The steers were stunned with
a captive bolt, exsanguinated and dressed following
commercial procedures. Hot carcass weights were
recorded 30 min p.m., and the right carcass sides of
16 animals (eight from each dam breed group) were
electrically stimulated (ES) with 230 V and 60 Hz for
30 s (Elektrostimulationsgerat Type IMA, Schermer &
Co., Apparatebau, Ettlingen, Germany). The current
was applied through clips attached to the muscles
of the neck region and the Achilles tendon. After
stimulation, both carcass sides were chilled for 90 min
in a blast chiller at a temperature of 5 C, 90%
relative humidity and an air speed of about 4 m s1 .
These carcasses are further referred to as data set 1.
For the other 18 animals (nine per dam breed group;
data set 2) the left carcass sides were chilled in the
same way, while the right sides of the carcasses were
subjected to delayed chilling (DC) by holding them
for 90 min at a temperature of 15 C. From then
on, all carcasses were stored in a chilling room at a
temperature of 2 C on average (air speed 0.2 m s1 ,
humidity 90%).
Early post-mortem temperature and pH
measurement
Temperature and pH were measured in the
M. longissimus dorsi (LD; between the 10th and
11th ribs) and M. biceps femoris (BF) at 1.5 h p.m.
(pH1.5h ) and 3 h p.m. (pH3h ) using an IP67 electrode
(model SenTix 21) attached to a WTW-340 pH meter
(Wissenschaftliche Technische Werkstatte, Weilheim,
Germany). The temperature of both muscles was measured with a PT-100 probe mounted on a TTX 290
SKW (Ebro, Ingolstadt, Germany) at depths of 3, 5.5
and 8 cm.
Sample preparation
Two days after slaughter the left side of each carcass
was dissected according to a standardised industry
procedure and the amount of saleable meat, bone and
dissected fat (further referred to as cutting fat) was
recorded. The amount of cutting fat was on average
8.4% of the cold carcass weight and ranged from 5.2
to 13.9%. Following dissection, meat samples from
the LD (2 kg; between the 9th and 12th ribs) and
BF (2 kg; between the line from the ischium to the
acetabulum and a parallel cut further distal at about
30% of the length of the femur) were taken from both
1345
RH Razminowicz, M Kreuzer, MRL Scheeder
carcass sides and transported in a refrigerated box to

the laboratory. Directly after transport the ultimate
pH was measured and 2.5 cm thick slices were cut for
colour measurements and later texture analysis. The
remaining part was vacuum packaged and kept to age
at 2 C for 15 days, while another 2.5 cm slice was
taken and stored frozen. From the LD an additional
2.5 cm slice was aged for a total of 29 days and then
stored at 20 C until analysis.
Meat colour and texture measurements
Meat colour was always measured at the same three
positions on the freshly cut surface after blooming
for 1 h at 4 C, using a Chroma Meter (model 300CR, Minolta, Dietikon, Switzerland) with an observer
angle of 0 and applying the L , a , b colour system
with D65 as light source. However, because no
treatment effect on beef colour was detected, data
of the colour measurements are not reported in the
tables nor referred to in the discussion.
After the colour measurements the slices were
weighed, vacuum packaged and kept frozen at 20 C
until used for texture measurements. For those, the
samples were thawed for 24 h at 4 C, then grilled
to a core temperature of 72 C in an electrical
double-contact grill (model TURMIX 246, Beer Grill,
Zurich, Switzerland) heated to 240 C. The core
temperature was controlled by two thermocouples
(Thermo ZA9020-FS, NiCr-Ni Type K) attached to
a data logger (ALMEMO model 3290-8, Ahlborn,
Holzkirchen, Germany) and placed in the centre of
the slices. Cooking loss was determined after cooling
the grilled slices on a grid for 30 min at ambient
temperature. From each of the LD and BF samples a
total of six cores (cylinders of 1.27 cm diameter) and
six strips (1 1 cm2 cross-section) were prepared by
drilling and cutting respectively parallel to the muscle
fibre direction. The LD samples were taken from six
defined positions in the arrangement shown in Fig. 1.
The BF samples were also taken from six defined
position of two rows from the superficial to the deep
side of the muscle and three columns from the lateral to
the medial side of the muscle. The cores were sheared
by a modified Warner-Bratzler shear blade (slot width
3.3 mm, 3 mm blade, measuring in compression) and
the strips by a Volodkevich device, both mounted on
a TA-XT2 texture analyser (Stable Micro System,
Godalming, UK). The texture measurements were
performed on slices at all aging stages (2, 15 and
29 days for the LD and 2 and 15 days for the BF).
Statistical analyses
Data were statistically analysed with the SAS program
(Version 8.0, SAS Institute Inc., Cary, NC, USA),
applying the General Linear Model (GLM) procedure
for analyses of variance and using different models
in a block design with the animals as block. Data
sets 1 and 2, i.e. ES and DC, were analysed
separately. In both cases the model included aging
time, p.m. treatment (ES versus non-stimulated (CO1)
1346
3
4
Figure 1. Locations within M. longissimus dorsi for collection of

cores (circles 16) for determination of maximum shear force
(Warner-Bratzler device) and strips (squares 16) for measurement of
compression energy (Volodkevich device).
or DC versus conventional (CO2)), dam breed (Brown

Swiss or Holstein-Friesian), feeding treatment and
the interactions aging time p.m. treatment, p.m.
treatment genotype and p.m. treatment cutting
fat as effects. The model to calculate the effects
of core/strip location within beef slices included
position, aging time, treatment and the interactions
between these effects. Data were further subjected
to Pearson correlation analyses. Additional GLM
procedures considering the proportion of cutting fat
or the slaughter weight as co-variables were applied to
evaluate possible linear effects of these variables under
different chilling regimens on meat texture properties.
RESULTS
Meat temperature and pH
The pH and temperature profiles measured in the LD
and BF illustrate that ES and DC resulted in different
rates of pH and temperature decline when compared
with the conventionally chilled controls (Fig. 2). The
temperature of the LD at 1.5 and 3 h p.m. was slightly
higher with ES compared with CO1. This effect was
more pronounced deep inside the muscle. The major
effect of ES, however, was a more rapid pH decline in
both muscles. The mean pH3h was slightly below 6 in
the LD and slightly above 6 in the BF in ES, while it
was still at above 6.5 in CO1. As intended, the DC
treatment resulted in a higher temperature compared
with CO2 in both muscles and at all locations and
times of measurement. In contrast, there was no or
only a very small effect on pH, resulting in a pH3h of
around 6.4 in both treatments. A relationship between
either cutting fat proportion or carcass weight and
early p.m. muscle temperature or pH in the LD was
only observed in the DC treatment, with correlations
between carcass weight and temperature taken at the
J Sci Food Agric 88:13441353 (2008)
DOI: 10.1002/jsfa
m. longissimus dorsi
CO1/ ES
40
35
CO1
ES
30
25
n.s.
20
15
8
***
Temperature C
Temperature C
***
pH
pH
30
***
***
***
25
20
15
8
n.s.
3 cm 5.5 cm 8 cm
1.5 h
3 cm 5.5 cm 8 cm
3h
3 cm 5.5 cm 8 cm
3h
m. biceps femoris
CO1 / ES
*
CO1
ES
n.s.
n.s.
n.s.
n.s.
n.s.
***
Temperature C
3 cm 5.5 cm 8 cm
1.5 h
Temperature C
35
CO2
DC
***
m. biceps femoris
*** CO2 / ES
40
30
CO2
DC
***
***
35
***
***
25
***
20
15
8
***
n.s.
n.s.
3 cm 5.5 cm 8 cm
1.5 h
3 cm 5.5 cm 8 cm
3h
6
pH
pH
***
4
2
2
0
40
40
35
30
25
20
15
8
CO2 / ES
***
3 cm 5.5 cm 8 cm
1.5 h
3 cm 5.5 cm
3h
8 cm
Figure 2. Temperature (lines) and pH (bars) at 1.5 and 3 h p.m. in M. longissimus dorsi and M. biceps femoris from steer carcasses treated by two
different regimes: CO1, control group 1; ES, electrically stimulated group; CO2, control group 2; DC, delayed chilling group. Error bars indicate
standard deviations. Comparisons between p.m. treatments within the same experimental data set were done with the t test: P < 0.001;
P < 0.05; P < 0.1; n.s., not significant.
different depths (3, 5.5 and 8 cm) and times (1.5

and 3 h p.m.) ranging from 0.44 (P = 0.06) to 0.6
(P = 0.009). The p.m. treatments had no effect on the
ultimate pH of meat aged for 2 and 15 days. However,
in both muscles of CO1/ES and in the BF of CO2/DC
the pH increased with aging time (Table 1).
No differences in early p.m. temperature decline
in the LD and BF of steers of different dam breeds
were observed (data not shown). In experimental data
set 1 (ES and CO1), pH1.5h and pH3h were lower in
the LD of the Limousin Holstein steers (6.42 and
6.15 respectively) compared with the LD of the Brown
Swiss progeny (6.62 and 6.35 respectively). A significant interaction between breed type and chilling treatment occurred only in the LD in experimental data set
1, with the LD of steers from Brown Swiss dams showing a higher pH than the LD of steers from Holstein
dams only in the non-stimulated LD (data not shown
in table), while no dam breed effects on the ultimate
pH in the aged LD were found (Table 2). No such
effects could be observed in experimental data set 2.
J Sci Food Agric 88:13441353 (2008)
DOI: 10.1002/jsfa
Cooking loss and meat texture

Cooking loss was higher in the BF than in the LD,
which can be explained by the longer cooking time
required to reach the target core temperature in the
BF (10 min compared with 7 min for the LD). No
significant effect of chilling regimen and dam breed on
cooking loss was found and no relevant interactions of
the p.m. treatments with other factors were observed
for meat colour traits and cooking loss.
The ES-treated LD showed lower maximum shear
force values compared with CO1 at 2 and 15 days p.m.
(Fig. 3). The treatment differences were no longer
significant after 29 days of aging, as the LD shear
force did not decrease further in ES but did do so in
CO1. In both ES and CO1, Volodkevich compression
energy (VOL) in the cooked LD decreased with aging,
until mean VOL values of 1.04 and 1.22 J (P = 0.10)
respectively were reached after 29 days of aging. The
DC treatment remained ineffective in decreasing the
maximum shear force in the LD at any stage of aging.
The mean level of maximum shear force remained
above 40 N even after 29 days of aging. There were
1347

Table 1. Effect of electrical stimulation, delayed chilling and post-mortem aging on pH, cooking loss and texture properties (least square means
and standard error of least square means (SEM))
Post-mortem treatment (PT)a

Aging (A; days p.m.)
M. longissimus dorsi
Ultimate pH
Cooking loss (%)
Compression energyb (J)
M. biceps femoris
Ultimate pH
Cooking loss (%)
Maximum shear forcec (N)
Post-mortem treatmentd
M. longissimus dorsi
Ultimate pH
Cooking loss (%)
M. biceps femoris
Ultimate pH
Cooking loss (%)
Maximum shear forcec (N)
Control (CO1)
Electrically stimulated (ES)
P level
15
15
SEM
PT
PT A
CFe
PT CF
5.46
25.0
1.98
5.50
24.0
1.46
5.47
24.7
1.56
5.52
24.3
1.15
0.010
0.53
0.069
0.748
0.837
0.017
<0.001
0.006
<0.001
0.693
0.831
0.184
0.453
0.003
0.001
0.925
0.805
0.154
5.40
31.1
35.4
1.38
5.45
29.6
43.0
1.29
5.40
32.1
38.5
1.36
5.47
30.6
42.9
1.30
0.012
1.01
1.90
0.048
0.324
0.678
0.647
0.749
<0.001
0.148
0.002
0.118
0.477
0.976
0.394
0.702
0.541
0.342
0.139
0.044
0.228
0.535
0.531
0.744
Control (CO2)
Delayed chilling (DC)
5.46
24.7
2.13
5.45
24.8
1.69
5.48
24.4
1.93
5.46
25.6
1.51
0.019
0.79
0.088
0.374
0.954
0.264
0.442
0.609
<0.001
0.953
0.726
0.182
0.080
0.069
0.005
0.462
0.933
0.403
5.38
31.4
38.8
1.54
5.44
30.9
40.2
1.39
5.38
32.8
40.9
1.52
5.45
31.1
43.2
1.48
0.025
0.91
1.92
0.052
0.796
0.133
0.175
0.046
0.007
0.185
0.310
0.063
0.752
0.508
0.807
0.286
0.064
0.007
0.038
0.001
0.764
0.087
0.097
0.030
n = 16 per treatment.
Volodkevich device.
c Warner-Bratzler device.
d n = 18 per treatment.
e Cutting fat proportion of carcass weight.
a
Table 2. Interaction of dam breed and post-mortem treatment on quality of M. longissimus dorsi (average of 2 and 15 days of aging) from steers
treated by two different regimes (least square means and standard error of least square means (SEM))
Dam breed (D)
Post-mortem treatment (PT)a

Ultimate pH
Cooking loss (%)
Maximum shear forceb (N)
Compression energyc (J)
Post-mortem treatmentd
Ultimate pH
Cooking loss (%)
Maximum shear forceb (N)
Compression energyc (J)
Brown Swiss
Holstein-Friesian
P level
Control (CO1)
Electrically
stimulated (ES)
Control (CO1)
Electrically
stimulated (ES)
SEM
D PT
5.48
25.4
48.1
1.53
5.49
24.9
38.7
1.25
5.49
24.4
52.2
1.56
5.50
25.1
38.7
1.26
0.011
0.48
2.56
0.063
0.332
0.442
0.483
0.778
0.947
0.149
0.395
0.838
Control (CO2)
Control (CO2)
5.44
25.6
65.9
1.87
5.47
25.3
64.4
1.67
5.47
23.9
57.0
1.57
5.46
25.0
59.4
1.58
0.020
0.66
3.37
0.074
0.556
0.128
0.041
0.008
0.298
0.303
0.553
0.142
n = 8 per sub-treatment; the P level for PT is given in Table 1.

Warner-Bratzler device.
c Volodkevich device.
d n = 9 per sub-treatment.
a
also no DC effects on VOL values of the LD, finally

reaching 1.42 and 1.35 J in DC and CO2 respectively.
In the BF, no effect of the chilling treatments on
maximum shear force was observed and, in contrast to
the LD, the shear force of the BF did not decrease from
2 to 15 days of aging and was even higher after aging
in CO1. The VOL values decreased only marginally
with aging.
1348
The texture traits were affected by the fatness of

the animals (proportion of cutting fat) for both experimental data sets, particularly in the LD (e.g. P < 0.01
and P = 0.09 for maximum shear force in CO1/ES
and CO2/DC respectively). Additionally, interactions
of cutting fat with p.m. treatments occurred for maximum shear force in CO1/ES (P < 0.05) as well as in
CO2/DC (P < 0.1) (Fig. 4). Accordingly, increasing
J Sci Food Agric 88:13441353 (2008)
DOI: 10.1002/jsfa
Maximum shear force (N)
n.s.
120
***
n.s.
80
80
n.s.
**
n.s.
40
40
2d
15 d
29 d
2d
15 d
Maximum shear force (N)
CO1
ES
CO2
DC
120
29 d
CO1 / ES
50
40
30
20
10
0
3
CO2 / DC
50
y = -2.9878 x + 37.975
R2 = 0.24
PInteraction = 0.025
12
15
Cutting fat (%)
Delta maximum shear force
Delta maximum shear force
Figure 3. Effect of aging time on maximum shear force (Warner-Bratzler device) of M. longissimus dorsi: CO1, control group 1; ES, electrically
stimulated group; CO2, control group 2; DC, delayed chilling group. Error bars indicate standard deviations. Comparisons between treatments
within the same experimental data set were done with the t test: P < 0.001; P < 0.01; n.s., not significant. P levels for aging, p.m. treatment
aging and cutting fat were <0.001, 0.137, <0.001 and <0.001, 0.710, 0.09 for the CO1/ES and CO2/DC p.m. treatments respectively.
y = -5.0529 x + 40.818
R2 = 0.27
PInteraction = 0.089
40
30
20
10
0
-10
12
-20
-30
-40
Cutting fat (%)
Figure 4. Interaction between amount of cutting fat and p.m. treatments on M. longissimus dorsi maximum shear force (Warner-Bratzler device):
CO1, control group 1; ES, electrically stimulated group; CO2, control group 2; DC, delayed chilling group. Delta maximum shear force is the
difference between the shear force measured in the steak from the CO side and that measured in the steak from the p.m. treated (ES or DC) side of
the same animal.
cutting fat proportions decreased the effects of the

p.m. treatments ES and DC on the LD shear force
relative to the control (Fig. 4). Therefore at low carcass fatness there was a certain positive effect of DC
which was reversed at high fatness, together leading
to a zero net effect of DC. In contrast to the LD,
in the BF of CO1/ES treatments, cutting fat affected
only compression energy, and no significant interactions with p.m. treatment were observed (Table 1).
However, both texture traits of the BF were affected
by cutting fat proportion in CO2/DC, and significant interactions with p.m. treatments were observed
(Table 1).
Maximum shear force and Volodkevich compression energy were lower for Holstein compared with
Brown Swiss offspring only in experimental data set
2 (CO2/DC) (Table 2). No interactions occurred
between dam breed and p.m. treatments.
Within the LD slice, maximum shear force was
lower for the core locations (Fig. 1) 1, 2 and 4 than
for location 5 and particularly locations 3 and 6,
J Sci Food Agric 88:13441353 (2008)
DOI: 10.1002/jsfa
producing a tenderness gradient from dorso-medial

to ventro-lateral (Fig. 5). These differences were
observed in the LD of all experimental treatments and
at all stages of aging (data not shown). Additionally,
significant interactions between ES treatment and
position were observed, with the ES-stimulated LD
showing less variation among positions and therefore
not only a more favourable but also a more
consistent texture over the cross-sections of the LD
slices.
DISCUSSION
Effects of production factors on beef quality
Extensive grass-based feeding is an inexpensive
method of fattening. However, the value of beef from
this production method is often discounted compared
with beef from concentrate-dominated diets because
of perceived or assumed differences in meat quality, an assumption which, however, is not necessarily
supported by investigations of beef obtained at the
1349

120
120
CO1
ES
CO2
DC
o
n.s.
n.s.
n.s.
80
***
80
n.s.
n.s.
**
o
40
40
Core location
Figure 5. Effect of core location within M. longissimus dorsi (see Fig. 1) on maximum shear force (Warner-Bratzler device) after 15 days of aging:
CO1, control group 1; ES, electrically stimulated group; CO2, control group 2; DC, delayed chilling group. Error bars indicate standard deviations.
Comparisons between treatments within the same core location were done with the t test: P < 0.001; P < 0.01; P < 0.05; P < 0.1; n.s., not
significant.
retail level.16 As grass-based fattening can be accompanied by less intensive growth of the animals, they
are often older at slaughter, which might be associated with less tender17 and darker meat21 and a
lower proportion of carcass fat than in other, more
intensive, feeding systems.10 Early animal production
studies11 indicated that fatter animals usually produced meat that was more tender than that from leaner
animals. This was partly confirmed by the results of the
present study, where a higher cutting fat proportion
was associated with a reduction in shear force in the
15 day aged LD of CO1 (r = 0.52, P = 0.04) and
CO2 (r = 0.36, P = 0.14). There was no correlation
between intramuscular fat content and shear force in
the 15 day aged LD of the carcasses of data set 1 (either
in ES or in CO1 carcasses; P > 0.25), while in data set
2 the correlation coefficients were 0.49 (P = 0.04)
for CO2 and 0.47 (P = 0.048) for DC. However,
intramuscular fat content and cutting fat proportion
were significantly correlated in data set 2 (r = 0.59,
P = 0.01), indicating collinearity. This correlation was
not that pronounced in data set 1 (r = 0.34, P = 0.2).
According to Koohmaraie and Geesink,2 the effect of
intramuscular fat on tenderness is often overemphasised and was estimated to contribute about 5% of the
variability in tenderness. In the present study the correlation of intramuscular fat content and shear force is
inconsistent in data sets 1 and 2, and the proportion of
cutting fat correlated with shear force only in the conventionally chilled carcass sides but not in the ES or
DC ones. A favourable effect of higher carcass fatness
may therefore be explained by the insulating effect
of the carcass fat cover and bigger-sized carcasses,
both decelerating the chilling rate. Production factors
influencing tenderness of grass-fed cattle by increasing
1350
fatness include gender (steers, as used here, generally deposit more body fat than bulls), supplementary
feeding in the finishing period (varied in the present
study and reported to affect carcass composition and
meat quality in cattle and lambs13,10,22 ) and breed.
Meat quality characteristics of different cattle breeds
have been investigated in various studies.20,23 Such
comparisons, however, mostly refer to different sire
breeds used for crossbreeding with dairy cows. The
potential role of the dam breed in beef production
is less well documented. In the two data sets of the
present study, some dam breed effects were found.
However, these were not always consistent across the
two data sets. In the second data set the beef from
steers born to Holstein dams was significantly more
tender than the meat from steers of Brown Swiss
dams (confirmed by both measures applied). Dam
breed differences could result from genetic differences
in enzymatic activity, fibre types and structural
characteristics.24 Differences in the rate of early p.m.
pH decline could affect the activity of enzymes2
but can hardly explain the lower Warner-Bratzler
values found in the LD of the Holstein offspring
in experimental data set 2, because differences in
p.m. pH were found only in experimental data set 1,
which in turn exhibited no difference in meat texture
characteristics between dam breed groups. Therefore
no conclusive evidence for dam breed effects can
be drawn from this study. Anyway, according to
Koch et al.,25 only about 30% of the variation in
beef tenderness between breeds can be explained by
additive gene effects, whereas 70% is explained by
environmental and non-additive gene effects.
J Sci Food Agric 88:13441353 (2008)
DOI: 10.1002/jsfa
Effects of post-mortem treatments on beef

quality
The first 24 h after the animal is slaughtered, complex
biochemical and structural processes take place while
the muscle converts to meat. During this period, rapid
chilling of the carcass to a temperature of 7 C or less
within 24 h is desired in order to improve shelf-life
and to reduce losses, labour and costs.26 However,
under rapid chilling conditions the sarcomeres might
undergo cold-induced shortening and the meat may
consequently suffer from toughening,27 a major factor
impairing beef quality. Normally, the pH in beef
declines from 7 upon slaughter to approximately
5.35.8 within 1840 h.28 The interrelationship of
time, temperature and pH differs between and within
muscles, causing variation in the susceptibility of
individual muscles to cold shortening.29 Although
shortening of sarcomeres cannot be completely
avoided, there are several known efficient means to
reduce the extent and toughening effects of this process
after slaughter.27
Electrical stimulation during the slaughter process
may reduce the susceptibility of muscles to cold shortening by inducing muscle contraction, accelerating
anaerobic glycolysis and, consequently, increasing the
rate of pH decline, thus reducing the time until rigor
mortis develops.27 The faster decline of pH recorded
in the present study with ES aligns with the results
of Eilers et al.30 However, ES did not accelerate early
p.m. temperature decline in muscle. The temperature
of the LD at 1.5 h p.m. was lower for control carcasses
compared with ES carcasses in the present study and
others.30 Jones and Tatum31 reported a positive linear relationship between LD pH3h and shear force
among steaks obtained from commercially processed
carcasses. In particular, a low shear force was found
when pH3h was below 6.2. In our study, this recommended pH3h level was reached only in ES carcasses,
and these carcasses actually expressed a lower maximum shear force of the LD compared with the control
carcasses. However, the lower pH3h level in the BF
of ES carcasses did not lead to a reduced shear force,
which was on a rather low level already at 2 days p.m.
A second promising technique could be to delay
chilling of the meat and thus accelerate rigor development and subsequent tenderisation. Keeping carcasses
out of the chilling room for a certain period of time
has been proposed as a means of DC28 and was found
to have a positive influence on meat quality.27 In
the present study, DC significantly reduced the rate
of early p.m. LD and BF temperature declines, but
resulted in only a slightly lower pH than in control
beef. Additionally, DC failed to generally improve
texture attributes. This would suggest that the overall
effect of DC on p.m. muscle metabolism was too weak
to exert changes in texture. Nevertheless, a certain
interaction between CO2/DC treatment and carcass
fatness was observed, which is discussed below.
A well-known technique to increase tenderness
is aging during refrigerated storage. This is mainly
J Sci Food Agric 88:13441353 (2008)
DOI: 10.1002/jsfa
due to the effect of weakening myofibrillar and

cytoskeletal proteins by endogenous enzymes.2 Bruce
et al.32 demonstrated that aging of LD muscles can
reduce the maximum shear force to less than 40 N,
a level that Shorthose et al.33 found to correspond
with a consumer rating of tender beef. In the present
study, there were clear aging effects in the LD when
comparing the texture of samples aged for 2 or 15 days.
The decrease in maximum shear force when aged for
29 days was less pronounced, and LD samples from
data set 2 did not decline below the threshold of
40 N for tender meat. Different from the LD, aging
the BF for 15 days instead of 2 days did not result
in a lower shear force, which was not expected and
cannot be explained. It may be speculated that the
myofibrillar texture compound is of low importance
in this muscle, which is consistent with the lower
initial shear force than in the LD. It was also reported
by Hostetler et al.34 that, in contrast to other major
muscles, the shear force of the BF did not correspond
to the sarcomere length.
Interactions among factors affecting texture
traits
A major objective of the present study was to investigate the effects of interactions between production
factors (e.g. resulting in different degrees of carcass
fatness) and p.m. treatments as well as between early
p.m. treatments and aging on beef texture.
Increasing fatness caused both ES and DC treatments to become less effective. However, while ES
improved the tenderness of the LD on average, DC
did not affect the texture of the LD in general, although
it tended to improve the texture in lean and impair it in
fatter carcasses. Fatness may reflect the effects of various production system factors, particularly finishing
regime and breed. In another approach, French et al.14
concluded that supplementing grass with concentrate
would suffice to produce tender and acceptable meat
already at 2 days p.m., and that further aging eliminated the treatment effects on eating quality of beef
observed at 2 days p.m. Realini et al.10 found, despite
differences in carcass weight, fatness and temperature during chilling, a similar initial shear force in
steaks from pasture- and concentrate-fed steers; more
extensive aging of the steaks from pasture-fed animals
resulted at 7 and 14 days p.m. in an even lower shear
force than in the steaks from concentrate-fed animals.
The interaction between p.m. treatment and aging
was such that the CO1 LD tenderised slower during
aging than the ES LD. ES accelerated tenderisation
to a degree that, at day 2, the shear force of the LD
was nearly as low as in the LD of CO1 after 15 days
of aging. ES beef fell below the threshold of 40 N
from 15 days of aging onwards, and prolongation of
the aging period was ineffective. This finding supports
the hypothesis of King et al.35 that the accelerated
p.m. metabolism induced by ES would increase the
myofibrillar fragmentation in the muscles, resulting
1351
in an improved tenderness already early in the aging

period.
Another relationship of texture traits and p.m.
processes becomes evident when looking at the
positional variation in texture within the same slice
of beef.36,37 Homogeneity of tenderness is important
for consumer satisfaction and purchase loyalty, which
might be particularly relevant for branded beef. In
the present study a systematic variation in texture
within LD steaks was observed. The highest shear
force values occurred at the ventro-lateral locations,
where the muscle touches the ribs, and the lowest
values in the dorso-medial region, which is in line with
the study of Kerth et al.38 Scheeder39 found the highest
shear force at the ventral location and the lowest at the
dorso-medial and dorso-lateral locations. At the same
time the different sarcomere lengths corresponded well
with the shear force data. Thus variation in sarcomere
length can be one underlying cause of the variation in
texture over the cross-section of LD steaks and may
partly explain the elevated maximum shear force at
certain locations.39 In muscle, attached to the skeleton,
shortening of the muscle fibres occurring in one zone
of the muscle may be compensated by stretching of the
fibres elsewhere.40 It may therefore be speculated that
a faster rate of temperature decline at the ventro-lateral
site can promote myofibrillar shortening because of the
close contact with the bones and the low tissue mass
surrounding the muscle at this site. The temperature
differences in the LD at 3 and 8 cm depth were of the
order of 10 C at 1.5 h p.m. and on average still above
5 C at 3 h p.m. Because the temperature at which
rigor develops affects the activity of -calpain and
calpastatin,12,41 the observed variation in texture over
the cross-section of the LD may also be partly due to
differences in early p.m. tenderisation rates. In contrast
to the LD, the texture of the BF did not respond to
any of the production factors and p.m. treatments.
Overall, it can be concluded that the tenderness
of the M. longissimus dorsi from grass-fed steers can
be improved by electrical stimulation and prolonged
aging. Electrical stimulation accelerated and enhanced
tenderisation. It was increasingly more effective as
carcass fatness decreased, thus compensating for
potentially detrimental effects of grass-only feeding,
and it reduced within-slice variation in tenderness.
Electrical stimulation therefore proved to be an
efficient measure to control the tenderness of beef
from cattle fed grass only.
ACKNOWLEDGEMENTS
We are grateful to the staff of the cutting plant
Traitafina AG and Rolf Bickel for their assistance with
sampling and to the Hermann Herzer Foundation for
financial support.
REFERENCES
1 Carpenter CE, Cornforth DP and Whittier D, Consumer preferences for beef colour and packaging did not affect eating
satisfaction. Meat Sci 57:359363 (2001).
1352
2 Koohmaraie M and Geesink GH, Contribution of postmortem

muscle biochemistry to the delivery of consistent meat quality
with particular focus on the calpain system. Meat Sci 74:3443
(2006).
3 Tornberg E, Biophysical aspects of meat tenderness. Meat Sci
43:175191 (1996).
4 Caballero B, Sierra V, Olivan M, Vega-Naredo I, TomasZapico C, Alvarez-Garca O, et al., Activity of cathepsins
during beef aging related to mutations in the myostatin gene.
J Sci Food Agric 87:192199 (2007).
5 Van Eenennaam AL, Li J, Thallman RM, Quaas RL, Dikeman ME, Gill CA, et al., Validation of commercial DNA tests
for quantitative beef quality traits. J Anim Sci 85:891900
(2007).
6 Olsson U, Herzman C and Tornberg E, The influence of low
temperature, type of muscle and electrical stimulation on the
course of rigor, ageing and tenderness of beef muscles. Meat
Sci 37:115131 (1994).
7 Locker RH and Hagyard CJ, A cold shortening effect in beef
muscles. J Sci Food Agric 14:787793 (1963).
8 Locker RH, Degree of muscular contraction as a factor in
tenderness of beef. J Food Sci 25:304312 (1960).
9 Muir PD, Deaker JM and Brown MD, Effects of forage- and
grain-based feeding systems on beef quality: a review. NZ J
Agric Res 41:623635 (1998).
10 Realini CE, Duckett SK, Brito GW, Dalla Rizza M and De
Mattos D, Effect of pasture vs. concentrate feeding with or
without antioxidants on carcass characteristics, fatty acid
composition, and quality of Uruguayan beef. Meat Sci
66:567577 (2004).
11 Smith GC, Duston TR, Hostetler RL and Carpenter ZL, Fatness, rate of chilling and tenderness of lamb. J Food Sci
41:748756 (1976).
12 Hwang IH and Thompson JM, The interaction between pH
and temperature decline early postmortem on the calpain
system and objective tenderness in electrically stimulated beef
longissimus dorsi muscle. Meat Sci 58:167174 (2001).
13 Razminowicz RH, Kreuzer M, Leuenberger H and Scheeder
MRL, Efficiency of extruded linseed for the finishing of grassfed steers to counteract a decline of omega-3 fatty acids in the
beef. Livest Sci 114:150163 (2008).
14 French P, ORiordan EG, Monahan FJ, Caffrey PJ, Vidal M,
Mooney MT, et al., Meat quality of steers finished on autumn
grass, grass silage or concentrate based diets. Meat Sci
56:173180 (2000).
15 French P, ORiordan EG, Monahan FJ, Caffrey PJ, Mooney
MT, Troy DJ, et al., The eating quality of meat of steers fed
grass and/or concentrates. Meat Sci 57:379386 (2001).
16 Razminowicz RH, Kreuzer M and Scheeder MRL, Quality of
retail beef from two grass-based production systems in
comparison with conventional beef. Meat Sci 73:351361
(2006).
17 Mitchell GE, Reed AW and Rogers SE, Influence of feeding
regimen on the sensory qualities and fatty acid contents of
beef steaks. J Food Sci 56:11021106 (1991).
18 Davey CL and Chrystall BB, Conditions for an efficient postmortem electrical stimulation. Ann Technol Agr 29:547561
(1980).
19 Specht H and Kunis J, Kalteverkurzung

und Elektrostimulation.
Auswirkungen auf die Beschaffenheit von Schaf- und
Rindfleisch. Fleischwirtschaft 69:12751280 (1989).
20 Monson F, Sanudo C and Sierra I, Influence of cattle breed and
ageing time on textural meat quality. Meat Sci 68:595602
(2004).
21 Priolo A, Micol D and Agabriel J, Effects of grass feeding
systems on ruminant meat colour and flavour. A review.
Anim Res 50:185200 (2001).
22 Priolo A, Micol D, Agabriel J, Prache S and Dransfield E, Effect
of grass or concentrate feeding systems on lamb carcass and
meat quality. Meat Sci 62:179185 (2002).
23 Chambaz A, Kreuzer M, Scheeder MRL and Dufey PA, Characteristics of steers of six beef breeds fattened from eight
J Sci Food Agric 88:13441353 (2008)

DOI: 10.1002/jsfa
24
25
26
27
28
29
30
31
32
months of age and slaughtered at a target level of intramuscular fat. II. Meat quality. Arch Anim Breed 44:473488
(2001).
Wulf DM, Tatum JD, Green RD, Morgan JB, Golden BL and
Smith GC, Genetic influences on beef longissimus palatability
in Charolais- and Limousin-sired steers and heifers. J Anim
Sci 74:23942405 (1996).
Koch RM, Cundiff LV and Gregory KE, Heritabilities and
genetic, environmental, and phenotypic correlations of carcass
traits in a population of diverse biological types and their
implication in selection programs. J Anim Sci 55:13191325
(1982).
Bowater FJ, Rapid carcass chilling plants compared to conventional systems. [Online]. International Institute of Refrigeration (2001). Available: http//www.fjb.co.uk [3 July 2007].
Savell JW, Mueller SL and Baird BE, The chilling of carcasses.
Meat Sci 70:449459 (2005).
Smulders FJM, Toldra F, Flores J and Prieto M (eds), New
Technologies for Meat and Meat Products. ECCEAMST/Audet
Tijdschriften, Utrecht, pp. 182, 186188 (1992).
Hannula T and Puolanne E, The effect of cooling rate on
beef tenderness: the significance of pH at 7 C. Meat Sci
67:403408 (2004).
Eilers JD, Tatum JD, Morgan JB and Smith GC, Modification
of early-postmortem muscle pH and use of postmortem aging
to improve beef tenderness. J Anim Sci 74:790798 (1996).
Jones BK and Tatum JD, Predictors of beef tenderness among
carcasses produced under commercial condition. J Anim Sci
72:14921501 (1994).
Bruce HL, Stark JL and Beilken SL, The effects of finishing
diet and postmortem ageing on the eating quality of the
M. longissimus thoracis of electrically stimulated Brahman steer
carcasses. Meat Sci 67:261268 (2004).
J Sci Food Agric 88:13441353 (2008)

DOI: 10.1002/jsfa
33 Shorthose WR, Harris PV, Hopkins AF and Kingston OL,

Relationships between some objective properties of beef and
consumer perceptions of meat quality. Proc Int Congr Meat Sci
Technol 34:667669 (1988).
34 Hostetler RL, Link BA, Landmann WA and Fitzhugh Jr HA,
Effect of carcass suspension on sarcomere length and shear
force of some major bovine muscles. J Food Sci 37:132135
(1972).
35 King DA, Voges KL, Hale DS, Waldron DF, Taylor CA and
Savell JW, High voltage electrical stimulation enhances
muscle tenderness, increases aging response, and improves
muscle color from cabrito carcasses. Meat Sci 68:529535
(2004).
36 Crouse JD, Theer LK and Seideman SC, The measurement of
shear force by core location in longissimus dorsi beef steaks from
four tenderness groups. J Food Qual 11:341347 (1989).
37 Berry BW, Tenderness of beef loin steaks as influenced by
marbling level, removal of subcutaneous fat, and cooking
method. J Anim Sci 71:24122419 (1993).
38 Kerth CR, Montgomery JL, Lansdell JL, Ramsey CB and
Miller MF, Shear gradient in longissimus steaks. J Anim Sci
80:23902395 (2002).
39 Scheeder MRL, Age-related changes in meat quality of growing
cattle, in Proceedings of the Symposium on Growth in Ruminants:
Basic Aspects, Theory and Practice for the Future, ed. by
Blum JW, Elsasser T and Guilloteau P. University of Berne,
Berne, pp. 265275 (1998).
40 Marsh BB and Leet NG, Studies in meat tenderness. The effect
of cold shortening on tenderness. J Food Sci 31:450459
(1966).
41 Dransfield E, Optimisation of tenderization, ageing and tenderness. Meat Sci 36:105121 (1994).
1353
J Sci Food Agric 88:13541362 (2008)
Predictability of price of tea from

sensory assessments and biochemical
information using data-mining techniques
Sanjoy K Paul
DTU, OCDEM, University of Oxford, Oxford OX3 7LJ, UK
Abstract
BACKGROUND: The valuation of tea depends on the sensory assessments made by the Brokers and Buyers
(Tea Tasters) to a large extent, though the market conditions and the requirements of a particular Buyer
play an important role in determining the basic prices of teas. Again, there are several biochemical quality
parameters in tea on which the quality of a particular tea depends. It is not straightforward to establish the
reflection of biochemical quality characteristics in tea on the Tasters sensory assessments and price because
of the complex dynamics within chemical properties and the inherent subjectivity of quality evaluation through
the Tasters scores. It is, however, important to judge the market valuation of teas from quality assessments
and biochemical properties. This paper describes the advantages of using statistical data-mining techniques to
explore the association of biochemical quality parameters in teas with the Tasters sensory assessments, and the
application of a nonparametric statistical technique, multivariate adaptive regression splines (MARSplines), to
establish the predictability of the realised prices of teas from sensory assessments.
RESULTS: The price of tea is significantly associated with various quality attributes and some of the biochemical
parameters. The MARSplines technique successfully demonstrated the predictability of price through Tasters
sensory assessments and also raised the issue of inherent subjectivity of the Tasters assessments.
CONCLUSION: It is important to explore appropriate statistical techniques to assess the subjectivity in Tasters
assessments, and a better-designed study needs to be conducted to understand the complex biochemical reflections
on the price of tea.
Keywords: biochemical quality parameters; sensory assessments; tea price; data mining; regression splines
INTRODUCTION
It is well acknowledged that the quality of tea is
crucially dependent on some inherent chemical characteristics. In practice, many biochemical properties of
tea can be measured fairly satisfactorily.1,2 However,
the quality of black tea cannot be judged solely on the
basis of chemical information. Here the professional
Tea Tasters play a vital role in grading various types of
tea in terms of different quality attributes, e.g. colour,
brightness, strength, taste (involving non-volatile compounds) and aroma (involving volatile compounds).
The most desirable biochemical quality parameters
in black tea are theaflavins (TFs) and thearubigins
(TRs). They significantly influence the Tasters perception and also play important roles in the ultimate
valuation of tea at the auction centres.2 20 The Tea
Broker Houses have their own Tasters who evaluate
the samples in terms of overall quality. The final price
is significantly influenced by their quality evaluation.
Thus we can clearly hypothesise a direct relationship
between the Tasters assessment and the price of tea.
It is generally conceded that the evaluation of quality

by Tea Tasters is not completely unbiased. Market
conditions in general and the requirements of the
Broker or Buyer whose needs the Tasters serve could
significantly affect the evaluation of tea quality. The
producers and Brokers will naturally try to obtain
the best possible evaluations on their teas. However,
the method of assessment should be objective as
far as possible. As the quality attributes assessed by
the Taster are results of the influence of inherent
biochemical quality parameters, we can also postulate
a relationship between the chemical information and
the Tasters judgement.
There have been a number of published efforts to
correlate in a quantitative manner the chemistry of tea
with the Tasters descriptions and cash valuations.3 24
Attempts were made by researchers to explain the
quality and various liquor characteristics of manufactured teas in terms of the chemical composition
and biochemical behaviour of both the unprocessed
tea shoots and the manufactured teas. Some earlier
Correspondence to: Sanjoy K Paul, DTU, OCDEM, University of Oxford, Oxford OX3 7LJ, UK
E-mail: sambhupaul@hotmail.com
(Received 17 April 2007; revised version received 22 December 2007; accepted 3 January 2008)
Predictability of price of tea using date-mining techniques
studies in this field are due to Roberts and Smith,9

Wood and Roberts,22 Deb and Ullah6 and Biswas
and Biswas,3 among many others. Roberts and Smith9
found that TFs and TRs were largely responsible for
colour and strength and that TFs were factors in quality and briskness. They also found that highest cash
values were given to teas with high TF levels, as long
as the TR content was also at a satisfactorily high
level. Wood and Roberts22 observed that the Tasters
scores for colour and strength were related to the TF
and TR contents of the manufactured teas. They also
observed that scores for briskness and quality depend
to some extent on TFs, with caffeine contributing to
briskness. According to their observations, cash valuation would be more closely related to TFs than to TRs.
Wickremasinghe and Swain23 discussed the relationship between the quantities of phenolic compounds
and commercial valuation and the contributions of
volatile compounds to the flavour of Ceylon tea. They
observed that the quality of black tea might be predicted from an estimation of the polyphenol content
before processing the tea shoots, because the amount
of polyphenols in black tea depends on the amount
originally present in the unprocessed tea shoots. All
these studies are based on total correlation between the
individual biochemical constituents and the Tasters
scores on the individual liquor characteristics or on
the cash valuation of the manufactured teas.
A well-known study on the statistical association of
liquor characteristics with the cash valuation of NE
Indian black tea is due to Biswas and Biswas.3 They
used a multiple regression technique to determine
whether the term quality of NE Indian plain black
tea has its own single characteristic as recognisable by
Tasters or whether it is the integration of some of the
other important liquor characteristics. The influence
of different quality characteristics on the cash valuation
of tea was explored. According to their observations,
the quality of NE Indian plain black tea depended
mainly on briskness, with quality being increased by
an increase in briskness. Cash valuations of Crush,
Tear and Curl (CTC) as well as orthodox teas, in
general, depended mainly on quality and/or briskness.
They related the biochemical quality parameters with
individual Tasters choices and studied the significance
of different biochemical parameters.
One relatively recent study aimed at assessing
the correlation of chemical quality parameters with
quality attributes and the market price of black
teas is due to Wright et al.24 Another study on
the estimation of black tea quality is due to Liang
et al.21 The latter study, based on Chinese tea, finds
significant correlations among phenolic compounds,
tea pigments, nitrogen-containing compounds and
sensory evaluation. We note here that these studies
do not address the inherent subjectivity of Tasters
choices.
There have been very few studies on the statistical association of sensory scores and biochemical
information, specific to tea quality assessment, after
J Sci Food Agric 88:13541362 (2008)
DOI: 10.1002/jsfa
eliminating the bias associated with sensory scores.

Aspects of inherent subjectivity in Tasters sensory
assessments and methodologies to eliminate the bias
have been addressed by Pal and co-workers.25 27
These statistical approaches reduce the problem of
uncertainty in sensory evaluation, making the derived
quality scores more objective.
All previous studies relating biochemical aspects
in tea with sensory assessments and valuation of
teas have basically drawn inferences based on simple
correlation and linear regression analyses, without
recognising the inherent complex dynamics and likely
interactions among biochemical quality parameters
and the nonlinear systems of relationships between
biochemistry and Tasters perceptions. The main
objectives of the present paper are twofold. First
we explore the patterns of association between
biochemical properties in teas, their quality attributes
as observed by Tea Tasters and the realised price
using advanced data-mining techniques. The second
objective is to examine the relationship between price
and quality of tea, with the exploration of possible
interactions of various quality aspects, using the
multivariate adaptive regression splines (MARSplines)
technique. To the best of our knowledge, such a
rigorous statistical analysis has not been attempted
before to address the complex issues of predicting
valuation of teas from biochemical properties and
sensory attributes.
THE DATA
The data for this study are based on the published work of Wright et al.,24 which investigates
the predictability of quality and price of black teas
produced in Central and Southern Africa from biochemical parameters, especially the TF contents. Forty
African tea clones (samples) from Malawi were processed and biochemical measurements were obtained
on TF-f, TF-A, TF-B, TF-dg and sum of individual TFs (SIT), flavognost (FLAV), caffeine (CAF),
total polyphenols (TP), crude fibre (CF), epicatechin
(EC), epigallocatechin (EGC), epicatechin-3-gallate
(EGCg), epicatechin-3-gallate 1 (ECg1), gallated catechins (GALEC), non-gallated catechins (NGALEC),
gallocatechins (GALOC), non-gallocatechins (NGALOC) and sum of individual flavognost (SIF).
Two professional Tasters evaluated the tea
samples on various quality attributes, but on two
different scales. Taster A evaluated colour of liquor
(COL-A), strength of liquor (SOL-A), colour of
infusion(COI-A), colour with milk (CWM-A), briskness (BRSK-A) and brightness (BRIG-A). Taster B
evaluated the samples on a 20-point scale in terms of
colour of liquor (COL-B), strength (STR-B), brightness (BRIG-B), briskness (BRSK-B), quality (QAL-B)
and valuation (VAL-B). The prices of the tea samples are presented in USc/ kg1 . These 40 tea clones
are differentiated by good (high) quality and poor
1355
SK Paul
(low) quality in terms of biochemical properties and

Tasters perception.
The basic statistics on sensory attributes by Taster A
and realised prices of tea samples are presented in
Table 1, differentiated by the quality status of the
tea clones. The basic statistics on all biochemical

parameters are given in Table 2. As evident from
Table 1, the within-sample variability in all quality
attributes is very low as assessed by Taster A. However,
the dispersions in the measures of most of the chemical
Table 1. Basic statistics on price and sensory attributes by quality status
Quality attribute/price
Colour of liquor
Colour of infusion
Colour with milk
Brightness
Briskness
Strength of liquor
Price (USc
/ kg1 )
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Minimum
Maximum
Mean
SD
3.90
4.30
1.70
2.60
2.50
3.20
1.00
1.20
1.00
2.00
3.50
4.10
88.60
109.40
4.90
5.90
3.50
5.70
4.30
5.60
2.10
3.20
2.00
3.50
4.60
6.20
142.00
153.00
4.39
4.75
2.67
4.18
3.43
4.47
1.49
2.34
1.52
2.56
3.88
4.70
112.35
136.44
0.26
0.35
0.59
0.69
0.49
0.60
0.35
0.50
0.29
0.39
0.28
0.49
12.42
13.74
Table 2. Basic statistics on biochemical parameters by quality status
Biochemical parameter
TF-f
TF-A
TF-B
TF-dg
TP
CF
CAF
EC
EGC
ECg1
EGCg
FLAV
GALEC
GALOC
NGALEC
NGALOC
SIF
SIT
1356
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Low quality
High quality
Minimum
Maximum
Mean
SD
2.96
4.51
2.22
3.11
0.70
1.32
0.85
0.86
104.03
131.27
2.38
3.91
130.52
145.25
16.32
24.82
28.22
61.97
43.32
54.73
165.90
174.94
4.82
6.56
238.44
233.03
204.78
305.39
49.44
93.68
64.09
90.76
306.18
413.78
7.29
12.33
11.64
16.72
4.96
6.28
2.49
2.89
4.34
3.68
290.09
276.08
12.32
13.39
243.10
267.10
55.75
114.67
139.88
250.50
82.09
131.23
294.18
329.29
12.32
18.44
368.52
428.67
412.00
461.37
198.76
351.30
134.82
255.97
532.85
717.34
19.33
26.62
6.99
11.21
3.58
4.72
1.53
2.08
1.96
2.06
178.76
199.85
6.61
8.73
187.42
190.97
34.68
61.05
97.39
141.88
63.13
80.43
237.69
235.95
8.55
12.88
300.82
316.38
335.08
377.83
138.69
211.66
104.42
150.22
439.50
528.04
14.07
20.07
2.39
3.58
0.80
0.90
0.48
0.49
0.82
0.75
41.93
40.00
2.44
2.57
30.43
26.69
11.81
23.68
36.53
48.92
10.36
21.91
30.73
32.54
2.35
3.77
34.97
47.95
50.18
45.85
47.74
70.79
17.62
39.82
60.91
76.45
3.46
4.57
J Sci Food Agric 88:13541362 (2008)

DOI: 10.1002/jsfa
parameters are very high (Table 2). We have not

compared the significance of differences in the average
levels of the biochemical measurements and quality
attributes, as this is not the aim of our study and we are
only interested in assessing the patterns of association
and predictability irrespective of the quality status of
the tea clones.
STATISTICAL METHODS AND ANALYSIS

The data-mining approach (feature selection)
The patterns of association of various biochemical
parameters with different sensory characteristics
cannot be satisfactorily explored using estimates
of correlation coefficients and linear regression
techniques. The main reasons for this are the
nonlinear relationships between individual chemical
parameters and quality scores and the unknown levels
of interactions among various chemical parameters
which influence a particular quality attribute in tea.
For example, there are various levels of TF measures,
and appropriate methodology needs to be employed
to determine the specific TF measures affecting
the particular quality attribute without constraining
the statistical exploration by prior assumptions (e.g.
normality of the data, non-existence of outliers, etc.)
about the relationships.
Data mining is an analytical approach designed to
explore data in search of consistent patterns and/or
systematic relationships among variables and then to
validate the findings by applying the detected patterns
to subsets of data. After recognising the pattern(s)
of relationship(s) among variables or systems, the
goal of data mining is prediction, and predictive
data mining is the most common type of data
mining. The analytical methods used in data mining
are often well-known mathematical and statistical
algorithms and techniques. The process of data
mining generally consists of three stages: (1) the
initial exploration, (2) model building or pattern
identification and (3) deployment (i.e. application of
the model to new data for prediction and validation).
Detailed explanations of data-mining techniques with
applications in the field of biochemistry can be found
in the books by Edelstein28 and Hastie et al.29
Association of biochemical parameters
with sensory scores and price
We first adopt the feature selection and variablescreening approach to explore the statistical associations of TF-f, TF-A, TF-B and TF-dg with all the
individual quality attributes assessed by both Tasters
and price. We do not consider SIT here, as this is
the sum of the measured TFs and therefore not independent of the other TF measures. This initial step
identifies the order of the strength of association of
chemical parameters with quality attributes using estimated probability values (P values) based on the F
test. This feature selection procedure is essentially
based on the robust analysis of variance (ANOVA)
J Sci Food Agric 88:13541362 (2008)
DOI: 10.1002/jsfa
technique which uses MM estimates and is suitable

under the existence of outliers and non-normality.
This approach is often more powerful compared with
general linear regression-type analysis and leads to a
better model choice in terms of inclusion or exclusion
of possible interaction effects.
The individual significance levels (P values) for all
TF measures in association with quality attributes
scored by both Tasters are presented in Table 3. The
significance levels of associations of other chemical
quality parameters with sensory scores and price
are presented in Table 4. As evident from the
results, the digallated TFs are not related to any of
the quality attributes assessed by the two Tasters.
The monogallated TFs are very highly significantly
associated with strength, colour of liquor and infusion,
briskness and brightness. It is interesting to observe
that, although the colour of liquor assessed by Taster
A (COL-A) is only marginally significantly associated
with TF-B and insignificantly associated with TF-A,
the scenario is completely different for the patterns
of association for the colour of liquor as assessed
by Taster B. This raises the issue of inconsistency
in sensory assessments by Tasters, though is not
conclusive based on this small set of tea samples.
The biochemical parameters TF-f, TF-A and TF-B,
among others, were significantly associated with price.
The patterns of relationships of the quality attributes
assessed by Taster A with the realised price are
presented using scatter plots with Kernel smoothers
in Fig. 1. As evident from the scatter plots, the
relationships between sensory scores and price cannot
be claimed to be linear. We have also assessed the
significance of association of all the quality attributes
with the realised price (Table 3) using the same feature
selection procedure, and the associations were very
highly statistically significant, except for the colour of
liquor assessed by Taster A. This definitely establishes
our primary hypothesis of the reflection of quality in
price through sensory assessment.
This approach of assessing the significance of
association of biochemical information with sensory
assessments and valuation using the nonparametric
data-mining technique is more reliable and more
Table 3. Significance (P values) of theaflavins and price in association
with quality attributes
Attribute
TF-f
TF-A
TF-B
TF-dg
Price
COL-A
SOL-A
CWM-A
BRSK-A
BRIG-A
COI-A
COL-B
BRIG-B
STR-B
BRSK-B
QAL-B
VAL-B
0.01
0.07
<0.001
0.001
0.001
0.001
0.07
0.04
0.08
0.08
0.04
0.5
0.23
0.01
<0.01
0.001
0.001
0.001
0.001
0.001
0.01
0.04
0.02
0.02
0.04
0.00
<0.001
0.001
0.001
0.001
0.13
0.01
0.05
0.02
0.05
0.02
0.22
0.14
0.83
0.21
0.58
0.90
0.50
0.35
0.31
0.55
0.55
0.58
0.25
0.02
0.001
0.001
0.001
0.001
0.001
0.001
0.001
0.001
0.001
0.001
1357
SK Paul
Table 4. Significance (P values) of biochemical parameters in association with quality attributes (empty cells indicate P values greater than 0.05)
Attribute
COL-A
SOL-A
CWM-A
BRSK-A
BRIG-A
COI-A
COL-B
BRIG-B
STR-B
BRSK-B
QAL-B
VAL-B
Price
TP
CF
CAF
0.05
EC
EGC
0.01
<0.001
0.01
0.002
0.003
<0.001
0.01
<0.001 <0.001
0.006
0.01
0.02
0.03
0.03
0.02
0.02
0.01
0.03
0.008
0.03
0.006
0.004
0.05
ECg1
EGCg
GALEC
GALOC
NGALEC
0.001
0.003
0.02
0.01
<0.001
0.04
0.03
0.04
0.04
0.04
0.04
0.01
NGALOC
SIF
SIT
FLAV
0.002
0.05
0.005
0.004
0.007
0.02
0.03 <0.001
0.004
0.03
0.001 <0.001
<0.001
0.008
0.003 <0.001 <0.001
0.04
0.005
0.002
0.03 <0.001
0.04 <0.001
0.003
<0.001
<0.001
0.04 <0.001
0.002
0.001
<0.001
0.002
<0.001
<0.001
0.005
0.007
0.02
0.02
0.008
0.01
0.007
TF-f, TF-A and TF-B were significantly associated with price (P < 0.001).
140
Price
Price
140
120
100
100
80
80
1.0
1.5
2.0 2.5
Briskness
3.0
3.5
1.0
120
100
2.0
2.5
Brightness
3.0
120
100
80
4.0
4.5
5.0
5.5
6.0
Colour of Liquor
140
3
4
5
Colour of Infusion
140
Price
Price
1.5
140
Price
Price
140
80
3.5
120
120
100
120
100
80
2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5
Colour With Milk
80
3.5 4.0 4.5 5.0 5.5 6.0
Strength of Liquor
Figure 1. Scatter plots with Kernel smoothers of price against quality attributes scored by Taster A.
authentic, as it suggests an exact significance level (P

value) and we do not have to base our inferences
on estimated correlation coefficients, which only
suggest the degree of linear relationships and are
highly sensitive to outliers or extreme values. To
demonstrate the effects of outliers and the possible
existence of nonlinear relationships in correlation
coefficient-based analysis, we have estimated both
1358
robust and classical correlation coefficients between

different types of TFs and the overall quality scores
given by the two tasters (TA and TB). The mean
(SD) values of TA and TB are 20.32 (3.59) and
57.73 (11.33) respectively. Details on the robust
estimation of correlation coefficients can be found in
the book by Wilcox30 and the Research and Statistical
Support section of the University of North Texas
J Sci Food Agric 88:13541362 (2008)
DOI: 10.1002/jsfa
(www.unt.edu) and may be easily implemented in

freely available R software.
Both robust and classical estimates of correlation
coefficients along with the Mahalanobis distance plot
are presented in Fig. 2. Clearly there are differences in
the classical and robust estimates, the reason being the
existence of outliers explored in the distance plot.
For example, the robust and classical correlations
between TF-A and TA are 0.86 and 0.54 respectively,
a difference of 0.32. From the distances based on
classical correlation estimates, we do not see any
outliers in the data set. In contrast, the distances
based on robust correlation estimates reveal quite a few
outliers in the data set that are otherwise hard to find.
Figure 2 compares the robust and classical correlation
matrix estimates by interpreting the correlations in the
upper triangle of each matrix as ellipses. The ellipses
are drawn such that the ijth ellipse is the contour of a
bivariate normal distribution with correlation rij . The
lower triangle contains the numerical correlations. The
overlaid ellipses are particularly useful for spotting
where the robust and classical correlation estimates
differ.
Figure 2. Comparison of robust and classical estimates of correlation

coefficients and detection of outliers through robust Mahalanobis
distance approach.
J Sci Food Agric 88:13541362 (2008)

DOI: 10.1002/jsfa
Predicting price from quality attributes

(the regression spline approach)
Here we discuss the aspects of developing a functional
relationship between quality attributes and the realised
price of tea and the possibility of predicting price
from the sensory assessments. This is more formally
known as the hedonic price function in the economics
literature. Hedonic analysis is a well-established
method for the study of market-based product
differentiations. The hedonic approach implies that
the final price of a product will be functionally related
to the products characteristics. The general standard
used to select characteristics for inclusion in the
hedonic price equation is due to Griliches.31 This
suggests the inclusion of only those variables that
are direct characteristics, i.e. quality characteristics
inherent in the commodity.
Most of the studies in this field are based on
parametric specification of the hedonic price function, which potentially leads to consequences of
misspecification. More flexible regression approaches
attempted involve nonlinear transformation models
such as BoxCox transformation.32 The nonparametric additive regression model in a more general set-up
for the hedonic price function is due to Martins-Filho
and Bin,33 whose study addresses the very important
issues related to specification of regression class, choice
of the smoother underlying the estimation method
and choice of the smoothing or bandwidth parameter. This type of methodology is especially warranted
in situations like ours, where the relationships are nonlinear and the levels of interaction effects of the sensory
quality attributes on the valuation of tea are not known.
We adopt the well-established multivariate adaptive
regression splines (MARSplines) approach to associate the different quality attributes in tea assessed
by the same Taster with price. MARSplines is a
non-parametric procedure that makes no assumptions about the underlying functional relationship
between the quality attributes and price. This regression approach constructs the relation from a set of
coefficients and basis functions that are entirely datadriven. This makes MARSplines particularly suitable
for developing the hedonic price function in tea, where
the relationships between individual quality attributes
and price are clearly nonlinear and not very straightforward to model (Fig. 1). The MARSplines technique
is particularly popular in the field of data mining, as
it does not assume or impose any particular type or
class of relationship (e.g. linear, logistic, etc.) between
the predictor variables (quality attributes) and the
dependent variable (price) of interest. Instead, models
that yield accurate predictions can be derived even
in situations where the relationship between the predictors and the dependent variables is non-monotonic
and difficult to approximate with parametric models. The special advantage with this nonparametric
regression method is that it automatically searches for
the statistically significant possible interaction effects
among the quality attributes, apart from the individual
1359
SK Paul
quality attributes, to include in the model to predict

price. Technical details and application aspects of this
regression technique can be found in the paper by
Friedman34 and the book by Hastie et al.29 A detailed
simplistic description of MARSplines with the interpretation of results from the regression fit may be
found in the freely available online textbook provided
by StatSoft (www.statsoft.com).
There are always issues related to over-fitting a
statistical predictive model. In general, nonparametric
models are adaptive and can exhibit a high degree
of flexibility that may ultimately result in over-fitting
if adequate measures are not taken to counteract it.
It has been observed that such models can achieve
zero prediction error on training data under certain
formulations; however, they have the tendency to
perform poorly when presented with new observations
or instances. This means that on many occasions
these predictive regression models do not generalise
well to the prediction of new samples. MARSplines,
like most methods of this kind, tends to over-fit the
data as well. To address this problem, we can use a
pruning technique to limit the complexity of the model
by reducing the number of its basis functions. The
features of the selection of pruning of basis functions
make this technique a very powerful tool for predictor
selection. The MARSplines algorithm can pick up only
those basis functions and relevant predictor variables
that make a significant contribution to the prediction.
Although the two Tasters scored the samples on
different scales and different quality attributes, we
have fitted regression models for both Tasters to
compare the predictive ability. This will also address
the inherent subjectivity in Tasters assessments to
some extent. Taster A assessed the samples in terms

of colour of liquor, strength of liquor, colour with
milk, briskness, brightness and colour of infusion,
while Taster B considered the attributes colour of
liquor, brightness, strength, briskness, quality and
value. Details of the model-fitting criteria along with
the regression results are presented in Table 5. We
set 25 basis functions with two levels of interactions
between the quality attributes. The choice of basis
functions is basically judgemental and some guidelines
on choosing the ideal basis functions are due to
Hastie et al.29 We have considered only the secondorder interactions between sensory attributes for two
reasons: simplicity and the relatively small size of tea
samples available for analysis.
For Taster A the final fitted model retained
five regressors, with strength of liquor, briskness
and brightness appearing independently along with
the interaction effects of briskness*brightness and
strength*briskness. The number of times specific
regressors were referred to the basis function is
indicated in Table 5, with the highest number of
references occurring for briskness. The influence of
these three quality attributes on the valuation of the
particular African tea types is very much in line with
the belief of the Tea Tasters. The additional new
information we have now is the specific significant
interaction effects among these quality attributes. In
the results we have presented the generalised crossvalidation (GCV) error and the root mean square
error of cross-validation (RMSECV). The RMSECV
measures the goodness of fit, which takes into account
not only the residual error but also the model
complexity. This error estimate also helps guide the
Table 5. Results from MARSpline fit
Information
Criterion
Initial conditions
Number of basis functions
Order of interaction
Pruning
Predictors
Output
Number of terms retained
Number of basis functions
Terms retained
Interaction terms
GCV error
Number of times particular predictor referenced to basis
function
Mean (SD) of observed price (USc
/ kg1 )
Mean (SD) of predicted price (USc
/ kg1 )
Mean (SD) of residual
Adjusted R2
RMSECV
Spline model for Taster A
Taster A
Taster B
25
2
Yes
COL, SOL, CWM, BRSK, BRIG, COI
25
2
Yes
COL, BRIG, BRSK, QAL, VAL, STR
5
12
SOL, BRSK, BRIG
BRSK BRIG, SOL BRSK
80.54
SOL(3), BRSK(5), BRIG(4)
3
3
BRSK, BRIG
BRSK BRIG
180.38
BRIG(2), BRSK(1)
125.03 (17.79)
125.01 (17.06)
0.06 (5.03)
0.89
1.1874
125.03 (17.79)
124.28 (13.29)
0.09 (11.82)
0.52
2.9948
Price = 160.11 51.1 max(0, 2.1 BRSK) 34.63 max(0, SOL 3.50) 472.83 max(0, 2.10 BRSK) max(0, BRIG 1.80) +
39.38 max(0, SOL 3.50) max(0, BRSK 2.30) + 38.23 max(0, SOL 3.50) max(0, 2.30 BRSK) + 58.98 max(0, BRIG 2.20)
17.18 max(0, 2.20 BRIG) 74.28 max(0, BRSK 2.10) max(0, BRIG 2.20)
1360
J Sci Food Agric 88:13541362 (2008)

DOI: 10.1002/jsfa
choice of basis functions. In the MARSpline method,

after implementing the forward stepwise selection of
basis functions, a backward procedure is applied in
which the model is pruned by removing those basis
functions that are associated with the smallest increase
in the (least squares) goodness of fit. The GCV error
is a type of least squares error function (inverse of
goodness of fit).
The performance of the predictive model is quite
impressive for Taster A, with very small average
residual and relatively small standard error. The fitted
model explains 89% of the variation in price levels
based on the Tasters assessment (quality attributes),
with a relatively small RMSECV estimate of 1.19.
However, the nature of the fit for Taster B was quite
different, with a poor quality of fit. The scatter plot of
the predicted price of tea samples versus the observed
price along with the density plot of the residual from
the fitted model for Taster A (Fig. 3) clearly illustrates
the successful prediction.
CONCLUSION
We have considered in this paper the potential
application of statistical data-mining techniques to
understand the complex association of biochemical
aspects in tea with human perception of its quality

and the realised price. This statistical approach is
clearly advantageous in exploring the association of
various chemical quality parameters and their possible
interactions with sensory assessments, which is
otherwise not possible through simple correlation and
linear regression-based analyses. Also, the interesting
issue, from a business point of view, of the
predictability of price through inherent quality in tea
has been addressed objectively using a nonparametric
adaptive regression technique. As far as we are aware,
this is the first methodological exercise to analyse the
hedonic price function for tea, which would allow the
Brokers to judge the worth of sensory analysis in price
realisation. Alhough this hedonic approach has the
advantage of being based on the realised price, it still
depends on subjective sensory assessments. However,
in the beverage industry, quality assessments are based
on sensory analysis only.
It is important to address the subjectivity of
sensory assessment methodologically so that a biascorrected derived sensory score can be associated
with biochemical aspects and price. A well-designed
study on a relatively large tea sample with exhaustive
assessment of biochemical parameters along with
sensory assessments by several Tasters would help
Figure 3. Observed versus predicted price and residual density from MARSpline fits.
J Sci Food Agric 88:13541362 (2008)

DOI: 10.1002/jsfa
1361
SK Paul
address predictability issues supported by appropriate

statistical methodological development.
17
ACKNOWLEDGEMENT
I would like to thank Dr Zeno Apostolides of the
University of Pretoria (South Africa) for providing
data for this study.
18
19
20
REFERENCES
1 Gilchrist RCJH and Wight W, The concept of kind of tea.
Nature 191:1460 (1961).
2 Baruah DN, Tea quality. Two and a Bud 39:26 (1992).
3 Biswas AK and Biswas AK, Biological and chemical factors
affecting the valuations of north-east Indian plains teas: II.
Statistical evaluation of the biochemical constituents and their
effects on briskness, quality and cash valuations of black teas.
J Sci Food Agric 22:196204 (1971).
4 Biswas AK and Biswas AK, Statistical evaluation of biochemical
constituents and their effects on colour, brightness and
strength. J Sci Food Agric 24:14571477 (1972).
5 Davies AG, Theaflavins objective quality indicators. Tea Coffee
Trade J 155157 (1983).
6 Deb SB and Ullah MR, The role of theaflavins and thearubigins
in the evaluation of black tea. Two and a Bud 15:101102
(1968).
7 Ellis RT and Cloughley JB, The importance of theaflavins in
black tea liquors. Int Tea J 2:78 (1981).
8 Roberts EAH, The phenolic substances of manufactured tea. II.
Their origin as enzymic oxidation products in fermentation. J. Sci.
Food Agric 9:212216 (1950).
9 Roberts EAH and Smith RF, Spectrophotometric measurements of theaflavins and thearubigins in black tea liquors
in assessment of quality of teas. Analyst 86:9498 (1961).
10 Roberts GR and Fernando RSS, Some observations on the
correlation of polyphenol content to the quality of tea clones.
Tea Q 50:3031 (1981).
11 Hilton PJ and Ellis RT, Estimation of market value of Central
African tea by theaflavins analysis. J. Sci. Food Agric
23:227232 (1972).
12 Hilton PJ and Palmer-Jones RW, Relation between flavanol
composition of tea shoots and theaflavin content of manufactured
tea. J. Sci. Food Agric 24:813818 (1973).
13 Hilton PJ and Palmer-Jones RW, Chemical assessment of
quality in tea and its relation to market over extended period.
J Sci Food Agric 26:681684 (1975).
14 Thanaraj SNS and Seshadri R, Influence of polyphenol oxidase
activity and polyphenol content of tea shoot on quality of
black tea. J Sci Food Agric 51:5770 (1990).
15 Owuor PO and Obanda M, Clonal variation in the individual
theaflavins and their impact on astringency and sensory
evaluation. Food Chem 54:273277 (1995).
16 Owuor PO, Obanda M, Nyirenda HE, Mphangwe NIK, Wright
WP and Apostolides Z, The relationship between some
1362
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
chemical parameters and sensory evaluations for plain black

tea (Camellia sinensis) produced in Kenya and comparison
with similar teas from Malawi and South Africa. Food Chem
97(4):644653 (2006).
Owuor PO, Theaflavins content as a basis for pricing Kenyan
black tea. Tea 4:1116 (1983).
Owuor PO, Othieno CO and Reeves SG, The economic impact
of theaflavins in Kenyan teas. Tea 7:8893 (1986).
Owuor PO, Reeves SG and Wanyoko JK, Correlation of
theaflavins content and valuations of Kenyan black teas.
J Sci Food Agric 37:507513 (1986).
Owuor PO, Reeves SG and Wanyoko JK, Estimation of the
market value of central African tea by theaflavin analysis.
J Sci Food Agric 23:227232 (1972).
Liang Y, Lu J, Zhang L, Wu S and Wu Y, Estimation of black
tea quality by analysis of chemical composition and color
difference of tea infusions. Food Chem 80:283290 (2003).
Wood DJ and Roberts WA, The chemical basis of quality in
tea. III. Correlation of analysis results with tea tasters reports
and valuations. J Sci Food Agric 15:1925 (1964).
Wickremasinghe RL and Swain T, Studies of the quality and
flavour of Ceylon tea. J Sci Food Agric 16:5764 (1965).
Wright LP, Mphangwe NIK, Nyirenda HE and Apostilides Z,
Analysis of theaflavin composition in black tea (Camellia
sinensis) for predicting the quality of tea produced in Central
and Southern Africa. J Sci Food Agric 82:517525 (2002).
Pal M and Paul SK, Small sample estimation problem with
BoxCox transformation: application to tea quality data.
Statist Appl 12:378393 (2000).
Pal M, Paul SK and Das AK, A statistical approach to study the
subjectivity of tea tasters scores. Two and a Bud 44:1825
(1997).
Pal M, Paul SK and Das AK, Assessment of tea quality
associating biochemical parameters and the tasters choice.
Two and a Bud 45:1630 (1999).
Edelstein A, Introduction to Data Mining and Knowledge
Discovery. Two Crows Corporation; 2 edition (1998).
Hastie T, Tibshirani R and Friedman J, The Elements of
Statistical Learning, Data Mining, Inference, and Prediction.
Springer, New York, NY (2001).
Wilcox RR, Fundamentals of Modern Statistical Methods.
Springer, New York, NY (2001).
Griliches Z, Price Indexes and Quality Change: Studies in
New Methods of Measurement. Harvard University Press,
Cambridge, MA (1971).
Wooldridge J, Some alternatives to BoxCox regression model.
Int Econ Rev 4:935955 (1991).
Martins-Filho C and Bin O, Estimation of hedonic price
function via additive nonparametric regression. Empir Econ
30:93114 (2005).
Friedman JH, Multivariate adaptive regression splines. Ann
Statist 19:167 (1991).
McDowell I, Feakes J and Gay C, The phenolic pigment
composition of black tea liquors Part I: Predicting quality.
J Sci Food Agric 69:467474 (1995).
J Sci Food Agric 88:13541362 (2008)

DOI: 10.1002/jsfa
J Sci Food Agric 88:13631368 (2008)
Comparison of volatile emissions from

undamaged and mechanically damaged
almonds
John J Beck,1 Bradley S Higbee,2 Glory B Merrill1 and James N Roitman1
1 United States Department of Agriculture, Agricultural Research Service, Western Regional Research Center, Plant Mycotoxin Research,
800 Buchanan Street, Albany, CA 94710, USA
2 Paramount Farming Company, 33141 East Lerdo Highway, Bakersfield, CA 93308, USA
Abstract
BACKGROUND: The navel orangeworm (NOW) Amyelois transitella (Walker) is a major insect pest of almonds
causing considerable monetary setbacks for both growers and processors, and thus control of NOW is one of the
top priorities for the almond industry. Field observations purport that NOW is attracted to previously injured
almonds. Accordingly, in this study the volatile output of damaged almonds was investigated in an effort to identify
potential attractants for further studies into the control and/or monitoring of NOW. Mature almonds from the
Monterey variety were evaluated for their volatile composition after mechanical damage and compared with the
volatile composition of undamaged almonds.
RESULTS: Volatile organic compounds (VOCs) were collected on Tenax, desorbed and identified via gas
chromatography/mass spectrometry analysis. VOCs unique to the damaged tree nuts included trace amounts
of 3-pentanol and isomers of the spiroketal chalcogran. VOCs that increased in relative amounts after damage
include the spiroketal conophthorin and numerous four-carbon ester and ketone as well as alcohol derivatives, in
addition to two eight-carbon chain compounds.
CONCLUSION: Several VOCs, both unique and in increased amounts, were identified from damaged almonds.
Their presence in damaged almonds warrants further investigation into their role in NOW response to damaged
almonds, which may lead to insights into the control and/or monitoring of NOW.
Published in 2008 by John Wiley & Sons, Ltd.
Keywords: almond; damaged; spiroketal; Tenax; volatile
INTRODUCTION
The navel orangeworm (NOW) Amyelois transitella
(Walker) is a major insect pest of almonds grown in
California and causes considerable monetary setbacks
for both growers and processors. Control of NOW
has been stated as one of the top priorities for
the almond industry, with another priority being
the development of new pest management tools.1
There is twofold interest in controlling NOW, namely
its direct damage to tree nuts and the associated
contamination of toxin-producing fungi (mycotoxins)
resulting from NOW feeding damage, which provides
avenues for infection by mycotoxigenic fungi. The
point of damage into the tree nut from the pest
insect exposes the protective layers (hull, shell, seed
coat) surrounding the kernel. This point of entry
allows for ambient spores of aspergilli to enter
and thus contaminate the nut.2 Contamination of

tree nuts by mycotoxins is a chief concern for
both human food and animal feed safety, with
both areas experiencing major export issues as a
result of the contamination.3 The aflatoxin-producing
(aflatoxigenic) fungi most relevant to agriculture
include Aspergillus flavus and Aspergillus parasiticus.
Aflatoxin is presently a significant food safety problem
owing to its carcinogenic and teratogenic attributes.
The current total aflatoxin action threshold for
international export of tree nuts is set at 4 ppb
compared with the domestic level of 20 ppb set by the
Food and Drug Administration (FDA).2,3 California
is the top producer of almonds, supplying 75% of
the worlds needs.1 Approximately 5% of Californias
cropland is dedicated to almond production.4 The
Correspondence to: John J Beck, USDA-ARS, WRRC, Plant Mycotoxin Research, 800 Buchanan Street, Albany, CA 94710, USA
E-mail: john.beck@ars.usda.gov
Segments of this report were presented at the 48th Annual Meeting of the American Society of Pharmacognosy, Portland, ME 04101, USA, 1418 July 2007
and at the 17th Annual Multi-Crop Aflatoxin Elimination Workshop, Sacramento, CA 95814, USA, 2528 October 2004
Retired
Contract/grant sponsor: USDA-ARS; contract/grant number: CRIS 5325-42000-036-00
Contract/grant sponsor: Paramount Farming Company; contract/grant number: CRADA #58-3K95-7-1198
(Received 18 September 2007; revised version received 10 December 2007; accepted 28 December 2007)
This article is a US Government work and is in the public domain in the USA. J Sci Food Agric 00225142/2008/$30.00
JJ Beck et al.
California almond industry generates approximately

$2 billion annually, with the total California tree
nut industry reporting over $3.5 billion. About
5070% of California tree nuts are exported overseas
annually, with 80% of almond production alone
being exported.1 The strict export action levels for
aflatoxin have resulted in mycotoxin management
issues for producers as well as state and federal
governments. Actual costs of crop loss due to aflatoxin
contamination in California were estimated to have
been $2347 million over the period 19952001.3
Moreover, the economic and health impacts of
mycotoxins have been stated to be severe for
developing nations.5
In a recent investigation, researchers reported the
observation that female NOW moths were attracted to
injured almonds.6 Current attractants used in the field
and/or lab for NOW include the female sex pheromone
of NOW, (Z,Z)-11,13-hexadecadienal,7 a pheromone
blend of (Z,Z,Z,Z,Z)-3,6,9,12,15-tricosapentaene,
(Z,Z,Z,Z,Z)-3,6,9,12,15-pentacosapentaene,
ethyl
palmitate and ethyl-(Z,Z)-11,13-hexadecadien-1-yl
acetate8 and the almond oil fatty acids myristic,
palmitic, stearic, oleic and linoleic.9 Investigations
on VOCs from almonds report the detection of 2hexyl-3-methylmaleic anhydride10 and various alkane,
alkene, alkanol, aromatic and furan VOCs.11 However,
a search of the literature does not provide examples
of VOC emission as a result of injury to the almond.
As part of our ongoing efforts to address the concerns
regarding NOW, our labs investigated the VOC output of mechanically damaged (DMG) almonds from
the Monterey variety and compared the VOC fingerprint with that of undamaged (CTRL) almonds to
ascertain what VOCs, if any, were unique to DMG
almonds. The major VOCs from the CTRL and DMG
experiments were compared and contrasted.

Plant material
Fruits of Prunis dulcis (P. Mill.) D.A. Webb,
variety Monterey, common name sweet almond, were
collected in two batches during mid to late June 2006
from the groves of Paramount Farming Company,
Bakersfield, CA, USA. Each batch was replicated in
triplicate over different days. Batch 1 consisted of
almonds that had been injured while intact on the
tree, allowed to remain on the tree for approximately
14 days, then removed and placed in glass jars with
a Teflon paper seal between the cap and jar. The
injury/damage consisted of hull penetration with an
8 penny nail (3 mm diameter). Batch 2 consisted of
control almonds that were not injured, removed from
the tree and placed in glass jars with a Teflon paper
seal between the cap and jar. Batches 1 and 2 were
collected during concurrent time frames. Batches were
sent via overnight delivery to the USDA-ARS facility
in Albany, CA, USA for volatile evaluation.
1364
Collection of VOCs6
Almonds (ca 500 per experiment) were transferred
to a 12 L round-bottomed flask fitted with an inlet
for purified airflow at 1 L min1 and a Tenax (25 g)
collection system. VOCs were collected for 18 h and
desorbed with freshly distilled diethyl ether (100 mL),
then the ether was concentrated to a volume of ca
1 mL with a warm water bath and a Vigreux distillation
column.
Gas chromatography/mass spectrometry
(GC/MS) analysis
Separation of the collected VOC mixture was achieved
with a DB-Wax column (60 m 0.32 mm i.d.
0.25 m; J&W Scientific, Folsom, CA, USA) installed
on an HP 6890 gas chromatograph (GC) coupled
to an HP 5973 mass selective detector (MSD)
(Hewlett Packard, Palo Alto, CA, USA). Extracts were
analysed with the following method: 1 L injections;
injector temperature, 150 C; splitless mode; inlet
temperature, 150 C; inlet pressure, 7.7 psi; total
flow, 11.9 mL min1 ; He carrier gas at 7.7 psi; flow,
1.5 mL min1 ; velocity, 31 cm min1 ; constant flow;
oven settings: initial temperature, 30 C; hold time,
4 min; ramp, 2 C min1 ; final temperature, 200 C;
hold time, 30 min. The MSD parameters were as
follows: source temperature, 230 C; MS quadrupole
temperature, 150 C; electron impact (EI) mode,
70 eV; solvent delay, 1 min; scan group 1, 40300
amu; scan group 2 at 20 min, 40450 amu. National
Institute of Standards and Technology (NIST), Wiley
and internally generated databases were used for
fragmentation pattern identification. Retention indices
(RIs) were calculated using a homologous series of nalkanes on a DB-Wax column. Compounds that did
not match the RIs of known VOCs from our database
and/or did not provide sufficient mass fragmentation
pattern matches were assigned as unknown in Table 1.
GC/MS analysis was performed on each of the three
separate samples for both the CTRL and DMG
batches of almonds. The relative areas for each of the
compounds from the GC/MS runs were normalised
to the internal standard cyclodecanone (15 g) and
the means, standard deviations and confidence limits
(95%) in Table 1 and Fig. 3 were calculated with
Microsoft Excel software (Redmond, WA, USA).

Analysis of the major VOCs emitted by both the
CTRL and DMG almonds provides a wide range
of compounds, which corroborated other reports
and added to the volatile fingerprint of almonds in
the literature. Table 1 provides a list of the major
VOCs detected from both experiments. Examination
of Table 1 showed a number of monoterpenes
common to citrus and other plants,12 namely pinene, camphene, -pinene, -myrcene, limonene
J Sci Food Agric 88:13631368 (2008)
DOI: 10.1002/jsfa
Volatile emissions from undamaged and mechanically damaged almonds
Figure 1. Total ion chromatogram (relative abundance versus time) illustrating a typical elution pattern of DMG almond VOCs. Unique, increased
and/or notable compounds are labelled with numbers corresponding to compounds listed in Table 1.
and cymene. The compounds -pinene and camphene

were noted to be in relatively large amounts in the
CTRL almonds and underwent a small decrease
in volatile output for the DMG almonds (Fig. 1
illustrates a typical GC elution pattern for DMG
VOCs). Camphene and -pinene are both common,
non-specific plant VOCs that have a wide range of
semiochemical activity,13 15 but neither has been
reported for activity against NOW. The remaining
monoterpenes are ubiquitous as plant VOCs, and
several have been noted as semiochemicals.14
The spiroketal conophthorin (7-methyl-1,6-dioxaspiro[4.5]decane), in unknown configuration, was
also observed to undergo a small increase in relative amounts in several of the DMG almond volatile
analyses. Conophthorin is present in several insects
and plants and in varying concentrations of isomers
(Fig. 2).16
The sesquiterpenes bourbonene (as a mixture
with benzaldehyde), -copaene and aromadendrene
also increased in relative amounts in the DMG
almonds. These particular sesquiterpenes have been
noted to occur together in potato leaf VOCs.17
Bourbonene and -copaene are pheromones for the
European birch aphid,18 and aromadendrene has
been reported to be an attractant for the Brazilian
eucalyptus brown looper.15 However, none of the
noted sesquiterpenes has been implicated as possessing
activity against NOW.
The only compounds to demonstrate corroboration
of previous reports of almond VOCs were 2pentylfuran, nonanal, 1-octen-3-ol, benzaldehyde
O
O O
Z-(5S,7R)
O O
Z-(5R,7S)
E-(5R,7R)
O
O
E-(5S,7S)
Figure 2. Stereoisomers of conophthorin (7-methyl-1,6-dioxaspiro

[4.5]decane).
J Sci Food Agric 88:13631368 (2008)

DOI: 10.1002/jsfa
and 2-phenylethyl alcohol.11,19 Notable differences

between the work performed by Buttery et al.,11
which evaluated VOCs from almond hulls, and
the VOCs collected in the present study were
the detection here of numerous four-carbon ester
and ketone as well as alcohol derivatives. Specific
examples were the compounds that also showed a
general increase in amounts between the CTRL and
DMG almond VOCs, namely 2-butanol, ethyl 2methylbutyrate, ethyl isovalerate, ethyl 2-butenoate,
ethyl 3-methylbut-2-enoate, ethyl tiglate and 3hydroxy-2-butanone. Several of these VOCs have
been attributed to fruity, wine aroma and smoky
odours20,21 and are known semiochemicals,22 24
yet are not associated with NOW semiochemicals.
The compounds that demonstrated statistically valid
increases were ethyl 2-methylbutyrate, 2-methyland 3-methyl-1-butanol, ethyl tiglate and -copaene
(Fig. 3), in addition to one unknown compound.
Several compounds in Table 1 were noted to be
indicative of fungal growth. Of particular interest were
2-methyl- and 3-methyl-1-butanol and 2-pentyfuran
owing to their relatively large amounts. The butanol
Figure 3. VOCs showing a statistically significant increase (95%

confidence limit) in DMG almonds.
1365
JJ Beck et al.
Table 1. Major volatile components of Monterey (MO) damaged (DMG) and control (CTRL) almondsa
Relative amountb
No.
Compound
RIc
RI (PMR)d
RI (lit.)
MO CTRL
MO DMG
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
-Pinene
2-Butanol
Ethyl butyrate
Unknown
Ethyl 2-methylbutyrate
Camphene
Ethyl isovalerate
-Pinene
Diethyl carbonate
3-Pentanol
Ethyl 2-butenoate
-Myrcene
Limonene
3-Methyl- and 2-methyl-1-butanol
Ethyl 3-methylbut-2-enoate
2-Pentylfuran
Ethyl tiglate, ethyl hexanoate
1-Dodecene
Styrene
3-Octanone
Cymene isomer (para- 1264)
3-Hydroxy-2-butanone
Conophthorin
Unknown
E-4,8-Dimethyl-1,3,7-nonatriene
Chalcogran isomer #1
Chalcogran isomer #2
Nonanal
Tetradec-1-ene
1-Octen-3-ol
Bourbonene/benzaldehyde mix
trans--Bergamotene
-Copaene
Aromadendrene
1-Hexadecene
Ethyl benzoate
1-Methyl-2-pyrrolidinone isomer
Cyclodecanonee
Unknown
2-Phenylethyl alcohol
1-Dodecanol
2-Phenoxyethanol
Docosane
Unknown
Unknown
Unknown
Vanillin
1016
1032
1037
1044
1053
1058
1067
1092
1100
1111
1158
1160
1188
1207
1219
1227
1231
1243
1247
1249
1261
1274
1280
1286
1301
1343
1348
1387
1444
1451
1505
1577
1582
1606
1645
1654
1662
1726
1870
1899
1968
2126
2187
2264
2279
2471
2541
1020
1027
1029
1014
1019, 1025
2.21 (1.42)
0.24 (0.12)
0.51 (0.37)
ND
0.32 (0.09)
2.27 (1.24)
2.57 (0.25)
0.36 (0.14)
0.53 (0.67)
ND
0.14 (0.25)
0.77 (0.04)
1.06 (0.36)
1.66 (0.19)
0.16 (0.28)
1.81 (0.04)
0.38 (0.07)
0.69 (0.75)
0.30 (0.02)
Tr
0.16 (0.04)
1.83 (0.76)
0.34 (0.26)
ND
0.11 (0.10)
ND
ND
0.30 (0.36)
1.02 (1.77)
0.28 (0.06)
0.21 (0.07)
0.19 (0.19)
0.64 (0.20)
0.11 (0.18)
0.63 (1.09)
0.51 (0.60)
0.60 (0.09)
15.00 (0.00)
0.58 (0.28)
0.16 (0.02)
0.37 (0.13)
0.21 (0.06)
0.52 (0.12)
0.17 (0.03)
0.56 (0.28)
0.18 (0.04)
1.88 (0.57)
1.78 (0.74)
0.32 (0.20)
0.59 (0.35)
0.19 (0.26)
0.62 (0.04)
1.98 (0.92)
3.34 (2.10)
0.32 (0.12)
ND
0.08 (0.08)
0.20 (0.27)
0.56 (0.13)
0.80 (0.18)
3.63 (2.95)
0.23 (0.30)
0.93 (0.38)
0.74 (0.14)
ND
0.52 (0.56)
0.12 (0.11)
0.11 (0.10)
2.55 (1.85)
0.79 (0.88)
Tr
0.15 (0.04)
Tr
Tr
ND
ND
0.42 (0.12)
0.47 (0.66)
0.13 (0.02)
1.04 (0.27)
0.24 (0.12)
ND
0.18 (0.20)
0.55 (0.22)
15.00 (0.00)
0.53 (0.21)
0.42 (0.62)
0.18 (0.17)
0.14 (0.12)
0.30 (0.29)
Tr
0.53 (0.33)
0.21 (0.21)
0.72 (0.68)
1046
1063
1062
1106
1101
1103
1158
1157
1197
1205
1226
1232
1242
1252
1251
1250
1278
1048
1088, 1094
1108
1154, 1159
1182, 1195
1190
1220, 1224
1302
1389
1446
1448
1516
1582
1589
1390, 1400
1428, 1446
1605
1647
1661
1744
1910
2142
2200
2585
1848
Almonds collected on three different days.

Volatile amounts reported as mean, normalised to 15 g of internal standard, with standard deviation in parentheses; ND, not detected; Tr, trace
amount (<0.10 g).
c Retention index relative to n-alkanes on DB-Wax column.
d RI of volatile compounds based on in-house database.
e
Internal standard.
b
VOCs increased in amounts from CTRL to DMG,

while 2-pentylfuran decreased between these two
experiments. The VOCs noted to occur during fungal
growth, particularly Aspergillus species, are 2-methyland 3-methyl-1-butanol, 2-pentylfuran, 1-octen-3-ol
1366
and 3-octanone.25,26 In addition to its previously

reported occurrence in almonds,11,19 it should be
noted that 1-octen-3-ol is also a plant volatile of
numerous plants, including genera of the Orchidaceae,
as well as a semiochemical for several different
J Sci Food Agric 88:13631368 (2008)
DOI: 10.1002/jsfa
Volatile emissions from undamaged and mechanically damaged almonds
insects. 2-Pentylfuran is also an Orchidaceae plant

volatile, but to a much lesser extent (The Pherobase,
www.pherobase.com, accessed 22 August 2007). The
eight-carbon VOCs, in addition to the sesquiterpenes
myrcene, limonene and copaene, have been reported
to be produced by Penicillium species.27 Moreover,
sesquiterpene VOCs unique to A. flavus28 were not
found in this study, thus indicating the possible
presence of Penicillium more so than Aspergillus, yet
this information did not provide enough evidence
to exclusively implicate one particular microbe. Both
Aspergillus and Penicillium are known to be present on
almonds.29
The compounds unique, albeit only present in trace
amounts, to the DMG almond VOCs were 3-pentanol,
two chalcogran isomers (Fig. 4) and one unknown
compound (No. 24, Table 1). 3-Pentanol is relatively
new as a semiochemical, with only one study that
demonstrated its ability to provoke a response in the
male sugarcane weevil.30 Interestingly, the same study
reported ethyl butyrate, among other esters, as eliciting
an antennal response in the female sugarcane weevil.
The chalcogran isomers, however, have a long history
of semiochemical activity, primarily with the European
spruce bark beetle Pityogenes chalcographus.31,32 The
(2S,5R) and (2S,5S) configurations of chalcogran are
found in P. chalcographus, and as two isomers with
unknown configurations in the bark beetle Pityogenes
quadridens.33 It is interesting to note that Byers
et al.34 used combinations of chalcogran, camphene
and - and -pinene, all VOCs detected in DMG
almond VOCs, along with the compound methylE,Z-2,4-decadienoate to enable host recognition of
the bark beetle. Other correlations between DMG
almond VOCs and semiochemicals from bark beetles
are similar VOCs, among others, emitted from Ips
typographus males under stress, namely - and pinene, camphene, myrcene, limonene and cymene,
and similar VOCs from Pityogenes species, namely
limonene, chalcogran, 1-octen-3-ol and 2-phenylethyl
alcohol.35 The occurrence of the chalcogran isomers
in this and the one associated previous study6 does
not conclusively determine whether the spiroketals
are emitted as a result of damage to the almonds or
formed by fungal growth. The detection of several
VOCs indicative of fungal growth brings into question
whether or not the method of removing the DMG
almonds after several days on the tree and subsequent
transportation to the laboratory allows ambient fungi
to initiate growth on the almonds. Investigations into
this matter are ongoing.
O
O
Z-(2R,5R)
Z-(2S,5S)
E-(2R,5S)
E-(2S,5R)
Figure 4. Stereoisomers of chalcogran (2-ethyl-1,6-dioxaspiro

[4.4]nonane).
J Sci Food Agric 88:13631368 (2008)

DOI: 10.1002/jsfa
CONCLUSION
The VOC emissions of control and damaged almonds
were investigated. VOCs unique to damaged almonds
include 3-pentanol and two isomers of the spiroketal
chalcogran (unknown configuration) in trace amounts.
Other VOCs that increased in relative quantity include
the spiroketal conophthorin (unknown configuration),
numerous four-carbon ester and ketone as well
as alcohol derivatives, in addition to two eightcarbon chain compounds. VOCs suggestive of fungal
growth were noted and brought to question whether
the chalcogran isomers are damage-induced or a
result of fungal growth. Also notable was the
apparent correlation between several bark beetle
semiochemicals and VOCs from the CTRL and
DMG almonds. The detection of the VOCs noted
above provides evidence that further investigation into
their role in NOW response to damaged almonds is
required.
ACKNOWLEDGEMENTS
This research was conducted under USDA-ARS
CRIS project 5325-42000-036-00 and a cooperative
research and development agreement with Paramount
Farming Company (CRADA #58-3K95-7-1198).
REFERENCES
1 Almond Board of California, The Foundation for a Pest
Management Strategic Plan in Almond Production: Summary
of a Workshop Held December 12, 2002. California Pest
Management Center, Modesto, CA (2003).
2 Campbell BC, Molyneux RJ and Schatzki TF, Current research
on reducing pre- and post-harvest aflatoxin contamination
of U.S. almond, pistachio, and walnut. J Toxicol Toxin Rev
22:225266 (2003).
3 Robens J and Cardwell W, The costs of mycotoxin management
to the USA: management of aflatoxins in the United States.
J Toxicol Toxin Rev 22:143156 (2003).
4 Epstein L, Bassein S, Zalom FG and Wilhoit LR, Changes
in pest management practice in almond orchards during
the rainy season in California, USA. Agric Ecosyst Environ
83:111120 (2001).
5 Wu F, Mycotoxin risk assessment for the purpose of setting
international regulatory standards. Environ Sci Technol
38:40494055 (2004).
6 Roitman JN, Merrill GB and Higbee BS, What attracts navel
orangeworm to oviposit preferentially on wounded almonds
rather than unblemished fruit? The search for a volatile
attractant. Proc 4th Annu Fungal Genomics, 5th Annu Multicrop Fumonisin, 17th Annu Multi-crop Aflatoxin Elimination
Workshops, pp. 27 (2004).
7 Coffelt JA, Vick KW, Sonnet PE and Doolittle RE, Isolation,
identification, and synthesis of a female sex pheromone
of the navel orangeworm, Amyelois transitella (Lepidoptera:
Pyralidae). J Chem Ecol 5:955966 (1979).
8 Leal WS, Parra-Pedrazzoli AL, Kaissling K-E, Morgan TI,
Zalom FG, Pesak DJ, et al, Unusual pheromone chemistry in
the navel orangeworm: novel sex attractants and a behavioral
antagonist. Naturwissenschaften 92:139146 (2005).
9 Phelan PL, Roelofs CJ, Youngman RR and Baker TC, Characterization of chemicals mediating ovipositional hostplant finding by Amyelois transitella females. J Chem Ecol
17:599613 (1991).
1367
JJ Beck et al.
10 Buttery RG, Seifert RM, Haddon WF and Lundin RE, 2Hexyl-3-methylmaleic anhydride: an unusual volatile component of raisins and almond hulls. J Agric Food Chem
28:13361338 (1980).
11 Buttery RG, Soderstrom EL, Seifert RM, Ling LC and Haddon WF, Components of almond hulls: possible navel orangeworm attractants and growth inhibitors. J Agric Food Chem
28:353356 (1980).
12 Choi H-S, Lipolytic effects of citrus peel oils and their
components. J Agric Food Chem 54:32543258 (2006).
13 Byers JA, Birgersson G, Lofqvist J, Appelgren M and
Bergstrom G, Isolation of pheromone synergists of bark
beetle, Pityogenes chalcographus, from complex insectplant
odors by fractionation and subtractive-combination bioassay.
J Chem Ecol 16:861876 (1990).
14 Whitehead AT, Electroantennogram responses by mountain
pine beetles, Dendroctonus ponderosae Hopkins, exposed to
selected semiochemicals. J Chem Ecol 12:16031621 (1986).
15 Batista-Pereira LG, Fernandes JB, Correa AG, Da Silva MFGF
and Vierira PC, Electrophysiological responses of eucalyptus
brown looper Thyrinteina arnobia to essential oils of seven
Eucalyptus species. J Braz Chem Soc 17:555561 (2006).
16 Zhang Q-H, Rolasch T, Schlyter F and Francke W, Enantiospecific antennal response of bark beetles to spiroacetal
(E)-conophthorin. J Chem Ecol 28:18391852 (2002).
17 Khalilov LM, Khalilova AZ, Odinokov VN, Baltaev UA, Paramonov EA and Dzhemilev UM, Identification and biological
activity of the volatile organic substances emitted by plants
and insects. II. Sesquiterpene compostion of the native scent
of leaves of the potato Solanum tuberosum. Chem Nat Comp
35:422426 (1999).
18 Francis F, Vandermoten S, Verheggen F, Lognay G and
Haubruge E, Is (E)--farnesene the only volatile terpenoid
in aphids? J Appl Entomol 129:611 (2005).
19 Caja MM, Ruiz del Castillo ML, Martinez Alvarez R, Herraiz M and Blanch GP, Analysis of volatile compounds in
edible oils using simultaneous distillationsolvent extraction
and direct coupling of liquid chromatography with gas chromatography. Eur Food Res Technol 211:4551 (2000).
20 Marti MP, Mestres M, Sala C, Busto O and Guasch J, Solidphase microextraction and gas chromatography olfactometry
analysis of successively diluted samples. A new approach of the
aroma extract dilution analysis applied to the characterization
of wine aroma. J Agric Food Chem 51:78617865 (2003).
21 Joulain D, Casazza A, Laurent R, Portier D, Guillamon N,
Pandya R, et al, Volatile flavor constituents of fruits from
southern Africa: mobola plum (Parinari curatellifolia). J Agric
Food Chem 52:23222325 (2004).
22 Bartelt RJ, Schaner AM and Jackson LL, Aggregation
pheromones in Drosophila borealis and Drosophila littoralis.
J Chem Ecol 14:13191327 (1988).
1368
23 Pinero JC and Prokopy RJ, Field evaluation of plant odor

and pheromonal combinations for attracting plum curculios.
J Chem Ecol 29:27352748 (2003).
24 Malo EA, Cruz-Lopez L, Toledo J, Del Mazo A, Virgen A and
Rojas JC, Behavioral and electrophysiological responses of the
Mexican fruit fly (Diptera: Tephritidae) to guava VOCs. Fla
Entomol 88:364371 (2005).
25 Magan N and Evans P, VOCs as an indicator of fungal activity
and differentiation between species, and the potential use
of electronic nose technology for early detection of grain
spoilage. J Stored Prod Res 36:319340 (2000).
26 Gao P, Korley F, Martin J and Chen BT, Determination of
unique microbial volatile organic compounds produced by
five Aspergillus species commonly found in problem buildings.
Am Ind Hyg Assoc J 63:135140 (2002).
27 Nilsson T, Larsen TO, Montanarella L and Madsen JO, Application of head-space solid-phase microextraction for the
analysis of volatile metabolites emitted by Penicillium species.
J Microbiol Meth 25:245255 (1996).
28 Zeringue HJ, Bhatnagar D and Cleveland TE, C15H24 volatile
compounds unique to aflatoxigenic strains of Aspergillus flavus.
Appl Environ Microbiol 59:22642270 (1993).
29 Bayman P, Baker JL and Mahoney ME, Aspergillus on tree nuts:
incidence and associations. Mycopathologia 155:161169
(2002).
30 Perez AL, Campos Y, Chinchilla CM, Oehlschlager AC,
Gries G, Gries R, et al, Aggregation pheromones and host
kairomones of West Indian sugarcane weevil, Metamasius
hemipterus sericeus. J Chem Ecol 23:869888 (1997).
31 Francke W, Heemann V, Gerken V, Renwick JAA and Vite JP,
2-Ethyl-1,6-dioxaspiro[4.4]nonane, principal aggregation
pheromone of Pityogenes chalcographus (L.). Naturwissenschaften 64:590591 (1977).
32 Byers JA, Hogberg H-E, Unelius CR, Birgersson G
and Lofqvist J, Structureactivity studies on aggregation pheromone components of Pityogenes chalcographus
(Coleoptera: Scolytidae), all stereoisomers of chalcogran and
methyl 2,4-decadienoate. J Chem Ecol 15:685695 (1989).
33 Francke W and Kitching W, Spiroketals in insects. Curr Org
Chem 5:233251 (2001).
34 Byers JA, Birgersson G, Lofqvist J and Bergstrom G, Synergistic
pheromones and monoterpenes enable aggregation and host
recognition by a bark beetle. Naturwissenschaften 75:153155
(1988).
35 Francke W, Bartels J, Meyer H, Schroder F, Kohnle U,
Baader E, et al, Semiochemicals from bark beetles: new
results, remarks, and reflections. J Chem Ecol 21:10431063
(1995).
J Sci Food Agric 88:13631368 (2008)

DOI: 10.1002/jsfa
J Sci Food Agric 88:13691375 (2008)
Cadmium accumulation in Agaricus

blazei Murrill
Jian Cheng Huang,1 Kai Ben Li,1 Ying Rui Yu,1 Hanwen Wu2 and De Li Liu2
1 Institute
of Plant Protection, Fujian Academy of Agricultural Sciences, Fuzhou, Fujian 350013, China
Graham Centre for Agricultural Innovation (a collaborative alliance between NSW Department of Primary Industries and Charles Sturt
University), Wagga Wagga Agricultural Institute, Wagga Wagga, NSW 2650, Australia
2 E.H.
Abstract
BACKGROUND: Agaricus blazei Murrill has become a popular food source of high nutritional and medicinal
value in many Asian countries. However, there are growing health concerns on cadmium (Cd) accumulation by
A. blazei. Experiments were conducted to investigate Cd accumulation patterns in A. blazei and to identify key
factors contributing to Cd accumulation.
RESULTS: Cd concentrations in the substrates and subsequent fruit bodies declined rapidly after the first, second
and third harvest wave. A quick rinse of the fruit bodies in water reduced the Cd concentration by 2754%
depending on the strain. The Cd concentration in the fruit bodies decreased as the fruit body yield m2 or fruit
body number m2 increased, while it increased as the substrate Cd content or fruit body size increased. Cd
accumulation was positively associated with phosphorus (P) uptake.
CONCLUSION: The results suggests that, in the A. blazei-growing region studied, Cd and P concentrations in the
substrates and casing soil should be reduced in order to effectively minimise Cd accumulation in the fruit bodies.
It is also necessary to improve fruit body yield by increasing the number of medium-sized fruit bodies. Overgrowth
of individual fruit bodies stimulates Cd accumulation in A. blazei.
Keywords: Agaricus blazei Murrill; cadmium; substrate; fruit body; accumulation; yield components; modelling
INTRODUCTION
Agaricus blazei Murrill is a mushroom species of
the phylum Basidiomycota originating from Brazil.1
It is a medicinally important fungus that is widely
consumed and prescribed in countries such as China,
Japan, South Korea and Turkey.2 4 Agaricus blazei
is rich in protein, amino acids, microelements and
polysaccharides. Since its introduction into Japan
in 1965 by Takatoshi Furumoto, it has gradually
gained popularity and is now widely known as
himematsutake.1,3 In 1992 the mushroom was
introduced from Japan into China and successfully
cultivated and is now in large-scale commercial
production.5,6
The high nutritional and medicinal value of
A. blazei has been well documented.3 It has been
widely used as a folk medicine for various diseases,
including diabetes, hyperlipidaemia, arteriosclerosis,
osteoporosis, gastric ulcer and cancer.1,7,8 Extensive research has been conducted to identify bioactive substances from A. blazei. A number of such
substances have been identified, e.g. polysaccharides, cytotoxic steroids, lectin and antimutagens.9 11
Among them, various polysaccharides and proteinpolysaccharide complexes isolated from the fruit
bodies of A. blazei possess antitumour activity.3,12
Ohno et al.12 reported that a highly branched 1,3-glucan, a main component of polysaccharides, showed
strong antitumour activity. It has been demonstrated
that the aqueous extract of A. blazei provides significant protection against mutagenicity induced both
in vivo by cyclophosphamide and in vitro by methyl
methanesulfonate.7 The most anticipated pharmacological effect of A. blazei is modulation of the immune
system against cancer. Recent research has shown that
extracts of A. blazei selectively up-regulate the genes
related to immune function, particularly proinflammatoric genes such as the interleukins IL1B and IL8.13
However, accumulation of cadmium (Cd) in
A. blazei has received increasing attention in the past
few decades owing to the potential health hazard of this
heavy metal. The genus Agaricus is able to accumulate
high concentrations of Cd, up to 100300 mg kg1
dry matter (DM).14,15 Accumulation of Cd in A.
blazei has been found to range from 3 to 35 mg kg1
DM.16 Cadmium is accumulated mainly in the
kidneys, spleen and liver, and its concentration in
Correspondence to: Jian Cheng Huang, Institute of Plant Protection, Fujian Academy of Agricultural Sciences, Fuzhou, Fujian 350013, China
E-mail: huangjc12@sina.com
Contract/grant sponsor: Department of Science and Technology of Fujian, China; contract/grant number: 2003-N-011
(Received 16 September 2007; revised version received 12 December 2007; accepted 11 January 2007)
JC Huang et al.
blood serum increases markedly following mushroom

consumption.17
Cadmium is a toxic element exerting profound
adverse effects on many life processes, e.g. kidney
function and the male reproductive system.18,19
Uptake of a high concentration of Cd via the food
chain is detrimental to the human body, causing
anaemia, high blood pressure, osteoporosis, kidney
dysfunction, lung impairment, reproductive function
damage and carcinogenesis.20,21 The FAO/WHO has
listed Cd as the third most important food pollutant
after aflatoxins and arsenic (As). The FAO/WHO
provisional tolerable weekly intake for Cd has a limit
of 0.007 mg kg1 body weight, and the maximum
permissible dose for an adult is 0.5 mg Cd week1 .22
If an average person with a body weight of 6070 kg
consumes a 300 g portion of fresh mushrooms per
meal, which generally contains 100 g DM kg1 ,3 the
tolerable weekly intake is thus easily reached by a single
portion of 300 g of fresh mushrooms containing 14 mg
Cd kg1 DM. Therefore Cd accumulation in A. blazei
could potentially affect food safety and eventually have
a direct or indirect impact on human health. However,
there is little information available on the distribution
and accumulation of Cd in A. blazei. The present
study aimed to investigate the accumulation patterns
of Cd in A. blazei and to determine the impact of
fruit body yield, yield components and phosphorus
(P) uptake on Cd concentration in order to maximise
mushroom production with minimum accumulated
Cd in the fruit body.

Agaricus blazei strains and site selection
Two strains of A. blazei, N-2 (narrow-stalk type)
and A-6 (broad-stalk type), were obtained from the
Institute of Plant Protection, Fujian Academy of
Agricultural Sciences, Fujian, China. Experiments
were conducted in the township of Xin Du in
southeastern Fujian. The research site was located
in a rural area about 30 km away from industrial sites.
Local farmers have a long history of growing common
mushroom (Agaricus bisporus) and A. blazei. Agaricus
blazei is normally grown twice a year in spring and
autumn. The present experiment was carried out in the
spring season. Drinking water was used to minimise
the risk of water contamination from other sources.
Substrate preparation and cultivation
The substrates consisted of 1000 kg of rice straw,
200 kg of dry cow manure, 150 kg of commercial
fertilisers (N:P:K = 2.5:1:2.5), 200 kg of ammonium
carbonate and 100 kg of gypsum. On day 1 a layer of
rice straw 20 cm thick was spread onto levelled ground
to form a rectangular pile of 2 m 4 m. A thin layer of
cow manure and fertilisers was then evenly spread on
top of the straw and covered with another layer of rice
straw. This process was alternated six times until the
pile reached a height of 1.5 m. The pile was turned on
1370
day 5 to mix the ingredients thoroughly. This turning

process was periodically repeated three more times
on days 9, 12 and 14. Gypsum was added during
the first turning operation. Drinking water was used to
maintain a moisture level of 650 g kg1 during layering
and turning and throughout the entire composting
period. The substrate was then subjected to steam
pasteurisation and evenly spread onto culture beds
in a temperature-controlled culture room. After the
temperature of the pasteurised substrate had dropped
to about 25 C, wheat grain spawn was introduced at
a rate of 1000 mL m2 and thoroughly mixed into the
substrate. A layer of casing soil (peat moss) was spread
over the surface of the substrate beds to a depth of 3 cm
when the substrate surface was completely colonised
by the spawn. The final substrate bed had a height of
15 cm. The bed was irrigated periodically. Common
district practices were used to manage the continuous
growth of A. blazei.6
Substrate and fruit body sampling
Substrates were consecutively sampled at different
times, i.e. immediately after the steam pasteurisation
stage, after complete substrate colonisation by the
spawn (colonisation stage) and at the first, second and
third harvest stages. The substrate samples were oven
dried at 65 C for 48 h. Fruit bodies of the first and
second harvests were sampled from nine fixed quadrats
of 1 m2 each, which were randomly selected to cover
the range of various numbers of fruit bodies and hence
yields m2 . The samples of the third harvest were
taken from another nine random quadrats (1 m2 ). The
fruit bodies from each quadrat were assessed for fresh
weight (g m2 ) and number of fruit bodies m2 . The
fresh fruit bodies were then bulked, oven dried and
weighed prior to analyses.
Effects of different Agaricus blazei strains,
rinsing treatments and fruit body parts on Cd
accumulation
For each of the two A. blazei strains A-6 and N-2 a 1 kg
sample of fresh fruit bodies was randomly obtained
from the first harvest and subjected to a quick rinse
with tap water for 2 min to remove the scales. Rinsed
and non-rinsed samples (1 kg fresh weight each) were
oven dried prior to Cd quantification. Another 1 kg
sample of non-rinsed fresh fruit bodies was taken and
separated into caps and stalks. The caps and stalks
were oven-dried prior to Cd analyses.
Quantification of Cd in cultivation substrates and
fruit bodies
Dried samples of fruit bodies and substrates were
subjected to atomic absorption spectrometry measurement by Fujian Centre for Instrumental Analysis.
A national standard protocol for element analysis was
used for the determination of Cd (GB/T 5009.152003).23 Briefly, each dried sample was homogenised
and stored in pre-cleaned polyethylene bottles until
analysis. For analysis, a 5 g sample was placed in
J Sci Food Agric 88:13691375 (2008)
DOI: 10.1002/jsfa
Cadmium accumulation in Agaricus blazei Murrill
a porcelain crucible and ashed at 500 C for 8 h.

The ash was then dissolved in 1 mL of a 4:1 (v/v)
mixture of nitric acid (HNO3 ) and perchloric acid
(HClO4 ), evaporated to dryness and heated again at
500 C for 4 h. The material obtained from this mineralisation process was further treated with 10 mL of
0.5 mol L1 hydrochloric acid (HCl) and diluted with
deionised water to a final volume of 50 mL. Three
blank samples were treated in the same manner. An
atomic absorption spectrometer (model AA6800, Shimadzu, Shanghai, China) operating at a wavelength
of 228.8 nm was used to determine the Cd concentrations in the mushroom samples.
Quantification of P in cultivation substrates and
fruit bodies
Phosphate was determined in accordance with a
national standard protocol (GB/T5009.872003)23
based on the molybdenum blue method. Briefly,
each dried sample was acid digested and subjected
to reaction with molybdic acid to form a heteropoly
molybdenum blue complex. Phosphorus (as P2 O5 )
was then determined spectrophotometrically by measurement of the absorbance at a wavelength of 660 nm
with a UVvisible spectrophotometer (model 7220,
Beijing Rayleigh Instrument Corp., Beijing, China).
Data analysis
From the sampling procedure a wide range of data
for fruit body yield m2 , fruit body number m2 , dry
weight per fruit body and Cd concentration were
obtained. The data were subjected to linear and
nonlinear regression analyses. The assumption was
made that Cd accumulation in the fruit body (Cd, g
m2 ) is primarily related to fruit body yield (Y , g m2 )
and follows the principle of enzyme kinetics.24 Thus
Cd accumulation is a function of fruit body yield as
described by
Cd = Cdmx Y /(Y0.5 + Y )
(1)
where Cdmx is the asymptote for Cd accumulation as

the fruit body yield approaches infinity and Y0.5 is the
fruit body yield for Cd accumulation at a half of Cdmx .
The Cd concentration (CCd , g g1 ) can be defined as
CCd = Cd/Y
(2)
Combining Eqns (1) and (2) gives

CCd = Cdmx /(Y0.5 + Y )
(3)
Equation (3) was used to express the Cd concentration in the fruit body as a function of fruit body
yield by a nonlinear least squares regression analysis.
In addition, the relationships between fruit body yield,
average fruit body dry weight per fruit and fruit body
number m2 were analysed using a similar equation.
The nonlinear least squares regression analysis was
conducted by a nonlinear module in SHAZAM.25
J Sci Food Agric 88:13691375 (2008)
DOI: 10.1002/jsfa

Dynamics of Cd accumulation in substrates and
fruit bodies during fructification and harvesting
period
There were slight changes in Cd concentration in
the substrates between the steam pasteurisation and
substrate colonisation stages, with values of 0.29 and
0.32 106 g g1 DM respectively. However, the Cd
concentration in the substrates declined rapidly after
the first, second and third harvests of fruit bodies,
resulting in 29, 44 and 58% reductions respectively
compared with the Cd concentration at the stage of
complete colonisation by the spawn. Heavy metals
are transported to the fruit body via the mycelium
during the start of fructification.17 After the first
harvest a significant amount of Cd in the substrates
was exported owing to the removal of fruit bodies,
thereby resulting in a decreasing Cd concentration
being detected in the substrates.
Similarly, the Cd concentration in the fruit bodies
decreased after the consecutive harvests of first, second
and third flushes of mushrooms, with values of 5.51,
5.22 and 4.73 106 g g1 DM respectively. Kalac
and Svoboda17 also reported that metal concentrations
were highest in the initial harvest wave of A. bisporus.
This declining trend of Cd concentration in the fruit
bodies after consecutive harvests is a result of the
decreasing Cd concentration in the substrates due to
the harvesting of fruit bodies.
Cd concentrations as affected by Agaricus blazei

strains, body parts and rinsing
Rinsing is an effective tactic to reduce the Cd
concentration in the fruit bodies after harvest. After
a quick rinse in water for 2 min to remove the scales,
the Cd concentration in the fruit bodies was reduced
from 10.6 to 7.70 106 g g1 DM for the A. blazei
strain N-2 and from 10.9 to 5.00 106 g g1 DM for
the strain A-6. In a similar study, Zrodlowski26 found
that washing and peeling of A. bisporus decreased
the contents of cadmium, lead, copper and zinc by
3040%.
Cadmium concentrations differ between body parts.
The Cd concentrations in the cap and stalk of the
strain N-2 were 14.3 and 6.20 106 g g1 DM
respectively. For the A. blazei strain A-6 the Cd
concentration was 15.0 106 g g1 DM in the cap
and 5.00 106 g g1 DM in the stalk. The uneven
distribution of heavy metals within fruit bodies has
also been reported by Kalac and Svoboda.17 They
found that metal concentrations were highest in the
sporophore (but not in the spores), lower in the rest
of the cap and lowest in the stalk. Similarly, Melgar
et al.27 reported that the Cd concentration in Agaricus
macrosporus was about two times higher in the cap than
in the other parts of the fruit body. Seeger15 found that
the Cd concentration in the gills was five times higher
than in the other parts.
1371
JC Huang et al.
Relationship between Agaricus blazei yield and

its components
The fruit body dry weight per fruit of A. blazei
decreased as the fruit body number m2 increased,
following a linear relationship between the reciprocal
of fruit body dry weight and fruit body number
m2 (Fig. 1). Similar trends were found for the first
and second harvests as well as for the two harvests
combined. The total dry weight of fruit bodies m2
can be fitted by a hyperbolic relationship to fruit body
number m2 by adopting a characteristic yielddensity
relationship described by Willey and Heath28 (Fig. 2).
Although a lower number of fruit bodies m2 resulted
in a higher weight per single fruit body, a high fruit
body yield m2 can only be achieved by increasing
the number of fruit bodies m2 rather than the size
(weight) of each individual fruit body.
Effect of fruit body yield m2 on Cd accumulation
The Cd concentration in the fruit body decreased as
the fruit body yield m2 increased (Fig. 3), following
a similar relationship between fruit body size (weight)
and fruit body number m2 to that shown in Fig. 1.
The fitted parameters for Eqn (3) suggest that the
relationship is valid when the fruit body yield is greater
than 60 g m2 . Within the experimental range of fruit
body yields a relatively low Cd content (<6.0 mg kg1 )
in the fruit body can be maintained when a fruit body
yield higher than 110 g m2 is achieved.
Figure 2. Relationship between fruit body yield m2 (Y) and fruit

body number m2 (). The full line is fitted to the combined data of
the two harvests by Y = Ymx /(0.5 + ), where Ymx = 187.75 and
0.5 = 28.08 (R2 = 0.69).
Cd accumulation as affected by yield

components
Linear regression analyses showed that the Cd
concentration in the fruit body can be well related
to the yield components of A. blazei, i.e. fruit body
Figure 3. Relationship between Cd concentration in fruit body (CCd )

and fruit body yield m2 (Y). The full line is fitted to the combined data
of the two harvests by CCd = Cmx /(Y0.5 + Y), where Cmx = 289.01
and Y0.5 = 59.20 (R2 = 0.87).
Figure 1. Relationship between fruit body dry weight per fruit (w) and
fruit body number m2 (). The full line is fitted to the combined data
of the two harvests by w = wmx /(0.5 + ), where wmx = 193.55 and
0.5 = 30.53 (R2 = 0.87).
1372
number m2 , fruit body size (weight) and their

interaction (Fig. 4). Fruit body number m2 made
the greatest positive contribution to Cd accumulation,
while the interaction between fruit body size and fruit
body number m2 showed a smaller but negative
effect. The results indicate that the decline in Cd
concentration in the fruit body might be due to a
dilution effect as a result of the increased number of
fruit bodies per unit area.
J Sci Food Agric 88:13691375 (2008)
DOI: 10.1002/jsfa
Figure 4. Relationship between predicted Cd concentration (CCd,prd )

and observed Cd concentration (CCd,obs ) in fruit body as a function of
yield components of Agaricus blazei. CCd,prd is fitted by
CCd,prd = E0 + E1 w + E2 + E3 w, where E0 = 2.40, E1 = 3.87,
E2 = 0.091 and E3 = 0.094.
Cd accumulation as affected by substrate Cd

concentration and fruit body size
The Cd content in the substrates is the source for Cd
accumulation in the fruit body. The Cd concentration
in the fruit body can be well predicted as a function
of the Cd concentration in the cultivation substrates
(CCd,E ) together with the fruit body size (w). The
Cd concentration in the fruit body can approach
an asymptote of 13.4 mg kg1 dry weight as the Cd
concentration in the cultivation substrates approaches
infinity (Fig. 5). The effect of fruit body size was
expressed as a negative value of the coefficient
(0.37), showing an increase in the Cd concentration
in the fruit body as the size of the fruit body increased.
The model for the Cd concentration in the fruit body
as a function of the Cd concentration in the cultivation
substrates and the size of the fruit body accounted for
87% of the variance in the observed Cd concentration
in the fruit body. It is therefore imperative to control
the overgrowth of individual fruit bodies to ensure the
production of a large number of medium-sized and
uniform fruit bodies. On the other hand, it is also
critical to limit the initial Cd concentration in the
substrates.
Substrate composition is considered to be an important factor in determining heavy metal concentrations in fruit bodies.17 The Cd concentration in
the fruit body increases as the Cd concentration in
the substrates increases.29 Careful selection of suitable materials for substrate preparation is therefore
an important step in reducing Cd concentrations in
A. blazei. In the present study the initial Cd concentrations were estimated as 0.06, 0.35, 0.52 and
0.1 mg kg1 in the rice straw, cow manure, calcium
superphosphate (Ca(H2 PO4 )2 H2 O) and casing soil
used respectively. Potassium dihydrogen phosphate
(KH2 PO4 ) and gypsum (CaSO4 2H2 O) were then
J Sci Food Agric 88:13691375 (2008)
DOI: 10.1002/jsfa
Figure 5. Relationship between predicted Cd concentration (CCd,prd )

and observed Cd concentration (CCd,obs ) in fruit body as a function of
substrate Cd content and fruit body size. CCd,prd is fitted by
CCd,prd = CCd,mx CCd,E /(1 + CCd,E + w), where CCd,E is the
substrate Cd content, w is the dry weight per fruit body, CCd,mx is the
maximum Cd concentration in the fruit body, is the coefficient for
the effect of CCd,E and is the coefficient for the effect of w. The
parameter values are CCd,mx = 13.40, = 2.16 and = 0.37.
used to replace calcium superphosphate, which contained relatively high concentrations of Cd and As.
The usage of cow manure was also significantly
reduced, from the commercial rate of 2230% to a
rate of 12%, but this had no significant impact on fruit
body yield. The cultivation substrates prepared and
used in the present research had a Cd concentration
of around 0.17 mg kg1 . The bioaccumulation factor
(ratio of Cd in the fruit body to Cd in the substrates)
was estimated as 27.832.4 in the present study. Kalac
and Svoboda17 reported that the bioaccumulation factor of Cd ranged from 50 to 300 depending on the
mushroom species.
Cd accumulation and P uptake
The Cd concentration in the fruit body was a
modified exponential function of the P concentration
in the fruit body (Fig. 6). The results suggest
that Cd accumulation is highly associated with P
uptake. However, there was no significant association
between Cd accumulation and calcium content (data
not shown). The positive relationship between Cd
accumulation and P absorption suggests that it might
be possible to limit Cd accumulation in the fruit
body by reducing P input in the cultivation substrates.
Meisch and Schmitt30 isolated a Cdmycophosphatin
organic complex from Agaricus macrosporus. The
P-containing organic compound had a molecular
weight of 12 000 Da. The presence of this CdP
organic complex might contribute to the positive
association of P and Cd. Higher P levels might also
stimulate Cd accumulation and increase Cd tolerance
in A. blazei.
1373
JC Huang et al.
8
Figure 6. Relationship between Cd concentration (CCd ) and P
concentration (CP ) in fruit body: CCd = CCd,0 + CCd,k /[1
exp(CP )]. The coefficient values are CCd,0 = 3.55, CCd,k = 0.16,
= 0.35 and = 0.10 (R2 = 0.93).
In a separate study we found that there was a slight

increase (2.2%) in the content of total amino acids
as the Cd concentration in the fruit body increased
(unpublished data). Among the 17 amino acids tested,
arginine, proline, phenylalanine and alanine were the
top four amino acids that were significantly increased.
It is not clear if amino acids are involved in the
chelation process of Cd.
CONCLUSIONS
Cadmium accumulation in A. blazei poses a potential
health threat to consumers. The popular demand
for A. blazei products has prompted the need to
significantly reduce Cd accumulation in the harvested
fruit bodies. The present research has identified a
number of control measures that can be taken by
local farmers in this key A. blazei-growing region
of southeastern Fujian to effectively reduce the Cd
concentration in fruit bodies: (1) limiting the initial
Cd and P concentrations in the substrates, (2) rinsing
the fruit bodies in water and (3) improving cultivation
techniques to increase fruit body yields m2 through
the production of sufficient numbers of medium-sized
fruit bodies. Overgrown fruit bodies should be avoided
owing to the risk of high Cd accumulation.
10
11
12
13
14
15
16
17
18
19
20
ACKNOWLEDGEMENT
The authors acknowledge funding support for the
project 2003-N-011 from the Department of Science
and Technology of Fujian, China.
21
REFERENCES
23
1 Barbisan LF, Spinardi-Barbisan AL, Moreira EL, Salvadori DM, Ribeiro LR, da Eira F, et al., Agaricus blazei
1374
22
(Himematsutake) does not alter the development of rat

diethylnitrosamine-initiated hepatic preneoplastic foci. Cancer
Sci 94:188192 (2003).
Duan XP, Ma JF and Zhao XH, Advances in bioactive
substances from Agaricus blazei Murrill. Anim Sci Vet Med
21:1517 (2006).
Firenzuoli F, Gori L and Lombardo G, The medicinal mushroom Agaricus blazei Murrill: review of literature and
pharmaco-toxicological problems. Evid based Compl Altern
Med 5:315 (2008). DOI: 10.1093/ecam/nem007.
Tuzen M, Sesli E and Soylak M, Trace element levels of
mushroom species from East Black Sea region of Turkey.
Food Control 18:806810 (2007).
Chen TQ, Li KB and Huang DB, Introduction and successful
cultivation of Agaricus blazei Murrill in Fujian. Edible Fungi
China 13:41 (1994).
He XJ, Yang PY and Chen TQ, Cultivation of medical
mushroom Agaricus blazei Murrill in Fujian. Fujian J Agric Sci
14:5658 (1999).
Delmanto RD, de Lima PLA, Sugui MM, da Eira AF, Salvadori DMF, Speit G, et al, Antimutagenic effects of Agaricus
blazei Murrill mushroom on the genotoxicity induced by
cyclophosphamide. Mutat Res 496:1521 (2001).
Matuo R, Oliveira RJ, Silva AF, Mantovani MS and Ribeiro LR,
Anticlastogenic activity of aqueous extract of Agaricus blazei
in drug-metabolizing cells (HTCs) during cell cycle. Toxicol
Mech Meth 17:147152 (2007).
Kawagishi H, Nomura A, Yumen T, Mizuno T, Hagiwara T
and Nakamura T, Isolation and properties of a lectin from the
fruiting bodies of Agaricus blazei. Carbohydr Res 183:150154
(1988).
Kawagishi H, Katsumi R, Sazawa T, Mizuno T, Hagiwara T
and Nakamura T, Cytotoxic steroids from the mushroom
Agaricus blazei. Phytochemistry 27:27772779 (1988).
Osaki Y, Kato T, Yamamoto K, Okubo J and Miyazaki T,
Antimutagenic and bactericidal substances in the fruit
body of a Basidiomycete Agaricus blazei. Yakugaku Zasshi
114:342350 (1994).
Ohno N, Furukawa M, Miura NN, Adachi Y, Motoi M and
Yadomae T, Antitumor -glucan from the cultured fruit body
of Agaricus blazei. Biol Pharmaceut Bull 24:820828 (2001).
Ellertsen LK, Hetland G, Johnson E and Grinde B, Effect of
a medicinal extract from Agaricus blazei Murrill on gene
expression in a human monocyte cell line as examined
by microarrays and immuno assays. Int Immunopharmacol
6:133143 (2006).
Schmitt JA and Meisch HU, Cadmium in mushrooms, distribution growth effects and binding. Trace Elem Med 2:163166
(1985).
Seeger R, Toxische Schwermetalle in Pilzen. Dtsch Apotheker
Zeitung 122:18351844 (1982).
Xu CS, Effects of pernicious trace elements on human health.
Guangdong Trace Elem Sci 6:13 (1999).
Kalac P and Svoboda L, A review of trace element concentrations in edible mushrooms. Food Chem 69:273281 (2000).
Shukla GS and Singhal RL, The present status of biological
effects of toxic metals in the environment: lead, cadmium, and
manganese. Can J Physiol Pharmacol 62:10151031 (1984).
Nordberg GF, Cadmium and health in the 21st
century historical remarks and trends for the future. Biometals 17:485489 (2004).
Waalkes MP, Cadmium carcinogenesis. Mutat Res 533:107120
(2003).
Wang H, Zhu G, Shi Y, Weng S, Jin T, Kong Q, et al, Influence
of environmental cadmium exposure on forearm bone density.
J Bone Miner Res 18:553560 (2003).
FAO/WHO, Joint FAO/WHO Expert Committee on Food
Additives 61st Meeting, JECFA/61/SC. [Online]. (2003).
Available: http://www.who.int/ipcs/food/jecfa/summaries/en/
summary 61.pdf. Accessed 28 March 2008.
CNSSE (China National Standards Series Editor), China
National Standards Compilation (2003 revision). Standards
Press of China, Beijing (2003).
J Sci Food Agric 88:13691375 (2008)

DOI: 10.1002/jsfa

24 Thornley JHM and Johnson IR, Plant and Crop Modelling: a
Mathematical Approach to Plant and Crop Physiology. Oxford
University Press, New York, NY (1990).
25 Whistler D, White KJ, Wong SD and Bates D, SHAZAM Users
Reference Manual. Version 9.0. Northwest Econometrics,
Vancouver (2001).
26 Zrodlowski Z, The influence of washing and peeling of
mushrooms Agaricus bisporus on the level of heavy metals
contamination. Pol J Food Nutr Sci 45:2633 (1995).
27 Melgar MJ, Alonso M, Perez-Lopez M and Garca MA, Influence of some factors on toxicity and accumulation of cadmium
J Sci Food Agric 88:13691375 (2008)

DOI: 10.1002/jsfa
from edible wild macrofungi in NW Spain. J Environ Sci

Health B 33:439455 (1998).
28 Willey RW and Heath SB, The quantitative relationships
between plant population and crop yield. Adv Agron
21:282321 (1969).
29 Si QQ, Lin L and Chen ZC, Studies on the accumulation of
heavy metals and their effects on the growth and metabolism
in edible fungi. Acta Mycol Sin 10:301310 (1991).
30 Meisch HU and Schmitt JA, Characterization studies on
cadmium-mycophosphatin from the mushroom Agaricus
macrosporus. Environ Health Perspect 65:2932 (1986).
1375
J Sci Food Agric 88:13761379 (2008)
Comparison of postmortem changes in

goose cardiac and breast muscles at 5 C
Sy-Shyan Ho, Chia-Ying Lin and Rong-Ghi R. Chou
Department of Animal Science, National Chiayi University, Chiayi City, Taiwan
Abstract
BACKGROUD: The tenderness of goose heart is an important consideration in its utilization as a popular
meat product. It is generally thought that postmortem degradation of myofibrillar proteins may improved meat
tenderness. Little information, however, is available regarding the postmortem changes in goose cardiac muscle.
Therefore, the postmortem proteolysis between goose cardiac and breast muscles at 5 C is compared.
RESULTS: The pH is higher (P < 0.05) in cardiac samples than in breast samples. Sodium dodecyl
sulfatepolyacrylamide gel electrophoresis and western blots results indicate that postmortem degradation of
titin and desmin and the appearance of the 28 and 30 kDa components are faster in breast muscle than in cardiac
muscle.
CONCLUSION: Our results may suggest that goose postmortem proteolysis occurs more rapidly in breast muscle
than in cardiac muscle at 5 C.
Keywords: white Roman goose; cardiac muscle; breast muscle; postmortem changes
INTRODUCTION
Poultry heart is considered as an edible by-product
in poultry production, but its texture is generally
perceived as tough by consumers. The tenderness of
heart, therefore, becomes an important consideration
in its utilization as a popular meat product. It is
generally believed that postmortem proteolysis may
improve the meat tenderness.1 The postmortem
changes in skeletal muscle from various animal origins
have been extensively studied.2 4 Degradation of
myofibrillar proteins and disintegration of Z-lines are
two main changes occurring in postmortem skeletal
muscle (for reviews, see Robson et al.5 ). It has been
suggested that -calpain is a key contributor in
postmortem proteolysis in bovine muscle at 5 C
(for reviews, see Koohmaraie and Geesink6 ). On the
other hand, little information is available regarding
the postmortem changes in goose cardiac muscle.
The purpose of this study, therefore, is to compare
the postmortem proteolysis between goose cardiac
and breast muscles at 5 C. The changes in pH and
degradation of myofibrillar proteins are examined.

Sample preparation
White Roman geese (Anser anser, 100 days old
with an average live weight of 4.5 kg) hearts and
carcasses (34 h postmortem) were obtained from
a local slaughterhouse using standard commercial

practices. Cardiac muscle from the left ventricle
and breast muscle (pectoralis major) excised from
the carcass of each bird were vacuum-packed and
stored at 5 C. Samples were taken at 0, 1, 3,
7, and 14 days of storage. This experiment was
replicated three times and 30 geese were used in
each replication. Geese were randomly assigned to
each of the five time periods, resulting in six geese
per time. After sampling, the cardiac or breast muscle
specimens from all six birds per time period were
combined into an averaged sample and then ground
through a 3 mm plate for pH measurement, sodium
dodecyl sulfatepolyacrylamide gel electrophoresis
(SDS-PAGE) and western blot analysis. The pH was
determined by the method of Farouk and Swan7 and
statistically analyzed by the split-plot design.8 The
main plots were cardiac and breast muscles and the
subplots were the meat specimens sampled at each
time period.
SDS-PAGE analysis
Cardiac and breast myofibrils from the pooled samples
were isolated via the method of Huff-Lonergan
et al.9 The protein concentration of myofibrils was
determined using a modified biuret method.10 The
myofibril samples for SDS-PAGE were prepared
by the method of Wang et al.11 SDS-PAGE was
routinely analyzed in a 12% Trisglycine slab gel
Correspondence to: Rong-Ghi R. Chou, Department of Animal Science, National Chiayi University, 300 University Road, Chiayi City, 60083 Taiwan
E-mail: chourg@mail.ncyu.edu.tw
(Received 27 August 2007; revised version received 9 January 2008; accepted 10 January 2008)
Postmortem changes in goose cardiac and breast muscles
Western blot analysis

Proteins were transferred from a 12% slab gel to
a nitrocellulose membrane by the method of Towbin
et al.13 After the transfer, the membrane was incubated
in a 5% bovine serum albuminphosphate buffer
solution (BSA-PBS) for 30 min at 37 C and then
washed three times in a 0.1% BSA-PBS solution for
5 min each time at room temperature. A monoclonal
antibody (mAb) of desmin (Clone DE-U-10) (D1033, Sigma, St Louis, MO, USA) was used as a
primary antibody. The membrane was incubated with
the primary antibody for 2 h at room temperature,
washed three times in 0.1% BSA-PBS for 5 min each
time, incubated with immunogold-labeled secondary
antibody for 2 h at room temperature, and washed
twice in 0.1% BSA-PBS solution for 5 min each time
and twice in deionized water for 1 min each. The gold
label was enhanced by silver staining.14
the findings of Sekikawa et al.,15 who have shown

that the final pH is higher in postmortem bovine
cardiac than skeletal muscle. That cardiac muscle has
a higher ultimate pH than skeletal muscle is likely due
to cardiac muscle having a greater aerobic capacity
than skeletal muscle, so that much of the postmortem
metabolism in cardiac muscle occurs via the citric acid
cycle and does not result in lactic acid production.16
Titin is first found in rabbit skeletal muscle17
and then in cardiac muscle.18 It has been reported
that skeletal titin is degraded during postmortem
storage.2,4,9 Our SDS-PAGE analysis of both CM
and BM samples with an 8% gel shows that two
closely spaced titin bands (T1 and T2) near the top
of the gel are present in 0-day samples (lane 1 in
Fig. 2). These migrations of titin bands in SDS-PAGE
are typical, as described previously for rabbit skeletal
muscle by Wang et al.17 Our results show that the
T1 band remains visible in CM samples during the
entire 14 days of storage at 5 C (Fig. 2) and that little
degradation of titin is found in CM samples. Locker
and Wild19 have also found no degradation of titin
in ox and chicken hearts stored at 15 C for 24 h. In
BM samples, however, the T1 band is visible on days
0 and 1, becomes faintly seen by day 3, and nearly
disappears by day 7 (Fig. 2(B)). Our results show that
titin degrades more rapidly in BM than in CM samples.
One of the most noticeable changes during
postmortem aging is the appearance of a 30 kDa
6.5
6.3
pH
(acrylamide:methylenebisacrylamide was 37.5:1, w/w)

for proteins migrating below myosin heavy chains
according to the method of Laemmli.12 Degradation
of titin was examined in an 8% Trisglycine slab gel
(acrylamide:methylenebisacrylamide 200:1, w/w).11
The same amount of protein (150 g) from each
sample was loaded on each well of the 12% and 8%
gels. Molecular weight markers ranging from 14 400 to
97 000 (Amersham Biosciences Ltd, Piscataway, NJ,
USA) were used as protein standards.
All gels were run at 15 mA at 25 C. SE 400 slab gel
electrophoresis units (Hoofer Scientific Instruments,
San Francisco, CA, USA) were used. Gels were
stained in a solution of 0.05% (w/v) Compassion Blue
R-250, 45% (v/v) methanol and 9.2% (v/v) acetic acid
for 4 h and distained in 10% (v/v) methanol and 7.5%
(v/v) acetic acid.
6.0
5.8

Figure 1 shows the changes in pH of cardiac (CM)
and breast (BM) muscle samples during 14 days of
storage at 5 C. The overall average pH is significantly
higher (P < 0.05) in CM (6.12 0.06) than in BM
(5.92 0.04) samples. This result was consistent with
5.5
6
8
10
Day of Storage
12
14
Figure 1. Changes in the pH of goose cardiac and breast muscles at

5 C. Standard error of means (SEM) = 0.06. , cardiac samples; ,
breast samples.
Figure 2. Changes in titin of goose cardiac (A) and breast (B) muscles at 5 C. These gels are representative of three replications of combined
samples. T1, titin 1; T2, titin 2; N, nebulin; M, myosin heavy chains. Lane 1 = 0 days; lane 2 = 1 day; lane 3 = 3 days; lane 4 = 7 days; lane
5 = 14 days.
J Sci Food Agric 88:13761379 (2008)

DOI: 10.1002/jsfa
1377
S-S Ho, C-Y Lin, R-GR Chou
component, a degradation product of troponin-T.20

The 12% gels of CM samples apparently show that
little changes in electrophoresis patterns can be found
in the molecular weight region between 30 and
40 kDa in CM samples during the entire 14 days
of storage at 5 C (Fig. 3(A)). The 30 and 28 kDa
bands in BM samples, on the other hand, are faintly
seen by day 0 and day 3, respectively, and become
more apparent by days 7 and 14 (Fig. 3(B)). These
results indicate that the appearance of the 30 kDa
component occurs more rapidly in BM samples than
in cardiac samples. However, the molecular weight
of cardiac troponin-T is higher than that of skeletal
troponin-T in mammals.21 This implies that the
degradation products of goose cardiac troponin-T
may be larger than 30 kDa. More studies are therefore
needed to identify the degradation products of cardiac

troponin-T.
Desmin is known as a major component of desmincontaining intermediate filaments in muscle cells.22
Several studies have reported that desmin degrades
in postmortem skeletal muscles.23 Our western blots
labeled with an mAb to desmin demonstrate that intact
desmin remains unchanged in CA samples (Fig. 4(A)).
In BM samples (Fig. 4(B)), however, intact desmin
decreases on day 3 and completely disappears by day
7. These results, again, indicate that degradation of
desmin is more rapid in BM samples than in CM
samples.
Our results show that postmortem degradation
of titin and desmin and appearance of 30 kDa
components occur more rapidly in BM samples
Figure 3. Changes in myofibrillar proteins of goose cardiac (A) and breast (B) muscles at 5 C. These gels are representative of three replications of
combined samples. M, myosin heavy chains; A, -actinin; A, actin; 30K, 30 kDa component; 28K, 28 kDa component; f, dye front. Lane
1 = 0 days; lane 2 = 1 day; lane 3 = 3 days; lane 4 = 7 days; lane 5 = 14 days; lane S = standard proteins; 97K = phosphorylase b; 66K = bovine
serum albumin; 30K = carbonic anhydase; 20K = trypsin inhibitor; 14K = -lactalbumin (14.4 kDa).
Figure 4. Western blotting showing the changes in desmin of goose cardiac (A) and breast (B) muscles at 5 C. These gels are representative of
three replications of combined samples. D, Desmin. Lane 1 = 0 days; lane 2 = 1 day; lane 3 = 3 days; lane 4 = 7 days; lane 5 = 14 days.
1378
J Sci Food Agric 88:13761379 (2008)

DOI: 10.1002/jsfa
Postmortem changes in goose cardiac and breast muscles
than in CM samples. It has been reported that

-calpain is responsible for postmortem proteolysis
in bovine muscle at 5 C,6,24 and titin, desmin
and troponin-T can be degraded by -calpain.25
Huff-Lonergan and Lonergan26 have also proposed
that calpain activation may explain the variation of
desmin postmortem degradation. This may imply that
the calpain activation is more rapid in BM than
in CM samples. On the other hand, our results
show that CM sample (>6.0) has a higher ultimate
pH than SM sample (<6.0). It may be assumed
that the calpains in CM sample are more active
than those in SM sample and favor more extensive
postmortem proteolysis. However, it has been shown
that little -calpain, which is essential for postmortem
proteolysis, is observed in chicken (avian) heart.27
Therefore, the difference between skeletal muscle
and cardiac muscle is probably more important than
the observed difference in final pH between the two
muscles examined. Thus, our results show that goose
postmortem proteolysis occurs more rapidly in BM
than in CM at 5 C.
In summary, the postmortem changes in goose CM
and BM at 5 C are compared in the present studies.
The results show that the pH is higher (P < 0.05) in
CM than in BM. The SDS-PAGE and western blot
results indicate that postmortem degradation of titin
and desmin and appearance of the 28 and 30 kDa
components are more rapid in goose BM than in
CM. Therefore, our results may suggest that goose
postmortem proteolysis occurs more rapidly in BM
than in CM at 5 C.
REFERENCES
1 Hopkins DL and Thompson JM, Factors contributing to
proteolysis and disruption of myofibrillar proteins and the
impact on tenderization in beef and sheep meat. Aust J Agric
Res 53:149166 (2002).
2 Ho C-Y, Stromer MH and Robson RM, Effect of electrical
stimulation on postmortem titin, nebulin, desmin and
troponin-T degradation and ultrastructural changes in bovine
longissimus muscle. J Anim Sci 74:15631575 (1996).
3 Wheeler TL, Shackelford SD and Koohmaraie M, Variation in
proteolysis, sarcomere length, collagen content, and tenderness among major pork muscles. J Anim Sci 78:958965
(2000).
4 Tsai S-F, Lin C-Y, Lu J-J and Chou R-GR, Postmortem
proteolysis of breast and leg muscles from Taiwan colored
chickens and Silkie bantam. Asia Aust J Anim Sci 19:739743
(2006).
5 Robson RM, Huff-Lonergan E, Parrish FC Jr, Ho C-Y,
Stromer MH, Huiatt TW, et al, Postmortem changes in the
myofibrillar and other cytoskeletal proteins in muscle. Proc
Recip Meat Confer 50:4352 (1997).
6 Koohmaraie K and Geesink GH, Contribution of postmortem
muscle biochemistry to the delivery of consistent meat quality
with particular focus on the calpain system. Meat Sci 74:3443
(2006).
7 Farouk MM and Swan JE, Acceptability and functional properties of restructured roast from frozen pre-rigor injected beef.
Meat Sci 46:5766 (1997).
J Sci Food Agric 88:13761379 (2008)

DOI: 10.1002/jsfa
8 SAS Institute, User Guide: Statistics, version 6. SAS Institute,

Cary, NC (1986).
9 Huff-Lonergan E, Parrish Jr FC and Robson RM, Effects of
postmortem aging time, animal age, and sex on degradation
of titin and nebulin in bovine longissimus muscle. J Anim Sci
73:10641073 (1995).
10 Robson RM, Goll DE and Temple MJ, Determination of
protein in Tris buffer by the biuret reaction. Anal Biochem
24:339341 (1968).
11 Wang S-M, Greaser ML, Schultz E, Bulinski JC, Lin JJ-C
and Lessard JL, Studies on cardiac myofibrillogenesis with
antibodies to titin, actin, tropomyosin, and myosin. J Cell Biol
107:10751083 (1988).
12 Laemmli UK, Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680685
(1970).
13 Towbin H, Staehelin T and Gordon J, Electrophoretic transfer
of proteins from polyacrylamide gels to nitrocellulose sheet:
procedure and some applications. Proc Natl Acad Sci USA
76:43504354 (1979).
14 Moeremans M, Daneels G, De Raeymaeker M, De Wever B
and De Mey J, The use of colloidal gold particles for testing
the specificity of antibodies and/or the presence of antigen, in
Immuno-Gold Labeling in Cell Biology, ed. by Verkleij AJ and
Leuniissen JLM. CRC Press, Boca Raton, FL, pp. 1727
(1989).
15 Sekikawa M, Shimada K, Fukushima M, Ishikawa T, Wakamatsu J and Mikami M, Presence of ubiquitin in bovine
post-mortem cardiac muscle. Food Chem 69:315318 (2000).
16 Katz AM, Contractile proteins of heart. Physiol Rev 50:63158
(1970).
17 Wang K, McClure J and Tu A, Titin: major myofibrillar
components of striated muscle. Proc Natl Acad Sci USA
76:36983702 (1979).
18 Hu DH, Kimura S and Maruyama K, Sodium dodecyl sulfate
gel electrophoresis studies of connectin-like high molecular
weight proteins of various types of vertebrate and invertebrate
muscles. J Biochem 99:14851492 (1986).
19 Locker RH and Wild DJ, A comparative study of huge molecular
weight proteins in various muscles across the animal kingdom.
J Biochem 99:14731484 (1986).
20 Ho C-Y, Stromer MH and Robson RM, Identification of the
30 kDa polypeptide in post mortem skeletal muscle as a
degradation product of troponin-T. Biochimie 76:369375
(1994).
21 Perry SV, Troponun-T: genetics, properties and function.
J Muscle Res Cell Motil 19:575602 (1998).
22 Lazarides E, Intermediate filaments: a chemically heterogeneous, developmentally regulated class of proteins. Annu Rev
Biochem 51:219250 (1982).
23 Hwan S-F and Bandman E, Studies of desmin and -actinin
degradation in bovine semitendinosus muscle. J Food Sci
54:14261430.
24 Koohmaraie M, Seideman SC, Schollmeyer JE, Dutson TR
and Crouse JD, Effect of post-mortem storage on Ca++ dependent proteases, their inhibitor and myofibril fragmentation. Meat Sci 19:187196 (1987).
25 Huff-Lonergan E, Mitsuhashi T, Beekman DD, Parrish FC Jr,
Olson DG and Robson RM, Proteolysis of specific muscle
structural proteins by -calpain at low pH and temperature is
similar to degradation in postmortem bovine muscle. J Anim
Sci 74:9331008 (1996).
26 Huff-Lonergan E and Lonergan SM, Mechanism of watercapacity of meat: the role of postmortem biochemical and
structural changes. Meat Sci 71:194204 (2005).
27 Lee HL, Sante-Lhoutellier V, Vigouroux S, Briand Y and
Briand M, Calpain specificity and expression in chicken
tissue. Comp Biochem Physiol B 146:8893 (2007).
1379
J Sci Food Agric 88:13801384 (2008)
Effects of pressure toasting on in situ

degradability and intestinal protein and
protein-free organic matter digestibility of
rapeseed
Arash Azarfar,1 Claudio S Ferreira,2 Jacob O Goelema3 and Antonius FB Van der
Poel4
1 Faculty
of Agriculture, University of Lorestan, PO Box 465, Khorramabad, Iran

do Frade 54, Chaneca, Casalinhos de Alfaite, 2560 Torres Vedras, Portugal
3 De Heus Voeders BV, Rubensstraat 175, 6717 VE, Ede, The Netherlands
4 Animal Nutrition Group, Department of Animal Sciences, Wageningen University, Marijkeweg 40, 6709 PG Wageningen, The Netherlands
2 Avenu
Abstract
BACKGROUND: Rapeseed is a protein supplement that contains up to 40% crude protein (CP) on a dry matter
(DM) basis, but a large part of its protein can be easily degraded in the rumen. Therefore, before inclusion in
ruminants diet, the extent of its protein degradation in the rumen must be reduced without altering its intestinal
digestibility. A study was conducted to investigate the effects of pressure toasting (T, 130 C) at two residence times
(1.5 and 10 min) alone or in combination with soaking in water (ST, 4 h) on ruminal degradability and intestinal
digestibility of CP and protein-free organic matter (PFOM) in whole full-fat rapeseed.
RESULTS: Regardless of the processing time (1.5 or 10 min), T significantly (P < 0.05) increased the fraction of
undegraded intake protein (UIP) compared to the untreated rapeseed samples. Soaking prior to further toasting
did not improve the rumen degradation characteristics of rapeseed CP. Compared to the untreated rapeseed
samples, both T and ST significantly (P < 0.0001) improved the true protein digested in the small intestine (DVE)
and degraded protein balance (OEB), effects that were more evident in samples heated for 10 min. Soaking prior
to pressure toasting, however, did not further improve the DVE or OEB in the rapeseed samples in comparison
with T treatment.
CONCLUSIONS: It was concluded that ruminal protein degradability of rapeseed decreased after pressure
toasting, without seriously affecting its intestinal digestibility.
Keywords: Brassica napus; intestinal digestibility; pressure toasting; rumen degradability; soaking
INTRODUCTION
In European countries, a large part of the protein
sources used in animal nutrition is imported from
abroad. Home-grown protein sources (e.g., seeds
as peas, faba beans, rapeseed, lupins) are available,
but because of the high rumen degradability of
their proteins and starches these feedstuffs are not
regularly included in compound feeds for dairy
cattle. Various chemical and physical methods for
the processing of feedstuffs have been proposed to
improve the degradability characteristics of protein
sources for ruminants.1 One of the possibilities to
reduce degradation of crude protein (CP) in the rumen
is thermal processing.2 Heat treatments have been
reported to reduce ruminal degradability of CP with a
concomitant increase in the lower gastrointestinal tract
digestibility.3 The effect of heat treatment is, amongst
others, a function of the temperature reached and the

duration of exposure.1
According to Aguilera et al.,4 heat treatment may
result in improved weight gain, feed efficiency and
nitrogen retention in ruminants. Heat treatment may
also destroy a number of antinutritional factors in some
legume seeds, an effect that may have a beneficial effect
on digestion in the small intestine.4
Rapeseed is a protein supplement that contains up
to 40% CP on a dry matter (DM) basis. However,
when rapeseed meal is fed to ruminants, a large part
of the protein is degraded in the rumen.5 Moreover,
if rapeseed protein is to be used more efficiently in
ruminant nutrition, for instance in the diets of rapidly
growing calves and high-yielding dairy cows, the extent
of protein degradation in the rumen must be reduced
without altering its intestinal digestibility.
Correspondence to: Arash Azarfar, Faculty of Agriculture, University of Lorestan, PO Box 465, Khorramabad, Iran
E-mail: Arash.Azarfar@gmail.com
(Received 27 June 2007; revised version received 9 January 2008; accepted 9 January 2008)
Processing of rapeseed
Pressure toasting as an available technology has

been proposed to improve the nutritive value of
legume seeds. In former experiments it was shown that
pressure toasting reduced rumen protein degradability
of peas, lupins and faba beans.6
McKinnon et al.2 investigated the effect of dry heat
treatment of canola meal using a vacuum tumble
dryer at 125 or 145 C for 10, 20 or 30 min on
ruminal, intestinal and total tract disappearance of
the dry matter (DM) and crude protein (CP) fractions
of canola meal. They concluded that heating canola
meal to a temperature of 145 C reduced ruminal and
total tract availability of the DM and CP fractions.
Heating to 125 C for 10, 20 or 30 min reduced
rumen disappearance of CP over the total tract of
the ruminant.
Limited work has been done on the effects of soaking
before the toasting of rapeseed, on the degradability
of protein in the rumen. Therefore, in this study,
samples of untreated rapeseed will be compared with
soaked/toasted or toasted samples to determine the
effects of the treatments on rumen degradation, as
well as on intestinal digestibility of CP and protein-free
organic matter (PFOM).

Experimental setup
The effects of using pressure toasting at different
residence time (1.5 versus 10 min) alone or in
combination with prior soaking on the rumen protein
and PFOM degradability and intestinal digestibility
in the samples of whole, full-fat rapeseed (Brassica
napus) were studied. The treatments were untreated
whole full-fat rapeseed (C), toasted rapeseed at 130 C
for 1.5 min (T 130/1.5), toasted rapeseed at 130 C
for 10 min (T 130/10), soaked (4 h) and subsequently
toasted rapeseed at 130 C for 1.5 min (ST 130/1.5)
and soaked (4 h) and subsequently toasted rapeseed at
130 C for 10 min (ST 130/10). Treatments (from the
same batch) were repeated on two consecutive days.
Rapeseed processing and sample preparation
Whole, full-fat rapeseed (Brassica napus) of French
origin was supplied by a commercial supplier (Agrifirm, Meppel, The Netherlands). Processing was
carried out at the Wageningen Feed Processing
Centre using a small-scale pressurized toaster, as
described by Van der Poel.7 Throughout the experiment, the toaster was used for a batch-type direct
steam heating of 22.5 kg of the samples. The
speed of the conveyor was adjusted to achieve the
required residence times (1.5 or 10 min). For the
soaking/toasting treatment, samples were soaked in
tap water for 4 h prior to sieving in a tray to
remove the water prior to toasting. The samples
were then dried in a forced oven for 16 h at 35 C
prior to grinding (Retsch ZM100, GmbH & Co.,
Hanover, Germany; 3 mm screen) and storage at
4 C.
J Sci Food Agric 88:13801384 (2008)
DOI: 10.1002/jsfa
In situ incubations
Rumen incubations were carried out according to
Dutch standard method8 with four rumen-cannulated
lactating HolsteinFriesian cows. The cows received
about 17 kg dry matter (DM) daily of a ration
consisting of grass silage (65% of DM intake) and
a commercial concentrate (90 g intestinal absorbable
protein and 6.5 MJ NEL kg1 ).
To incubate the samples, 5 g DM of each ground
sample (Retsch ZM100 centrifugal mill; 3 mm)
were weighed into pre-weighed nylon bags (10
17 cm; pore size 40 m; PA 40/30, Nybolt, Zurich,
Switzerland) and incubated in the rumen for 0,
4, 8, 12, 48 and 120 h. The all-out method was
applied. For incubation times 4 and 8 h two bags,
and for 12 and 48 h three bags, of each sample were
incubated in the rumen of each cow. All treatments
were randomly assigned to cows. After incubation,
bags were immediately immersed in ice water and
rinsed with tap water to stop the fermentation and
the residues were pooled per time per treatment.
The bags were washed using a domestic washing
machine for 52 min with 70 L of cold tap water,
without centrifuging. The bags were dried in a forcedair oven at 60 C for 24 h, air equilibrated and weighed.
Residues from the bags were then pooled within time
and treatment and ground prior to further chemical
analysis.
Intestinal incubations
Intestinal digestibility of crude protein and PFOM
was measured as described by Goelema et al.9 Two
non-lactating Holstein cross Friesian cows, fitted with
a cannula in the proximal duodenum, were used
to measure intestinal protein digestibility. The cows
received a daily ration consisting of 22.5 kg maize
silage and 7.5 kg grass silage. The feed was offered at
06.00 h (40%) and 18.00 h (60%).
Nylon with a pore size of 40 m (PA 40/30, Nybolt)
was used to prepare bags with an inner size of
3 7 cm. The bags were filled with approximately
0.5 g DM of the 12 h rumen incubation residue.
Prior to incubation, the rumen incubation residue
was prepared and handled as described above, but
with freeze-drying instead of oven-drying.
Prior to incubation in the proximal duodenum
the bags were incubated in a solution containing
1 g (2000 FIP U g1 ) pepsin in 1 L of 0.1 mol
L1 HCl at 37 C for 1 h. Three bags were inserted
into the proximal duodenum through the cannula
of each cow after every 5 min for a period of 7 h.
After insertion of 12 bags, a 20 min break was
taken, after which the procedure continued. Bags
were retrieved from the faeces every 2 h and stored
at 20 C until all the bags had been recovered.
After thawing, the bags were rinsed, washed and
freeze dried as described above. Residues were
pooled within treatment and ground through a 1 mm
sieve.
1381
A Azarfar et al.
Chemical analysis
Rapeseed samples were analysed for DM, Ash, CP,
neutral detergent fibre (NDF) and acid detergent fibre
(ADF) as described by Goelema et al.9
Calculations of ruminal degradability and
intestinal digestibility
Both CP and PFOM were classified into three
fractions: a washable fraction (W), the fraction that
disappears from the nylon bags after washing; an
undegradable fraction (U), measured as the asymptote
of the degradation curve at infinite time; and a
potentially degradable fraction (D) measured as 1000W-U. The fractional rate of degradation of D fraction
of CP and PFOM (kd , h1 ) was measured using a
first-order kinetic degradation model.10 Undegraded
intake CP (UIP, as g kg1 of CP) and undegraded
intake of PFOM (UIPFOM, as g kg1 of PFOM)
were calculated assuming a ruminal outflow rate (kp ,
h1 ) of 0.06 h1 as described by Goelema et al.9 The
residues of CP and PFOM after intestinal incubations
were used to calculate intestinal digestibility of UIP
(DUP, as g kg1 of UIP) and intestinal UIPFOM
(DUPFOM, as g kg1 of UIPFOM). True protein
digested in the small intestine (DVE, g kg1 DM) and
degraded protein balance (OEB, g kg1 DM) were
calculated as described by Tamminga et al.11
The fractional rate of degradation and the U fraction
were estimated with the NLIN procedure in SAS 9.1
(SAS/STAT package, SAS Institute Inc., Cary, NC,
USA). Analysis of variance was conducted using the
GLM procedure of SAS 9.1, with treatment (four
replicates in the in situ incubations and two replicates
in the intestinal incubations) and treatment day effect
as independent variables in the model.
Differences between the treatment means were analysed by a multiple comparison test (Tukey/Kramer),
and the least square means were listed using the
LSMEANS statement of SAS 9.1. Differences among
treatments were separated by contrast statements,
using the GLM procedure of SAS 9.1.
RESULTS
Chemical analysis
The DM, ash, CP, NDF and ADF content of the
untreated whole, full-fat rapeseed sample were 956.7
(g kg1 ), 43.1, 205.4, 155.5 and 141.0 g kg1 DM,
respectively. Compared to the reference tabulated
values (DM, ash, CP, NDF and ADF were 923.0
(g kg1 ), 39.0, 198.0, 198.0 and 181.0 g kg1 DM,
respectively)12 the rapeseed samples used in the
current study contained a higher organic matter and
CP whereas the NDF and ADF contents were lower.
Rumen degradation and intestinal digestion of
CP and PFOM
In Tables 1 and 2, rumen CP and PFOM degradation
and intestinal digestion characteristics of untreated
and treated rapeseed samples are presented.
Significant differences were observed between C and
other treatments with regard to U of CP (135.0 versus
179.0 g kg1 CP, P < 0.01) and UIP (387.0 versus
425.0 g kg1 , P < 0.05). Residence time (1.5 and
10 min) had no significant effect on rumen degradation
and intestinal digestion of CP (Table 1). Regardless of
the residence time, differences were observed between
T and ST with respect to U of CP (T 2.5% lower
than ST, P < 0.05), kd of CP (T 2.6% h1 lower
than ST, P < 0.01) and UIP (T 3.5% higher than
ST). Compared to the C, ST for 1.5 min significantly
decreased the D fraction of CP.
Toasting (T and ST) regardless of residence time
significantly increased the DVE in the samples of
rapeseed. The effect of toasting, however, was more
profound in those samples which were heated for
10 min compared to those which were heated for
1.5 min (116.8 and 121.1 g kg1 DM in 1.5 and
10 min, respectively; P < 0.01). As opposed to DVE,
toasting drastically decreased (77.5%) OEB. However,
like DVE, the effect of toasting on decreasing OEB was
more profound in those samples which were heated
for 10 min.
Statistical analysis revealed that, compared to the
C, both T and ST increased the W and U of the
PFOM (9.4% and 11.7%, respectively) and increased
Table 1. Ruminal degradation characteristics and intestinal digestion of crude protein (CP) in untreated and treated samples of rapeseed
Treatment
W
U
D
kd
UIP
DUP
DVE
OEB
Significance (P)
T 130/1.5
ST 130/1.5
T 130/10
ST 130/10
SEM
Controls vs. others
1.5 vs. 10
T vs. ST
220.0a
135.0b
645.0a
0.094a
387.0c
773.0a
60.7c
102.8a
270.0a
167.0a
563.0ab
0.064c
440.0ab
785.0a
116.4b
23.5bc
278.0a
194.0a
528.0b
0.090ab
405.0c
781.0a
117.1b
26.4b
234.0a
166.0a
600.0ab
0.069bc
445.0a
787.0a
122.5a
19.7c
224.0a
189.0a
587.0ab
0.099a
411.0bc
777.0a
119.6ab
23.2bc
18.2
7.6
25.1
0.059
7.9
4.4
0.9
1.2
NS
<0.01
NS
NS
<0.05
NS
<0.0001
<0.0001
NS
NS
NS
NS
NS
NS
<0.01
<0.05
NS
<0.05
NS
<0.01
<0.05
NS
NS
NS
W, washable fraction (g kg1 CP); U, undegradable fraction (g kg1 CP); D, potentially degradable fraction (g kg1 CP); kd , fractional rate of
degradation of D (h1 ); UIP, undegraded intake protein (g kg1 CP); DUP, intestinal digestibility (g kg1 UIP); DVE, true protein digested in the small
intestine (g kg1 DM); OEB, degraded protein balance (g kg1 DM); SEM, standard error of least square mean; NS, not significant. Means with
different letters within a row differ significantly (P < 0.05).
1382
J Sci Food Agric 88:13801384 (2008)

DOI: 10.1002/jsfa
Processing of rapeseed
Table 2. Ruminal degradation characteristics and intestinal digestion of protein-free organic matter (PFOM) in untreated and treated samples of
rapeseed
Treatment
W
U
D
kd
UIPFOM
DUPFOM
Significance (P)
T 130/1.5
ST 130/1.5
T 130/10
ST 130/10
SEM
Controls vs. others
1.5 vs. 10
T vs. ST
203.0b
187.0b
610.0a
0.056b
502.0a
518.0c
324.0a
323.0a
353.0b
0.063b
499.0a
558.0bc
319.0a
317.0a
364.0b
0.079ab
473.0ab
631.0a
277.0ab
286.0a
437.0ab
0.067ab
489.0a
617.0ab
266.0ab
289.0a
445.0ab
0.107a
450.0b
644.0a
25.2
19.3
44.0
0.011
9.6
18.1
<0.05
<0.01
<0.05
NS
NS
<0.01
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
<0.05
<0.05
W, washable fraction (g kg1 PFOM); U, undegradable fraction (g kg1 PFOM); D, potentially degradable fraction (g kg1 PFOM); kd , fractional rate
of degradation of D (h1 ); UIPFOM, undegraded intake PFOM (g kg1 of PFOM); DUPFOM, intestinal digestibility (g kg1 UIPFOM); SEM, standard
error of least square mean; NS, not significant. Means with different letters within a row differ significantly (P < 0.05).
DUPFOM (9.5%), whereas D was decreased by

21% (Table 2). Residence time had no significant
effect on ruminal degradation characteristics and
intestinal digestion of PFOM in the rapeseed samples.
Compared to the T samples, a decreased UIPFOM
was observed for ST samples which was caused
by a numerically decreased kd . However, intestinal
digestibility of UIPFOM was higher in the ST samples
than in the T samples.
DISCUSSION
Several studies have been carried out to investigate the
influence of heat treatment on rumen degradability
and intestinal digestibility of diet ingredients.13
Goelema et al.6 studied the influence of pressure
toasting and flaking on nutritive value of lupins
(Lupinus albus) and rapeseed (Brassica napus) for dairy
cows. They concluded that pressure toasting is a
suitable method to improve nutritive value of lupins,
but for rapeseed steam toasting, either at 100 C for
20 min or at 130 C for 1.5 min, did not improve the
protein value of rapeseed since the fractional rate of
degradation of the nitrogen was increased. In contrast
with their results, our findings show, that regardless
of residence time, toasting significantly decreased the
kd of whole full-fat rapeseed (Table 1). In agreement
with our findings, Sadeghi and Shawrang14 reported a
reduced kd when canola meal samples were subjected
to microwave irradiation for 2, 4 and 6 min. Kaldmae
et al.15 also observed that heat treatment of rape
seed cake (100 C for 1520 min) decreased effective
degradability of protein. However, when the rapeseed
samples were soaked in water prior to toasting no
significance differences were observed between C
and heat-treated (ST) samples with regard to kd . In
contrast to findings of Goelema et al.9 with pressuretoasted peas, lupins and faba beans, toasting and
soaking before toasting increased the washable fraction
of CP (numerically) and PFOM (significantly) in our
study. These changes may be attributed to the added
water, which may have created a more favourable
environment for the endogenous enzymes present
in the plant material. According to Davies et al.,16
J Sci Food Agric 88:13801384 (2008)
DOI: 10.1002/jsfa
endogenous enzyme activity may be enhanced in

a liquid environment, thereby increasing nutrient
availability to the animal.
Compared to the C, UIP was increased by both
the T and ST (for 1.5 or 10 min) in the current
study, which is in agreement with the results of
Goelema et al.9 The elevated UIP due to the T
process was mainly due to a lowered D (with a
lower kd ) and an increased U fraction. Moshtaghi
Nia and Ingalls17 investigated the effect of heating on
canola meal protein degradation in the rumen and
digestion in the lower gastrointestinal tract of steers.
They reported a lower ruminal degradability and a
higher intestinal disappearance after the treatments.
According to these authors, heat treatment of protein
sources decreases the ruminal degradability of CP by
creating cross-linkages between peptide chains and
carbohydrates, thereby increasing their resistance to
proteolysis in the rumen. However, in the current
study the effect of pressure toasting in increasing
UIP was more profound when toasting was applied
without soaking. Rape seed proteins consist of two
subunits: napin (2S albumin) and cruciferin (12S
globulin).14 Napin is an albumin that is characterized
with a high water solubility and ruminal degradability.
The cruciferin subunits have a lower water solubility
compared to the napin subunits, and degrade slower
in the rumen than dose napin. It is likely that
during soaking the napin subunits were washed out
of the samples, which may explain the significantly
lower UIP in the ST sample compared to that of
the T samples. Indeed, the lower UIP in the ST
samples was concomitant with a lower W of CP
(Table 1).
Despite an elevated UIP, intestinal digestibility of
UIP was not decreased by T and ST, resulting in
a higher DVE in these samples compared to the C
samples. Concomitantly, both T and ST with a more
profound effect for 10 min processing significantly
improved the OEB, which implies a shift from rumen
degradation to intestinal digestion of CP. This was in
the line with findings of Goelema et al.,9 who found
a drastically lower OEB in the samples of pressure
toasted (136 C; 3, 7 and 15 min) faba beans, peas
and lupins compared to the untreated samples.
1383
A Azarfar et al.
Although compared with untreated samples, pressure toasting (T) irrespective of residence time
increased the W and U fractions of PFOM, but
UIPFOM was not affected by these treatments. This
effect can be explained by a significantly lower D in
the T samples compared to the untreated samples.
Maillard polymerization thought to be responsible for
decreased D of PFOM after toasting.18 Except in
pressure-toasted samples at 130 C for 1.5 min, pressure toasting alone or in combination with soaking
significantly improved the intestinal digestibility of
PFOM compared to the C samples. It is documented
that when sufficient enzymatic activity for hydrolysis
of PFOM is provided in the duodenum, an increase of
undegraded PFOM after toasting improves the nutritive value of the feedstuffs.19 However, in the current
study the improved intestinal digestibility of PFOM
due to the pressure toasting was not concomitant with
an increased UIPFOM.
CONCLUSIONS
Soaking prior to further toasting did not enhance the
intestinal digestibility of UIP in rapeseed samples;
therefore, it is not recommended. The lack of
significant differences between processing times (1.5
versus 10 min) with regard to ruminal degradation
characteristics of CP and PFOM suggest that toasting
can be regarded as a high-temperature short-time
technological process in this respect. Although the
processing time (1.5 versus 10 min) did not have
any effects on ruminal degradation characteristics of
either CP or PFOM, OEB and DVE were improved
by increasing the processing time during toasting
from 1.5 to 10 min. Pressure toasting irrespective of
residence time improved OEB and DVE; therefore,
it is recommended to improve the protein quality of
rapeseed for ruminants.
REFERENCES
1 Waltz DM and Stern MD, Evaluation of various methods for
protecting soya bean protein from degradability by rumen
bacteria. Anim Feed Sci Technol 25:111122 (1989).
2 McKinnon JJ, Olubobokun JA, Mustafa A, Cohen RDH and
Christensen DA, Influence of dry heat treatment of canola
meal on site and extent of nutrient disappearance in
ruminants. Anim Feed Sci Technol 56:243252 (1995).
3 Arieli A, Ben-Moshe A, Zamwel S and Tagari H, In situ evaluation of the ruminal and intestinal digestibility of heat treated
whole cotton seed. J Dairy Sci 72:12281233 (1989).
1384
4 Aguilera JF, Bustoa M and Molina E, The degradability of

legume seed meals in the rumen: effect of heat treatment.
Anim Feed Sci Technol 36:101112 (1992).
5 De Boer G, Murphy JJ and Kennely JJ, Mobile nylon bag
for estimating intestinal digestibility of rumen undegradable
protein. J Dairy Sci 70:977982 (1987).
6 Goelema JO, Hof G, Tamminga S and Van der Poel AFB,
Influence of pressure toasting of lupins and rapeseed and
subsequent expander treatment and/or pelleting on rumen
degradation and intestinal digestibility of concentrate for
dairy cows. Internal report, Wageningen Institute of Animal
Sciences, The Netherlands (1995).
7 Van der Poel AFB, Effects of processing on bean (Phaseolus
vulgaris L.) protein quality. PhD thesis, Wageningen
University (1990).
8 CVB, Voorloping protocol voor In situ pensincubatie voor het
meten van eiwitbestendigheide, Centraal Veevoeder Bureau,
Lelystad, NL (2003).
9 Goelema JO, Spreeuwenberg MAM, Hof G, van der Poel AFB
and Tamminga S, Effect of pressure toasting on the rumen
degradability and intestinal digestibility of whole and broken
peas, lupins and faba beans and a mixture of these feedstuffs.
10 Robinson PH, Fadel JG and Tamminga S, Evaluation of
mathematical models to describe neutral detergent residue
in terms of its susceptibility to degradation in the rumen.
11 Tamminga S, van Straalen WM, Subnel APJ, Meijer RMG,
Steg A, Wever CJG, et al, The Dutch protein evaluation
system: DVE/OEB system. Liv Prod Sci 40:139155 (1994).
12 CVB, Veevoedertable, gegevens over chemische samenstelling,
verteerbaarheid en voederwaarde van voedermiddelen, Centraal Veevoeder Bureau, Lelystad, NL (2005).
13 Van der Poel AFB, Preslkken E and Goelema JO, Feed
processing: effects on nutrient degradation and digestibility,
in Quantitative Aspects of Ruminant Digestion and Metabolism,
ed. by Dijkstra J, Forbes JM and France J. CABI Publishing,
Wallingford, UK, p. 734 (2005).
14 Sadeghi AA and Shawrang P, Effects of microwave irradiation
on ruminal degradability and in vitro digestibility of canola
meal. Anim Feed Sci Technol 127:4554 (2006).
15 Kaldmae H, Kass M, Kart O and Olt A, Effect of temperature
on the degradation of rapeseed cake protein. Vet Zootech
36:3034 (2006).
16 Davies ZS, Mason D, Brooks AE, Griffith GW, Merry RJ and
Theodorou MK, An automated system for measuring gas
production from forages inoculated with rumen fluid and its
use in determining the effect of enzymes on grass silage. Anim
Feed Sci Technol 83:205221 (2000).
17 Moshtaghi Nia SA and Ingalls JR, Evaluation of moist heat
treatment of canola meal on digestion in the rumen, small
intestine, large intestine and total digestive tract of steers. Can
J Anim Sci 75:279283 (1992).
18 Hurrel RF, Carpenter KJ, Sinclair WJ and Otterburn MS,
Mechanisms of heat damage in proteins. 7. The significance
of lysine-containing isopeptides and lanthionine in heated
proteins. Br J Nutr 35:383395 (1976).
19 Van Soest PJ, Nutritional Ecology of the Ruminant. Cornell
University Press, Ithaca, NY (1994).
J Sci Food Agric 88:13801384 (2008)

DOI: 10.1002/jsfa
J Sci Food Agric 88:13851393 (2008)
Rye bread reduces plasma cholesterol

levels in hypercholesterolaemic pigs
when compared to wheat at similar dietary
fibre level
Helle Nygaard Lrke, Camilla Pedersen, Marianne Asp Mortensen,
Peter Kappel Theil, Torben Larsen and Knud Erik Bach Knudsen
University of Aarhus, Faculty of Agricultural Sciences, Department of Animal Health, Welfare and Nutrition, PO Box 50, 8830 Tjele, Denmark
Abstract
BACKGROUND: Rye is a whole-grain cereal with the potential of contributing to a healthy diet, but research
on rye in relation to chronic diseases is scarce compared to wheat and oats. In this study, a total of 17
hypercholesterolaemic pigs were fed high-fat high-cholesterol rye (n = 9) or wheat-based buns (n = 8) with similar
dietary fibre (DF) content for 910 weeks to study the effect on cardiovascular risk factors.
RESULTS: Ingestion of rye bread resulted in a 40% lower plasma total and LDL cholesterol compared to the wheat
group, whereas HDL cholesterol, insulin and glucose concentrations were not affected by dietary treatments.
Intestinal viscosity was 7.2 times higher, and organic matter and fat digestibility significantly reduced in the pigs
fed rye buns. The hepatic expression of the cholesterol 7-hydroxylase gene (CYP7A1) was lower in rye-fed pigs,
whereas four other key genes involved in cholesterol metabolism were not affected. Plasma cholesterol correlated
inversely with intestinal viscosity and organic matter digestibility.
CONCLUSION: The ability of DF from rye to interfere with digestion and absorption is more important for
whole-body cholesterol homeostasis than regulation in the liver at gene level.
Keywords: dietary fibre; viscosity; cereals; metabolic syndrome; gene expression
INTRODUCTION
Whole-grain products are recommended as part of
a healthy diet preventing several lifestyle diseases,
including cancer, type 2 diabetes and cardiovascular
disease (CVD). Regarding the prevention of CVD,
most attention has been paid to cereals rich in glucans (oats and barley) with profound evidence
of hypocholesterolaemic effects.1,2 Rye, which is
the only grain traditionally used as whole-grain
and contributes extensively to dietary fibre (DF)
intake in Scandinavia,3 contains relatively little glucan, but has a high content of both soluble and
insoluble DF in the form of arabinoxylans (AX).4
To date, research on the effect of rye on chronic
diseases is scarce compared to wheat and oats, but
animal and human studies indicate lipid-lowering
properties similar to oats, although conflicting results
occur. Hence, further evidence of the effects of
rye consumption on cardiovascular risk factors and
knowledge of the mechanisms are needed. In this

respect, the pig is considered an excellent model as
its lipoprotein and apolipoprotein profiles are similar
to humans; it can develop hypercholesterolaemia
and atherogenic lipoproteins within few a weeks,
and develop complex atherosclerotic lesions similar
to those found in humans under experimental
conditions.5,6
In the present study we examined the effects
of rye DF on central risk markers of CVD (total
plasma cholesterol, LDL, HDL, triglycerides, insulin,
and glucose levels) in pigs fed an atherogenic
diet for several weeks. We hypothesize that the
risk markers of CVD are influenced either through
events incurred by the action of DF in the
gut compartments (viscosity in the small intestine
or short-chain fatty acids produced in the large
intestine) or by regulatory hepatic enzymes involved
in the regulation of cholesterol synthesis. Therefore,
Correspondence to: Helle Nygaard Lrke, University of Aarhus, Faculty of Agricultural Sciences, Department of Animal Health, Welfare and Nutrition, PO Box
50, 8830 Tjele, Denmark
E-mail: Hellen.laerke@agrsci.dk
Present address: School of Biomedical and Molecular Sciences, University of Surrey, Guildford, Surrey GU2 7XH, UK.
Preliminary results were presented at the LMC International Food Congress 2006 Nutrigenomics and Health From Vision to Food held at the Royal
Veterinary and Agricultural University, Denmark, 1516 March 2006. An abstract from the congress is published in Scand J Food Nutr 50(suppl 1): 29.
(Received 19 June 2007; revised version received 7 January 2008; accepted 13 January 2008)
HN Lrke et al.
we studied five key genes involved in cholesterol

homeostasis: sterol regulatory element binding protein
(SREBP2), HMG-CoA reductase (HMGR), acylCoA:cholesterol O-acyltransferase (ACAT ), hepatic
LDL receptors (LDLr) and cholesterol 7-hydroxylase
(CYP7A1).
EXPERIMENTAL
The study was divided into two parts: (I) immediate
changes in clinical chemical parameters when changing from a low-DF low-fat diet to high-fat high-DF
wheat or rye buns; (II) medium-term effects of ingesting high-fat high-DF wheat or rye-based buns on
selected key parameters of glucose, lipid and cholesterol metabolism.
The study consisted of two blocks: based on the
experiences from block 1 (five pigs), the study protocol
was subjected to minor improvements to ensure the
health of the pigs in block 2 (12 pigs). In part I of the
study only pigs from block 2 were included, whereas
both blocks were included in part II.
The experiment was conducted according to protocols approved by the Danish Animal Experiments
Inspectorate and complied with Danish Ministry of
Justice Law no. 382 (10 June 1987) and Acts 739
(6 December 1988) and 333 (19 May 1990).
Diets
An atherogenic wheat-flour based selection diet
supplemented with egg powder (Dang Products A/S,
Roskilde, Denmark), lard, rape seed oil, whey protein
concentrate (Lacprodan 87, Arla Foods Ingredients
amba, Viby J, Denmark), pure cholesterol, and
vitaminmineral mixture (Table 1) was used to select
for pigs responding to dietary cholesterol. A wash-out
diet used in block 1 consisted of 867 g kg1 wheat
flour, 73 g kg1 whey protein concentrate, 30 g kg1
rape seed oil and 30 g kg1 vitaminmineral mixture.
However, as constipation was observed in the wash-out
period in the pigs from block 1, 60 g kg1 cellulose in
the form of Vitacel WF 600 (LCH A/S, Frederiksberg,
Denmark) was added to the wash-out diet in block 2.
The diets during the experimental period consisted
of high-DF buns enriched with fat and cholesterol
(Table 1). The rye buns contained finely ground
whole-grain rye (Valsemllen, Esbjerg, Denmark)
and ground rye bran (Nordmills, Uppsala, Sweden),
whereas the wheat buns contained white wheat flour
with added Vitalcel WF 600 in order to obtain the
same DF level. Whey protein concentrate was used to
adjust the protein content, and lard, egg powder and
cholesterol to increase the fat and cholesterol content.
The wheat buns were produced at Lantmannen
Unibake, Karup, Denmark, and the rye buns at
Holstebro Technical College, Denmark. The buns
were stored at 20 C until consumption.
Animals and feeding
A total of 30 Duroc Danish Landrace Yorkshire
4-month-old gilts (weighing approximately 70 kg)
1386
Table 1. Ingredients of experimental diets (g kg1 )
Atherogenic
Wheat flour
Rye whole meal
Rye bran
Cellulose
Whey protein concentrate
Yeast
Sugar
Egg powder
Rape seed oil
Lard
Cholesterol
Vitaminmineral mixb
Experimental
bun dietsa
Selection diet
Wheat
Rye
735
0
0
0
10
0
0
150
20
50
5
30
528
0
0
157
25
20
15
150
20
50
5
30
0
310
400
00
0
20
15
150
20
50
5
30
Before water addition and baking.

Providing in mg kg1 diet: 6642 Ca(H2 PO4 )2 , 4122 NaCl, 16 580
CaCO3 , 286 FeSO4 .7H2 O, 114 ZnO, 41 Mn3 O4 , 92 CuSO4 .5H2 O,
0.3 KI, 0.8 Na2 SeO3 .5H2 O, 2.1 retinoacetate, 0.03 cholecalciferol, 69
-tocopherol, 2.52 menadione, 4.58 riboflavin, 12.59 D-pantothenic
acid, 0.025 cyanocobalamine (B12 ), 2.52 thiamin (B1 ), 25.2 niacin, 3.78
pyridoxine (B6 ), 0.063 biotin.
b
obtained from the swine herd at the Faculty of

Agricultural Sciences, Foulum, Denmark, were fed the
atherogenic selection diet twice daily (1 kg per meal)
for 2 weeks. Based on the cholesterol response, hyperresponders (cut-off value of 3.5 mmol L1 plasma)
were chosen as study subjects for the remaining part
of the study. For the following 2 weeks the pigs were
fed the wheat-flour based wash-out diet at a level of
2 kg.d1 (blocks 1 and 2) increasing to 2.5 kg d1 in
the third week (block 2 only).
After the wash-out period the pigs were fed the
experimental diets (eight pigs on wheat buns, nine
pigs on rye buns) for 6 (block 1) or 7 weeks (block 2)
at an initial level of 2 kg d1 ) increasing to 3 kg d1 for
the last 2.5 weeks of the study, where the buns were
ground and chromic oxide (2 g kg1 on as-is basis) was
added. In the second week after chromium addition
the pigs were transferred to metabolic cages for 7 days,
where faeces and urine were collected quantitatively on
a daily basis and pooled. The pigs were subsequently
returned to their pens and slaughtered 24 days after
the end of the balance period. When not placed in
metabolic cages, the pigs were housed individually in
4 m2 smooth-walled pens with a concrete floor. The
pigs were weighed once weekly.
Blood sampling
After 2 weeks on the atherogenic wheat-flour based
diet a fasting blood sample was taken by venipuncture.
During the wash-out period, 8 out of 10 selected
pigs in block 1 were fitted with a jugular vein (JV)
catheter with the aim of repeated blood samplings.
However, the catheters were removed after a few days
due to technical problems (infections and/or blockage
of catheters), and the pigs treated with 0.05 mL
kg1 Streptocillin Vet. (Boehringer Ingelheim,
J Sci Food Agric 88:13851393 (2008)
DOI: 10.1002/jsfa
Rye bread reduces plasma cholesterol levels in hypercholesterolaemic pigs
Copenhagen, Denmark) for 3 days. Consequently, five

pigs (three rye, two wheat) in block 1 completed
the study, and only data from the balance period
and slaughter are included. In block 2 fasting blood
samples were taken by venipuncture on day 2, 8,
and 12, from 12 pigs (six rye, six wheat) to study the
development in clinical chemical blood parameters
after transfer to the experimental diets.
Postprandial blood samples from vena jugularis, lateral arteria auricularia, vena hepatica, and vena portae
were taken 3 h after the morning meal from anaesthetized pigs using 10 mL Zolitil mixture containing
50 mg mL1 of tiletamine/zolazepam (Vibrac SA, Carros, France), 2.5 mg mL1 Torbugesic Vet (Scan Vet
Animal Health A/S, Fredensborg, Denmark), 12.5 mg
mL1 Ketaminol Vet (Intervet Danmark, Skovlunde,
Denmark), and 12.5 mg mL1 Rompun (Bayer Health
Car AG, Animal Health Division, Leverkusen, Germany). Anaesthesia was maintained using Dipivan
(propofol, Astra-Zenica A/S, Albertslund, Denmark)
and Haldid (Fentanyl, Janssen-Cilag A/S, Birkerd,
Denmark) perfused through an ear vein at rates of 140
and 50 mL min1 , respectively.
Sampling from visceral organs
The pigs were euthanized with an overdose of
pentobarbital sodium (Pharmacy of Copenhagen
University, Faculty of Life Science, Frederiksberg,
Denmark) followed by exsanguination. A biopsy was
taken from the left lobe of the liver, quick-frozen in
liquid nitrogen, and stored at 80 C until analysis.
The bowel content in the distal third of the small
intestine, caecum, and the distal third of the colon
were homogenized, an aliquot was stored frozen at
20 C, and the remainder freeze-dried for further
analyses.
Analyses of diets and digesta
All chemical analyses were performed in duplicate.
Freeze-dried samples of diets, digesta and faeces were
ground to a particle size of less than 0.5 mm prior
to analysis. The dry matter content of feed, freezedried faeces, and intestinal content was determined by
drying to constant weight at 105 C for 20 h. Organic
matter (OM) content was determined as the difference
between the content of DM and ash,7 chromic oxide
concentrations in digesta, faeces, and diets were
analysed as described by Schurch

et al.,8 and HCl9
fat after the Stoldt procedure. Starch was analysed
enzymatically as described by Knudsen10 without
prior extraction of low-molecular-weight sugars, and
with the use of enzymes supplied by Megazyme
International Ireland Ltd, Wicklow, Ireland. Neutral
non-starch polysaccharides (NSP) and constituent
sugars and Klason lignin was determined as described
by Knudsen.10
Viscosity of the digesta liquid phase was measured
at 40 C in a Wells-Brookfield Dial cone/plate
viscometer after thawing and centrifugation of digesta
J Sci Food Agric 88:13851393 (2008)
DOI: 10.1002/jsfa
at 10 000 g for 20 min at 4 C. Values of apparent

viscosity are reported at shear rate 30 s1 .
Clinical chemical analyses on blood plasma
Plasma glucose, triglycerides, total cholesterol, LDL
and HDL cholesterol, and bile acids were analysed
using an auto analyser, ADVIA 1650 Chemistry
System (Bayer Corporation, Tarrytown, NY, USA)
using human standards and calibration materials.
Glucose, triglycerides, total cholesterol and LDL
and HDL cholesterol were analysed according to
standard procedures (Bayer HealthCare LLC). Total
bile acids were analysed by oxidizing bile acids using
3-hydroxysteroid dehydrogenase with subsequent
reduction of thio-NAD to thio-NADH according to
the Randox assay procedure (Randox Laboratories
Ltd, Crumlin, UK). Immunoreactive insulin was
analysed as described by Tindal et al.,11 and shortchain fatty acid (SCFA) concentrations in plasma
were determined by gas chromatography according to
Brighenti et al.12
Real-time reverse transcriptasepolymerase
chain reaction (RT-PCR)
Approximately 30 mg of liver samples was weighed and
homogenized in 1000 L TriReagent solution. The
RNA was purified using the TriReagent kit (Sigma,
St Louis, MO, USA) according to manufacturers
protocol, except that liver samples were added to
200 L of BCP solution (1-bromo-3-chloropropane).
Synthesis of cDNA and quantification of gene
transcription using real-time RT-PCR were carried
out as previously described.13 Primers were designed
across exon boundaries (exon structures reported
for human were used) by using Primer Express
2.0 software (Applied Biosystems, Foster City,
CA, USA). The design of primers and probe for
ACAT did not allow discrimination between ACAT1 and ACAT-2. Details of primer (and probe)
design and runs of real-time RT-PCR are given
in Table 2. Transcription of target genes were
normalized according to glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) transcription.
Calculations and statistical analysis
Apparent digestibility of organic matter and fat were
calculated relative to the concentration of chromic
oxide.
The flux of propionate in the portal vein (PV) was
calculated as the product of an estimated portal flow
of 25 mL kg1 min1 based on interpolation of values
previously reported for this parameter,14,15 weight of
the pigs, and the concentration of propionate in the
PV. The estimated absorption of organic acids was
calculated from the porto-arterial difference using the
same portal flow values as mentioned above.
For real-time RT-PCR all statistics were performed
at the Ct stage defined as the difference between
Cycles at threshold (Ct) of the target gene and Ct
of GAPDH, as described in detail by Theil et al.13
1387
HN Lrke et al.
Table 2. Accession numbers, amplicon location, amplicon length, slope of standard curve and PCR efficiency of target genes
Gene
Accession no.
Amplicon Amplicon Slope of

location
length standard
(exonexon)
(bp)
curve
CYP7A1 NM 001005352
34
146
3.49
SREBP2 DQ020476
78
89
3.32
LDLr
AF067952
67
86
3.43
HMGR
S79678
1617
83
3.31
ACAT
AK230873
1213
119
3.34
GAPDH
AF017079
23
76
3.47
Primer design (forward,

reverse)
5 -gaatgacaccctctccacct
5 -gaatgacaccctctccacct
5 -gatgcaaaggtcaaagacga
5 -aaggtgaggacacacagcag
5 -aaggagtgtgggaccaacga
5 -aggcactcatagccgatcttg
5 -tcgtgactgccatctacattgc
5 - cgcttccattaaagtaataca
gttgga
5 -tcaatgcctttgctgagatgtt
5 -cagccagtcatggaccacaac
5 -gtcggagtgaacggatttgg
5 -caatgtccactttgccagagttaa
Probe/detection
PCR
efficiency
5 -aagctgctttcattgcttca
(Taqman probe)a
SYBR
0.94
SYBR
0.96
SYBR
1.00
5 -tggtggaa
(LNA probe # 31)b
5 -cgcctggtcaccagggctgct
(Taqman probe)a
0.99
1.00
0.94
Taqman probe labelled with FAM (carboxyfluorescein).

Locked nucleic acid probe labelled with FAM (Universal ProbeLibrary (human); https://www.roche-applied-science.com/sis/rtpcr/upl/index.jsp;
Roche Diagnostics A/S, Hvidovre, Denmark).
The relative mRNA quantity was calculated by using

the formula: Relative mRNA quantity = 2Ct . For
target genes with PCR efficiencies lower than 1.0, the
base number of two was adjusted accordingly (e.g., a
base number of 1.96 for LDL receptor was used to
account for a PCR efficiency of 0.96).
All statistical analyses were carried out using
SAS for Windows, version 8.2 (SAS Institute
Inc., Cary, NC, USA). Level of significance was
P < 0.05 in all analyses. Variables meeting the
criteria of normal distribution are reported as least
square means (lsmeans) their standard error of
mean (SEM). When variables were not normally
distributed, statistical evaluation was performed on
logarithmized values, and results are reported as
geometric means with 95% confidence intervals.
Relative gene expression is also reported as 95%
confidence intervals.
The effect of diet in the initial phase of dietary
intervention, of site of blood collection on plasma
concentrations at slaughter, and on digestibility along
the gut was examined by PROC MIXED, taking
repeated measurements made on the same individuals
(time, site or segment) into account.16 However, as
there was no difference between sites of total HDL and
LDL cholesterol, means of sites were subsequently
subjected to one-way ANOVA using a general linear
model.
The effect of diet on faecal digestibility, apparent
ileal viscosity, SCFA absorption, propionate flux and
concentrations and proportions of SCFA at distinct
collection sites, as well as the mRNA quantities,
were subjected to one-way ANOVA analysis using
PROC GLM.
Only block 2 (n = 12) was included in the analysis
of the development of blood cholesterol in phase
I. For none of the studied responses were there
any measurable long-term effects of differences in
experimental handling between block 1 and 2, and
1388
both blocks (n = 17) were included in the results

obtained from the balance period and at slaughter.
Pearson correlation coefficients between parameters
were obtained using the PROC CORR procedure.
RESULTS
Diets and animals
The rye and wheat high-DF buns were formulated to
be of similar macronutrient composition and energy
content (Table 3). Protein provided 14%, fat 28%
and carbohydrates 58% of the gross energy. The DF
content was approximately 200 g kg1 DM in both
diets, but the chemical composition was different. The
rye buns contained more Klason lignin, arabinoxylans
(AX) and less cellulose than the wheat buns. The rye
buns also contained three times more soluble NSP, of
which AX is the main component.
The pigs tolerated the experimental diets well.
During the wash-out period, the pigs weighed 89.7
1.0 kg. At the end of the balance period, the mean
weight was 136.3 0.9 kg with no effect of dietary
treatment.
Gastrointestinal effects
The apparent viscosity of the supernatant of digesta
in the distal small intestine was 7.2 times higher when
pigs consumed the rye diet compared to the wheat diet
(Table 4). Concurrently, the small intestinal OM and
HCl-fat digestibility was significantly reduced in the
rye group compared to the wheat-fed pigs, an effect
that remained throughout the colon. Quantitatively,
the reduction corresponded to 32 g (81%) more HClfat being excreted per day although the fat intake
was 7% higher in the rye group at the end of the
experiment.
Total plasma cholesterol, LDL and HDL
Initially, when fed the atherogenic selection diet
the 17 hyper-responders completing the study had
J Sci Food Agric 88:13851393 (2008)
DOI: 10.1002/jsfa

Table 3. Chemical composition (g kg1 DM) and gross energy
content (MJ kg1 DM) of the experimental high-DF diets
DF, dietary fibre as the sum of NSP and Klason lignin; NSP, nonstarch polysaccharides; NCP, non-cellulosic polysaccharides; AX,
arabinoxylans as the sum of anhydro-arabinose and anhydro-xylose;
A:X ratio, arabinose:xylose ratio.
Values in parentheses are soluble NSP.
Subsequently, after ingestion of both types of

high-fat and cholesterol-rich buns there was a rapid
rise in plasma total cholesterol (Table 5). However,
the increase in cholesterol level was less rapid
in pigs fed the rye buns. The development of
LDL cholesterol levels followed the trend of total
cholesterol, but the effect of diet did not reach
statistical significance (Pdiet = 0.06). HDL cholesterol
levels increased significantly in the initial phase
of intervention (Ptime < 0.0001), but did not differ
between dietary treatments. Hence, the LDL:HDL
ratio increased also with both dietary treatments from
baseline to day 12, but the difference between dietary
treatments was not significant (Pdiet = 0.06).
Whereas the cholesterol level increased throughout
the experiment in pigs fed the wheat buns, the rye
buns led to an apparent small decrease toward the end
of the experiment (postprandial values, Table 6), and
pigs fed the rye diet had significantly lower total and
LDL cholesterol concentrations and LDL:HDL ratio
than the wheat-fed pigs.
a plasma cholesterol level of 7.2 0.51 mmol L1

(range: 4.512.0 mmol L1 ). Then, after 23 weeks
on the wash-out diet, plasma total cholesterol fell to
2.5 0.08 mmol L1 .
Plasma insulin, glucose and triglycerides

There was no effect of diet on fasting insulin or
plasma glucose level between wash-out and day 12.
The triglyceride concentration remained stable in pigs
fed rye whereas it decreased in pigs fed the wheat buns
(Table 5). However, no dietary differences were seen
Wheat diet
Dry matter (as-is basis)
Energy (MJ)
Starch and sugars (g)
Protein (g)
Fat (g)
Ash (g)
DF (g)
Klason lignin (g)
NSP (g)
Cellulose (g)
NCP-glucose (g)
AX (g)
A:X ratio
Rye diet
661
21.10
437
182
153
39
194
22
173 (18)
110
16 (6)
36 (6)
0.26
680
21.16
384
172
159
50
203
40
163 (53)
22
31(13)
93 (35)
0.64
Table 4. Extract viscosity (mPa s) in the contents of the distal small intestine (SI) and digestibility of organic matter (OM) and HCl-fat in gut
segments and faecesa
Diet
Viscosity
Organic matter
Fat
P-value
Segment
Wheat
Rye
Diet (D)
Segment (S)
DS
SI3
Distal SI
Caecum
Distal colon
Faeces
Distal SI
Caecum
Distal colon
Faeces
3.2 (1.975.11)
0.73 0.010
0.82 0.008
0.90 0.003
0.91 0.004
0.76 0.020
0.87 0.010
0.88 0.006
0.87 0.010
22.9 (14.2136.82)
0.63 0.010
0.79 0.009
0.86 0.003
0.86 0.004
0.68 0.020
0.78 0.010
0.81 0.006
0.78 0.010
<0.0001
<0.0001
<0.0001
0.002
<0.0001
<0.0001
<0.0001
0.45
0.0003
a Calculated separately on the basis of faeces samples in the balance period. Values are lsmeans SEM or in parentheses 95% confidence intervals,
n = 8 for wheat, n = 9 for rye, except for viscosity, where n = 8 for rye.
Table 5. Development in fasting plasma concentrations of glucose (mmol L1 ), insulin (g L1 ), triglycerides (mmol L1 ), total, LDL and HDL
cholesterol (mmol L1 ) and LDL:HDL ratio in the immediate period after transfer to the high-fat, high-cholesterol DF-rich wheat or rye based buns
Wash-out
Wheat
Day 8
Rye
Wheat
Day 12
Rye
Wheat
P-values
Rye
Glucose
4.6 0.1
4.5 0.1
4.5 0.1
4.5 0.1
4.5 0.1
4.6 0.1
Insulin
0.12 0.06 0.19 0.06 0.14 0.06 0.15 0.06 0.13 0.03 0.09 0.03
Triglycerides
0.20 0.02 0.22 0.02 0.13 0.02 0.22 0.02 0.13 0.02 0.23 0.02
Total cholesterol
2.5 0.1
2.5 0.1
8.8 0.5
6.7 0.5
10.2 0.6
7.9 0.6
HDL cholesterol 0.81 0.04 0.87 0.04 1.60 0.09 1.58 0.09 1.64 0.10 1.67 0.10
LDL cholesterol
1.3 0.1
1.3 0.1
5.4 0.4
4.3 0.4
6.2 0.4
4.9 0.4
LDL:HDL ratio
1.6 0.1
1.5 0.1
3.4 0.2
2.7 0.2
3.9 0.4
2.9 0.4
Diet
Time
Diet Time
0.94
0.81
0.009
0.021
0.80
0.06
0.06
0.60
0.65
0.16
<0.0001
<0.0001
<0.0001
<0.0001
0.69
0.58
0.16
0.06
0.80
0.12
0.16
Values are lsmeans SEM, n = 8 for wheat, n = 9 for rye.
J Sci Food Agric 88:13851393 (2008)

DOI: 10.1002/jsfa
1389
HN Lrke et al.
Table 6. Postprandial plasma concentrations of glucose (mmol L1 ), insulin (g L1 ), triglycerides (mmol L1 ), total, LDL and HDL cholesterol (mmol
L1 ) and LDL:HDL ratio, in the portal vein (PV), hepatic vein (HV), ear artery (Art) and jugular vein (JV) at the time of slaughter
Diet
Glucose
PV
HV
Art
JV
PVa
HV
Art
JV
PV
HV
Art
JV
Insulin
Triglycerides
Total cholesterolb
LDL cholesterolb
HDL cholesterolb
LDL:HDL ratiob
P-value
Wheat
Rye
Diet (D)
Site (S)
DS
7.5 0.9
18.2 3.6
5.2 0.3
5.2 0.3
0.18 0.05
0.10 0.03
0.05 0.008
0.04 0.006
0.85 0.10
0.97 0.12
0.59 0.07
1.03 0.18
11.9 0.9
6.9 0.6
1.86 0.11
3.8 0.3
7.1 0.9
19.1 3.8
5.1 0.3
4.8 0.3
0.13 0.05
0.02 0.03
0.05 0.008
0.03 0.006
0.99 0.10
1.12 0.12
0.75 0.07
0.82 0.17
7.2 0.8
4.2 0.6
1.55 0.11
2.7 0.3
0.99
0.003
0.59
0.30
0.0006
0.09
0.55
0.02
0.35
0.001
0.005
0.06
0.03
Values are lsmeans SEM. PV, Art and JV: n = 8 for wheat, n = 9 for rye; HV: n = 8 for wheat, n = 7 for rye. a n = 7 for wheat, n = 7 for rye.
b Values are calculated from means of the different sites, as no effect of site was found.
on postprandial values at the end of the experiment

(Table 6).
Postprandial glucose and triglyceride concentrations
were highest in the hepatic vein (HV), whereas
insulin concentration was highest in PV (Table 6).
The HV glucose concentrations were much higher
than PV values, probably reflecting stress-induced
conversion of hepatic glycogen to glucose during blood
sampling.
Bile acids
The concentration of bile acid was 3.69.2 times
higher in PV compared to HV (Table 7), and more
than nine times higher than in JV and arterial plasma
(P < 0.0001). Overall, there was no significant effect
of diet, or interaction between diet and site of plasma
collection. Eliminating the non-significant interaction
led to an overall significant effect of diet (P = 0.04).
However, separate analyses by one-way ANOVA
of dietary effects at the different sites showed no
difference between diets in portal, jugular, and arterial
plasma, and only a tendency to reduced bile acid
concentrations in hepatic plasma in rye-fed compared
to wheat-fed pigs (P = 0.06).
Short-chain fatty acids

SCFA concentrations in plasma were very variable,
and values were not significantly different between ryefed and wheat-fed pigs in PV (1544 138 mol L1 ,
P = 0.41) and JV (339 24 mol L1 , P = 0.11).
However, in artery plasma (Art), the concentration was
lower (P = 0.003) in rye-fed pigs (350 21 mol L1 )
compared to pigs fed the wheat buns (461
22 mol L1 ), and there was a similar tendency in
HV (583 159.6 versus 1049 159.6 mol L1 , P =
0.053). The proportion of propionate was higher in
portal plasma of rye-fed pigs (23.1 1.50) compared
to pigs fed the wheat buns (18.1 1.59, P = 0.036).
Although numerically quite small, there was a
significant change in composition from acetate (94.2
0.26 versus 95.6 0.27, P = 0.002) to propionate
(4.0 0.29 versus 2.9 0.31, P = 0.019) in arterial
blood when feeding rye buns at the expense of wheat
buns.
Dietary treatment had no influence on the apparent
daily absorption of total organic acids amounting on
average to 5641 658 mmol 24 h1 , or the portal propionate flux amounting to 1547 201 mmol 24 h1 .
Table 7. Postprandial plasma concentrations (mol L1 ) of total bile acids in the portal vein (PV), hepatic vein (HV), ear artery (Art), and jugular vein
(JV) at the time of slaughter
Wheat
PV
HV
JV
Art
113.0
30.9
10.8
11.6
Rye
(89.7142.3)
(24.538.9)
(8.314.1)
(9.014.9)
126.4
13.7
8.4
8.6
P-values
(101.7157.1)
(10.917.4)
(6.510.8)
(6.810.9)
Pdiet : 0.27
Psite : <0.0001
Pdietsite : 0.13
Values in parentheses are 95% confidence intervals obtained from PROC MIXED analysis. PV, Art and VJ: n = 8 for wheat, n = 9 for rye; HV: n = 8
for wheat, n = 7 for rye.
1390
J Sci Food Agric 88:13851393 (2008)

DOI: 10.1002/jsfa

2.0
Relative expression
1.5
****
1.0
0.5
0.0
Wheat Rye
Wheat Rye
Wheat Rye
Wheat Rye
Wheat Rye
SREBP2
HMGR
LDLr
ACAT
CYP7A1
Figure 1. Expression of liver mRNA of genes involved in cholesterol metabolism in rye bun-fed pigs compared to wheat-fed pigs.
Gene expression in liver tissue

With expressions of genes encoding for SREBP2,
HMGR and LDLr of 1.211.25 and 0.99 for ACAT,
there was no significant difference (P > 0.2) compared
to wheat (Fig. 1). However, for CYP7A1, encoding
cholesterol 7-hydroxylase, the rate-limiting enzyme
in bile acid biosynthesis in the liver, there was a
significantly lower expression (P < 0.0001) in the pigs
fed rye compared to the pigs fed the wheat diet.
Correlations between responses
The log-transformed apparent ileal viscosity was
negatively correlated with total plasma cholesterol
(r = 0.61, P = 0.012), and LDL cholesterol concentrations (r = 0.54, P = 0.032), and was also
negatively associated with OM digestibility in the distal
small intestine (r = 0.65, P = 0.006).
There were no significant correlations between
acetate, propionate or butyrate concentrations or their
proportions and total plasma cholesterol in the portal
vein, hepatic vein and jugular vein. However, in the
ear artery acetate concentration (r = 0.51, P = 0.035)
and acetate proportion (r = 0.52, P = 0.032) were
positively correlated with total plasma cholesterol
concentration.
DISCUSSION
Both types of high-fat, high-cholesterol buns increased
plasma total and LDL cholesterol compared to the
wash-out period, but the rye buns blunted the increase
and maintained a lower total cholesterol level relative
to the wheat buns. The results support other studies
showing a hypocholesterolaemic effect of rye products
in hamsters,17,18 rats,19 chickens20 and moderately
hypercholesterolaemic men,21 but are in contrast to
other studies with hamsters,22 human ileostomates23
and hypercholesterolaemic women.21
Several factors may count for the discrepancies
between different studies; Firstly, the impact of DF
is influenced by the initial cholesterol level, as has
J Sci Food Agric 88:13851393 (2008)
DOI: 10.1002/jsfa
previously been documented in numerous human

and animal intervention studies.1,17,22 Secondly,
differences both between species and individuals may
be explained by differences in their ability to maintain
cholesterol homeostasis.24 27
Impaired glucose tolerance, insulin resistance and
elevated triglyceride level are components of the
metabolic syndrome, which increases the risk of developing type 2 diabetes and cardiovascular disease.28
However, neither fasting nor 3 h postprandial glucose
and triglyceride levels were affected by diet. This supports previous observations on the effect of rye in
hypercholesterolaemic subjects21,29 and in normocholesterolaemic pigs.14 However, we cannot exclude
that the two experimental diets would result in different insulin sensitivity, as arabinoxylan-rich wheat
endosperm DF and rye bread have previously been
shown to reduce the insulin response to a meal in both
type 2 diabetics and healthy subjects.29 33
The ability of rye DF to create a viscous environment
leading to impaired absorption of fat and cholesterol
and increased excretion of bile acids is probably a
major factor accounting for the hypocholesterolaemic
effect of the rye buns. Knudsen et al.14 has previously
reported an approximately 50% higher viscosity when
pigs were fed a rye diet when compared to a high-DF
wheat diet. In rats and hamsters intestinal content
viscosity has been reported to be inversely correlated
to total liver cholesterol and plasma cholesterol,34 and
the importance of viscosity is underlined by results
showing that bile acid excretion in ileostomy subjects
is reduced, and hypocholesterolaemic properties are
abolished when soluble DF is hydrolysed.20,35
Interference of enterohepatic circulation and
increased faecal excretion of bile acids and/or sterols
were previously suggested as a mechanism for hypocholesterolaemic effects of DF.36 38 However, the
relation is not straightforward, and it is still intensively discussed to what extent plasma cholesterol is
regulated by intracellular cholesterol and bile acid
levels, bile acid pool size, bile acid composition and
1391
HN Lrke et al.
excretion.24 26,38 40 In the current study there was no

difference in the concentration of bile acids in portal
blood. Instead, there was a trend for a lower concentration of bile acid in plasma from the hepatic vein of
the rye-fed pigs, which might indicate a lower bile acid
synthesis compared to the wheat-fed pigs, although
the majority of bile acids will flow into the bile duct.
These results were supported by the lower hepatic
expression of CYP7A1. None of the other key genes
involved in hepatic cholesterol metabolism were significantly altered, although metabolic profiling using
1
H NMR suggests differences in hepatic fatty acid and
cholesterol metabolism.41
As bile acid sequestrants, DF may lead to increased
faecal excretion, thereby diminishing the bile acid
pool size, and counteracting a suppressive effect of
bile acids on CYP7A1.36,37 The lower expression of
CYP7A1 in the current study is opposite to other
studies on the effect of DF.37,38 However, since
dietary cholesterol also induces a higher expression
and activity of CYP7A1,24,25 the lower expression of
CYP7A1 in the current study may be an effect of a
lower fat and cholesterol absorption in the rye-fed pigs,
as indicated by the lower small intestinal digestibility
of HCl-fat. In this respect it must be emphasized that
ileal and faecal bile acid excretion was not measured in
the present study, but bile acids may have contributed
to the increased excretion of HCl-fat in the rye-fed
pigs.
Another proposed mechanism for hypocholesterolaemic action of DF is via fermentation in the large
bowel. Propionate has been suggested to attenuate hepatic cholesterol synthesis by decreasing the
activity of the rate-limiting enzyme HMGR.42 44 Neither propionate concentration nor the proportion
of SCFA in the form of propionate was correlated
with plasma cholesterol levels, and the concentrations of propionate in the portal vein found in this
study (300 mol L1 ) are hardly sufficient to exert
a significant effect on cholesterol synthesis. Furthermore, neither total SCFA absorption nor propionate
flux was influenced by diet. Consistently, Knudsen
et al.14 found no differences in total SCFA absorption,
whereas butyrate absorption was enhanced in pigs consuming high-DF wheat or rye diets. Collectively, these
results suggest that SCFA is not a mediator of the
hypocholesterolaemic effect of rye, as also suggested
by others.45 47
Beside the difference in DF composition, the buns
also differed in content of plant lignans, plant sterols
and several other phenolic compounds,48 which may
have the potential to affect blood lipids. Collectively,
these confounding compounds may have added to
the hypocholesterolaemic effect observed with the rye
buns.
CONCLUSIONS
The present study demonstrated that a high intake
of rye in the form of buns had hypocholesterolaemic
1392
properties when compared to a wheat-based diet at

similar DF level. The hypocholesterolaemic effect
of rye is presumably a result of the combination of
soluble DF intake as well other bioactive components.
However, reduced absorption rather than hepatic
regulation is most likely the main factor contributing
to the hypocholesterolaemic effect seen in the present
study. However, the mechanisms involved require
further research, and need to be confirmed at lower
dose levels and in human subjects.
ACKNOWLEDGEMENTS
This project was financially supported by a grant from
the Nordic Research Council (NKJ-121: Rye Bran
for Health). Skilful assistance by the technical staff at
the Institute of Animal Health, Welfare and Nutrition
and the Department of Farm and Animal Research
Facilities is greatly appreciated.
REFERENCES
1 Ripsin CM, Keenan JM, Jacobs DR, Elmer PJ, Welch RR,
Vanhorn L et al., Oat products and lipid lowering: a
metaanalysis. JAMA 267:33173325 (1992).
2 Aman P, Cholesterol-lowering effects of barley dietary fibre in
humans: scientific support for a generic health claim. Scand J
Food Nutr 50:173176 (2006).
3 Buttriss JL, Rye: the overlooked cereal. BNF Nutr Bull 31:35
(2006).
4 Hansen HB, Rasmussen CV, Knudsen KEB and Hansen A,
Effects of genotype and harvest year on content and
composition of dietary fibre in rye (Secale cereale L) grain.
J Sci Food Agric 83:7685 (2003).
5 Knudsen KEB and Canibe N, Changes in pig plasma lipids
to dietary cholesterol, source and level of dietary fibre and
caecal infusion of propionate, in COST 92: Metabolic and
Physiological Aspects of Dietary Fibre in Foods. Mechanisms of
Action of Dietary Fibre on Lipid and Cholesterol Metabolism,
Carry le Rouet-Marseille, France, 2324 October 1993, ed.
by Lairon D. Commission of the European Communities,
Luxembourg; pp. 123130 (1993).
6 Dixon JL, Stoops JD, Parker JL, Laughlin MH, Weisman GA
and Sturek M, Dyslipidemia and vascular dysfunction in
diabetic pigs fed an atherogenic diet. Arterioscler Thromb Vasc
Biol 19:29812992 (1999).
7 AOAC, Official Methods of Analysis. Arlington, VA (2006).
8 Schurch
AF, Lloyd LE and Crampton EW, The use of chromic
oxide as an index for determining the digestibility of a diet. J
Nutr 50:629636 (1950).
9 Stoldt W, Vorschlag zur Vereinheitlichung der Fettbestimmung
in Lebensmitteln. Fette und Seifen/(Fette, Seifen, Anstrichmittel)
54:206207 (1952).
10 Knudsen KEB, Carbohydrate and lignin contents of plant
materials used in animal feeding. Anim Feed Sci Technol
67:319338 (1997).
11 Tindal JS, Knaggs GS, Hart IC and Blake LA, Release of
growth-hormone in lactating and non-lactating goats in
relation to behavior, stages of sleep, electroencephalograms,
environmental stimuli and levels of prolactin, insulin, glucose
and free fatty-acids in circulation. J Endocrinol 76:333346
(1978).
12 Brighenti F, Testolin G, Canzi E, Ferrari A, Wolever MS,
Ciappellano S et al., Influence of long-term feeding of
different purified dietary fibers on the volatile fatty acid (VFA)
profile, pH and fiber-degrading activity of the cecal contents
in rats. Nutr Res 9:761772 (1989).
J Sci Food Agric 88:13851393 (2008)

DOI: 10.1002/jsfa

13 Theil PK, Srensen IL, Therkildsen M and Oksbjerg N,
Changes in proteolytic enzyme mRNAs relevant for meat
quality during myogenesis of primary porcine satellite cells.
Meat Sci 73:335343 (2006).
14 Knudsen KEB, Serena A, Kjaer AKB, Jorgensen H and Engberg R, Rye bread enhances the production and plasma
concentration of butyrate but not the plasma concentrations
of glucose and insulin in pigs. J Nutr 135:16961704 (2005).
15 Serena A, Jorgensen H and Bach Knudsen KE, The absorption
of lactic acid is more synchronized with the absorption of
glucose than with the absorption of short-chain fatty acids: a
study with sows fed diets varying in dietary fibre. Livest Sci
109:118121 (2007).
16 Littell RC, Milliken GA, Stroup WW and Wolfinger RD, SAS
System for Mixed Models. SAS Institute, Cary, NC (1996).
17 Rieckhoff D, Trautwein EA, Malkki Y and Erbersdobler HF,
Effects of different cereal fibers on cholesterol and bile
acid metabolism in the Syrian golden hamster. Cereal Chem
76:788795 (1999).
18 Zhang JX, Lundin E, Reuterving CO, Hallmans G, Stenling R,
Westerlund E et al., Effects of rye bran, oat bran and soyabean fibre on bile composition, gallstone formation, gallbladder morphology and serum cholesterol in Syrian golden
hamsters (Mesocricetus auratus). Br J Nutr 71:861870 (1994).
19 Lund EK, Salf KL and Johnson IT, Baked rye products modify
cholesterol-metabolism and crypt cell-proliferation rates in
rats. J Nutr 123:18341843 (1993).
20 Frigard T, Pettersson D and Aman P, Fiber-degrading enzyme
increases body-weight and total serum-cholesterol in broilerchickens fed a rye-based diet. J Nutr 124:24222430 (1994).
21 Leinonen KS, Poutanen KS and Mykkanen HM, Rye bread
decreases serum total and LDL cholesterol in men with
moderately elevated serum cholesterol. J Nutr 130:164170
(2000).
22 Zhang JX, Lundin E, Hallmans G, Bergman F, Westerlund E
and Petterson P, Dietary-effects of barley fiber, wheat bran
and rye bran on bile composition and gallstone formation in
hamsters. Apmis 100:553557 (1992).
23 Zhang JX, Lundin E, Hallmans G, Adlercreutz H, Andersson H, Bosaeus I et al., Effect of rye bran on excretion of
bile-acids, cholesterol, nitrogen, and fat in human-subjects
with ileostomies. Am J Clin Nutr 59:389394 (1994).
24 Pandak WM, Schwarz C, Hylemon PB, Mallonee D, Valerie K,
Heuman DM et al., Effects of CYP7A1 overexpression on
cholesterol and bile acid homeostasis. Am J Physiol-Gastr L
281:G878G889 (2001).
25 Tiemann M, Han ZH, Soccio R, Bollineni J, Shefer S, Sehayek E
et al., Cholesterol feeding of mice expressing cholesterol
7 alpha-hydroxylase increases bile acid pool size despite
decreased enzyme activity. PNAS 101:18461851 (2004).
26 Ratliff EP, Gutierrez A and Davis RA, Transgenic expression of
CYP7A1 in LDL receptor-deficient mice blocks diet-induced
hypercholesterolemia. J Lipid Res 47:15131520 (2006).
27 Patterson BW, Wong WW, Sheng HP, Mersmann HJ, Insull W,
Klein PD et al., Neonatal genetically lean and obese
pigs respond differently to dietary cholesterol. J Nutr
122:18301839 (1992).
28 Dyson MC, Alloosh M, Vuchetich JP, Mokelke EA and
Sturek M, Components of metabolic syndrome and coronary
artery disease in female ossabaw swine fed excess atherogenic
diet. Comp Med 56:3545 (2006).
29 Juntunen KS, Laaksonen DE, Poutanen KS, Niskanen LK and
Mykkanen HM, High-fiber rye bread and insulin secretion
and sensitivity in healthy postmenopausal women. Am J Clin
Nutr 77:385391 (2003).
30 Leinonen K, Liukkonen K, Poutanen K, Uusitupa M and
Mykkanen H, Rye bread decreases postprandial insulin
response but does not alter glucose response in healthy Finnish
subjects. Eur J Clin Nutr 53:262267 (1999).
J Sci Food Agric 88:13851393 (2008)

DOI: 10.1002/jsfa
31 Lu ZX, Walker KZ, Muir JG and Odea K, Arabinoxylan fibre

improves metabolic control in people with Type II diabetes.
Eur J Clin Nutr 58:621628 (2004).
32 Lu ZX, Walker KZ, Muir JG, Mascara T and Odea K, Arabinoxylan fiber, a byproduct of wheat flour processing, reduces
the postprandial glucose response in normoglycemic subjects.
Am J Clin Nutr 71:11231128 (2000).
33 Juntunen KS, Niskanen LK, Liukkonen KH, Poutanen KS,
Holst JJ and Mykkanen HM, Postprandial glucose, insulin,
and incretin responses to grain products in healthy subjects.
Am J Clin Nutr 75:254262 (2002).
34 Gallaher DD, Hassel CA and Lee KJ, Relationships between
viscosity of hydroxypropyl methylcellulose and plasma
cholesterol in hamsters. J Nutr 123:17321738 (1993).
35 Lia A, Hallmans G, Sandberg AS, Sundberg B, Aman P and
Andersson H, Oat beta-glucan increases bile acid excretion
and a fiber-rich barley fraction increases cholesterol excretion
in ileostomy subjects. Am J Clin Nutr 62:12451251 (1995).
36 Marlett JA, Hosig KB, Vollendorf NW, Shinnick FL, Haack VS
and Story JA, Mechanism of serum-cholesterol reduction by
oat bran. Hepatology 20:14501457 (1994).
37 Goel V, Cheema SK, Agellon LB, Ooraikul B and Basu TK,
Dietary rhubarb (Rheum rhaponticum) stalk fibre stimulates
cholesterol 7 alpha-hydroxylase gene expression and bile
acid excretion in cholesterol-fed C57BL/6J mice. Br J Nutr
81:6571 (1999).
38 Buhman KK, Furumoto EJ, Donkin SS and Story JA, Dietary
psyllium increases expression of ileal apical sodium-dependent
bile acid transporter mRNA coordinately with doseresponsive changes in bile acid metabolism in rats. J Nutr
130:21372142 (2000).
39 Moundras C, Behr SR, Remesy C and Demigne C, Fecal losses
of sterols and bile acids induced by feeding rats guar gum are
due to greater pool size and liver bile acid secretion. J Nutr
127:10681076 (1997).
40 Levrat-Verny MA, Behr S, Mustad V, Remesy C and
Demigne C, Low levels of viscous hydrocolloids lower
plasma cholesterol in rats primarily by impairing cholesterol
absorption. J Nutr 130:243248 (2000).
41 Bertram HC, Duarte IF, Gil AM, Knudsen KEB and Laerke
HN, Metabolic profiling of liver from hypercholesterolemic
pigs fed rye or wheat fiber and from normal pigs: highresolution magic angle spinning H-1 NMR spectroscopic
study. Anal Chem 79:168175 (2007).
42 Chen WJ, Anderson JW and Jennings D, Propionate may
mediate the hypocholesterolemic effects of certain soluble
plant fibers in cholesterol-fed rats. Proc Soc Exp Biol Med
175:215218 (1984).
43 Wright RS, Anderson JW and Bridges SR, Propionate inhibits
hepatocyte lipid-synthesis. Proc Soc Exp Biol Med 195:2629
(1990).
44 Cheng HH and Lai MH, Fermentation of resistant rice starch
produces propionate reducing serum and hepatic cholesterol
in rats. J Nutr 130:19911995 (2000).
45 Nishina PM and Freedland RA, Effects of propionate on lipid
biosynthesis in isolated rat hepatocytes. J Nutr 120:668673
(1990).
46 Kishida T, Nogami H, Ogawa H and Ebihara K, The hypocholesterolemic effect of high amylose cornstarch in rats is
mediated by an enlarged bile acid pool and increased fecal
bile acid excretion, not by cecal fermented products. J Nutr
132:25192524 (2002).
47 Illman RJ, Topping DL, McIntosh GH, Trimble RP, Storer
GB, Taylor MN et al., Hypocholesterolemic effects of dietary
propionate: studies in whole animals and perfused rat liver.
Ann Nutr Metab 32:97107 (1988).
48 Liukkonen KH, Katina K, Wilhelmsson A, Myllymaki O, Lampi
AM, Kariluoto S et al., Process-induced changes on bioactive
compounds in whole grain rye. Proc Nutr Soc 62:117122
(2003).
1393
J Sci Food Agric 88:13941399 (2008)
Color stability of frozen whole tilapia

exposed to pre-mortem treatment with
carbon monoxide
David Mantilla,1 Hordur G Kristinsson,1 Murat O Balaban,1 W Steven Otwell,1
Frank A Chapman2 and Sivakumar Raghavan1
1 Aquatic
Food Products Program, Department of Food Science and Human Nutrition, University of Florida, Gainesville, FL 32611, USA
of Fisheries and Aquatic Sciences, University of Florida, Gainesville, FL 32611, USA
2 Department
Abstract
BACKGROUND: Color of muscle foods plays a major role in consumer perception of meat quality. Carbon
monoxide (CO) has been successfully used for improving color of packaged meat and fish products. In this study,
we wanted to investigate pre-mortem treatment of live tilapia using 100% CO for its ability to improve the color
of frozen whole tilapia. We compared untreated and CO-treated whole, gutted tilapia, frozen for 2 and 4 months
at 20 C. Frozen tilapia samples were thawed overnight at 4 C, filleted and analyzed for their color, heme peak
wavelength and CO concentration.
RESULTS: Euthanasia using CO significantly increased redness (a value) and lightness (L value) of tilapia
white and red muscle. Frozen storage significantly (P < 0.05) decreased redness of both CO-treated and untreated
tilapia. However, even after 4 months of frozen storage, a -value of CO-treated tilapia was similar to fresh
untreated tilapia fillets. Heme peak wavelengths of CO-euthanized tilapia were higher than in untreated tilapia
and there was no significant (P > 0.05) decrease in heme peak wavelengths of CO-treated tilapia white and red
muscle during frozen storage. The CO content of frozen euthanized tilapia fillets was significantly (P > 0.05)
higher than in untreated fillets. In general, red muscle tissue of euthanized tilapia had a higher concentration of
CO than white muscle.
CONCLUSION: Color stability of tilapia fillets was significantly improved by pre-mortem CO treatment. The
color of CO-treated fillets was retained during frozen storage compared to untreated fillets. Hence, pre-mortem
CO treatment could be used as a new method for improving color of tilapia.
Keywords: carbon monoxide; tilapia; euthanasia; frozen storage; color; carbon monoxide concentration
INTRODUCTION
The color of fresh meat and meat products is one of
the parameters by which consumers judge the quality
of muscle foods.1 Typically, fresh meat is cherry-red in
color due to the presence of oxy-myoglobin. However
during storage, the oxy- form of myoglobin can oxidize
into the undesirable brown-colored met-myoglobin.2,3
Antioxidants are usually added to muscle foods to
prevent oxidation and to maintain the red color of
meat. During the last decade, numerous researchers
have started using carbon monoxide (CO) as a foodprocessing tool to preserve the red color of muscle
foods.4 6 When muscle foods are treated with CO, it
binds with the ferrous iron of myoglobin and forms a
stable complex. The stable COmyoglobin complex
provides the desirable red color of meat. Usually, meat
products are treated with CO as a part of modified
atmospheric packaging.7 9 The use of CO in muscle

foods has created controversy as the cherry red color
can last well beyond the microbial shelf life of the meat
and thus may mask spoilage10 and more importantly
could potentially hide underlying safety problems. The
US Food and Drug Administration (USFDA) has
reviewed the data on CO and filtered smoke (which
contains CO) and has not objected to its use as a
preservative on tuna as long as the product is frozen
and properly labeled, with the goal of preserving taste,
aroma, texture, and color.11 Hence, for this reason it is
important to investigate the effect of CO on the quality
and safety of other seafood products such as tilapia.
In this study, we wanted to examine the pre-mortem
treatment of live tilapia (Oreochromis aureus) with CO
as a method to improve the color stability of frozen
whole tilapia.
Correspondence to: Hordur G Kristinsson, Aquatic Food Products Program, Department of Food Science and Human Nutrition, University of Florida,
Gainesville, FL 32611, USA
E-mail: HGKristinsson@mail.ifas.ufl.edu
(Received 10 December 2007; revised version received 21 January 2008; accepted 22 January 2008)
Color stability of CO-treated frozen tilapia
Several methods of fish slaughter, such as electrical

stunning,12 immersion in liquid ice,13 and stunning
using carbon dioxide (CO2 ),14 are currently being
used in the aquatic food industry. Although several
researchers have shown the ability of CO to improve
the color and quality of fish,8,15,16 little or no research
has studied 100% CO dissolved in water as a way
of euthanizing tilapia and its effect on the quality of
frozen tilapia fillets. CO has been known to induce
loss of consciousness without pain and with minimal
discomfort in small animals.17 Hypoxemia induced
by CO could lead to death at concentrations as low
as 46%. Hence, our objective in this study was to
investigate the color retention of fillets obtained from
CO-euthanized and then frozen tilapia and compare
them with frozen non-treated tilapia fillets. Parameters
such as change in the color of tilapia fillets due to CO
treatment, change in the absorbance of heme protein,
and CO retention in muscle tissues were investigated.

Materials
Live tilapia (Oreochromis niloticus) were obtained from
a farm in Pierson, FL, USA. They were transferred
live to the laboratory and kept in holding tanks prior
to euthanasia using CO. Chemicals were of American
Chemical Society (ACS) grade and were purchased
from Fisher Scientific (Santa Clara, CA, USA).
Treatment of tilapia using a saturated solution of
CO
A holding tank was constructed using transparent
Plexiglas (36 16 12 in.), in which tilapia were
euthanized with CO-saturated water. CO (100%) was
flushed into the circulatory system of the holding
tank to saturate the water with gas.18 All experiments
were performed at ambient room temperature (21 C).
Tilapia were maintained in the euthanizing tank until
they were confirmed dead by visual inspection. On
average, 31 min were needed for the completion of the
euthanasia process. During every trial, 13 fish were
euthanized. To flush the remaining CO out of the tank,
air was flushed into the tank and CO was converted
to CO2 by passing it through a Hopcalite catalyst
tube. After CO treatment, tilapia were immediately
gutted, vacuum packaged in high-density polyethylene
(HDPE) bags, and frozen at 20 C. A set of normally
slaughtered (i.e., concussive blow to the head of the
fish, without CO treatment), tilapia were also gutted,
vacuum packed and stored at 20 C. The latter were
used as control. For storage studies, frozen tilapia
were removed at the end of 2 and 4 months, thawed
for 24 h at 4 C, filleted, and then analyzed for various
parameters. All analyses were replicated at least twice.
Color analysis
A digital color machine vision system (CMVS) was
used following the procedures outlined by Balaban
et al.19 for detailed color analysis of RGB and L
J Sci Food Agric 88:13941399 (2008)
DOI: 10.1002/jsfa
(lightness), a (redness), and b (yellowness) values,

along with hue values and identifying important color
blocks for each treatment. The average L , a , and
b values were reported. The color analysis was done
separately for white and dark lateral muscle of tilapia.
The dark muscle was collected from the left lateral
side of tilapia fillets. The reverse side, which had
practically no red muscle, was used for analysis of the
white muscle.
Quantification of CO in tilapia fillets
The concentrations of CO in the white and dark
muscle of tilapia fillets were determined separately
using the method of Miyazaki et al.20 Briefly, 6 g of
minced muscle was introduced into a 60 mL headspace
bottle. Three drops of 1-octanol (antifoaming agent)
and 12 mL of 10% sulfuric acid were then added
to the sample. Sulfuric acid was added to denature
heme proteins and release CO. The mixture was
shaken for 10 s and then incubated for 5 min at
40 C. After incubation, the tubes were shaken at
room temperature for 15 min and 100 L of the
headspace gas was injected into a gas chromatography
(GC) system (Agilent Technologies Inc. Santa Clara,
CA, USA) equipped with a stainless steel Poropak
Q column (3.17 mm i.d. 1.82 m; 80100 mesh), a
methanizer (to convert CO to methane) and a flame
ionization detector. Helium was used as the carrier
gas at a flow rate of 29.7 mL min1 . The injection
port, column, methanizer and detector temperatures
were maintained at 100 C, 35 C, 320 C and 250 C,
respectively. Hydrogen was used as the reducing gas
at a flow rate of 40 L min1 . The retention time and
area of the methane peak were compared to those
obtained with a calibration CO gas. CO levels were
then calculated based on a standard curve constructed
by injecting different known levels of 100% CO. For
CO quantification, three fillets from CO treatment
and the control were retrieved from the cold room
(4 C) and were analyzed.
Heme protein extraction and spectrophotometric
analysis
The amount of CO taken up by tilapia muscle and
the stability of CO bound to heme proteins during
storage were determined using spectrophotometric
analysis. Heme was extracted by the method of Huo
and Kristinsson.21 A 10 g sample of tilapia muscle
was mixed with 100 mL of 20 mmol L1 Na2 HPO4
buffer (pH 8), followed by homogenization with an
Ultra-Turrax T19 homogenizer (IKA Works, Inc.,
Wilmington, NC) at its lowest speed. The homogenate
was filtered through Whatman no. 1 filter paper
followed by centrifugation at 3000 g. The entire
extraction procedure was done at 4 C to avoid protein
denaturation and loss of CO from the heme protein.
The absorbance spectra of the supernatant was read
between 350 and 700 nm. The absorption maxima for
the heme protein was determined at 419 nm for COHb/Mb (carboxy-hemoglobin/myoglobin), 414 nm for
oxy-Hb/Mb, and 408 nm and below for met-Hb/Mb.
1395
D Mantilla et al.
1396
(a) 35
25
30
a*-value

Effect of pre-mortem CO treatment on color of
tilapia fillets
The change in the muscle color of CO-treated whole
tilapia, frozen at 20 C for 4 months, was analyzed
using a CMVS. In this, method, the machine analyzes
the color of the entire tilapia fillet. One advantage of
using CMVS for color measurement is the ability to
measure uneven surface color distribution such as the
surface of tilapia fillets.
The degree of redness (a value) is often used
as an indicator of quality and freshness of fish
rich in dark muscle.22 In this study, we found that
euthanizing tilapia with CO significantly (P < 005)
increased the redness (a value) of both red (Fig. 1(a))
and white muscle (Fig. 1(b)) compared to untreated
tilapia fillets. The average a value of fresh untreated
tilapia red muscle was around 21 and white muscle
around 17. Immediately after CO euthanization, the
a value of red muscle increased to 27 and white
muscle to 23. The control a values decreased
progressively during frozen storage. During the first
2 months of frozen storage, a value of the control
decreased, but insignificantly (P > 0.05) compared
to fresh untreated tilapia. However, during 4 months
of frozen storage, there was a significant (P < 0.05)
decrease in the redness of untreated tilapia fillets
(Fig. 1(a, b)). The loss of redness in tilapia fillets
during storage is due to the oxidation of the bright red
oxy-myoglobin to brownish met-myoglobin.23 The a
values of CO-euthanized tilapia also decreased during
frozen storage. There was no significant (P > 0.05)
change during the first 2 months of storage, but both
red and white muscle had significantly (P < 0.05)
lower a values after 4 months of storage. However, a
values of the fillets from the CO-euthanized fish were
significantly (P < 0.05) higher throughout the study
compared to the control. Even after 4 months of frozen
storage, the redness of CO-euthanized tilapia red and
white muscle was similar to the a value of untreated
fresh tilapia fillets. These results suggest significantly
higher stability of a values for frozen CO-euthanized
tilapia compared to the untreated tilapia. Interestingly,
an increase in a values of red muscle was observed
after 2 months of frozen storage. Danyali24 also noted
an increase in a values of CO-treated yellowfin tuna
steaks subjected to 30 days of storage at 25 C. The
increase in red color of the tilapia muscle is due to
an increase in the concentration of bound CO in the
muscle. Upon treatment, significant amounts of CO
could remain unbound in the muscle, and during
freezing and also thawing the unbound CO could bind

to free reduced heme proteins and lead to an increase
in redness.
The yellowness (b value) of CO-euthanized tilapia
fillets was not significantly (P > 0.05) affected by
frozen storage (Fig. 2). However, the b value of
both CO-treated and untreated samples increased
during the initial 2 months and decreased during
the subsequent 2 months of frozen storage. For the
untreated (control) tilapia fillets, the b value of red
and white muscle increased significantly (P < 0.05)
during the first 2 months of frozen storage and then
decreased during the subsequent 2 months of storage.
The increase in yellowness (b value) could be due to
the oxidation of lipids and proteins and the subsequent
formation of yellow pigments.25 Also, the reduction in
a values for the tilapia fillets (Fig. 1) could correspond
to oxidation and met-myoglobin formation, which
could produce a brown-yellowish appearance in the
red muscle, resulting in an increased b value.
The lightness (L ) values of the CO-euthanized
tilapia red and white muscle decreased significantly
(P > 0.05) during the 4 months of frozen storage
(Fig. 3). However, at the end of 4 months, the L
value of the CO-treated fillets was not significantly
(P > 0.05) different from the untreated fresh tilapia
muscle. The results may suggest that euthanasia with
100% CO yielded more natural fresh-looking tilapia
fillet than untreated fillets, at the end of frozen storage.
The L value of untreated tilapia red muscle showed
a significant decrease (P < 0.05) during 4 months
storage (Fig. 3(a)). The decrease in lightness values
may indicate oxidation in tilapia red muscle. In tilapia
white muscle (Fig. 3(b)), no significant decrease
(P > 0.05) in L value was observed. The difference in
L values between the red and white muscle of tilapia
Control
100% CO Euthanized
d
20
15
10
5
0
Fresh
2 months
Storage time
30
25
4 months
Control
100% CO Euthanized
(b) 35
a*-value
All analyses were conducted in triplicate. Analysis of
variance (ANOVA) and t-test were used to determine
significant differences between treatments and among
treatments. Statistical Analysis Software (SAS; Cary,
NC, USA) and Microsoft Excel were used for
analyzing the data.
20
d
a
15
10
5
0
Fresh
2 months
Storage time
4 months
Figure 1. Effects of euthanasia with 100% CO and no treatment on

a values of (a) red muscle and (b) white muscle of fresh tilapia and
tilapia stored frozen for up to 4 months. Columns having different
letters are significantly different (P < 0.05).
J Sci Food Agric 88:13941399 (2008)

DOI: 10.1002/jsfa

Control
100% CO Euthanized
(a) 20
b,c
12
a,b
b,c
70
a,b
60
L-value
b*-value
16
(a) 80
Control
100% CO Euthanized
b
50
40
30
20
10
0
Fresh
2 months
Storage time
(b) 20
b,c
Control
100% CO Euthanized
12
Fresh
(b) 80
70
60
50
40
30
20
10
0
a,b
2 months
Storage time
4 months
Control
100% CO Euthanized
b
b
L-value
b*-value
16
b,c
a,b
4 months
8
4
0
2 months
Storage time
Fresh
4 months
Figure 2. Effect of euthanasia with 100% CO and no treatment on b

values of (a) red muscle and (b) white muscle of fresh tilapia and
could be due to a lower amount of heme pigments

present in the white muscle than in red muscle and
hence a lesser degree of oxidation in the white muscle
of tilapia fillets.
Spectroscopic analysis of heme pigments
Hemoglobin/myoglobin in the muscle tissue of tilapia
exists primarily in three different forms: oxy-, deoxyand met- forms. However, treatment with CO would
change the UV-visible spectra of heme proteins.
Kristinsson et al.26 had shown earlier that at pH 6.5
oxy-, met- and carboxy- forms of myoglobin would
Fresh
2 months
Storage time
4 months
Figure 3. Effect of euthanasia with 100% CO and no treatment on L

values of (a) red muscle and (b) white muscle of fresh tilapia and
absorb around 414, 408 and 418 nm, respectively.

Heme proteins from the red and white muscle of
untreated and CO-treated tilapia were extracted and
analyzed spectroscopically between 350 and 700 nm.
For tilapia red muscle, a heme peak wavelength of
415 nm was observed for the untreated fresh sample,
signifying the presence of oxy-hemoglobin/myoglobin
(Fig. 4(a)). This peak was expected since the fillets
were exposed to air during the filleting and skinning
process (which was part of the sample preparation),
which would have allowed oxygen from the air
100% CO Euthanized
Control
Wavelength (nm)
(a) 420
418
416
414
412
410
408
406
404
Fresh
(b) 420
418
416
414
412
410
408
406
404
2 months
Storage time
4 months
Wavelength (nm)
100% CO Euthanized
Control
Fresh
2 months
Storage time
4 months
Figure 4. Maximum heme peak values for (a) red muscle and (b) white muscle of euthanized (100% CO) and untreated fresh and frozen whole
tilapia.
J Sci Food Agric 88:13941399 (2008)

DOI: 10.1002/jsfa
1397
D Mantilla et al.
1398
(a)
CO (g kg-1 of muscle)
Quantification of CO in tilapia fillets

Quantifying the concentration of CO in the muscle
tissue of tilapia fillets is important for differentiating
CO-treated products from untreated ones. Currently,
a variety of methods are available for CO detection in
food materials. These include spectrophotometric27,28
and gas chromatographic methods.29,30 In our present
study, we used GC equipped with a flame ionization
detector for quantifying CO in tilapia fillets. We chose
the GC method for two reasons: (i) ability to detect
CO at g kg1 level and (ii) availability of limited
amount of muscle tissue for CO analysis.
The amount of CO present in tilapia muscle
varied with the type of muscle (white or red
muscle). Untreated tilapia red (Fig. 5(a)) and white
muscles (Fig. 5(b)) had low levels of CO, around
1100 g and 900 g respectively per kilogram of
muscle. Euthanizing tilapia with CO increased the

concentration of CO in the red and white muscle
tissues to 3800 and 1300 g/kg, respectively. In the
untreated tilapia red and white muscle, there was no
significant decrease (P > 0.05) in the concentration of
CO during 4 months of frozen storage. In general, both
the untreated and CO-treated white muscle of tilapia
had lower amounts of CO than their corresponding red
muscle tissue. This was expected since white muscle
tissue contains lesser amounts of heme proteins and
hence less ability to bind CO than the red muscle
tissue. In the CO-euthanized tilapia samples, the
amount of CO increased during the first 2 months of
frozen storage and then decreased for the subsequent
2 months of storage. The increase and decrease in CO
concentration were more significant in the red muscle
(Fig. 5(a)) than in the white muscle (Fig. 5(b)) of COtreated tilapia fillets. It is possible that CO taken up via
gills and bloodstream had not all been delivered into
the muscle when it was sampled. Red muscle tissue,
having a higher content of heme, would be able to trap
greater amounts of released CO, leading to a higher
concentration of CO and greater a value or redness
(Fig. 1(a)) compared to the white muscle. However,
the concentration of CO decreased during 4 months
of frozen storage in both the red and white muscle
of CO-treated tilapia, indicating oxidation and loss of
CO from the COFe2+ heme complex.
In conclusion, the color stability of tilapia fillets
was significantly (P < 0.05) improved by pre-mortem
treatment with 100% CO. Also, the red color of COtreated tilapia white and red muscle was retained
during frozen storage. Hence, euthanasia of tilapia
using 100% CO-saturated water could be used as a
new method for improving the color of tilapia fillets.
12000
10000
(b)
Control
100% CO Euthanized
d
8000
b
6000
4000
2000
0
2 months
Storage time
Fresh
CO (g kg-1 of muscle)
to bind to the heme proteins. The coupling of

oxygen with heme would give a bright red color,
explaining the high a values obtained for the
control in the fresh state (Fig. 1(a)). The heme peak
wavelengths decreased during frozen storage, which
indicates oxidation of heme proteins and loss of
oxygen. These results correlate well with the loss
of a value of tilapia red muscle. At the end of
4 months frozen storage, the heme peak wavelength
was around 409 nm, which indicates that the heme
proteins were significantly oxidized, leading to methemoglobin/myoglobin formation.
The red muscle from CO-euthanized tilapia fillets
had higher heme peak wavelengths (418 nm) than
the control, indicating the presence of CO-hemoglobin
(Fig. 1(a)). The heme proteins in the euthanized
fish were also significantly (P < 0.05) more stable as
they maintained high heme peak wavelengths during
4 months of frozen storage. This stability accounts for
the high a values of CO-treated tilapia red muscle
(Fig. 1(a)).
Spectroscopic analysis showed that the heme peak
absorbance values of tilapia white muscle (Fig. 4(b))
were not as high as those of red muscle (Fig. 4(a)).
However, the absorbance values of CO-euthanized
tilapia white muscle were higher compared to the
control fillets. The high peak wavelengths of COtreated tilapia white muscle indicates CO binding
with heme proteins. Binding of CO to the heme
proteins would also result in a greater degree of
redness (higher a value), as observed with tilapia
white muscle (Fig. 1(b)). The lower wavelength value
of the euthanized white muscle compared to the red
muscle suggests that the values represent an average of
all three different heme protein forms, i.e., met-, oxy-,
and carboxy-, while the control might be a mixture
of met- and oxy- forms.21 The increase in heme peak
wavelength, increased heme protein stability, and red
color of the euthanized white muscle during 4 months
of frozen storage may hence be due to the partial
binding of CO to the heme proteins in the white
muscle of tilapia.
2500
2000
4 months
Control
100% CO Euthanized
c,d
1500
a,b
c,d
a,c
b
1000
500
0
Fresh
2 months
Storage time
4 months
Figure 5. Concentration of CO (g/kg) in (a) red muscle and (b) white

muscle of fresh and frozen untreated and euthanized (100% CO)
tilapia. Columns having different letters are significantly different
(P < 0.05).
J Sci Food Agric 88:13941399 (2008)

DOI: 10.1002/jsfa
ACKNOWLEDGEMENTS
The authors would like to express their thanks to
Mr. Gene Evans at Evans Farms in Pierson, FL for
supplying tilapia for this study.
REFERENCES
1 Kanner J, Oxidative processes in meat and meat-products:
quality implications. Meat Sci 36:169189 (1994).
2 Millar S, Wilson R, Moss BW and Ledward DA, Oxymyoglobin
formation in meat and poultry. Meat Sci 36:397406 (1994).
3 Faustman C and Cassens RG, The biochemical basis for
discoloration in fresh meat: a review. J Muscle Foods
1:217243 (1990).
4 Brewer MS, Wu SY, Field RA and Ray B, Carbon-monoxide
effects on color and microbial counts of vacuum-packaged
fresh beef steaks in refrigerated storage. J Food Qual
17:231244 (1994).
5 Jayasingh P, Cornforth DP, Carpenter CE and Whittier D,
Evaluation of carbon monoxide treatment in modified
atmosphere packaging or vacuum packaging to increase color
stability of fresh beef. Meat Sci 59:317324 (2001).
6 Martinez L, Djenane D, Cilla I, Beltran JA and Roncales P,
Effect of different concentrations of carbon dioxide and low
concentration of carbon monoxide on the shelf-life of fresh
pork sausages packaged in modified atmosphere. Meat Sci
71:563570 (2005).
7 Wicklund RA, Paulson DD, Tucker EM, Stetzer AJ, DeSantos F, Rojas M, et al, Effect of carbon monoxide and high oxygen modified atmosphere packaging and phosphate enhanced,
case-ready pork chops. Meat Sci 74:704709 (2006).
8 Brown WD, Albright M, Watts DA, Heyer B, Spruce B and
Price RJ, Modified atmosphere storage of rockfish (Sebastes
miniatus) and silver salmon (Oncorhynchus kisutch). J Food Sci
45:9396 (1980).
9 Hunt MC, Mancini RA, Hachmeister KA, Kropf DH, Merriman M, DelDuca G, et al, Carbon monoxide in modified
atmosphere packaging affects color, shelf life, and microorganisms of beef steaks and ground beef. J Food Sci 69:C45C52
(2004).
10 Kropf DH, Effects of retail display conditions on meat color, in
Proceedings of the Annual Reciprocal Meat Conference, American
Meat Science Association, IN, pp. 1532 (1980).
11 Hahn MJ, The tasteless smoke process: preserving seafood with
tasteless smoke, in Proceedings of the 25th Annual Meeting
of the Seafood Science and Technology Society of the Americas,
Longboat Key, FL (2000).
12 Robb DHF, OCallaghan M, Lines JA and Kestin SC, Electrical
stunning of rainbow trout (Oncorhynchus mykiss): factors that
affect stun duration. Aquaculture 205:359371 (2002).
13 Huidobro A, Mendes R and Nunes ML, Slaughtering of
gilthead seabream (Sparus aurata) in liquid ice: influence
on fish quality. Eur Food Res Technol 213:267272 (2001).
14 Kestin S, Wotton S and Adams S, The effect of CO2 concussion
or electrical stunning of rainbow trout (Oncorhynchus mykiss)
on fish welfare, in Quality in Aquaculture, ed. by Svennevig N
and Krogdahl A. EAS Special Publication 23, Ghent,
Belgium, pp. 380381 (1995).
J Sci Food Agric 88:13941399 (2008)

DOI: 10.1002/jsfa
15 Hsieh PP, Chow CJ, Chu YJ and Chen WL, Change in color
and quality of tuna during treatment with carbon monoxide
gas. J Food Drug Anal 6:605613 (1998).
16 Chow CJ, Hsieh PP, Tsai ML and Chu YJ, Quality changes
during iced and frozen storage of tuna flesh treated with
carbon monoxide gas. J Food Drug Anal 6:615623 (1998).
17 American Veterinary Medical Association, AVMA Guidelines on
Euthanasia. AVMA, Schaumburg, IL, pp. 139 (2007).
18 Mantilla TD, Euthanasia of tilapia using carbon monoxide for
color fixation and color stabilization. MS thesis, Department
of Food Science and Human Nutrition, University of Florida,
Gainesville, FL, p. 74 (2005).
19 Balaban MO, Kristinsson HG and Otwell WS, Evaluation of
color parameters in a machine vision analysis of carbon
monoxide treated fish. Part I: Fresh tuna. J Aquat Food
Prod Technol 14:524 (2005).
20 Miyazaki H, Abe M, Asanoma M, Nagai Y, Nakajima M and
Miyabe M, Simple determination of carbon monoxide in fish
meat by GC. J Food Hyg Soc Japan 38:233239 (1997).
21 Huo L and Kristinsson H, Rapid detection of carbon monoxide
treated seafood products based on spectral properties of heme
proteins, in Institute of Food Technologists Annual Meeting, New
Orleans, LA, pp. 89A35 (2005).
22 Hiroyasu O, Packaging for freshness and the prevention of
discoloration of fish fillets. Packag Technol Sci 2:201213
(1989).
23 Lee S, Joo ST, Alderton AL, Hill DW and Faustman C,
Oxymyoglobin and lipid oxidation in yellowfin tuna (Thunnus
albacares) loins. J Food Sci 68:16641668 (2003).
24 Danyali N, The effect of carbon monoxide and filtered smoke on
quality and safety of yellowfin tuna, in Food Science and Human
Nutrition, University of Florida, Gainesville, FL, pp. 2443
(2004).
25 Thanonkaew A, Benjakul S, Visessanguan W and Decker EA,
Yellow discoloration of the liposome system of cuttlefish
(Sepia pharaonis) as influenced by lipid oxidation. Food Chem
102:219224 (2007).
26 Kristinsson HG, Mony SS and Petty HT, Properties of tilapia
carboxy- and oxyhemoglobin at postmortem pH. J Agric Food
Chem 53:36433649 (2005).
27 Bylkas SA and Andersson LA, Microburger biochemistry:
extraction and spectral characterization of myoglobin from
hamburger. J Chem Educ 74:426430 (1997).
28 Smulevich G, Droghetti E, Focardi C, Coletta M, Ciaccio C
and Nocentini M, A rapid spectroscopic method to detect the
fraudulent treatment of tuna fish with carbon monoxide. Food
Chem 101:10711077 (2007).
29 Oritani S, Zhu BL, Ishida K, Shimotouge K, Quan L, Fujita
MQ, et al, Automated determination of carboxyhemoglobin
contents in autopsy materials using head-space gas chromatography/mass spectrometry. Forensic Sci Int 113:375379
(2000).
30 Ishiwata H, Takeda Y, Kawasaki Y, Yoshida R, Sugita T,
Sakamoto S, et al, Concentration of carbon monoxide in
commercial fish flesh and in fish flesh exposed to carbon
monoxide gas for color fixing. J Food Hyg Soc Japan 37:8390
(1996).
1399
J Sci Food Agric 88:14001405 (2008)
Antioxidant activity of the ethanolic

extract from the bark of Chamaecyparis
obtusa var. formosana
Palanisamy Marimuthu, Chi-Lin Wu, Hui-Ting Chang and Shang-Tzen Chang
School of Forestry and Resource Conservation, National Taiwan University, Taipei, Taiwan
Abstract
BACKGROUND: Chamaecyparis obtusa var. formosana (Taiwan hinoki) is an endemic conifer in Taiwan and
the purpose of this study is to evaluate the antioxidant activity of various fractions obtained from the bark of
this plant material. The ethanolic extract of the bark was sequentially separated into three fractions, including
n-hexane, ethyl acetate and ethanol soluble fractions, by liquidliquid partition. Then the antioxidant activities of
crude extract and three fractions along with 13 subfractions obtained from the ethyl acetate (EA) soluble fraction
were tested for several antioxidant assays.
RESULTS: The total phenolic content of the samples varied from 27.71 to 102.86 mg GAE g1 dry weight for
fractions, and from 49.94 to 206.46 mg GAE g1 for subfractions (where GAE is milligrams of gallic acid per
gram of extract). The Trolox equivalent antioxidant capacity (TEAC) ranged from 0.15 to 0.26 mmol L1 Trolox
equivalents. The EA soluble fraction was found to be the best antioxidant-rich fraction in terms of DPPH and
reducing power assays. With further data analysis it was found that there was a positive correlation between the
total phenolic content of extracts and TEAC is R2 = 0.61.
CONCLUSION: Results from various antioxidant assays showed that the EA fraction possessed strong antioxidant
activity. This would provide additional information about the antioxidant activity of bark extract of this plant
species.
Keywords: antioxidant activity; bark extract; -carotene bleaching assay; Chamaecyparis obtusa var. formosana;
total phenolic content; Trolox equivalent antioxidant capacity
INTRODUCTION
Plants have been used in many domains including
medicine, nutrition, flavourings, beverages, dyeing,
repellents, fragrances, cosmetics and other industrial
purposes. Since the prehistoric era, plants have
been the basis for nearly all medicinal therapy
until synthetic drugs were developed in the 19th
century.1,2 The preservative effect of many plant
extracts suggests the presence of antioxidative and
antimicrobial constituents in their tissues.3,4 Recently,
interest has increased considerably in finding naturally
occurring antioxidants for use in foods or medicinal
materials to replace synthetic antioxidants, which are
being restricted due to their carcinogenicity.5
Many medicinal plants contain large amounts of
antioxidants such as polyphenols, which can play
an important role in adsorbing and neutralising free
radicals, quenching singlet and triplet oxygen, or
decomposing peroxides. Many of these phytochemicals possess significant antioxidant capacities that are
associated with lower occurrence and lower mortality
rates of several human diseases.6 It has been reported
that there is an inverse relationship between the antioxidative status occurrences of human diseases.7 In addition, antioxidant compounds which are responsible for
such antioxidant activity could be isolated and then
used as antioxidant for the prevention and treatment
of free radical-related disorders.8 Therefore, research
to identify antioxidative compounds is an important
issue. Although it remains unclear which of the compounds from medical plants are the active ones,
polyphenols have recently received increasing attention because of some interesting new findings regarding their biological activities. From pharmacological
and therapeutic points of view, the antioxidant properties of polyphenols, such as free-radical scavenging and
inhibition of lipid peroxidation, are the most crucial.
There are seven species of the genus Chamaecyparis
(Cupressaceae), but only two endemic species, C. formosensis and C. obtusa var. formosana, are found in the
central mountains of Taiwan. Five new cadinane-type
sesquiterpenes were isolated from the heartwood
extract of C. obtusa var. formosana9 and also a recent
report explains the dominancy of this plant partly due
Correspondence to: Shang-Tzen Chang, School of Forestry and Resource Conservation, National Taiwan University, Taipei 106, Taiwan
E-mail: peter@ntu.edu.tw
(Received 29 November 2007; revised version received 11 January 2008; accepted 17 January 2008)
Antioxidant activity of C. obtusa
to the allelopathic potential, when it was planted along

with other plant species.10 Both of these species are
important building materials, and the latter species is
believed to be more resistant to wood-decaying fungi.
The choice of our investigated plant is based on two
criteria: firstly, in this domain there is no antioxidative
study that deals with this plant; and secondly, this
plant is believed to be more resistant to wood-decaying
fungi.11 Although there are several earlier studies
on the chemical constituents12,13 and antitermite14
studies on C. obtusa var. formosana, there are no studies
reported to antioxidant activity of bark of this plant
species. This evaluation is related to the total phenolic
content and antioxidant activity to determine new
potential sources of natural antioxidants from the bark
of C. obtusa var. formosana.

Plant material
The bark was collected from the 600-year-old
Chamaecyparis obtusa var. formosana tree located
in the central Taiwan. A voucher specimen was
deposited in the laboratory of wood chemistry, School
of Forestry and Resource Conservation, National
Taiwan University.
Chemicals
2,2 -Diphenyl-1-picrylhydrazyl radical (DPPH),
potassium dihydrogen phosphate, trichloracetic acid,
3-(-2-pyridyl)-5,6-bis(4-phenyl-sulfonic acid), carotene, lipoxidase (type I) from Glycine max Merrill (soybean), FolinCiocalteu reagent, quercetin,
-carotene and (+)-catechin were purchased from
Sigma Chemical Co., St Louis, MO. Linoleic acid
was from Acros, Morris Plains, NJ, USA. All other
solvents and reagents were purchased from Sigma.
Extraction and isolation
Fifty kilograms of bark from the plant material was
dried at room temperature and milled. The milled
material was percolated in 95% ethanol (2 60 L) at
room temperature for 6 days. Then, the extract was
filtered and solvent was evaporated under reduced
pressure gave an extract (472.4 g), which was subjected
to liquidliquid partition successively with n-hexane
then ethyl acetate (EA) to give the n-hexane (180.5 g)
and EA soluble fractions (166 g), respectively. The
remaining fraction was considered as the ethanol
soluble fraction (22.6 g).
Based on the results obtained from antioxidant
assays (DPPH and reducing power), the EA soluble
fraction was considered to be the antioxidant-rich
fraction. One hundred grams of the EA soluble fraction
was applied to a silica gel open column and eluted
with a stepped gradient consisting of n-hexane, EA,
acetone, ethanol and water. The samples collected
were screened by thin-layer chromatography (TLC)
profile and fractions having similar TLC patterns were
combined: 13 fractions (SF1SF13) were obtained.
J Sci Food Agric 88:14001405 (2008)
DOI: 10.1002/jsfa
Based on the DPPH screening assay, fraction 11

was found to be the antioxidant-rich fraction. It was
applied (20 g) to a RP-18 open column and eluted with
a gradient of MeOHH2 O and further fractionated
into 13 subfractions. Then the fractions were studied
for antioxidant activity by using the DPPH assay and
determining the reducing power, and also for their
total phenolic content.
Antioxidant assays
DPPH assay
The DPPH assay was carried out as reported
previously.15 Fifty microliters of sample solution (100,
50, 25, 12.5 g mL1 as per final concentration)
were added to 450 L of Tris-HCl buffer and
1 mL of 0.1 mmol L1 methanol solution of DPPH.
After a 30 min incubation at room temperature, the
absorbance was read against a blank at 515 nm in a
Jasco V-550 UVvisible spectrophotometer (Tokyo,
Japan). The assay was carried out in triplicate and
results were averaged. (+)-Catechin was used as a
positive reference.
Reducing power
The reducing power was determined as described
previously.16 Various amounts (final concentration of
50, 25, 12.5, 6.25 g mL1 ) of fractions or subfractions
(dissolved in methanol) were mixed with 0.5 mL
of 0.2 mol L1 phosphate buffer (pH = 6.6) and
0.5 mL of 1% potassium ferricyanide, and the mixture
was incubated at 50 C for 20 min. After adding
0.5 mL of 10% trichloroacetic acid, the mixture was
centrifuged at 976 g for 10 min in a Hettich Micro
22R model centrifuge (Tuttlingen, Germany). The
supernatant (0.5 mL) was mixed with 0.55 mL of
distilled water and 0.1 mL of 0.1% ferric chloride
and the absorbance read at 700 nm in a Jasco V-500
UVvisible spectrophotometer. Quercetin was used as
a positive control.
-Carotene bleaching assay
The -carotene antioxidant assay was carried out
as given by Chaillou and Nazareno17 and Kulisica
et al.18 with slight modifications. All the reagents and
solutions were prepared according to the procedure
reported in the literature. Initially, 2.5 mL of carotene solution was thoroughly mixed with 200 L
of linoleic acid. Then, 200 L of lipoxidase were added
followed by 100 L of sample (final concentrations of
100, 50, 25, 12.5, 6.25 g mL1 ). The absorbance
of the control sample was measured immediately
(t = 0) and t = 10 min. Reading of samples containing
antioxidants were measured at 10 min at 460 nm in
a Jasco V-550 UVvisible spectrophotometer. All
determinations were performed in triplicate. The
percentage of -carotene inhibition was calculated as
% inhibition = (1 ((AS(0) AS(10) )/
(AC(0) AC(10) ))) 100
1401
P. Marimuthu et al.
where AS(0) is the absorbance of the sample at

t = 0 min; AS(10) is the absorbance of the sample at
t = 10 min; AC(10) is the absorbance of the control at
t = 10 min; and AC(0) is the absorbance of the control
at t = 0 min.
Quantification of total antioxidant activity
The total antioxidant activity values were estimated by
the Trolox equivalent antioxidant capacity (TEAC)
assay.19 In this test, we measured the relative capacity of antioxidants to scavenge the 2,2-azinobis(3ethylbenzothiazoline-6-sulfonic acid) diammonium
salt (ABTS) radical compared to the antioxidant
potency of Trolox is used as a standard. The ABTS
radical generated by mixing a solution of ABTS
(7 mmol L1 ) with K2 S2 O8 (2.45 mmol L1 ). Before
use, the ABTS solution was diluted with water to
obtain an absorbance of 0.700 0.020 at 734 nm.
Upon adding 1485 L of the diluted ABTS solution
to 15 L of antioxidant sample or Trolox standard,
the absorbance at 734 nm was recorded by a Jasco
V-550 UVvisible spectrophotometer 6 min after initial mixing. Appropriate solvent blanks were run in
each assay, and all measurements are done at least
three times. Decreases in absorbance were noted and
then calculated and plotted with respect to absorbance
and concentration of the standard and samples. The
final TEAC value of the antioxidant compound was
calculated by comparing ABTS decolorisation with
Trolox, which gives a useful indication of the antioxidant potential of the specimen.
Determination of total phenolics according to the
FolinCiocalteu method
The amount of total phenolics was measured by the
FolinCiocalteu method15 using gallic acid as standard, for which a calibration curve was obtained with
solutions of 0.08, 0.04, 0.02, 0.01, and 0.005 mg
mL1 of this compound (y = 37.907x 0.093, R2 =
0.9991). A 0.4 mL aliquot of diluted extract (all
fractions were diluted with methanol to adjust the
absorbance within the calibration limits), 0.4 mL of
1 mol L1 FolinCiocalteu reagent, and 0.8 mL of
Na2 CO3 (20%, w/v) were mixed. After 8 min, the mixture was centrifuged at 15 616 g for 10 min. Then
the absorbance of the supernatant solution was measured at 730 nm by using a Jasco V-550 UVvisible
spectrophotometer and against a blank prepared similarly but containing distilled water instead of extract.
The concentration of phenolics thus obtained was
multiplied by the dilution factor and the results were
expressed as the equivalent to milligrams of gallic acid
per gram of extract (mg GAE g1 ).
For all the extracts three samples were prepared for
assays of every antioxidant attribute. The data were
presented as mean standard deviation of three
determinations. The significance of difference was
1402
analysed using SAS Scheffes statistics software and

a value of P < 0.05 was considered significant.

Antioxidant activities of bark extract and its
fractions from C. obtusa var. formosana
DPPH and reducing power assay
The scavenging effect of crude (71.7212.06%),
n-hexane (38.686.81%), EA (83.0632.12%) and
ethanol (80.5624.31%) soluble fractions on DPPH
radical increased linearly with increasing concentration (Fig. 1) at 100, 50, 25 and 12.5 g mL1 .
The IC50 values of EA, ethanol, crude and (+)catechin were found to be 21.88, 31.07 56.65 and
2.18 g mL1 , respectively. Wang et al.20 reported that
the IC50 of an ethanolic extract of Calocedrus formosana bark, which belongs to the same family, was
23 g mL1 , which is higher in comparison with our
plant. The reducing power of various soluble fractions increased with increasing concentration (Fig. 2).
Based on optical density values of the fractions, the
antioxidant activity can be ranked in the following
descending order: EA fraction > ethanol fraction >
crude extract > n-hexane fraction.
Total phenolic content and TEAC assay
The amount of total phenolics varied in different
fractions and ranged from 27.71 to 102.86 mg
GAE g1 of dry material (Table 1) while for the
subfractions it was ranged from 49.94206.46 mg
GAE g1 (Table 2). EA soluble fraction showed higher
phenolic content (102.86 mg GAE g1 ) followed
by ethanol, crude and n-hexane extract (27.71 mg
GAE g1 ). TEAC values are expressed in mmol L1
Trolox equivalent. The ethanol fraction has a higher
TEAC value of 0.26 mmol L1 Trolox equivalent
followed by the EA, crude and n-hexane fractions
(Table 1). Wang et al.20 also demonstrated that the
total phenolic content of the ethanol extract from
Calocedrus formosana heartwood (159.5 1.9 mg GAE
Figure 1. Antioxidant activity of extract and various soluble fractions

of C. obtusa var. formosana bark in terms of the DPPH radical
scavenging assay.
J Sci Food Agric 88:14001405 (2008)

DOI: 10.1002/jsfa

Table 2. Total phenolic content, DPPH (IC50 value) and reducing
power of subfractions fractionated on a reverse-phase open column

of C. obtusa var. formosana bark in terms of the reducing power
assay.
g1 ) was higher than that of the bark extract (115.3 mg

GAE g1 ), which is relatively lower (90.72 0.18)
in Chamaecyparis obtusa var. formosana. The report21
on antioxidant activity of n-hexane, EA, n-butanol
and water extracts from the bark of Chamecyparis
lawosoniana revealed that the EA fraction exhibited
a higher total phenolic content (337 mg GAE g1 )
and a lower IC50 value (6.53 g mL1 ) in the DPPH
assay. The EA fraction from our bark extract belonging
to the same family showed lower total phenolic
content (102.86 mg GAE g1 ) and higher IC50 value
(21.88 g mL1 ) in the DPPH assay. At the same
time, our crude bark extract showed relatively higher
total phenolic content in comparison with Juniperus
oxycedrus22 from the same family.
-Carotene bleaching assay
This method is based on the loss of the yellow colour
of -carotene due to its reaction with radicals that
are formed by oxidation of linoleic acid, induced
by lipoxidase in the emulsion. It was reported that
linoleic acid is the preferred substrate for lipoxidase
as it particularly attacks the fatty acid containing
a 1-cis, 4-cis-pentadiene system.23 The rate of carotene bleaching can be reduced in the presence
of antioxidants. This fact is used in the determination
Specimen
Total phenolic
content
(mg GAE g1 )
DPPH IC50
(g mL1 )
Reducing
power
SF1
SF2
SF3
SF4
SF5
SF6
SF7
SF8
SF9
SF10
SF11
SF12
SF13
Catechin
Querectin
49.94 1.15i
84.86 0.75h
134.77 0.50e
177.52 0.50b
206.46 1.34a
141.02 0.57d
138.52 0.78e,d
172.58 1.78c
139.75 0.32d
135.04 0.98e
113.02 0.76f
91.60 0.84g
109.21 1.37f
82.87 1.73a
49.93 0.22b
37.52 0.07c
26.43 0.72d
14.82 0.47g
16.82 0.17g,f
17.00 0.24g,f
15.05 0.21g
17.30 0.29g,f
23.89 1.41e
26.79 0.52d
22.63 0.18f
23.14 0.25e
2.18 0.03h
0.75 0.01h
1.29 0.10f
1.27 0.03f
1.77 0.04e,d
2.22 0.01b
2.10 0.05c,b
1.94 0.01c,d
2.06 0.03c,b
1.77 0.07e,d
1.39 0.15g,f
1.66 0.05e,f
2.19 0.05c,b
1.76 0.09e,d
2.49 0.01a
Numbers followed by different letters (ad) are statistically different

at the probability level of P < 0.05 according to Scheffes analysis.
SF, subfraction. Absorbance value at 700 nm, subfractions at final
concentration of 50 g mL1 . Each value is mean SD of three
measurements.
of antioxidant activity of fractions obtained from C.

obtusa var. formosana. Figure 3 shows the antioxidant
activity of various fractions, among which the EA
fraction showed strong antioxidant activity with
75.82% inhibition of -carotene at a concentration
of 100 g mL1 . IC50 values of the ethanol fraction,
EA fraction, n-hexane fraction, crude extract and
quercetin were found to be 43.16, 43.90, 92.45, 65.76
and 4.27 g mL1 , respectively. In terms of percent
inhibition of -carotene bleaching at 100 g mL1 ,
antioxidant activity of various fractions can be ranked
as EA fraction = ethanol fraction > crude extract >
n-hexane fraction.
In the modified -carotene assay, the percent
inhibition of various fractions at higher concentration
(100 g mL1 ) were significantly different, but at lower
Table 1. Total phenolic content and Trolox equivalent antioxidant

capacity values for extract and various fractions of C. obtusa var.
formosana bark
Specimen
Crude extract
n-Hexane fraction
EA fraction
Ethanol fraction
Quercetin
Total phenolic content

(mg GAE g1 )
TEAC (mmol L1
trolox equivalent)
50.86 1.61c
27.71 0.18d
102.86 0.78a
90.72 0.18b
0.19 0.01b
0.15 0.00b
0.21 0.05b
0.26 0.01b
3.55 0.11a
Numbers followed by different letters (ad) are statistically different at

the probability level of P < 0.05 according to Scheffes analysis.
Each value is mean SD of three measurements.
J Sci Food Agric 88:14001405 (2008)

DOI: 10.1002/jsfa

of C. obtusa var. formosana bark in terms of the modified -carotene
bleaching assay.
1403
P. Marimuthu et al.
concentration, almost all the specimens (except the nhexane fraction) showed similar percent inhibition.
At the lower concentration (6.25 g mL1 ), the nhexane fraction gave a negative antioxidant value
(0.81%); this represents a pro-oxidant effect of the
n-hexane fraction in this system. This result is in
accord with the pro-oxidant effect of cinnamic acid
shown by Chaillou and Nazareno.17 The presence of
different antioxidant components in the plant tissues
makes it relatively difficult to quantify each antioxidant
component separately. Therefore, in many studies,
several intermediate extractions are used to ensure a
maximum extraction of the available antioxidants.24
The antioxidant activity of phenolics is mainly due
to their redox properties which make them act as
reducing agents, hydrogen donors, and singlet oxygen
quenchers. They may also have a metallic chelating
potential.25
Antioxidant activities of the subfractions
from the ethyl acetate soluble fraction
DPPH and reducing power assay
Subfractions obtained from the RP-18 open column
have IC50 values in the range 14.8282.87 g mL1
(Table 2). Subfractions SF5, SF6, SF7, SF8 and
SF9 exhibited strong radical scavenging effects and
these subfractions have IC50 values of 14.82
17.30 g mL1 . As for the reducing power, subfractions SF5, SF6, SF8 and SF12 showed higher reducing
power (2.102.22) in comparison with other samples
(Table 2).
Total phenolic content
RP open column considerably increased total phenolic
content in the subfractions SF5, SF4 and SF8.
Subfraction SF5 exhibited higher total phenolic
content followed by subfractions SF4 and SF8 in
comparison with other fractions (Table 2).
The correlation coefficient, R2 , between TEAC and
total phenolic content of various solvent fractions is
0.61 (Fig. 4). The antioxidant activity of fractions
may not only be due to the presence of phenolic
compounds but also related to the presence of some
individual active components in the extracts. The
unclear relationship between the antioxidant activity
and total phenolic content may be explained by the fact
that the total phenolic content does not incorporate all
the antioxidants. In addition, the synergism between
the antioxidants in the mixture makes the antioxidant
activity not only dependent on the concentration but
also on the structure and interaction between the
antioxidants. This is why the EA and ethanol fractions,
which have similar total phenolic contents, varied in
antioxidant performance in the TEAC assay.
Phenolic groups play an important role in antioxidant activity.26,27 It has been reported that most
natural antioxidative compounds often work synergistically with each other to produce a broad spectrum of
antioxidative activities that create an effective defence
system against free-radical attack.28 The composition
1404
Figure 4. Linear correlation of Trolox equivalent antioxidant capacity

(TEAC) with respect to the total phenolic content of various fractions
obtained from C. obtusa var. formosana.
of the extract is very complex; it consists of various

classes of organic compound which may exert opposite effects on the process of lipid oxidation. Based
on the results obtained, it is highly possible that some
constituents of different polarity may contribute to the
antioxidative activity of the extract.
CONCLUSIONS
It has also been noted in this study that the EA
fraction of C. obtusa var. formosana bark extract showed
strong radical scavenging and can be considered a
good source of natural antioxidants for medicinal
and commercial use. However, due to the diversity
and complexity of the natural mixtures of phenolic
compounds in this plant extract, it is not easy
to characterise every compound and assess the
antioxidant activity of each one. Each plant generally
contains different phenolic compounds with different
amounts of antioxidant activity. As a result of this
study, we believe that in vivo studies are needed to
further confirm the advantageous quality of these
natural products. In order to confirm the antioxidative
effect of these promising plant extracts, a further
survey, which uses other types of antioxidant assay,
is now under way. This survey also includes the
characterisation of active phenolic antioxidants.
ACKNOWLEDGEMENT
We thank the National Science Council, Taiwan
for generous financial support (NSC95-2313-B-002012).
REFERENCES
1 Dahanukar SA, Kulkarni RA and Rege NN, Pharmacology of
medicinal plants and natural products. Indian J Pharmacol
32:81118 (2000).
2 Exarchou V, Nenadis N, Tsimidou M, Gerothanassis IP, Troganis A and Boskou D, Antioxidant activities and phenolic
composition of extracts from Greek oregano, Greek sage and
summer savory. J Agric Food Chem 50:52945299 (2002).
J Sci Food Agric 88:14001405 (2008)

DOI: 10.1002/jsfa

3 Singh G, Marimuthu P, de Heluani CS and Catalan CAN,
Antimicrobial and antioxidant potentials of essential oil and
acetone extract of Myristica fragrans Houtt. (aril part). J Food
Sci 70:141148 (2005).
4 Cheng SS, Liu JY, Hsui YR and Chang ST, Chemical polymorphism and antifungal activity of essential oils from leaves of
different provenances of indigenous cinnamon (Cinnamomum
osmopholeum). Bioresource Technol 97:306312 (2006).
5 Velioglu YS, Mazza G, Gao L and Oomah BD, Antioxidant
activity and total phenolics in selected fruits, vegetables, and
grain products. J Agric Food Chem 46:41134117 (1998).
6 Anderson KJ, Teuber SS, Gobeille A, Cremin P, Waterhouse AL and Steinberg FM, Walnut polyphenolics inhibit
in vitro human plasma and LDL oxidation. Biochemical and
molecular action of nutrients. J Nutri 131:28372842 (2001).
7 Rice-Evans CA, Sampson J, Bramley PM and Holloway DE,
Why do we expect carotenoids to be antioxidants in vivo? Free
Radical Res 26:381398 (1997).
8 Middleton EJ, Kandaswami C and Theoharides TC, The effects
of plant flavonoids on mammalian cells: implications for
inflammation, heart disease, and cancer. Pharmacol Rev
52:673751 (2000).
9 Kuo YH, Chen CH, Chien SH and Lin YL, Five new cadinanetype sesquiterpenes from the heartwood of Chamaecyparis
obtusa var. formosana. J Nat Prod 65:2528 (2002).
10 Tseng MH, Lai WR, Hsieh CL and Kuo YH, Allelopathy on
bark of downed logs of Chamaecyparis obtusa Sieb. and Zucc.
var. formosana (Hayata) Rehder. J Chem Ecol 33:12831296
(2007).
11 Kuo YH, Chen CH and Huang SL, New diterpenes from the
heartwood of Chamaecyparis obtusa var. formosana. J Nat Prod
61:829831 (1998).
12 Su YC, Ho CL and Wang EIC, Analysis of leaf essential oils
from the indigenous five conifers of Taiwan. Flavour Frag J
21:447452 (2006).
13 Wang SY, Wang YS, Tseng YH, Lin CT and Liu CP, Analysis
of fragrance compositions of precious coniferous woods grown
in Taiwan. Holzforschung 60:528532 (2006).
14 Cheng SS, Chang HT, Wu C-L and Chang ST, Anti-termitic
activities of essential oils from coniferous trees against
Coptotermes formosanus. Bioresource Technol 98:456459
(2007).
15 Tung YT, Wu JH, Kuo YH and Chang ST, Antioxidant
activities of natural phenolic compounds from Acacia confusa
bark. Bioresource Technol 98:11201123 (2007).
J Sci Food Agric 88:14001405 (2008)

DOI: 10.1002/jsfa
16 Oyaizu M, Studies on products of browning reactions: antioxidative activities of products of browning reactions prepared
from glucosamine. Japanese J Nutr 44:307315 (1986).
17 Chaillou LL and Nazareno MA, New method to determine
antioxidant activity of polyphenols. J Agric Food Chem
54:83978402 (2006).
18 Kulisica T, Radonic A, Katalinic V and Milosa M, Use of
different methods for testing antioxidative activity of oregano
essential oil. Food Chem 85:633640 (2004).
19 Miller NJ, Rice-Evans CA and Papaganga G, Antioxidant properties of phenolic compounds. Trends Plant Sci 4:152159
(1997).
20 Wang SY, Wu JH, Cheng SS, Lo CP, Chang HN, Shyur LF
et al., Antioxidant activity of extracts from Calocedrus
formosana leaf, bark and heartwood. J Wood Sci 50:422426
(2004).
21 Gao H, Shupe TF, Hse CY and Eberhardt TL, Antioxidant
activity of extracts from the bark of Chamaecyparis lawsoniana
(A. Murray) Parl. Holzforschung 60:459462 (2006).
22 Djeridane A, Yousfi M, Nadjemi B, Boutassouna , Stocker P
and Vidal N, Antioxidant activity of some Algerian medicinal
plants extracts containing phenolic compounds. Food Chem
97:654660 (2006).
23 Belitz HD and Grosch W. Lipids, in Food Chemistry, 2nd
edition, ed. by Belitz HD and Grosch W. Springer-Verlag,
Berlin, Heidelberg, pp. 199200 (1999).
24 Kakoen MP, Hopia AI, Vuorela HJ, Rauha JP, Pihlaja K and
Kujala TS, Antioxidant activity of plant extracts containing
phenolic compounds. J Agric Food Chem 47:39543962
(1999).
25 Rice-Evans CA, Miller NJ, Bolwell PG, Bramley PM and Pridham JB, The relative antioxidant activities of plant derived
polyphenolic flavonoids. Free Radical Res 22:375383 (1995).
26 Huang SW and Frankel EN, Antioxidant activity of tea
catechins in different lipid systems. J Agric Food Chem
40:30333038 (1997).
27 Baratta MT, Dorman HJD, Deans SG, Figueiredo AC, Baroso
JG and Ruberto G, Antimicrobial and antioxidant properties
of some commercial essential oils. Flavour Frag J 13:235244
(1998).
28 Lu F and Foo LY, Phenolic antioxidant component of evening
primrose, in Nutrition, Lipids, Health and Diseases, ed. by
Ong ASH, Niki E and Packer L. Champaign: American Oil
Chemists Society Press, pp. 8695 (1995).
1405
J Sci Food Agric 88:14061414 (2008)
Cloning of an alfalfa polyphenol oxidase

gene and evaluation of its potential in
preventing postharvest protein degradation
Michael L Sullivan,1 Ronald D Hatfield1 and Deborah A Samac2
1 US
Dairy Forage Research Center, 1925 Linden Drive West, Madison, WI 53706, USA
Plant Science Research Unit and Department of Plant Pathology, University of Minnesota, 1991 Upper Buford Circle, St Paul,
MN 55108, USA
2 USDA-ARS
Abstract
BACKGROUND: Ensiling forages often leads to degradation of protein to non-protein nitrogen (NPN), which is
poorly utilized by ruminants. Postharvest protein degradation is especially high in alfalfa (Medicago sativa L.). In
contrast, red clover (Trifolium pratense L.) has up to 90% less protein loss during ensiling due to polyphenol oxidase
(PPO) forming o-quinones from endogenous o-diphenols and subsequent binding of o-quinones to cytoplasmic
proteins. Here we determined whether an endogenous PPO might be exploited for postharvest protein protection
in alfalfa.
RESULTS: We isolated an alfalfa PPO gene (MsPPO1) that shares limited sequence identity (7072%) with red
clover PPO genes. MsPPO1 is expressed primarily in flowers and developing seed pods, but not in leaves or stems.
Expression of MsPPO1 from a strong constitutive promoter in transgenic alfalfa results in accumulation of PPO
transcripts in leaves, but little enzyme activity is detected using a variety of o-diphenol substrates unless assayed
in the presence of sodium dodecyl sulfate (SDS). Under this SDS-activated condition, preference of MsPPO1 for
tested substrates is catechol ()-epicatechin > caffeic acid. PPO activity in unactivated MsPPO1-alfalfa extracts
is sufficient to inhibit proteolysis in the presence of catechol, but not caffeic acid or ()-epicatechin. Inhibition is
less than in extracts of alfalfa expressing the red clover PPO1 gene.
CONCLUSION: Endogenous alfalfa PPO, even if expressed in appropriate target tissues, would be less effective
at preventing proteolytic losses in ensiled forages than red clover PPO.
Published in 2008 by John Wiley & Sons, Ltd.
Keywords: polyphenol oxidase; alfalfa; forage legumes; proteolysis; protein preservation
INTRODUCTION
Polyphenol oxidases (PPOs; EC 1.14.18.1, 1.10.3.1)
are capable of catalyzing the oxidation of o-diphenols
to their corresponding o-quinones. Although they are
nearly ubiquitous among plants,1 the exact roles they
play in plant growth, development, and physiology are
not entirely clear. In at least some cases, PPOs appear
to be involved in pathogen defense responses.2,3
Some PPOs have been implicated in biosynthetic
pathways including the biosynthesis of yellow aurone
pigments in snapdragon flowers4 and a specific lignan
in creosote bush.5 PPOs are probably best known for
their negative impact on the quality of fresh fruits
and vegetables as a result of PPO-mediated oxidation
of endogenous o-diphenols to oquinones.6 The
resulting o-quinones covalently couple to a number
of cellular nucleophiles and consequent secondary
quinone reactions lead to the formation of brown
and black colored polymers (the browning reaction).
Despite the usual negative association of PPO with
agricultural crops, we have recently demonstrated that

oxidation of o-diphenols by PPO can be exploited as
a natural system of protein protection in forage crops
preserved by ensiling.7
Postharvest protein degradation in ensiled forage
crops results in the conversion of true protein to
amino acids and peptides (non-protein nitrogen,
NPN). This conversion of true protein to NPN is
problematic because dairy cows and other ruminant
animals poorly utilize excess non-protein nitrogen,
resulting in economic losses to farmers, who must
supplement rations with other sources of true protein.
Such losses are especially high in alfalfa (Medicago
sativa L.), approaching $100 million annually in the
United States alone.7,8 Further, loss of true protein in
preserved forages has negative environmental impacts,
as excess NPN is excreted by ruminants as urea,
increasing N burdens to the environment. In contrast
to alfalfa, the forage legume red clover (Trifolium
pratense L.) experiences up to 90% less proteolysis
Correspondence to: Michael L Sullivan, US Dairy Forage Research Center, 1925 Linden Drive West, Madison, WI 53706, USA
E-mail: michael.sullivan@ars.usda.gov
(Received 18 October 2007; revised version received 16 January 2008; accepted 17 January 2008)
This article is a US Government work and is in the public domain in the USA. J Sci Food Agric 00225142/2008/$30.00
Cloning and characterization of an alfalfa polyphenol oxidase gene
when ensiled.9 We have recently demonstrated that

red clovers lower level of postharvest proteolysis is
due to the oxidation of endogenous o-diphenols by
red clover PPO.7 Using genetically modified alfalfa
expressing the red clover PPO1 gene (TpPPO1), we
also demonstrated that this natural system of protein
protection could be transferred to alfalfa, relatively
little PPO activity is required, and a number of odiphenol PPO substrates are effective in the process.
Although the mechanism of protein protection by
PPO-generated o-quinones is not clear, it seems likely
the quinones react with nucleophilic sites on cellular
proteins resulting in direct inactivation of proteases,
modification of proteins such that they become poor
substrates for endogenous proteases, or both. PPOgenerated o-quinones also appear to prevent lipid
breakdown in ensiled red clover10 and have a positive
impact on the lipid profile of products derived from
animals fed diets high in red clover.11,12
Red clover leaves accumulate high levels of both
PPO activity (as high as 70 nkat mg1 protein)7,13
and caffeic acid derived o-diphenols phasalic acid and
clovamide14,15 (Winters A, personal communication)
that seem to be good substrates for the predominant
foliar PPO enzymes.16,17 In contrast to red clover,
alfalfa, including a collection of almost 200 perennial
Medicago accessions, has little if any PPO activity in
its leaves and lacks significant levels of o-diphenol
PPO substrates.13,17 19 Here we have identified
and characterized an alfalfa PPO gene (MsPPO1)
to determine whether alfalfas endogenous PPO
enzyme might be exploited for preserving forage
protein.
EXPERIMENTAL
Plant materials
A highly regenerable clone of Regen-SY20 was
used for alfalfa (Medicago sativa L.) transformation.
Additionally, alfalfa expressing red clover PPO1
and control alfalfa transformed with pILTAB 357
empty vector were the same Regen-SY background.13
Transformed alfalfa was maintained in a growth
chamber at 26 C with 16 h d1 of approximately
3000 lx illumination. Alfalfa clone P derived from
variety Blazer XL21 used in some experiments
was maintained in a greenhouse year-round at
2030 C with light intensities between 25 000 and
60 000 lx. Supplemental lighting (13 h d1 ) was
used during all but summer months. All plants
were fertilized weekly with Peters soluble 20-20-20
(Scotts, Marysville, OH).
DNA and RNA methodologies
Preparation and characterization of nucleic acids
Genomic DNA from young leaves of alfalfa plants,
plasmid DNA, and lambda DNA were prepared
using the DNeasy Plant Maxi Kit, QIAprep Spin
Miniprep Kit, and Lambda Midi Kit, respectively
(Qiagen, Valencia, CA, USA). For DNA blotting,
J Sci Food Agric 88:14061414 (2008)
DOI: 10.1002/jsfa
DNA digested with restriction endonucleases was

fractionated on agarose gels and transferred to
nylon membranes essentially as described by Sambrook et al.22 DNA sequence was determined by
cycle sequencing using Big Dye v3.1 (Applied
Biosystems, Foster City, CA, USA) and run on
ABI automated sequencers by the University of
Wisconsin Biotechnology Center. Sequence analyses were carried out using the Wisconsin Package, Version 10 (Accelrys, San Diego, CA, USA),
ChloroP23 and SignalP24 algorithms available online
at http://www.cbs.dtu.dk/services, and BLAST using
the National Center for Biotechnology Information
(www.ncbi.nlm.nih.gov) and the Institute for Genome
Research (www.tigr.org) web sites.
Total RNA was prepared from plant tissues using
an RNeasy kit (Qiagen) or by the method of Chang
et al.25 Formaldehyde agarose gels were run and RNA
blots prepared as previously described.26 DNA and
RNA hybridizations were carried out as previously
described,13 except that in some experiments 32 Plabeled riboprobes, prepared using the Strip-EZ RNA
Kit (Ambion, Austin, TX, USA), were used instead of
32
P-labeled DNA probes.
Generation of PPO gene fragments by polymerase chain
reaction (PCR)
A previously described primer pair corresponding to the conserved region flanking the CuA
copper binding site of plant PPOs13 was used
to amplify a PPO gene fragment from an
alfalfa DNA preparation. The primers were 5 GGGGAATTCCAACAAGCTARKRTHCATTG
TGCTT-3 (sense) and 5 -GGGAAGCTTATCC
CAATTCCARWAHGG-3 (antisense). A series of
three G deoxyribonucleotides and either an EcoRI
or HindIII restriction endonuclease site (underlined)
were included in each primer to facilitate subsequent cloning. These primers (50 pmol) and alfalfa
clone P genomic DNA (50 ng) were used in a
50 L PCR reaction using Taq polymerase (Promega
Corp., Madison, WI, USA) in the supplied reaction buffer supplemented with 2 mmol L1 MgCl2
for 30 cycles of 30 s at 94 C, 30 s at 50 C, and
1 min at 72 C. The resulting DNA fragment was
digested with EcoRI and HindIII and cloned into
pBluescript SKII() (Stratagene, La Jolla, CA, USA)
digested with the same enzymes using standard
methodologies.22
PCR of full-length MsPPO1 from alfalfa cDNA was
accomplished using the primers 5 -ATGGCATCTA
TCTCACCCCTTG-3 (sense) and 5 -TCAATCTT
CAAGCTCTATC-3 (antisense), KlenTaq LA
(Sigma, St Louis, MO, USA) and cDNA template
prepared from total RNA. cDNA was prepared using
Superscript III reverse transcriptase according to the
manufacturers protocol (Invitrogen, Carlsbad, CA,
USA) from DNase I-treated total RNA isolated from
MsPPO1-expressing transgenic alfalfa (described in
detail below).
1407
ML Sullivan, RD Hatfield, DA Samac
Library screening
Approximately 5 105 phage from an alfalfa genomic
library (derived from cultivar Saranac) in the Lambda
DASH II vector27 were plated and lifted to nylon or
nitrocellulose filters using standard protocols,22 then
screened by hybridization with a cloned 196 bp PPO
fragment derived by PCR (described above). This
screening procedure was repeated once for a total of
106 phage screened.
Overexpression of MsPPO1 in transgenic alfalfa
An MsPPO1 overexpression construct was prepared
in a manner analogous to that previously described
for red clover PPO genes13 using the primers 5 GGGGAATTCAAACAATGGCATCTATCTCACCCCTTG-3 (sense) and 5 -GGGGAATTCAGATCTTCAATCTTCAAGCTCTATC-3 (antisense)
to generate an MsPPO1 coding region fragment
by PCR from the cloned gene. These primers
incorporated the proposed dicot consensus sequence
AAACA28 immediately upstream of the initiating Met
codon and EcoRI restriction sites (underlined) to facilitate cloning behind the cassava vein mosaic virus
(CsVMV) promoter of the pILTAB 357 plant transformation vector.29 The cloned insert was sequenced
to ensure that no mutations were introduced that
would alter the sequence of the translated protein. The
MsPPO1 construct was transferred to Agrobacterium
tumefaciens strain LBA4404 and transformed into a
Regen-SY alfalfa clone as previously described.13,30,31
Putative transformants were initially screened for the
presence of the npt II gene by PCR as previously
described.32
Analysis of PPO-mediated browning, PPO
activity, protein accumulation, and proteolytic
inhibition
For PPO activity and immunoblots, leaf tissues
were extracted with 100 mmol L1 CH3 COONH4 ,
20 mmol L1 Tris, pH 7.5 (3 mL g1 fresh weight) and
protein content determined as previously described.13
For immunoblotting, a protease inhibitor cocktail
(P9599, Sigma) was included in the extraction buffer
according to the suppliers instructions. Flower and
seed pod protein samples were prepared by phenol
extraction as previously described.13 Browning assays
were carried out on plant leaf extracts by addition
of 100 mmol L1 o-diphenol solution in ethanol to
3 mmol L1 final concentration or ethanol to 3%
(v/v) as a negative control followed by incubation at
room temperature. PPO activity assays were carried
out essentially as described by Esterbauer et al.33 as
previously detailed,13 except assays were carried out
in 0.1 McIlvaines citratephosphate buffer, pH
7.0 (15 mmol L1 Na2 HPO4 , 2.3 mmol L1 citric
acid). For comparison of different PPO substrates,
data for a given extract were normalized to the
activity for catechol. Immunoblotting was carried out
using antiserum raised against red clover PPO1 as
previously described.13 Proteolysis in leaf extracts
1408
(protein content adjusted to 2 mg mL1 protein

with extraction buffer) was determined by measuring
the release of tricholoroacetic acid (TCA, 50 g L1 )
soluble amino acids and peptides over time using
previously described procedures.7 For quantitative
PPO activity and proteolytic inhibition experiments,
the results using two extracts prepared from different
leaf tissue samples harvested on different days were
averaged and error reported as standard error of the
mean (SEM). For comparison of two sample means,
statistical significance was determined using the t-test.
For comparison of more than two sample means,
data were subjected to single-factor ANOVA using
the statistical package of Excel (Microsoft Corp.,
Redmond, WA, USA) and Tukeys HSD post hoc
test.

Cloning and sequencing of a PPO gene from
alfalfa
Degenerate primers flanking the conserved CuA
copper binding site of several previously cloned
plant PPO genes, and previously used to amplify
approximately 200 bp PPO gene fragments from red
clover cDNA,13 amplified a DNA fragment of the
expected size from alfalfa clone P DNA. The 196
bp fragment was cloned and sequenced (Genbank
accession EU168793). The resulting nucleotide and
predicted protein sequences (excluding sequence
derived from the PCR primers), were used in BLASTn
and tBLASTn searches of the NCBI database.
Sequences with the highest probability matches
corresponded to PPO genes from a wide variety of
plant species, including red clover, Ipomoea batatas L.,
Malus domestica Borkh., and Triticum aestivum L., with
most showing 6070% amino acid identity. These
results suggested the gene fragment derived from the
PCR reaction corresponds to a polyphenol oxidase
gene. Interestingly, no high identity matches (i.e.,
>80%) with Medicago truncatula Geartn. ESTs or
genomic sequences were identified.
The 196 bp PCR fragment was used as a hybridization probe to screen an alfalfa genomic library.27 A
single hybridizing clone with an approximately 12 kbp
insert was obtained following a screen of approximately 5 105 lambda clones. By Southern blotting
of restriction enzyme-digested clone DNA followed
by hybridization with the PCR-derived probe, an
approximately 6 kbp EcoRI fragment containing the
hybridizing DNA sequence was isolated and subcloned
into a plasmid cloning vector. Sequence analysis indicated the 6 kbp EcoRI fragment contains an entire PPO
coding region as well as 1.2 kbp of upstream sequence
(Genbank Accession AY283062). This alfalfa PPO
coding region contains no introns, typical of PPO
genes isolated from dicotyledonous plants.34 The gene
(designated MsPPO1) is predicted to encode a protein of 607 amino acid residues (68.5 kDa) (Fig. 1).
Based on ChloroP23 and Signal P24 algorithms, the
J Sci Food Agric 88:14061414 (2008)
DOI: 10.1002/jsfa
Figure 1. Predicted amino acid sequence encoded by an alfalfa PPO gene, MsPPO1. Predicted cleavage sites for chloroplast transit and thylakoid
lumen signal peptides are indicated by open and filled arrowheads, respectively. The conserved CuA and CuB copper binding sites (starting at
amino acids 205 and 363, respectively) are underlined.
protein is predicted to be localized to the thylakoid

lumen following cleavage of a 69 amino acid transit
peptide and 26 amino acid signal peptide. Localization
of the protein to the thylakoid lumen would be similar to that observed for nearly all characterized PPO
proteins. If the alfalfa PPO protein is targeted to the
chloroplast thylakoid lumen as predicted, the mature
protein would be 512 amino acid residues (58.0 kDa).
The sequence of MsPPO1 isolated from the library
had only limited nucleotide sequence identity (70%,
excluding primer sequence) with the PCR-derived
gene fragment used for the screen. Screening of an
additional 5 105 genomic clones from the alfalfa
genomic library using the 196 bp PCR fragment failed
to identify a clone containing its corresponding gene,
although three additional clones identical or nearly
identical to MsPPO1 were identified. This result
suggests that the original PCR product amplified from
clone P alfalfa DNA was amplified from contaminating
DNA in the original DNA preparation or PCR
reactions, represents a PCR artifact, or is derived from
a divergent alfalfa gene not present in the genomic
library that was screened. That we were unable to
identify any potential homologs in searches of M.
truncatula sequence databases nor detect hybridzing
fragments in Southern blotting experiments with clone
P DNA (data not shown) suggests the 196 bp PCR
fragment does not represent an actual alfalfa PPO
sequence.
Using the 1824 bp coding region sequence from
the full-length MsPPO1 clone in BLASTn searches
of the NCBI Genbank database we identified an M.
truncatula BAC clone (Genbank accession AC157507,
clone mt2-78b21) containing two tandem PPO genes
with a high degree of sequence similarity to MsPPO1.
The first gene (from position 53 210 to 51 387) and the
second gene (from position 59 385 to 57 560) are 95%
and 88% identical to MsPPO1, respectively. The two
M. truncatula genes are 89% identical to each other.
We currently have no evidence of tandemly arranged
PPO genes in M. sativa, although Southern blotting
experiments using DNA derived from clone P and
Regen SY27 alfalfa genotypes indicate the presence of
multiple PPO genes (data not shown). In addition, a
J Sci Food Agric 88:14061414 (2008)
DOI: 10.1002/jsfa
BLASTn search of the TIGR M. truncatula gene index

with the full-length MsPPO1 coding region identified
a tentative consensus sequence (TC101697) sharing
91% sequence identity with MsPPO1. Interestingly,
TC101697 is not identical to either of the PPO
genes contained on mt2-78b21, although sequence
comparisons suggest TC101697 is comprised of
cDNAs originating from both genes. MsPPO1 shares a
high degree of sequence identity (82% over the coding
region) with Vicia faba PPO (Genbank accession
Z11702). MsPPO1 shares lower sequence identity
(70%) with PPO cDNAs and genomic clones from red
clover (Genbank accessions AY017302, AY017303,
AY01704, EF183483, EF183484), suggesting the red
clover PPOs may have diverged from the other legume
enzymes.
MsPPO1 is expressed in seedpods and flowers
We analyzed MsPPO expression in alfalfa by RNA
blotting and hybridization with a probe derived from
MsPPO1. Hybridization of a blot containing RNA
from young leaves, mature leaves, stems, flower
buds, flowers, seed pods 2 weeks post pollination,
and 3-day-old seedlings was carried out using an
in vitro-labeled RNA corresponding to a 1.5 kbp
XbaIHindIII fragment of the MsPPO1 coding
region. Hybridization and washes were at moderate
stringency (approximately 25 C below probe-target
Tm calculated according to Sambrook et al.22 ) to
detect MsPPO1 as well as any related PPO sequences.
RNA from leaves of transgenic alfalfa expressing
MsPPO1 under the control of a constitutive promoter
(detailed below) served as a positive control. Under
the hybridization and wash conditions used, PPO
transcripts of the expected size (approximately 2 kb)
were detected in developing seed pods, and to a lesser
extent flowers and flower buds (Fig. 2). No transcripts
of the approximate expected size of an MsPPO1
transcript were apparent in lanes corresponding to
leaves, stems, and seedlings. Although faint higher and
lower molecular weight bands are present in several
of the lanes, these bands are likely an artifact because
their locations on the blot correspond to ribosomal
RNA bands that had been visualized by ethidium
1409
Figure 2. Expression of MsPPO1 as detected by RNA blot

hybridization. Total RNA (5 g) from Regen SY alfalfa young leaves
(Y. Leaf), mature leaves (M. Leaf), stems, flower buds (F. Bud),
flowers, seed pods (Pod), or 3-day seedlings was used to make an
RNA blot. Seed pods (2 weeks post-pollination) and seeds were
produced by self-pollination. RNA (1 g) from leaves of genetically
modified MsPPO1-alfalfa (GM Leaf) served as a positive control.
Migration position of a 1.9 kb ribosomal RNA (detected on the
ethidium stained gel, not shown) is indicated by an arrow. To facilitate
comparison of expression levels, a 50-fold shorter exposure of the
GM Leaf sample is shown.
bromide staining of the original gel. These results are

consistent with a more limited expression analysis that
we previously carried out on RNA derived from tissues
of clone P alfalfa,16 in which PPO mRNA was detected
in seed pods and to a lesser extent flowers, but not
in leaves, stems, or apical shoots. The RNA blotting
results are also consistent with M. truncatula EST data.
Of 14 M. truncatula EST sequences with nucleotide
identity 90% to MsPPO1, seven are from a pod
wall library (representing 0.2% of the ESTs from this
library). Of the remaining seven ESTs, four are from a
drought-stressed plantlet library (representing 0.05%
of the ESTs from this library), and one each from
developing leaf, insect herbivory, and virus-infected
leaf libraries (representing approximately 0.01% of
the ESTs from each of these libraries). Together these
results suggest that under normal growing conditions
PPO genes are expressed at exceedingly low levels, if
at all, in alfalfa leaves.
MsPPO1 has low activity in leaves of genetically
modified alfalfa
Because alfalfa leaves and stems fail to express
MsPPO1 mRNA at levels detectible by RNA blotting
and alfalfa leaves have little if any detectible
endogenous PPO activity,13,17 19 we decided to
characterize the enzymatic activity of MsPPO1 by
ectopically expressing it in alfalfa leaves. Creation of
genetically modified alfalfa expressing MsPPO1 in its
leaves would also allow us to test whether endogenous
alfalfa PPO might be useful in preventing postharvest
proteolytic losses if it were expressed in leaves. The
entire coding region of MsPPO1 including plastidtargeting signals was inserted behind the CsVMV
promoter29,35 in a plant transformation vector, the
resulting construct was transformed into alfalfa, and 16
independent alfalfa transformants containing the npt II
selectable marker gene were identified. Protein extracts
1410
were made from leaves of the alfalfa plants transformed

with the MsPPO1 gene and used in quantitative assays
of PPO activity. Caffeic acid was used as a substrate
in this screening experiment since it had proven to be
among the best substrates for red clover PPOs.16,18
A leaf extract of alfalfa transformed with empty
vector (control alfalfa) served as a negative control.
For the 16 MsPPO1-transformed alfalfa analyzed
in this experiment, measured PPO activities were
indistinguishable from that of control alfalfa (0.04 nkat
mg1 in this experiment). Because enzyme activities
in leaf extracts of MsPPO1-transformed alfalfa were
not detectible above background in the quantitative
assay, we screened the plants for enzyme activity
using a more sensitive qualitative assay. MsPPO1transformed alfalfa or control alfalfa leaf extracts were
prepared and incubated at room temperature in the
presence of catechol, caffeic acid, or ()-epicatechin,
and color changes in the extracts characteristic of PPO
activity were observed (Fig. 3). These o-diphenols
were chosen because they are structurally diverse,
representing the simplest o-diphenol and two distinct
classes of naturally occurring o-diphenols (caffeic
acid derivatives and flavanol o-diphenols). Following
o-diphenol addition and incubation at 25 C, for
four of the MsPPO1-transformed alfalfa plants, color
changes were apparent after 16 h for all three
substrates. Maximum color development was observed
at 624 h. Extracts of the remaining MsPPO1transformed and control alfalfa extracts failed to
exhibit discernible color changes, even after 2-day
incubations. For the four MsPPO1-transformed alfalfa
plants that did have PPO activity based on this
assay (hereafter referred to as MsPPO1-alfalfa), the
length of time for color changes to become apparent
were substantially longer (several hours) than that
previously observed in leaf extracts of alfalfa expressing
TpPPO genes (25 min).13 Interestingly, we observed
slight darkening of MsPPO1-alfalfa leaf extracts
following a 3-day incubation in the absence of added
o-diphenol compared to extracts of control alfalfa (no
PPO transgene) or alfalfa expressing TpPPO1 (data
not shown), although the biological significance of this
observation is unclear. A plant consistently showing
the most rapid extract color changes in the presence of
added o-diphenol substrate, and hence the highest
levels of PPO activity, was used for the analyses
detailed below.
MsPPO1 protein accumulates as a truncated
form in genetically modified alfalfa leaves
The relatively low PPO activity detected in leaves of
MsPPO1-alfalfa could be due to low-level expression
of the transgene, poor accumulation of the active gene
product, or poor activity against the tested substrates
or under the conditions of the assay. To avoid the first
possibility, MsPPO1 was expressed from the CsVMV
promoter, which has been shown to direct high-level
expression of transgenes in alfalfa.29,35 An appropriately sized approximately 2 kb transcript corresponding to the MsPPO1 transgene was easily detected
J Sci Food Agric 88:14061414 (2008)
DOI: 10.1002/jsfa
Figure 3. Qualitative assay for PPO activity. Extracts of leaves of

MsPPO1- or control alfalfa (Cont.) were supplemented (+) with the
indicated o-diphenols at 3 mmol L1 . Extracts are shown following a
24 h incubation at 25 C. A non-supplemented MsPPO1-alfalfa
extract () incubated for 24 h is shown for comparison.
Figure 4. Immunological detection of MsPPO1 protein. An

immunoblot of 10 g protein from untransformed Regen SY alfalfa
leaves, flowers, or seed pods; or leaves of MsPPO1-alfalfa (GM Leaf)
was developed with anti-TpPPO1 antiserum. Red clover PPO1
expressed in Escherichia coli (TpPPO1, approximately 5 ng) served as
a positive control.13 An asterisk indicates the full-length mature
(lacking chloroplast targeting signals) TpPPO1 used to produce the
antiserum. Lower molecular weight bands in the TpPPO1 lane
correspond to truncation products that accumulate when the protein
is overexpressed in E. coli (Sullivan M, unpublished result).
in leaves of MsPPO1-alfalfa (Fig. 2), indicating the

MsPPO1 transgene is well expressed at the mRNA
level, accumulating to approximately 250-fold higher
levels than the endogenous transcript in seed pods. To
make sure that the MsPPO1 protein was accumulating
in transgenic plants, leaf extracts were fractionated on
SDS-PAGE and analyzed by immunoblotting using
anti-TpPPO1 antiserum,13 which cross-reacts with
PPOs from several dicot (Sullivan M, unpublished
data) and monocot (Anderson JV and Marita J, personal communication) species. As shown in Fig. 4, a
J Sci Food Agric 88:14061414 (2008)
DOI: 10.1002/jsfa
faint band running at approximately 54 kDa is associated with expression of the MsPPO1 transgene and is
close to the expected size (58 kDa) of the mature,
plastid targeted MsPPO1 gene product. However,
a much more intense band associated with expression of the MsPPO1 transgene corresponds to an
approximately 42 kDa protein. It is unlikely that this
42 kDa protein represents post-isolation cleavage of
the expected mature protein product since a protease
inhibitor cocktail was included in the buffer used to
prepare this protein extract. A faint band <18 kDa in
size is also present in the MsPPO1-alfalfa leaf extract
and could be the other cleavage product derived from
the expected full-length MsPPO1 protein. To rule out
the possibility that the MsPPO1 expression construct
contained a premature stop codon, we resequenced
the MsPPO1 coding region in the binary vector used
for the alfalfa transformation. We also sequenced a
PCR fragment of the entire MsPPO1 coding region
derived from MsPPO1-alfalfa leaf cDNA and found
no coding region mutations had been introduced during the transformation process. These results suggest
the 42 kDa form of MsPPO1 in the transgenic plants is
a truncated form produced in vivo from the full-length
protein. This 42 kDa form could represent the mature
form of the protein since similar truncation products
have been purified as active PPO from other plant
species.36 We have recently demonstrated that for red
clover PPOs expressed in alfalfa post-isolation proteolytic cleavage in alfalfa leaf extracts to a 45 kDa form
may be partly responsible for enzyme activation.17
Alternatively, the 42 kDa form of the alfalfa protein
could be the result of aberrant processing due to
high-level ectopic expression in leaves. If the protein
is being aberrantly processed, this might explain the
relatively low activity levels observed despite high levels of MsPPO1 mRNA and protein detected in the
genetically modified alfalfa.
In extracts of leaves from control plants not transformed with MsPPO1, a faint band of approximately 36 kDa molecular weight cross-reacting with
the TpPPO1 antibody was detected. It is not clear if
this represents a breakdown product of an endogenous
PPO protein or an unrelated alfalfa protein that fortuitously contains an epitope recognized by the red clover
PPO antiserum. Given the lack of MsPPO1 mRNA
detected in leaves, the latter explanation seems more
likely. We also examined extracts of alfalfa flowers and
seed pods, since these were the only tissues in which
we identified PPO1 mRNA. Faint bands co-migrating
with recombinant TpPPO1 (apparent molecular mass
of 65 kDa) and cross-reacting with TpPPO1 antiserum
were detected. It is not clear if these bands are the proteins translated from the mRNA observed in Fig. 2,
since the immunoblot band intensities for flowers and
seed pods are similar but the corresponding mRNA
levels are different. We cannot rule out the possibility
that the bands seen on the immunoblot for flower and
pod proteins are not related to PPO, and that actual
1411
alfalfa PPO protein in these tissues is below the limit

of detection in this experiment.
MsPPO1 activity is enhanced by sodium dodecyl
sulfate
Many PPO enzymes are activated by small amounts of
detergent or other denaturants. These agents presumably cause conformational changes in the enzyme that
allow substrates better access to the active site.37 We
assayed leaf extracts from control and MsPPO1-alfalfa
for PPO activity with caffeic acid, ()-epicatechin,
and catechol, in standard assay buffer or assay buffer
supplemented with 8.7 mmol L1 sodium dodecyl sulfate (SDS) to test for activation (Table 1). As in the
screening experiment described above, in standard
assay buffer (lacking SDS), PPO activity measurements for extracts of MsPPO1-alfalfa could not be
distinguished from those of control alfalfa for any of the
tested substrates (P > 0.05). This result underscores
the limitations of this quantitative assay with extremely
low activity levels, since the MsPPO1-alfalfa extracts
could mediate the substrate-dependent color changes
described above, whereas control alfalfa extracts could
not. Addition of SDS to the assay buffer resulted
in a slight increase in enzyme activity measurements
made for extracts of control alfalfa with catechol (P <
0.025), but values for caffeic acid and ()-epicatechin
were unchanged by SDS addition (P > 0.3). For control alfalfa extracts it is unclear what any of these
background values represent, since extract browning
is not seen in the presence of PPO substrate, even
with SDS addition (data not shown), and although
these background assay values are extract-dependent,
addition of more or less extract does not result in the
expected corresponding changes in measured activity (data not shown). In contrast to control alfalfa
extract, MsPPO1-alfafla extracts showed substantial
increases in PPO activity when assayed in the presence
of SDS. A high degree of variability was observed in
the SDS-activated measurements for MsPPO1-alfalfa
leaf extracts prepared from different tissue samples,
presumably due to uncontrolled environmental variables that affected enzyme accumulation. This high
degree of variability resulted in a relatively high Pvalue for the difference between non- and SDS-treated
MsPPO1 alfalfa extracts (0.07 < P < 0.09) despite
the obvious increase in activity. We have previously
observed similar high levels of variation when working with transgenic alfalfa expressing red clover PPO
genes from the CsVMV promoter, although normalizing activity data to a given substrate greatly reduces
variability between extracts of different tissue samples
expressing the same PPO.7,13,17 Using this approach
allowed us to evaluate the relative substrate specificities for MsPPO1 (Table 2). SDS-treated MsPPO1
activity for catechol and ()-epicatechin was approximately the same, although catechol may be favored
(P = 0.08), and about 10-fold higher than for caffeic
acid (P < 0.01). It is unclear what the natural substrates for MsPPO1 might be, but with its preference
for a flavanoid o-diphenol and seedpod expression
pattern, a role in the formation of condensed tannins
during seed development is an intriguing possibility
(e.g., see Dixon et al.38 ). Interestingly, the substrate
preference of activated MsPPO1 is different from
those of characterized red clover PPO gene products,
which seem to prefer caffeic acid over ()-epicatechin
and catechol.16,17 With the SDS-induced increase in
the enzyme activity measured for MsPPO1-alfalfa leaf
extracts, PPO activity levels approach those of freshly
prepared (and not SDS-activated) leaf extracts of
alfalfa expressing TpPPO1 from the CsVMV promoter (up to approximately 5 nkat mg1 ), although
additional activation of the clover enzyme in alfalfa
extracts results in a 5- to 10-fold increase in PPO
activity.13,17 This finding suggests the truncated form
of the protein accumulating in MsPPO1-alfalfa leaves
represents the active form of the enzyme.
MsPPO1 inhibits proteolysis in alfalfa extracts in
the presence of catechol
Previous studies utilizing red clover PPO1 (TpPPO1)
ectopically expressed in alfalfa indicated that even
relatively low levels of PPO activity can inhibit
postharvest proteolysis in alfalfa leaf extracts.7 To
determine whether MsPPO1 is capable of inhibiting
Table 2. Relative preference of SDS-activated MsPPO1 for various
substrates
Percent maximum activitya
Substrate
Catechol
()-Epicatechin
Caffeic acid
100a
74 9a
82
a Average of two experiments SEM. For each experiment, activities

for each substrate were corrected for background activity measured in
control alfalfa extract and normalized to the catechol value. Difference
marked with a is significant at P = 0.08. Other differences are
significant at P < 0.01.
Table 1. PPO activitiesa (nkat mg1 ) in MsPPO1- and control alfalfa leaf extracts without and with SDS
Without SDS
Substrate
Catechol
()-Epicatechin
Caffeic Acid
a
With SDS
MsPPO1
Control
MsPPO1
Control
0.09 0.01b
0.06 0.03b
0.05 0.04b
0.13 0.01a
0.11 0.01
0.07 0.05
4.22 1.69b
3.13 1.49b
0.43 0.17b
0.22 0.02a
0.15 0.03
0.07 0.05
Average of two experiments SEM. Differences within a row marked with the same letter are significant at P < 0.025 (a) and P < 0.10 (b).
1412
J Sci Food Agric 88:14061414 (2008)

DOI: 10.1002/jsfa

Table 3. Proteolysis in control, MsPPO1-, and TpPPO1-alfalfa extracts in the presence of various o-diphenols
Amino acid release (4 h), mol mg1a

Extract
Control
MsPPO1
TpPPO1
Amino acid release (20 h), mol mg1a
Caffeic
()-Epi
Catechol
Caffeic
()-Epi
Catechol
0.74 0.07a
0.69 0.04a
0.09 0.02
0.68 0.02a
0.57 0.11a
0.09 0.02
0.75 0.01
0.45 0.01
0.13 0.01
1.50 0.07a
1.41 0.08a
0.21 0.03
1.47 0.05a
1.35 0.22a
0.17 0.03
1.43 0.00
1.00 0.05
0.32 0.02
a Average of two experiments SEM. Data marked with the same letter within a column are not significantly different (P > 0.56). All other differences
within a column are significant (P < 0.025).
proteolysis in alfalfa extracts in the presence of PPO

substrate, leaf extracts of control and MsPPO1-alfalfa
were incubated at 37 C in the presence of 3 mmol L1
caffeic acid, ()-epicatechin, or catechol. An extract
of alfalfa expressing TpPPO17 served as a positive
control. These assays were carried out without SDS
activation, since during ensiling such extraordinary
steps would be impractical. Proteolysis was measured
as release of TCA-soluble amino acids after 4 and
20 h (Table 3). Trends at the 4 h and 20 h time
points were similar. As previously observed,7 in the
TpPPO1-alfalfa extract proteolysis was reduced by
>75% in the presence of any of the tested o-diphenols
relative to a control extract. While no significant
reduction in proteolysis was seen for MsPPO1alfalfa extracts in the presence of either caffeic acid
or ()-epicatechin (P > 0.5), a reduction in amino
acid release was observed when catechol was the
o-diphenol used. Although the reduction in proteolysis
seen for MsPPO1 was not as great as that seen for
TpPPO1, it was substantial given the relative lack
of quantifiable PPO activity of these extracts. This
finding underscores our previous observation that even
small amounts of PPO activity are capable of inhibiting
postharvest proteolysis.7 Although ()-epicatechin is
almost as good a substrate as catechol for SDS-treated
MsPPO1, it is unclear why it failed to significantly
reduce proteolysis in MsPPO1-alfalfa extracts. Many
factors may influence the efficacy with which a
given PPO-generated o-quinone results in proteolytic
inhibition (e.g., rate of quinone formation, relative
reactivity towards various nucleophiles, half-life, crosslinking potential). Until the roles these parameters
play in proteolytic inhibition are better understood, it
may be difficult to fully predict optimal PPO/quinone
combinations. The high levels of enzyme activity
available from TpPPO1 without additional activation
may be sufficient to allow proteolytic inhibition with a
wide variety of o-diphenol substrates.7 Unfortunately,
the relative lack of enzymatic activity and/or limited
substrate specificity of MsPPO1 make it, overall, less
effective at preventing postharvest proteolysis than its
red clover counterpart.
CONCLUSIONS
The properties of the MsPPO1 gene (e.g., natural
expression pattern limited to flowers and seed pods,
poor activity of the encoded enzyme in the absence
J Sci Food Agric 88:14061414 (2008)
DOI: 10.1002/jsfa
of activation against naturally occurring substrates

most likely to be available for an ensiling process)
make it a poor target for development of a PPO/
o-diphenol-based system of protein protection in
alfalfa. These results are consistent with a recent screen
of approximately 200 accessions of perennial Medicago
species for useful levels of foliar PPO activity against
caffeic acid, ()-epicatechin, and catechol.19 In that
screen, no accessions were identified with potential
for development of a PPO-based protein preservation
system. Together, these results suggest development
of a PPO-based protein protection system in alfalfa will
likely require the use of transgenic approaches (e.g.,
use of TpPPO1 as a transgene). Additionally, the
results reported here underscore the uniqueness of the
red clover PPOs among legume species with respect to
sequence, expression pattern, and enzymatic activities.
ACKNOWLEDGEMENTS
We thank Merici Evans Awe, Sara Zerbel, and Mindy
Dornbusch for excellent technical assistance, and
Dr George Schmitz for helpful comments on the
manuscript. Mention of trade names or commercial
products in this article is solely for the purpose
of providing specific information and does not
imply recommendation or endorsement by the US
Department of Agriculture.
REFERENCES
1 Sherman TD, Gardeur TL and Lax AR, Implications of the
phylogenetic distribution of polyphenol oxidase in plants, in
Enzymatic Browning and its Prevention, ed. by Lee CY and
Whitaker JR. American Chemical Society, Washington, DC,
pp. 103119 (1995).
2 Li L and Steffens JC, Overexpression of polyphenol oxidase in
transgenic tomato plants results in enhanced bacterial disease
resistance. Planta 215:239247 (2002).
3 Thipyapong P and Steffens JC, Tomato polyphenol oxidase:
differential response of the polyphenol oxidase F promoter
to injuries and wound signals. Plant Physiol 115:409418
(1997).
4 Nakayama T, Soto T, Fukui Y, Yonekura-Sakakibara K,
Hayashi H, Tanaka Y, et al, Specificity analysis and
mechanism of aurone synthesis catalyzed by aureusidin
synthase, a polyphenol oxidase homolog responsible for flower
coloration. FEBS Lett 499:107111 (2001).
5 Cho MH, Moinuddin SGA, Helms GL, Hishiyama S, Eichinger
D, Davin LB, et al, (+)-Larreatricin hydroxylase, an enantiospecific polyphenol oxidase from the creosote bush (Larrea
tridentata). Proc Natl Acad Sci USA 100:10 64110 646
(2003).
1413

6 Vamos-Vigyazo L, Polyphenol oxidase and peroxidase in fruits
and vegetables. CRC Crit Rev Food Sci Nutr 15:49127
(1981).
7 Sullivan ML and Hatfield RD, Polyphenol oxidase and
o-diphenols inhibit postharvest proteolysis in red clover and
alfalfa. Crop Sci 46:662670 (2006).
8 Rotz CA, Pitt RE, Muck RE, Allen MS and Buckmaster DR,
Direct-cut harvest and storage of alfalfa on the dairy farm.
Trans ASAE 36:621628 (1993).
9 Papadopoulos YA and McKersie BD, A comparison of protein
degradation during wilting and ensiling of six forage species.
Can J Plant Sci 63:903912 (1983).
10 Lee MRF, Winters AL, Scollan ND, Dewhurst RJ, Theodorou
MK and Minchin FR, Plant-mediated lipolysis and proteolysis
in red clover with different polyphenol oxidase activities.
J Sci Food Agric 84:16391645 (2004).
11 Dewhurst RJ, Shingfield KJ, Lee MRF and Scollan ND,
Increasing the concentrations of beneficial polyunsaturated
fatty acids in milk produced by dairy cows in high-forage
systems. Anim Feed Sci Technol 131:168206 (2006).
12 Lee MRF, Minchin FR, Hatfield RD and Sullivan ML, Red
clover polyphenol oxidase reduces ruminal lipolysis in in vitro
batch culture, in Proceedings of the British Society of Animal
Science, Southport, UK, p. 25 (2007).
13 Sullivan ML, Hatfield RD, Thoma SL and Samac DA, Cloning
and characterization of red clover polyphenol oxidase cDNAs
and expression of active protein in Escherichia coli and
transgenic alfalfa. Plant Physiol 136:32343244 (2004).
14 Yoshihara T, Yousikawa H, Sakamura S and Sakuma T,
Clovamides; L-DOPA conjugated with trans- and cis-caffeic
acids in red clover (Trifolium pratense). Agric Biol Chem
38:11071109 (1974).
15 Hatfield RD and Muck R, Characterizing proteolytic inhibition
in red clover silage, in XIIth International Silage Conference,
Swedish University of Agriculture and Sciences, Upsala,
Sweden, pp. 147148 (1999).
16 Sullivan M, Thoma S, Samac D and Hatfield R, Cloning of red
clover and alfalfa polyphenol oxidase genes and expression
of active enzymes in transgenic alfalfa, in Molecular Breeding
of Forage and Turf, ed. by Hopkins A, Wang ZY, Mian R,
Sledge M and Barker R. Kluwer, Dordrecht, pp. 189195
(2004).
17 Schmitz GE, Sullivan ML and Hatfield RD, Three polyphenol
oxidases from red clover (Trifolium pratense) differ in
enzymatic activities and activation properties. J Agric Food
Chem 56:272280 (2008).
18 Jones BA, Hatfield RD and Muck RE, Screening legume forages
for soluble phenols, polyphenol oxidase and extract browning.
J Sci Food Agric 67:109112 (1995).
19 Sullivan ML and Bringe A, A plate-based browning assay to
screen alfalfa germplasm for polyphenol oxidase activity and
o-diphenols, in 2004 Research Report, US Dairy Forage
Research Center, Madison, WI, pp 1315 (2005).
20 Bingham ET, Registration of alfalfa hybrid Regen-SY
germplasm for tissue culture and transformation research.
Crop Sci 31:1098 (1991).
21 Dilkova M and Bingham ET, Microsporogenesis of alfalfa
cultivars and selected genotypes. http://www.medicagoreports.org/pdfs/microsporogenesis.pdf [17 October 2007].
1414
22 Sambrook J, Fritsch EF and Maniatis T, Molecular Cloning: A

Laboratory Manual. Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, NY (1989).
23 Emanuelsson O, Nielsen H and von Heijne G, ChloroP,
a neural network-based method for predicting chloroplast
transit peptides and their cleavage sites. Prot Sci 8:978984
(1999).
24 Nielsen H, Engelbrecht J, Brunak S and von Heijne G, Identification of prokaryotic and eukaryotic signal peptides
and prediction of their cleavage sites. Prot Eng 10:16
(1997).
25 Chang S, Puryear J and Cairney J, A simple and efficient method
for isolating RNA from pine trees. Plant Mol Biol Rep
11:113116 (1993).
26 Newman TC, Ohme-Takagi M, Taylor CB and Green PJ, DST
sequences, highly conserved among plant SAUR genes, target
reporter transcripts for rapid decay in tobacco. Plant Cell
5:701714 (1993).
27 Gregerson RG, Miller SS, Petrowski M, Gantt JS and Vance
CP, Genomic structure, expression and evolution of the alfalfa
aspartate aminotransferase genes. Plant Mol Biol 25:387399
(1994).
28 Joshi CP, Zhou H, Huang XQ and Chiang VL, Context
sequences of translation initiation codon in plants. Plant Mol
Biol 35:9931001 (1997).
29 Verdaguer B, de Kochko A, Beachy RN and Fauquet C,
Isolation and expression in transgenic tobacco and rice plants,
of the cassava vein mosaic virus (CVMV) promoter. Plant Mol
Biol 31:11291139 (1996).
30 Austin S, Bingham ET, Matthews D, Shahan M, Will J and
Burgess RR, Production and field performance of transgenic
alfalfa expressing alpha-amylase and manganese-dependent
lignin peroxidase. Euphytica 85:381393 (1995).
31 Samac DA and Austin-Phillips S, Alfalfa (Medicago sativa L.),
in Agrobacterium Protocols (2nd edn), ed. by Wang K. Humana
Press, Totowa, NJ, pp. 301311 (2006).
32 Saruul P, Srienc F, Somers DA and Samac DA, Production of
a biodegradable plastic polymer, poly-beta-hydroxybutyrate,
in transgenic alfalfa. Crop Sci 42:919927 (2002).
33 Esterbauer H, Schwarzl E and Hayn M, A rapid assay for
catechol oxidase and laccase using 2-nitro-5-thio benzoic
acid. Anal Biochem 77:486494 (1977).
34 Gooding PS, Bird C and Robinson SP, Molecular cloning and
characterisation of banana fruit polyphenol oxidase. Planta
213:748757 (2001).
35 Samac DA, Tesfaye M, Dornbusch M, Saruul P and Temple SJ, A comparison of constitutive promoters for expression
of transgenes in alfalfa (Medicago sativa). Transgenic Res
13:349361 (2004).
36 Eicken C, Zippel F, Buldt-Karentzopoulos K and Krebs B,
Biochemical and spectroscopic characterization of catechol
oxidase from sweet potatoes (Ipomoea batatas) containing a
type-3 dicopper center. FEBS Lett 436:293299 (1998).
37 Jimenez M and Garcia-Carmona F, The effect of sodium
dodecyl sulfate on polyphenol oxidase. Phytochemistry
42:15031509 (1996).
38 Dixon RA, Xie DY and Sharma SB, Proanthocyanidins: a final
frontier in flavonoid research? New Phytol 165:928 (2005).
J Sci Food Agric 88:14061414 (2008)

DOI: 10.1002/jsfa
J Sci Food Agric 88:14151422 (2008)
Application of surface response

methodology to optimize hydrolysis of
wheat gluten and characterization of selected
hydrolysate fractions
1 and Mara C An on
2,3
Silvina R Drago,1,3 Rolando J Gonzalez
de Tecnologa de Alimentos, FIQ-UNL, 1 de Mayo 3250 (3000) Santa Fe, Argentina
calle 47 y 116, La Plata, Argentina
3 CONICET
1 Instituto
2 CIDCA
Abstract
BACKGROUND: The aim of this work was to optimize the hydrolysis experimental conditions to obtain wheat
gluten hydrolysates and to characterize fractions from hydrolysates with different hydrolysis degrees in order to
develop protein functional ingredients. Surface response methodology was used to analyze the effect of reaction
factors on the degree of hydrolysis to assess the conditions for maximum fungal protease enzyme activity.
Hydrolysates having three different trichloroacetic acid indices (TCAI) were prepared. Soluble fractions at pH 4,
6.5 and 9 from these hydrolysates were characterized by electrophoresis, reverse-phase high-performance liquid
chromatography, free amino group content and peptide chain length.
RESULTS: Temperature and pH ranges for highest enzyme activity at 2.5 h were 5458 C and 4.24.4, respectively.
Hydrolysate fraction composition differs according to the hydrolysis degree and extracting pH, the difference being
more pronounced at low TCAI. Hydrolysate having 32% TCAI is composed of peptides whose size is lower than
18.5 kDa, with an average peptide chain length of 14 amino acid residues.
CONCLUSION: The combination of hydrolysis degree and pH of extraction allows fractions of different peptide
composition to be obtained, which could be taken into account when trying to find a defined composition related
to determined functional characteristics.
Keywords: hydrolysis; wheat gluten; enzymes; experimental design; surface response methodology
INTRODUCTION
Gluten is one of the products obtained from the wheat
wet milling process, which consists of several steps:
hydration of flour, gluten formation, washing and
drying the final vital gluten under mild conditions,
which ensures that the unique viscoelastic properties
are retained.
It is particularly used to improve commercial wheat
bread flours of average quality and, also, to reinforce
viscoelastic properties in special formulations1,2 that
require functional properties related to viscoelasticity
or gluten vitality.3 Due to the relative low price of
gluten in comparison with other protein ingredients,
there is interest in expanding the scope of gluten
application by means of structural transformations
which could provide other functional properties.
Hydrolysis is one of the alternatives that allow
protein modification, which can be carried out either
by chemical (acid or alkaline), physical, or enzymatic
methods, the latter having remarkable advantages over
the traditional chemical one.4,5 Although different

food-grade proteases can be used, the only information
usually available is that offered by the manufacturer,
which is limited to conditions of use based on
tests carried out on a standard substrate, the
structural characteristics of which differ from those
corresponding to the protein system under study.
By controlling the reaction conditions during enzymatic hydrolysis, hydrolysates of various characteristics can be obtained. The degree of protein hydrolysis
depends on the hydrolysates expected use,6,7 and low
degrees of hydrolysis are required in order to maintain
functional properties.8,9
The aim of the present work was to optimize
the hydrolysis experimental conditions to obtain
wheat gluten hydrolysates using surface response
methodology and to characterize fractions from
hydrolysates with different hydrolysis degrees in order
to develop functional protein ingredients.
Correspondence to: Silvina R Drago, Instituto de Tecnologa de Alimentos, FIQ-UNL, 1 de Mayo 3250 (3000) Santa Fe, Argentina
E-mail: sdrago@fiq.unl.edu.ar
(Received 11 October 2007; revised version received 6 February 2008; accepted 7 February 2008)

SR Drago, RJ Gonzalez, MC An on
EXPERIMENTAL
The enzyme used in the experiments, provided by
Genencor SA (Arroyito, Cordoba,

Argentina), is a
fungal protease derived from Aspergillus oryzae (31 000
HU g1 ). The activity is expressed in hemoglobin
units, where 1 HU is that activity which will liberate
0.0447 mg of non-protein nitrogen in 30 min under
the conditions of the assay (denatured hemoglobin,
pH 4.7; T : 40 C). The enzyme is a mixture
of endo/exopeptidases whose characteristics are as
follows: effective pH 3.59, optimum pH 4.35;
temperature range 3050 C.
Commercial vital gluten, provided by Molinos
a, Santa Fe, Argentina) was
Semino SA (Carcaran
used as a substrate. Gluten composition was as follows:
moisture 5.95% (AACC 44-15A method);10 protein
(N 5.7) 77.20% dry basis (d.b.) (KjeldahlAACC
46-11 method);10 starch 13.15% d.b. (Ewers polarimetric method); ether extract 0.71% d.b. (AACC
30-25 method);10 and ash 0.834% d.b. (ICC No.
104IRAM No. 15 851, standard technique).
additional two central points). Time was kept constant

(2.5 h). The data obtained were modeled by a
second-degree polynomial function. In every case,
hydrolysis was carried out in a laboratory batch
system with temperature and agitation control. Protein
concentration was 5% and enzyme/substrate (E/S)
ratio 3%, pH being adjusted with HCl or NaOH, as
necessary. A parallel reaction blank was carried out.
Thermal treatment of vital gluten

In order to disperse vital gluten in water and secure
a uniform suspension, a moderate thermal treatment
was carried out. Vital gluten was placed in screw-cap
cylindrical tubes (16 mm diameter) which were placed
in a boiling water bath for 15, 25 and 35 min. The
sample was then cooled by placing the tubes in a
21 C water bath. To estimate the thermal treatment
intensity, the impact on the viscoelastic properties of
each sample was analyzed by means of an alveogram,
carried out with a Chopin alveograph (Paris, France),
which used a glutenstarch mixture as a model. The
thermal treatment time was selected based on the
capacity of the treated gluten to form a uniform
dispersion, considering the alveogram as an indicator
of thermal treatment intensity.
Enzyme/substrate ratio
The conditions selected from the experimental design
were pH 4.25 and temperature 55 C and substrate
concentration [S] was 5%. The E/S ratios under study
were 1.87%, 3%, 3.75%, 5% and 10% (w/w). TCAI
was determined by using the Lowry et al. technique12
to measure protein concentration.
Effect of operating variables on degree of

hydrolysis as studied by experimental designs
Surface response methodology was used to analyze the
effect of reaction factors (pH, temperature and time)
on the degree of hydrolysis with two experimental
designs.11 Experimental design 1, central composite
blocked cube star, consisted of a total of 20
experiments which included 15 treatments with an
additional five central points. Reaction factor levels
were selected by taking into account the pH and
temperature data supplied by the manufacturer, and
the time, which ranged between 2 and 5 h, considering
a time variation between each experimental level
sufficient to show the difference between each
treatment. In order to be more precise in the
assessment of maximum enzyme activity for this
particular substrate, a second experimental design
was used, central composite design 22 + star, using
pH (between 3 and 5) and temperature (between
35 and 55 C) as independent variables, with a
total of 11 experiments (nine treatments with an
1416
Hydrolysis reaction progress

The progress of hydrolysis was followed by means
of the trichloroacetic acid index (TCAI), using TCA
20% and diluting the sample in a 1:1 ratio. N was
measured by the SemimicroKjeldahl method. The
TCAI, which was used as an indirect measurement of
degree of hydrolysis (DH), was calculated as follows:
TCAI = [N soluble in TCA (hydrolysate)
N soluble in TCA (blank)
100]/total aminic N
Preparation of hydrolysates
Hydrolysates were prepared in a 5 L batch reactor with
agitation, using a thermostated bath kept at a constant
temperature of 55 C. HCl (3 mol L1 ) was added in
order to maintain a constant pH of 4.25. A protein
concentration of 8% (w/w) and E/S ratio of 5% were
used. Hydrolysates were obtained at different reaction
times: 31 min, 2 h and 6 h. Enzyme inactivation was
carried out at 70 C for 15 min. The hydrolysates were
frozen at 20 C and lyophilized.
Preparation of fractions at different pH
In order to obtain hydrolysate fractions at different pH
(4, 6.5 and 9), a 2% (w/w, d.b.) solution of the different
hydrolysates was prepared.13 The pH was achieved by
adding 0.8 mol L1 HCl or 0.8 mol L1 NaOH. The
samples were stirred for 1 h at room temperature,
and then centrifuged for 15 min at 8000 g at room
temperature. The supernatant (the extract at each pH)
was frozen and protein content determined using the
semimicroKjeldahl method.
Characterization of soluble fractions at different
pH of thermally treated gluten (TTG) and
hydrolysates
Sodium dodecyl sulfatepolyacrylamide gel electrophoresis
(SDS-PAGE) (EF)
Electrophoresis was performed according to
Laemmli,14 in a 415% gradient buffer system using a
J Sci Food Agric 88:14151422 (2008)
DOI: 10.1002/jsfa
Wheat gluten hydrolysates and characterization of selected fractions
Mini-Protean II electrophoresis cell (Bio-Rad, Hercules, CA, USA) with a Model 200/2.0 Bio-Rad
source. The gel plates were fixed and stained with
a solution containing 0.125% Coomassie Blue R250, 50% methanol and 10% acetic acid in water.
The pH extracts were mixed with sample buffer
containing stacking buffer, glycerol and Bromophenol Blue, using a 1.33 dilution, with or without 5%
-mercaptoethanol. The mixtures were heated in a
boiling bath for 90 s and loaded.
Reverse-phase high-performance liquid chromatography
(RP-HPLC) of extracts
The extracts were diluted to a protein concentration
(N 5.7) of 2.5 mg mL1 . A Sephasil peptide C8
column of 12 m ST 4.6/250 (Pharmacia Biotech,
Piscataway, NJ., USA) was used, together with
an auto injector Waters 717 Plus Auto sampler
(Millipore, Billerica, MA, USA), a Waters 600 E pump
(multisolvent delivery system, Millipore), and a diode
array detector (Waters 996, Millipore). Peptides were
separated and eluted at 1.1 mL min1 , at 60 C, using
the following buffers: buffer A: acetonitrilewater
2:98, with 650 L L1 trifluoroacetic acid (TFA);
buffer B: acetonitrilewater 65:35 with 650 L L1
TFA, and detected at 210 nm. Since elution profiles
of RP-HPLC can be grouped into categories according
to increasing hydrophobicity of the eluted peptides,15
chromatogram analysis was carried out by integrating
peak areas in three sections of each chromatogram:
(a) components of low molecular weight and low
hydrophobicity: 020 min of elution range;
(b) components of medium molecular weight and
medium hydrophobicity: 2040 min of elution
range;
(c) components of high molecular weight and high
hydrophobicity: 4060 min of elution range.
Results were expressed as a percentage of each section
with respect to the total area.
Determination of free amine group content
The o-phthaldialdehyde (OPA) technique16 was used
for this purpose. Free amine group content was used to
calculate the number of peptide bonds cleaved during
hydrolysis.
Estimation of peptide chain length (PCL)
PCL can be estimated by means of the following
expression:17
PCL (soluble fraction) = 100 S/(h/htot )%
where htot is the total number of peptide bonds in
the protein substrate (8.3 mEq g1 protein), h is the
number of peptide bonds cleaved during hydrolysis,
and S is the fraction of soluble proteins.
J Sci Food Agric 88:14151422 (2008)
DOI: 10.1002/jsfa
Software Statgraphics Plus 3.0 was used for statistical
analysis. The effect of variables on TCAI was
analyzed by response surface methodology and the
least significant difference (LSD) test was used
to determine statistical differences among samples
(p < 0.05).

Thermal treatment of vital gluten
Table 1 shows the alveographic test results. A
significant increase in gluten strength (P) is observed,
even with slight thermal treatment (15 and 25 min).
These results are in agreement with those reported
by Jeanjean et al.18 and Autran and Berrier.19
Thermal treatment also produced a decrease in
total absorbed energy (W ) and in the swelling
index (G). Values corresponding to 15 and 25 min
samples were similar; however, a 35 min treatment
proved excessive, which explains the P drop and
also indicates a decrease in dough-forming ability.
The increase in P/G ratio at the beginning of
the thermal denaturation process is related to the
decrease in cohesivity. These results indicate that
the decrease in gluten-forming ability caused by heat
treatment is better described by G and W . Gluten
treated for 25 min produced an alveographic diagram
similar to that frequently observed in wheat samples
taken from silos with overheating.20 The loss of
gluten bread-making quality could be associated with
the formation of aggregates between the different
protein fractions,21 which could be the result of
polymerization by sulfhydryldisulfur interchange.22
The selected thermal treatment was 25 min, since
better gluten dispersion was obtained when compared
with that corresponding to 15 min, which seems to
be insufficient for an easy dispersion, and also with
25 min treatment gluten is not over-treated as in the
case of 35 min treatment.
Effect of operating variables on degree of
hydrolysis as studied by experimental designs
Table 2 shows the results of TCAI corresponding to
the central composite blocked cube star experimental
design. It is observed that the highest TCAI value
was obtained for one extreme of the design (pH 3.8
and 40 C) and the lowest ones were around pH 6.5
Table 1. Alveographic test
Sample
Vital gluten
15 min gluten
25 min gluten
35 min gluten
P/G
172c
135b
135b
35a
82b
111c
119d
71a
15.5c
11b
10b
8.5a
5.29a
10.1c
11.9d
8.35b
W, total absorbed energy; P, strength; G, swelling index; P/G,

alveographic equilibrium index.
For each column, different letters represent significant differences
between the samples (p < 0.05).
1417

Experiment no.
pH
Temp. ( C)
Time (h)
TCAI
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
6.5
8.0
8.0
5.0
5.0
6.5
5.0
8.0
8.0
5.0
6.5
6.5
6.5
9.2
6.5
6.5
3.8
6.5
6.5
6.5
40
32
32
48
48
40
32
48
48
32
40
40
25.5
40
54.5
40
40
40
40
40
3.5
2.0
5.0
2.0
5.0
3.5
5.0
2.0
5.0
2.0
3.5
3.5
3.5
3.5
3.5
3.5
3.5
6.21
0.79
3.5
3.29
0.44
1.05
11.20
17.00
2.60
9.65
0.70
1.35
4.62
2.42
2.22
1.07
0.90
5.30
2.85
17.08
3.56
0.73
2.96
Standardized Pareto Chart for TCAI

A:pH
AA
B:Temp.
AB
C:time
AC
BB
BC
CC
0
12
16
20
24
Standardized effect
Figure 1. Pareto chart corresponding to central composite blocked
cube star experimental design. [S] = 5%, E/S = 3%; TCAI,
trichloroacetic acid index.
TCAI
Table 2. Results of TCAI corresponding to the central composite

blocked cube star experimental design. [S] = 5%, E/S = 3%
30
25
20
15
10
5
0
3.5 4 4.5 5 5.5 6 6.5 7
7.5 8 8.5 9 9.5
pH
50 55
40 45
35
Temp C
25 30
Figure 2. Surface response for TCAI as a function of pH and

temperature, for 3.5 h, corresponding to central composite blocked
cube star experimental design. [S] = 5%, E/S = 3%; TCAI,
trichloroacetic acid index.
or higher. The Pareto chart (Fig. 1) shows that pH

is the variable of highest impact, both in its linear
and quadratic term. The effects of the three variables
were significant, particularly in the case of the linear
terms, the pH quadratic term and the interactions
pH temperature and pH time. The time quadratic
term and interaction time temperature, on the
contrary, were not significant (P < 0.05). Figure 2
shows the response surface for TCAI as a function
of pH and temperature, for 3.5 h. A minimum TCAI
was observed around 6.57.5 and low temperature.
Bombara,23 working with wheat flour, reported similar
TCAI values at 54 C, pH 6.5 and time less than 6 h.
However, Adler-Nissen,17 working with soy protein
and an enzyme derived from A. oryzae, found that
the DH obtained at pH 7 was similar to that at
pH 5. In the present work, the TCAI obtained
for pH 7 is surprisingly lower than that at pH 5,
this difference being probably due to the fact that
experiments were carried out with different substrates
and also a different method of measuring DH.
Gluten isoelectric point is around pH 7, which favors
molecular association by hydrophobic interactions,
and makes them less susceptible to enzymatic attack
by aggregate formation. According to the results
obtained, the highest TCAI values will be obtained
in the pH range between 3.7 and 5.
Table 3 shows the results of TCAI corresponding
to the central composite design 22 + star. Analysis of
variance showed that the two variables were significant
in every term and that the correlation coefficient was
r = 0.9907. Figure 3 shows the surface response for
TCAI as a function of pH and temperature, and shows
a maximum around pH 4.24.4 and at 54 and 58 C.
1418
Table 3. Results of TCAI corresponding to the central composite

experimental design 22 + star. [S] = 5%, E/S = 3%
Experiment no.
1
2
3
4
5
6
7
8
9
10
11
pH
Temp. ( C)
TCAI
4.25
3.0
3.0
5.5
5.5
4.25
4.25
4.25
2.48
6.02
4.25
45
35
55
35
55
45
30.9
59.1
45
45
45
17.600
12.484
12.630
3.886
13.568
17.466
8.500
20.036
9.060
3.860
17.000
The polynomial corresponding to this experimental

design was
TCAI% = 46.5172 + 19.1734 pH + 0.842979
Temperature 3.44202 pH2 + 0.19072 pH
Temperature 00 147 418 Temperature2
According to the information given by the manufacturer, the operating conditions (pH and temperature)
of this enzyme include conditions at which very
low activity was observed in the present work. This
underlines the importance of checking the operating
conditions for each particular enzymesubstrate system; surface response methodology could be used to
find the best conditions.
J Sci Food Agric 88:14151422 (2008)
DOI: 10.1002/jsfa

Table 4. Solubility of gluten hydrolysates and thermally treated gluten
(TTG)
20
TCAI
16
12
pH
TTG
4.0
6.5
9.0
58.04 0.41d
5.88 0.13h
25.58 0.88g
TCAI 14%
4.0
6.5
9.0
80.47 0.28a,b
35.87 0.06f
57.77 0.37d
TCAI 22%
4.0
6.5
9.0
81.01 0.50a
53.74 0.32e
73.88 0.63c
TCAI 32.6%
4.0
6.5
9.0
77.58 0.16a,b
67.54 0.69b,c
79.94 0.06a
8
4
0
3
3.5
4.5
5.5
35
40
45
50
55
60
Temp. C
pH
Figure 3. Surface response for central composite experimental
design 22 + star. [S] = 5%, E/S = 3%; TCAI, trichloroacetic acid
index.
Selection of E/S ratio

Figure 4 shows the hydrolysis curves corresponding to
different E/S ratios at pH 4.25 and 55 C, expressed as
percentage (%w/w). It is observed that TCAI increases
with an increase in E/S. However, when selecting the
enzyme concentration to reach a particular degree
of hydrolysis, the relationship effectivenesseconomy
has to be taken into account. A higher enzyme
concentration could be used in order to increase
hydrolysis rate, but in this case a cost analysis of
raw material versus reaction rate should be carried
out. In our case, a 5% E/S ratio was chosen because
it was considered to be a reasonable ratio, although
with products having a high added value (for example,
peptides with specific functions) a higher E/S ratio
could be selected.
Analysis of hydrolysates and solubility
Three hydrolysate samples were prepared under the
conditions previously selected (pH, temperature and
E/S) for times 0.5, 2 and 6 h and their TCAI were
14%, 22% and 32.6%, respectively.
Table 4 shows the protein solubilities corresponding
to thermally treated gluten and the three hydrolysates.
At pH 6.5 (isoelectric point region), hydrolysate
solubility was always lower than that corresponding
30
25
TCAI
20
15
10
5
0
0
20
40
60
Time (min)
1.87%
3%
3.75%
5%
10%
Figure 4. Effect of E/S ratio (%w/w) on TCAI; [S] = 5%, pH = 4.25,

T = 55 C; TCAI, trichloroacetic acid index.
J Sci Food Agric 88:14151422 (2008)

DOI: 10.1002/jsfa
x SD
Samples
Different letters represent significant differences between the samples

(P < 0.05); x SD, mean of triplicate standard deviation.
to other pH values. The enzyme could hydrolyze

the protein, producing large-size polypeptides, whose
solubility is more pH dependent, together with small
peptides. The pH dependence could be associated
not only with the size of the peptides produced by
hydrolysis but also their net charge. Linares et al,15
working with wheat gluten hydrolysate (DH 1.4%,
measured as the increase in free amino groups),
observed that a pH increase from 4 to 6.5 produced
a decrease in the solubility of the more hydrophobic
peptides. Molecular size decrease allows hydrolysates
to be obtained which are more soluble than the
native proteins and within a wider pH range. The
solubility profile of the partially hydrolyzed protein
improves along the whole pH scale, being generally
higher with higher TCAI, since the protein does
not form large aggregates even at the isoelectric
pH. The solubility increase obtained from a limited
proteolysis is attributed to the formation of either
smaller and more hydrophilic polypeptide unities
or soluble hydrophobic peptides,24 as well as the
disruption of protein aggregates.25
Characterization of soluble fractions at different
pH of thermally treated gluten (TTG) and
hydrolysates
SDS-PAGE
When observing the electrophoresis pattern corresponding to non-hydrolyzed gluten (TTG) (Fig. 5(a),
lanes 4, 5 and 6), without mercaptoethanol (ME), a
diffuse stain can be observed for the extracts obtained
at the three pH values. These could be attributed
to the presence of protein aggregates distributed along
the range of the molecular weights (MW) under study.
When using ME (Fig. 5(b), lanes 4, 5 and 6) these
aggregates break up and form well-defined bands,
which show that disulfur bridges may be involved in
their formation. Moreover, pH has a marked influence
on the fractions of solubilized proteins. The extracts
at pH 4 and 9 treated with ME (Fig. 5(b), lanes 4 and
5) are formed by components of MW higher than 94
1419

and lower than 14.4 kDa, and the extract at pH 6.5

(Fig. 5(b), lane 6) is mainly formed by components
whose MW is around 43 and 14.4 kDa.
The differences between the fractions extracted at
pH 4 and 9 are particularly evident at MW ranging
between 67 and 30 kDa. According to Cornec et al,26
gliadins are present between fractions of 3040 kDa,
except for -gliadin, which is present in the fractions
rich in glutenins. Glutenins of high MW are present in
fractions of more than 50 kDa and those of low MW
are present within the range 4043 kDa. Fractions
lower than 20 kDa are non-storage proteins, but
membrane and lipid binding proteins.
The extracts at pH 9 and 4 from hydrolysate with
TCAI = 14.1% (Fig. 5(a), lanes 1 and 3, respectively)
have components of MW higher than 43 kDa which,
when treated with ME (Fig. 5(b), lanes 1 and 3),
show that they corresponded to subunits of MW
below 43 kDa, linked by disulfur bridges. That is, with
a low hydrolysis, the extracts at these pH showed
components of high MW, which corresponded to
glutenin fractions associated with SS, though already
hydrolyzed. The extracts at pH 4 and 9 have different
components between 40 and 30 kDa. In the case of
the pH 6.5 fraction (Fig. 5(b), lane 2) the extracted
(a)
kDa
94
67
43
30
20.1
14.4
(b)
polypeptides are mainly formed by monomers of MW

below 20.1 kDa, though showing an MW dispersion,
like those components of extracts at pH 9.
The extracts from hydrolysates with higher TCAI
(22% and 32.6%) had components whose MW are
higher than 43 kDa (electrophoresis without ME is not
shown), which correspond to SS bridge associations
of peptides whose MW is lower than 43 kDa for TCAI
22% and lower than 20.1 kDa for TCAI 32.4%. This
is shown in Fig. 6 for samples treated with ME. In
every case there seem to be components of 14.4 kDa,
which do not hydrolyze, since there is always a band
corresponding to that MW.
The extracts at pH 4 and 9 are similar but differ
from that at pH 6.5, the later lacks the components
corresponding to the 2040 kDa zone (ITCA 32.6%)
or have low quantities of them (TCAI 22%), this
probably being related to the presence of a limiting
peptide size for the enzyme action in the range of
hydrolysis degrees evaluated in this work.
Average peptide chain length
Figure 7 shows the average peptide chain length of the
soluble fraction. The extracts at pH 6.5 for the same
TCAI have the peptides with the smallest sizes. For the
hydrolysate with 32.6% TCAI, protein extractability
was not much affected by pH, and their extracts have
peptides of about 14 amino acid residues.
The way the enzyme acts can be seen with the PCL
measured at the pH corresponding to the isoelectric
point (pH 6.5) or pH 9, where the solubility of
the thermally treated gluten is low. PCL shows a
rapid decrease with progress of the enzymatic reaction
during the first 30 min. This increase is then slower,
which shows that soluble peptides are degraded during
hydrolysis until they reach a certain length. After
that, the enzyme would not act on them but on the
substrates of higher MW, which increases solubility.
Integrated areas of RP-HPLC
Figure 8 shows the integrated areas of RP-HPLC
chromatograms. The extracts at pH 6.5 have a higher
kDa
S
94
67
kDa
43
94
30
20.1
14.4
Figure 5. (a) EF-SDS-PAGE without mercaptoethanol of pH extracts

from thermally treated gluten (TTG) and hydrolysate (TCAI: 14%). S,
standard; 1, 14%pH 9; 2, 14%pH 6.5; 3, 14%pH 4; 4, TTGpH 9;
5, TTGpH 6.5; 6, TTGpH 4. (b) EF-PAGE-SDS with
mercaptoethanol of pH extracts from TTG and hydrolysate (TCAI:
14%). S, standard; 1, 14%pH 9; 2, 14%pH 6.5; 3, 14%pH4; 4,
TTGpH 9; 5, TTGpH 4; 6, TTGpH 6.5.
1420
67
43
30
20.1
14.4
Figure 6. EF-PAGE-SDS with mercaptoethanol of pH extracts from

hydrolysate (TCAI: 22% and 32.6%). S, standard; 1, 32.6%pH 9; 2,
32.6%pH 6.5; 3, 32.6%pH 4; 4, 22%pH 9; 5, 22%pH 6.5; 6,
22%pH 4.
J Sci Food Agric 88:14151422 (2008)

DOI: 10.1002/jsfa

40
35
30
PCL
25
20
15
g
g
10
5
0
0
10
20
30
40
TCAI (%)
pH 4
pH 6.5
pH 9
These results suggest that enzyme action on

gluten proteins reduced the size of gliadin and
glutenin molecules. The resulting hydrolysate varied
in composition with the degree of hydrolysis reached,
though in general peptide size distribution would not
be unimodal. At TCAI 32%, most of the hydrolysate is
composed of peptides whose size is less than 18.5 kDa,
with an average PCL of 14 amino acid residues. PCL
is useful to evaluate the hydrolysis process at pH values
at which the proteins have a low solubility. However, it
is important to point out that PCL does not represent
the average of a unimodal population, particularly at
low degrees of hydrolysis.
Figure 7. Average peptide chain length versus TCAI. Different letters

represent significant differences between the samples (P < 0.05).
CONCLUSIONS
Surface response methodology was used to find
the experimental conditions required for the highest
enzymatic activity for hydrolysis of wheat gluten by
fungal protease.
Fractions at different pH values had different
compositions, mainly at low TCAI (14% and 22%),
which could be taken into account when trying to find a
defined composition related to determined functional
characteristics.
70
% total Area
60
50
40
30
20
10
0-20 min
20-40 min
32
_
32 4
_6
.5
32
_9
22
_
22 4
_6
.5
22
_9
14
_
14 4
_6
.5
14
_9
G
TT
G _4
TT
_9
40-60 min
Figure 8. Area percentage of each eluate section (020, 2040 and

4060 min) with respect to the total area, corresponding to different
extracts at pH 4, 6.5 and 9 of hydrolysates (TCAI: 14%, 22% and
32.6%) and thermally treated gluten (TTG).
content of components with low hydrophobicity and

MW (020 min zone) compared to the other extracts,
which is in agreement with the lower PCL values
obtained.
As TCAI increases, the quantity of components with
average hydrophobicity and MW (2040 min zone)
increases, except at pH 6.5, where it decreases. It is
also observed that as TCAI increases there is a clear
decrease in hydrophobic components (4060 min
zone), though there are practically no changes for
pH 6.5 extracts. This could be attributed to the break
pattern of this protease. Since hydrolysis products
have components of high and low MW, at pH
6.5 the solubilized proteins would be poorer in
hydrophobic components of high MW, and richer in
components of low hydrophobicity, which is reversed
at TCAI 32.6%, when solubility increases. It is then
confirmed that during the first reaction stages (TCAI
14% and 22%) this enzyme hydrolyzes the protein,
generating components of high MW, the solubility of
which is more pH dependent, together with soluble
components of low MW. At TCAI 32.3%, the enzyme
generates peptides which are soluble (solubility higher
than 76%) and less pH dependent.
J Sci Food Agric 88:14151422 (2008)
DOI: 10.1002/jsfa
ACKNOWLEDGEMENTS
This work was partly supported by Proyecto CAI+D
2005-005-25, Universidad Nacional del Litoral, Santa
Fe, Argentina.
REFERENCES
1 Kalin F, Wheat gluten applications in Food Products. J Am Oil
Chem Soc 56:477479 (1979).
2 Pecquet C and Lauriere M, New allergens in hydrolysates of
wheat proteins. Rev Fr Allergol Inmmunol Clin 43:2123
(2003).
3 Popineau Y, Huchet B, Larre C and Berot S, Foaming and
emulsifying properties of fractions of gluten peptides obtained
by limited enzymic hydrolysis and ultrafiltration. J. Cereal Sci
35:327335 (2002).
MP, Gonzalez-Tello P and
4 Guadix A, Guadix E, Paez-Duenas
Camacho F, Procesos tecnologicos

y metodos de control en
la hidrolisis
de protenas. Ars Pharm 41:7989 (2000).
5 Loffler
A, Proteolytic enzymes: sources and applications. Food
Technol 40:6370 (1986).
6 Spellman D, McEvoy E, Cuinn GO and FitzGerald RJ, Proteinase and exopeptidase hydrolysis of whey protein: comparison of the TNBS, OPA and pH-stat methods for quantification of degree of hydrolysis. Int Dairy J 13:447453
(2003).
7 Mullally MM, OCallaghan DM, Fitzgerald RJ, Donnelly WJ
and Dalton JP, Zymogen activation in pancreatic endoproteolytic preparations and influence on some whey protein
hydrolysate characteristics. J Food Sci 60:227233 (1995).
8 Vioque J, Clemente A, Pedroche J, Yust MM and Millan F,
y aplicaciones de hidrolizados proteicos. Grasas
Obtencion
y Aceites 52:132136 (2001).
9 Lee JY, Duck H and Lee CH, Characterization of hydrolysates
produced by mild-acid treatment and enzymatic hydrolysis of
defatted soybean flour. Food Res Int 34:217222 (2001).
10 AACC, Approved Methods of the American Association of Cereal
Chemists (8th edn). AACC, St Paul, MN (1983).
1421

11 Cochran WG and Cox GM, Disenos experimentales. Trillas,
Mexico (1978).
12 Lowry OH, Rosenbrough NJ, Farr AL and Randall RJ, Protein
measurement with the Folin-phenol reagent. J Biol Chem
193:265 (1951).
13 Drago SR and Gonzalez RJ, Foaming properties of enzymatically hydrolysed wheat gluten. Innov Food Sci Emerg Technol
1:269273 (2001).
14 Laemmli UK, Cleavage of structural proteins during the
assembly of the head of bacterophage T4. Nature 227:680
(1970).
15 Linares E, Larre C and Popineau Y, Freeze or spray-dried
gluten hydrolysates. 1. Biochemical and emulsifying properties as a function of drying process. J Food Eng 48:127135
(2001).
16 Nielsen PM, Petersen D and Dambmann C, Improved method
for determining food protein degree of hydrolysis. J Food Sci
66:642646 (2001).
17 Adler-Nissen J, Enzymic Hydrolysis of Food Proteins. Elsevier
Applied Science, London (1986).
18 Jeanjean MF, Damidaux R and Feillet P, Effect of heat
treatment on protein solubility and viscoelastic properties
of wheat gluten. Cereal Chem 57:325331 (1980).
19 Autran JC and Berrier R, Durum wheat functional protein
subunits revealed through heat treatments: biochemical and
genetical implications, in Gluten Proteins: Proceedings of the
2nd International Workshops on Gluten Protein, Wageningen
1422
20
21
22
23
24
25
26
Netherlands, ed. by Graveland A and Moonen JEH,

pp. 175183 (1984).
Tosi E, Re E, Catalano O and Cazzoli A, Secado de trigo por
lecho fluidizado. Alim Latinoam 16(133):6180 (1982).
Lavelli V, Guerrieri N and Cerletti P, Controlled reduction study of modifications induced by gradual heating
in gluten proteins. J Agric Food Chem 44:25492555
(1996).
Schofield JD, Bottomley RC, LeGrys GA, Timms MF and
Booth MR, Effects of heat on wheat gluten, in Gluten
Proteins: Proceedings of the 2nd International Workshops on
Gluten Protein, Wageningen, Netherlands, ed. by Groveland
A and Moonen JHE, pp. 8190 (1984).
de las propiedades de la harina
Bombara N, Modificacion
de trigo mediante hidrolisis

enzimatica. Doctoral thesis,
Universidad de Mar del Plata (1995).
Linares E, Larre C, Lemestre M and Popineau Y, Emulsifying
and foaming properties of gluten hydrolysates with an
increasing degree of hydrolysis: role of soluble and insoluble
fractions. Cereal Chem 77:414420 (2000).
Masson P, Tome D and Popineau Y, Peptic hydrolysis of
gluten, glutenin and gliadin from wheat grain: kinetics and
characterization of peptides. J Sci Food Agric 37:12231235
(1986).
Cornec M, Popineau Y and Lefebvre J, Characterization of
gluten subfractions by SE-HPLC and dynamic rheological
analysis in shear. J Cereal Sci 19:131139 (1994).
J Sci Food Agric 88:14151422 (2008)

DOI: 10.1002/jsfa
J Sci Food Agric 88:14231430 (2008)
High-performance liquid
chromatography procedure for the
determination of flavor enhancers in consumer
chocolate products and artificial flavors
Charles H Risner and Melissa J Kiser
RJ Reynolds Tobacco Company, Bowman Gray Technical Center, Winston-Salem, NC 27102-1487, USA
Abstract
BACKGROUND: A number of individual high-performance liquid chromatography (HPLC) procedures exist
for the analysis of maltol, theobromine, ethyl maltol, catechin, vanillic acid, caffeine, vanillin, epicatechin, and
ethyl vanillin. A single procedure utilizing simple sample preparation and less sophisticated equipment would be
advantageous for the analysis of different sample types containing these compounds.
RESULTS: An HPLC procedure has been developed using water as the extract for consumer products and
artificial flavors. A methanolwater gradient was used to elute the compounds of interest using a reverse-phase
column. Absorbance detection using a wavelength of 273 nm was used to monitor the eluent. Recoveries for these
compounds ranged from 88% to 104%.
CONCLUSIONS: Results obtained for theobromine, catechin, caffeine, and epicatechin in Standard Reference
Material 2380 Baking Chocolate compare well with those found in its certificate of analysis verifying that the
procedure is valid. Vanillic acid and ethyl vanillic acid were found as oxidation products of vanillin and ethyl
vanillin in both standards and some consumer products.
Keywords: artificial flavors; consumer products; flavor enhancers; HPLC
INTRODUCTION
Several individual reverse-phase high-performance
liquid chromatography (RP-HPLC) procedures are
reported in the literature for the determination of flavor
enhancers: theobromine, theophylline, (+)-catechin,
caffeine and ()-epicatechin in chocolate;1 adenine,
theobromine, theophylline, and caffeine in cola beverages, tea, coffee, and cocoa;2 theobromine, theophylline, and caffeine in cocoa, coffee, tea, chocolate,
coconut water, and baking chocolate;3 5 theobromine
and caffeine in cocoa and chocolate products;6,7 (+)catechin and ()-epicatechin in cocoa beans, powders,
chocolates, and baking chocolate;8,9 theobromine, caffeine, and vanillin in a cocoa drink;10 and maltol and
ethyl maltol in beverages.11
Preparation of these samples includes extraction
in methanol,1,8 10 defatting with petroleum ether or
hexane prior to further sample treatment,2 7,9 and,
in some cases, solid-phase extraction.2,7 Although
amperometric,2 electrochemical,8 and mass selective
detection are used,9 most procedures employ more
common ultraviolet (UV) detection for the determination of the analytes.1,3 7,10,11
No single procedure exists for the simultaneous

determination of maltol, theobromine, ethyl maltol,
(+)-catechin, vanillic acid, caffeine, vanillin, ()epicatechin, and ethyl vanillin in consumer products
and artificial flavors used to enhance the flavor of
these products using RP-HPLC. Since all of these
compounds have some solubility in water, it was
decided to use water as the extract and avoid the use
of solvents such as petroleum ether or hexane for fat
removal and methanol to dissolve the compounds of
interest. Sample preparation consists of simple dilution
of the sample in water or warming the water extract
to melt the sample in the case of solid samples, after
which the extract is filtered prior to analyses. No solidphase extraction is used for sample preparation as is
done in other procedures where loss of the analyte can
occur.2,7 UV detection, which is more commonplace
in many laboratories, is employed for the analyses
of nine flavor enhancers. The method described here
has the capability of quantitatively determining maltol,
theobromine, ethyl maltol, (+)-catechin, vanillic acid,
caffeine, vanillin, ()-epicatechin and ethyl vanillin
from the water extract of consumer products and
artificial flavors.
Correspondence to: Charles H Risner, RJ Reynolds Tobacco Company, Bowman Gray Technical Center, Winston-Salem, NC 27102-1487, USA
E-mail: risnerc@rjrt.com
(Received 17 August 2007; revised version received 29 January 2008; accepted 30 January 2008)
CH Risner and MJ Kiser
EXPERIMENTAL
Samples
All consumer products were purchased from local
supermarkets in the United States in January 2006.
Dove milk chocolate, Dove dark chocolate, Hersheys
chocolate syrup, Hersheys chocolate milk, Tootsie
Roll and Swiss Miss Cocoa were selected as research
material. Proprietary formulations of commercially
available, artificially compounded cocoa/chocolate
flavors in propylene glycol were obtained from three
different suppliers. Standard Reference Material 2384
baking chocolate was purchased from the National
Institute of Standards and Technology (NIST)
Gaithersburg, MD, USA.
Chemicals and reagents
Adenine, maltol, theobromine, theophylline, ethyl
maltol, (+)-catechin hydrate (catechin), vanillic acid,
caffeine, vanillin, ()-epicatechin (epicatechin), and
ethyl vanillin were purchased from Sigma/Aldrich
(St Louis, MO, USA) and used as received.
In-house water was passed through a Nanopure
system which consisted of an organic removal
cartridge, two anion/cation mixed-bed cartridges,
a carbon and mixed-bed cartridge and a 0.20 m
filter (Barnstead/Thermolyne, Dubuque, IA, USA).
Methanol (MeOH) (Burdick & Jackson, Muskegon,
MI, USA) was used as a portion of the mobile
phase. Glacial acetic acid was purchased from Fisher
Scientific Company LLC, Suwanee, GA, USA.
Stock standard preparation
The stock standard concentrations were chosen so
as not to exceed their solubility in water. Stock
standards of adenine were prepared at 150 g mL1 ;
maltol 150 g mL1 ; theobromine 300 g mL1 ; theophylline 150 g mL1 ; ethyl maltol 1300 g mL1 ;
catechin 130 g mL1 ; vanillic acid 100 g mL1 ; caffeine 200 g mL1 ; vanillin 500 g mL1 ; epicatechin
130 g mL1 ; and ethyl vanillin 300 g mL1 in water.
The stock solutions and working standards were stored
at 5 C in the dark when not in use. The standards
were stable for at least 2 weeks when stored under
these conditions.
Extraction and sample preparation
Owing to the variation of analyte concentration in
the samples and their different molar absorptivities,
sample weights ranged from 0.001 to 1 g in the 5 mL
water extract (no constant ratio of sample weight
to water extract volume was used). The variation in
sample weight was done to keep the concentration of
the analytes in the range of the working standards.
Vortexing for 15 min (VWR VX-2500 Multi-Tube
Vortexer; Henery Troemner LLC, Thorofare, NJ,
USA) was used to extract the samples. NIST baking
chocolate, Dove milk chocolate and Dove dark
chocolate sample extracts were heated to 60 2 C
for 10 min in a water bath to melt the sample. After
extraction, the extract was then filtered using a 0.45 m
1424
pore size polyvinylidene fluoride Whatman Autovial

(Whatman, Clifton, NJ, USA) into a glass autosampler
vial which was sealed with a screw cap containing a
septum.
Spectrophotometer, HPLC system and
conditions
UV absorbance spectra were determined using an Agilent 8453 ultraviolet-visible absorbance spectrophotometer (Agilent Technologies Deutschland gmbH,
Waldbronn, Germany) of the standard compounds in
water to find the wavelength of maximum absorption
(max ) to be used for their detection.
The HPLC system consisted of a 680 gradient
controller, two 515 pumps, a 717 plus autosampler
and a 2487 absorbance detector (Waters, Milford,
MA, USA). Analysis was conducted using a 2.0 mm
150 mm, 5 m particle size Gemini C18 analytical
column preceded by a guard column containing a
Gemini C18, 2 mm cartridge (Phenomenex, Torrance,
CA, USA). The injection volume was 5 L and the
autosampler temperature set at 10 C. The absorbance
detector wavelength was set at 273 nm using different
sensitivity settings (absorbance units full scale, AUFS)
during and within a run to avoid saturation of the
detector or non-detection of the analyte. The mobilephase flow rate was 500 L min1 using a gradient
composed of 0.3% (volume fraction) acetic acid
(A) and MeOH (B). Initial conditions consisted of
85% A and 15% B (volume fractions) for 10 min, after
which the composition was changed to 75% A and
25% B and held for 8 min. After 18 min the mobile
phases were changed to 70% A and 30% B and held
for 7 min. This was followed by a column wash of
100% B for 5 min and a 5 min conditioning of the
column using 100% A prior to the next injection.
Data were acquired and results calculated in
mg kg1 using EZChrom Elite version 3.0.0 (Scientific
Software, Pleasanton, CA, USA).
Method validation procedures

Quantification was determined by injecting 5 L of
each sample extract into the high-performance liquid
chromatograph and the height of the peak observed at
the retention time corresponding to each authentic
standard was recorded. This value was used to
calculate the amount (mg kg1 ) of flavor enhancer
in the samples using the linear equation obtained from
the standard curve, the extract volume and sample
weight. Precision was obtained by analyzing each
sample at least three times. Recoveries and y-intercept
values from standard addition experiments were
determined in duplicate by spiking pure standards
at one half, one, and two times the amounts found in
the samples to the extract solutions prior to sample
analysis. All statistical and mathematical calculations
were done using Microsoft Excel 2003 (Microsoft
Corporation, Redmond, WA, USA).
J Sci Food Agric 88:14231430 (2008)
DOI: 10.1002/jsfa
HPLC method for flavor enhancers
the C18 columns using water as the mobile phase was

phase collapse, resulting in poor or no resolution after
only about 10 injections.12
The gradient described in the Experimental section
was chosen because 11 compounds found in consumer
products can be separated in a single run. Figure 1 is a
chromatogram of a composite standard containing the
11 analytes evaluated in this work. Adenine (Aden)
and theophylline (Theop) were not detected in the
samples analyzed as determined by comparison of
retention times with authentic standards and spiking
of the sample extract with solutions of authentic
standards.
Portions of the gradient may not be needed. For
example, after screening a sample extract, if only
maltol, theobromine, and ethyl maltol are observed
the first two segments of the gradient would only need
to be applied (85:15, 0.3% acetic acid:MeOH and
75:25, 0.3% acetic acid:MeOH). The 100% MeOH
column wash would be optional, depending on the
cleanliness of the sample extract, but may be included
to prevent phase collapse. The last segment of 100%
0.3% acetic acid may also be an option, but proved to
help better resolve early-eluting compounds such as
adenine.

Ultraviolet absorbance spectra
UV-visible spectra were obtained on standards
dissolved in water at a concentration of 10
1 g mL1 . Table 1 gives the max and the absorbance:
concentration ratios (AUFS/g mL1 ) of these compounds. Even though some of these compounds
do not have their maximum absorbance at 273 nm,
this wavelength was used for detection since a sufficient response was obtained. Other workers who
used UV absorbance detection for the determination
of these compounds used wavelengths from 273 to
280 nm.1,3 11
Columns and conditions evaluated
Initially, water was used as the mobile phase on
reverse-phase octadecylsilane (C18) columns using
column temperatures as high as 55 C. Caffeine was
strongly retained (>60 min) on the columns using
water as the mobile phase, but the main drawback of
Table 1. Wavelengths of maximum absorbance and
absorbance:concentration ratios of compounds evaluated in watera
AUFS/g mL1
261
272
273
271
275
279
257
273
279
279
279
0.0888
0.0651
0.0503
0.0574
0.0696
0.0127
0.0582
0.0521
0.0646
0.0124
0.0576
Instrument precision, linearity of response, limit

of detection, and limit of quantitation
Table 2 lists the instrument precision, linearity of
response, limit of detection (LOD), and limit of
quantitation (LOQ) of the standards used in this work.
The percent relative standard deviations (%RSD) were
less than 3%, except for catechin and epicatechin.
This may be due to the low sensitivity setting of
0.008 absorbance units full scale (AUFS) required to
detect catechin and epicatechin at these concentrations
due to their lower absorbance:concentration ratio at
273 nm (see Table 1).
max , wavelength of maximum absorption; AUFS, absorbance units

full scale.
a Concentration of 10 1 g mL1 .
Malt
1.0
0.5
Van
Vana
0.4
Caff
0.6
Theop
0.3
0.2
Cat
Absorbance Units
0.7
EtMalt
0.8
Theob
Aden
0.9
EtVan
Adenine
Maltol
Theobromine
Theophylline
Ethyl maltol
Catechin
Vanillic acid
Caffeine
Vanillin
Epicatechin
Ethyl vanillin
max (nm)
0.1
Ecat
Compound
0.0
-0.1
0
10 12 14 16 18 20 22 24 26 28 30 32 34
Min
Figure 1. Chromatogram of adenine (Aden), maltol (Malt), theobromine (Theob), theophylline (Theop), ethyl maltol (EtMalt), catechin (Cat), vanillic
acid (Vana), caffeine (Caff), vanillin (Van), epicatechin (Ecat), and ethyl vanillin (EtVan) standards in water. Conditions: Gemini C18
(2.0 mm 150 mm, 5 m); mobile phase gradient 0.3% acetic acid and MeOH at 500 L min1 ; injection volume 5 L; autosampler temperature
10 C; absorbance detection at 273 nm and 0.350 absorbance units full scale (AUFS); concentration of all components 10 1 g mL1 .
J Sci Food Agric 88:14231430 (2008)

DOI: 10.1002/jsfa
1425

Table 2. Instrument precision (n = 12), linearity of response, limit of detection and limit of quantitationa
Compound
Adenine
Maltol
Theobromine
Theophylline
Ethyl maltol
Catechin
Vanillic acid
Caffeine
Vanillin
Epicatechin
Ethyl vanillin
% Relative standard deviation
Concentration range (g mL1 )b
r2
LOD (g mL1 )c
LOQ (g mL1 )d
1.66
0.76
2.74
2.47
2.58
4.01
1.20
2.61
1.59
3.89
2.55
1.0016.56
1.5018.60
1.0015.84
1.0016.32
1.5019.96
0.5010.10
1.0014.90
1.0015.50
1.0014.80
0.5011.70
1.0015.36
0.9970
0.9994
0.9986
0.9996
0.9998
0.9976
0.9999
0.9995
0.9993
0.9976
0.9958
0.05
0.03
0.08
0.07
0.11
0.06
0.04
0.06
0.05
0.06
0.08
0.17
0.10
0.26
0.24
0.35
0.19
0.13
0.19
0.16
0.19
0.26
% Relative standard deviation = height standard deviation/height average 100; r 2 , linear correlation coefficient.
a Absorbance units full scale (AUFS) = 0.100 for all compounds except catechin and epicatechin, where AUFS = 0.008.
b Five levels.
c LOD, limit of detection, three times the standard deviation of the lowest standard analyzed as a sample.
d LOQ, limit of quantitation, ten times the standard deviation of the lowest standard analyzed as a sample.
Table 3. Percent recovery, amount found by standard addition and amount found by external standard of compounds from Flavor 1, Hersheys
chocolate syrup and Hersheys chocolate milk
Compound
Maltola
Theobromineb
Ethyl maltola
Catechinb
Vanillic acidc
Caffeineb
Vanillinb
Epicatechinb
Ethyl vanillina
% Recovery SD (n = 2)
101.7 1.7
102.1 0.8
94.7 6.3
97.6 0.9
88.3 0.8
102.2 2.1
103.8 0.6
102.1 2.6
101.6 1.5
mg kg1 SD standard addition (n = 2)
mg kg1 SD external standard (n = 3)
1 576 1
1 788 22
29 661 93
54 1
19 0.1
130 1
148 1
144 3
137 246 683
1 515 20
1 843 22
30 871 328
67 2
19 0.6
132 3
147 2
150 2
130 875 1 411
SD, standard deviation.

a Flavor 1, absorbance units full scale (AUFS) = 0.200, 0.030 0.001 g in 5 mL water for maltol and ethyl maltol, 0.016 0.001 g in 5 mL water for
ethyl vanillin.
b Herseys chocolate syrup, AUFS = 0.350 initially, changing to 0.100 after 10 min, 0.15 0.01 g in 5 mL water for theobromine and caffeine,
AUFS = 0.200, 0.16 g 0.01 in 5 mL water for vanillin, AUFS = 0.008, 0.12 0.01 g in 5 ml for catechin and epicatechin.
c
Herseys chocolate milk, AUFS = 0.040, 1.02 0.01 g in 5 mL water for vanillic acid.
The linear correlation coefficients (r 2 ) for the

standards over the specified concentration ranges are
greater then 0.99. The LOQ values were well below
the concentration of the standards used to analyze the
samples.
Recovery and standard addition
Table 3 shows the percent recoveries to be acceptable,
except for vanillic acid found at a low level in Hersheys
chocolate milk, which was 88%. The amounts found
by standard addition are in the same range as those
found by external standard, showing no interferences
with the compounds analyzed in their sample matrix.
Comparison of results with National Institute of
Standards and Technology (NIST) baking
chocolate
Table 4 compares the results for theobromine,
catechin, caffeine, epicatechin, and theophylline in
a baking chocolate standard reference material (NIST
Standard Reference Material 2384) obtained by the
1426
procedure described in the Experimental section with

those stated by NIST.5 The results are comparable to
the NIST certified results except that no theophylline
was detected in the baking chocolate using the
procedure described here. Theobromine, caffeine,
and theophylline results obtained by NIST were
determined on a sample defatted with hexane
four times, dried in a stream of nitrogen, and
reconstituted in water. The extract was analyzed using
absorbance detection at 274 nm and quantified using
an internal standard (-hydroxyethyltheophylline) and
an isocratic mobile phase of acetonitrile, water,
and acetic acid.5 This is similar to the procedure
described here except that hexane was not used,
results were calculated based on external standard, and
an MeOH, water, acetic acid mobile phase gradient
was employed. Theophylline is below detection limits
(<11 mg kg1 ), but an amount of 151 mg kg1 should
have given a response around 11 min (see Fig. 1), since
catechin at 222 mg kg1 , which has a fivefold lower
absorbance:concentration ratio than theophylline, was
detected (Table 1). Other workers have also reported
J Sci Food Agric 88:14231430 (2008)
DOI: 10.1002/jsfa

Table 4. Comparison of results with the National Institute of Standards and Technology (NIST) Standard Reference Material 2384, baking chocolate
(n = 6, mg kg1 ), percent recovery (n = 2, percent SD) and standard addition from NIST baking cocoa (n = 2, mg kg1 SD)
Theobromine
Catechin
Caffeine
Epicatechin
Theophylline
Results by this procedurea

Average
SD
% RSD
12 532
1 166
9.30
222
16
7.22
1117
40
3.56
1463
47
3.18
<11b
Certified results of NIST

Average
SD
% RSD
11 600
1 100
9.48
245
51
20.82
1060
50
4.72
1220
240
19.67
151
3
1.96
102.1 2.5
1126 2c
101.0 0.4
1517 15d
Recovery and standard addition from NIST baking cocoa

% Recovery
99.6 1.2
104.3 0.9
Standard Addition
11 659 122c
211 1d
SD, standard deviation; % RSD, percent relative standard deviation = standard deviation/average 100.
a 0.020 0.001 g in 5 mL 60 C water.
b
Based on S/N 2 at 0.002 AUFS.
c
Absorbance units full scale (AUFS) = 0.6 initially, changing to 0.04 AUFS after 10 min.
d
AUFS = 0.002 initially, changing to 0.008 AUFS after 18 min.
not detecting theophylline in Theobroma seeds and dark

and milk chocolates, where theophylline was detected
in some samples but not in others.1,13
The NIST results for catechin and epicatechin
(quantified using an internal standard of trytophan
methyl ester hydrochloride) were obtained using mass
selective detection after removing the fat from the
sample with three extractions of hexane, drying under
nitrogen, extracting two times in MeOH, combining
the MeOH extracts, and final dilution in water.9
Table 4 shows the percent recovery of theobromine,
catechin, caffeine, and epicatechin to be acceptable
(100%). The amounts found by standard addition
compare with those obtained by external standard,
indicating no interferences with the analytes in the
baking chocolate sample matrix.
The overall results obtained here, except for possibly
catechin, are higher than those using the two NIST
procedures. This may be due to the additional sample
preparation steps used in the NIST procedures, which

can result in the loss of the analyte or change in the
internal standard concentration.
Application to consumer products and artificial
flavors
Table 5 gives the results for seven compounds found
in consumer chocolate products, sample weights
extracted in 5 mL water, and the absorbance detector
sensitivity (AUFS) setting. Maltol and ethyl maltol
were not detected in these samples. Theobromine,
catechin, caffeine, vanillin, and epicatechin were
higher in Dove dark chocolate than in Dove milk
chocolate. Herseys chocolate syrup was purchased
on two occasions and analyzed three separate
times, yielding similar results. In both Herseys
chocolate syrup samples there was a large peak
at approximately 20 min (not shown), which was
not observed in other consumer product samples.
Table 5. Results for consumer products (n = 3, mg kg1 SD)
Compound
Dove dark
chocolate
Dove milk
chocolate
Hersheys
chocolate syrup
Hersheys
chocolate milk
Tootsie
Roll
Swiss
Miss cocoa
Theobromine
Sample wt/AUFS
Catechin
Sample wt/AUFS
Vanillic acid
Sample wt/AUFS
Caffeine
Sample wt/AUFS
Vanillin
Sample wt/AUFS
Epicatechin
Sample wt/AUFS
Ethyl vanillin
Sample wt/AUFS
6184 31
0.04/0.350
287 21
0.04/0.020
<2a
0.12/0.040
1072 16
0.04/0.020
401 13
0.04/0.020
630 160
0.04/0.020
<2a
0.10/0.160
2168 21
0.08/0.350
123 4
0.08/0.020
<2a
0.12/0.040
355 3
0.08/0.020
134 3
0.08/0.020
284 10
0.08/0.020
<2a
0.10/0.160
1843 22
0.15/0.350
67 2
0.12/0.008
<2a
0.12/0.040
132 3
0.15/0.100
147 2
0.16/0.200
150 2
0.12/0.008
<2a
0.12/0.160
139 2
1.0/0.350
<2a
0.60/0.008
19 1
1.0/0.040
11 1
1.0/0.100
<1a
0.60/0.160
<1a
0.60/0.008
<1a
0.60/0.160
488 8
0.20/0.200
14 1
0.60/0.040
<2a
0.60/0.040
59 3
0.20/0.200
51 1
0.40/0.160
29 1
0.60/0.040
21 1
0.40/0.160
1626 34
0.04/0.200
28 2
0.40/0.040
<2a
0.60/0.040
140 4
0.04/0.200
<4a
0.50/0.160
26 1
0.40/0.040
81 2
0.10/0.160
Sample wt, weight of sample (g, two significant figures); AUFS, absorbance units full scale; SD, standard deviation.
a
Based on S/N 2.
J Sci Food Agric 88:14231430 (2008)

DOI: 10.1002/jsfa
1427
This peak did not match the retention time of

epicatechin as determined by spiking experiments
and was estimated to have a concentration of
2325 19 mg kg1 (n = 6, 0.1690 0.004 g in 5 mL
water using 0.200 AUFS, based on the response of
ethyl vanillin) much higher than the amounts of
epicatechin found in the other consumer products
(Table 5). Herseys chocolate milk was also purchased
twice and analyzed three times. Vanillic acid was
only found in Herseys chocolate milk. This may
be due to the oxidation of vanillin since in the
second sample of Herseys chocolate milk vanillin was
detected (32 mg kg1 ) and the sample contained less
vanillic acid (14 mg kg1 ). The oxidation of vanillin
to vanillic acid will be discussed later, as well as
the oxidation of ethyl vanillin to ethyl vanillic acid
in Herseys chocolate syrup. Tootsie Roll contained
theobromine, catechin, caffeine, vanillin, epicatechin
and ethyl vanillin. These same compounds, with
the exception of vanillin, were found in Swiss Miss
cocoa mix.
The sample weights varied from 0.04 0.01 g
to 1.00 0.01 g, the higher weights being used to
detect compounds of low concentration such as
vanillic acid and caffeine in Hersheys chocolate
milk. The detector sensitivity settings were also
varied from 0.0008 to 0.350 AUFS, the lower, more
sensitive settings required to detect compounds of
low absorbance:concentration ratios like catechin and
epicatechin (Table 1). Higher sample weights and
or low sensitivity setting were used to determine
the minimum detectable quantity based on an
approximate height in the extract chromatogram of
two times the background signal of the detector.
Figure 2 is a chromatogram of the water extract
of Dove dark chocolate. A lower sensitivity setting
(0.02 AUFS) was used after 10 min to better
detect the compounds of lower concentration than
theobromine. The two peaks on either side of
epicatechin may be either ()-epigallocatechin gallate
or ()-epigallocatechin from the cocoa added to the
chocolate formulation, but their presence was not

confirmed by the use of authentic standards.1
Table 6 gives the results for the major components
found in four different artificial flavors, sample weights
extracted in 5 mL water, and the absorbance detector
sensitivity (AUFS) setting. As seen in Table 6, maltol,
ethyl maltol, vanillin and ethyl vanillin are present
in substantial amounts in some of these samples,
vanillin, for example, being over 300-fold the amount
found in consumer products (Table 5). Catechin and
epicatichin may be present in these samples, but are
difficult to detect since an increase in sample weight
or decrease in extract volume would be required
to determine catechin and epicatichin at levels of
mg kg1 . Since maltol, ethyl maltol, vanillin, and
ethyl vanillin are present at g kg1 levels in these
samples, an increase in sample weight or decrease
in extract volume may not be practical. Attempts at
increasing sample extract concentration in this work
using these artificial flavors often resulted in column
overload, and hence a decrease in retention time of
the analytes in the sample matrix and compound
carried over from previous injections (instrument
contamination). Because of these drawbacks caused
by concentrated extracts, catechin and epicatechin
were not determined in Flavor 2, Flavor 3, and
Flavor 4.
Favor 1 contains large amounts of vanillin and ethyl
vanillin. Favor 2 is similar to Flavor 1, but contained
no detectable theobromine and less caffeine. Flavor
3 contains lesser amounts of maltol, theobromine,
and ethyl maltol than Flavor 1, but vanillin and ethyl
vanillin are in the same range as Flavors 1 and 2. Flavor
4 appears unusual in that the amount of caffeine is
greater than theobromine. It may be that this flavor
was not entirely formulated from cocoa, which usually
has a ratio of theobromine:caffeine of at least 2.5 to
1.6
As done for consumer products (Table 5), various
sample weights (0.001 to 0.100 0.001 g) and
detector sensitivity settings (0.100 to 1.000 AUFS)
1.6
Theob
1.2
1.0
Van
0.8
0.6
Ecat
0.4
Cat
Absorbance Units
1.4
0.2
Caff
0.0
-0.2
0
10 12 14 16 18 20 22 24 26 28 30 32 34
Min
Figure 2. Chromatogram of 60 C water extract of Dove dark chocolate. Conditions: Gemini C18 (2.0 mm 150 mm, 5 m); mobile phase gradient
of 0.3% acetic acid and MeOH at 500 L min1 ; injection volume 5 L; autosampler temperature 10 C; absorbance detection at 273 nm and 0.35
AUFS initially then 0.02 AUFS after 10 min; 0.04 g in 5 mL1 ; theobromine (Theob), catechin (Cat), caffeine (Caff), vanillin (Van), epicatechin (Ecat).
1428
J Sci Food Agric 88:14231430 (2008)

DOI: 10.1002/jsfa

Table 6. Results for artificial chocolate flavors (n = 3, mg kg1 SD)
Compound
Maltol
Sample wt/AUFS
Theobromine
Sample wt/AUFS
Ethyl maltol
Sample wt/AUFS
Catechin
Sample wt/AUFS
Caffeine
Sample wt/AUFS
Vanillin
Sample wt/AUFS
Epicatechin
Sample wt/AUFS
Ethyl vanillin
Sample wt/AUFS
Flavor 1
Flavor 2
Flavor 3
Flavor 4
1515 20
0.030/0.200
961 11
0.020/0.350
30871 328
0.030/0.200
619 20
0.020/0.100
294 6
0.020/0.100
131173 1468
0.016/0.200
269 3
0.020/0.100
130875 1411
0.016/0.200
1363 94
0.012/1.000
<9a
0.020/0.200
32264 159
0.012/1.000
NA
83 7
0.100/1.000
591 7
0.010/0.200
3285 9
0.100/1.000
NA
<9a
0.100/0.100
753 4
0.010/0.200
<16a
0.100/0.100
NA
81 2
0.024/0.200
132540 1786
0.001/0.160
NA
217 2
0.010/0.200
14257 143
0.006/0.160
NA
2267 22
0.010/0.200
<9a
0.100/0.100
NA
129838 918
0.001/0.160
14563 205
0.006/0.160
115544 701
0.002/0.160
SD, standard deviation; Sample wt, weight of sample (g, three significant figures); AUFS, absorbance units full scale; NA, not analyzed.
a Based on S/N 2.
0.14
0.12
Theob
0.08
0.06
Caff
0.04
Malt
EtMalt
-0.02
-0.04
0
EtVan
0.00
Ecat
Cat
0.02
Van
Absorbance Units
0.10
10 12 14 16 18 20 22 24 26 28 30 32 34
Min
Figure 3. Chromatogram of the water extract of Flavor 1. Conditions: Gemini C18 (2.0 mm 150 mm, 5 m); mobile phase gradient of 0.3% acetic
acid and MeOH at 500 L min1 ; injection volume of 5 L; autosampler temperature 10 C; absorbance detection at 273 nm and 0.350 AUFS initially
then 0.100 AUFS after 10 min; 0.02 g in 5 mL1 ; maltol (Malt), theobromine (Theob), ethyl maltol (EtMalt), catechin (Cat), caffeine (Caff), vanillin (Van),
epicatechin (Ecat), and ethyl vanillin (EtVan).
were used for the different analytes, since the

concentrations varied from not detected (<9 mg kg1 )
for maltol and vanillin in Flavor 4 to 132 540 mg kg1
vanillin in Flavor 2.
Figure 3 is a chromatogram of the water extract
of Flavor 1 intentionally enlarged to illustrate the
chromatographic problems associated with these artificial flavors when large amounts of other compounds
are present in the extract. One of the two peaks on
either side of ethyl maltol may be ()-epigallocatechin
from the cocoa added to the formulation.1 These
peaks may also be 4-hydroxybenzoic acid or 4hydroxybenzaldehyde from a vanilla extract used in
Flavor 1.10,14 The peak around 20 min may be ethyl
vanillic acid since Flavor 1 contained a large amount
of ethyl vanillin. The presence of these compounds
was not confirmed by authentic standards.
J Sci Food Agric 88:14231430 (2008)
DOI: 10.1002/jsfa
Stability of standards
It was observed when catechin and epicatechin
standards were injected before and after the sample
extracts (bracket calibration) that the set of standards
analyzed after the sample extracts gave about 10%
less response than the standards analyzed prior to the
sample extracts. This occurred after a 16 h runtime
with the autosampler temperature compartment set
at 10 C. Standards of catechin and epicatechin also
became discolored under ambient conditions in light
after 3 days, with a response loss of around 20%.
Some workers have used ascorbic acid to reduce the
degradation of catechins.15
The vanillin standard began to yield two peaks
after about a month under ambient conditions in
the presence of light, the unknown peak having
a retention time of approximately 2 min less than
1429
vanillin (not shown). Since vanillin is an aldehyde,

the expected oxidized form of vanillin would be
vanillic acid. An authentic standard of vanillic acid
was obtained and the additional peak in the vanillin
standard was confirmed by retention time and spiking
experiments to be vanillic acid. An analogous situation
also occurred with ethyl vanillin, with an unknown
peak having a retention time of about 2 min less
than ethyl vanillin (not shown). Although an authentic
standard of ethyl vanillic acid was not used to confirm
the presence of this compound (not commercially
available), it does show that ethyl vanillin, like vanillin,
oxidizes similarly to vanillin, forming a more polar
compound which is less retained on the C18 column.
These two degradation products of vanillin and
ethyl vanillin were seen in Hersheys chocolate
milk and Hersheys chocolate syrup. Even though
these consumer products were refrigerated (5 C)
as recommended and were analyzed within 1 day
after purchase, vanillic acid was found in Hersheys
chocolate milk and ethyl vanillic acid appeared in
Hersheys chocolate syrup.
CONCLUSIONS
An accurate and precise method has been developed
which is capable of simultaneously quantifying
theobromine, catechin, vanillic acid, caffeine, vanillin,
epicatechin, and ethyl vanillin from the water extract
of consumer products and maltol, theobromine,
ethyl maltol, caffeine, vanillin, and ethyl vanillin
from artificial flavors. Minimal sample preparation
is required and equipment found in most laboratories
can be used to perform the analyses. Results from
this procedure compare well with other RP-HPLC
techniques and is the first reported single procedure
to determine theobromine, catechin, caffeine, and
epicatechin in Standard Reference Material 2380
baking chocolate without extensive sample preparation
and mass selective detection. Vanillic acid and ethyl
vanillic acid, found in some consumer products, may
be indicators of shelf-life stability since it would be not
likely that these compounds were added intentionally
to consumer products.
10
11
12
13
14
15
compounds in chocolate using RP-HPLC. Eur Food Res Technol 215:340346 (2002).
Meyer A, Ngiruwonsanga T and Henze G, Determination
of adenine, caffeine, theophylline and theobromine by
HPLC with amperometric detection. Fresenius J Anal Chem
356:284287 (1996).
Hurst WJ, Snyder KP and Martin RA, Use of microbore highperformance liquid chromatography for the determination of
caffeine, theobromine and theophylline in cocoa. J Chromatogr
318:408411 (1985).
Bispo MS, Veloso MCC, Pinheiro HLC, DeOliveira RFS,
Reis JON and DeAndrade JB, Simultaneous determination
of caffeine, theobromine and theophylline by high performance liquid chromatography. J Chromatogr Sci 40:4548
(2002).
May EW and Watters RL, National Institute of Standards
and Technology, Certificate of Analysis Standard Reference
Material 2384 Baking Chocolate, Department of Commerce,
USA (2004).
Kreiser WR and Martin RA, High pressure liquid chromatographic determination of theobromine and caffeine in cocoa
and chocolate products. J Assoc Off Anal Chem 61:14241427
(1978).
Naik JP, Improved high-performance liquid chromatography
method to determine theobromine and caffeine in cocoa and
cocoa products. J Agric Food Chem 49:35793583 (2001).
Subagio A, Sari P and Morita N, Simultaneous determination
of (+)-catechin and ()-epicatechin in cacao and its
products by high performance liquid chromatography with
electrochemical detection. Phytochem Anal 12:271276
(2001).
Nelson BC and Sharpless KE, Quantification of the predominate monomeric catechins on baking chocolate standard
reference material by LC/APCI-MS. J Agric Food Chem
51:531537 (2003).
Herrmann A and Stoeckli M, Rapid control of vanillacontaining products using high performance liquid chromatography. J Chromatogr 246:313316 (1982).
Peng SH, Ma WH and Di JW, Determination of maltol and
ethyl maltol by spectrophotometry, HPLC and voltammetry.
Guangpu Shiyanshi 22:680682 (2005).
Nagae N, Enami T and Doshi S, The retention behavior of
reversed-phase HPLC columns with 100% aqueous mobile
phase. LCGC North America 20:964972 (2002).
Marx F and Maia JGS, Purine alkaloids in seeds of Theobroma
species from the Amazon. Z Lebensm Unters 193:460461
(1991).
Scharrer A and Mosandi T, Reinvestigation of vanillin contents
and component ratios of vanilla extracts using highperformance liquid chromatography and gas chromatography.
Dtsch Lebensm Rundsch 97:449456 (2001).
Yang SY, Lee MJ and Chen L, Human salivary tea catechin
levels and catechin esterase activities: implication in human
cancer prevention studies. Cancer Epidemiol Biomarkers Prev
8:8389 (1999).
REFERENCES
1 Tokusoglu O and Uenal MK, Optimized method for simultaneous determination of catechin, gallic acid and methylxanthine
1430
J Sci Food Agric 88:14231430 (2008)

DOI: 10.1002/jsfa
J Sci Food Agric 88:14311441 (2008)
Fatty acid and fat-soluble antioxidant

concentrations in milk from high- and
low-input conventional and organic systems:
seasonal variation
Gillian Butler,1 Jacob H Nielsen,2 Tina Slots,2 Chris Seal,1 Mick D Eyre,1
Roy Sanderson3 and Carlo Leifert1
1 School
of Agriculture, Food and Rural Development, Newcastle University, Nafferton Farm, Stocksfield, Northumberland, NE43 7XD, UK
of Food Science, Danish Institute for Agricultural Science (DIAS), PO Box 50 DK-8830 Tjele, Denmark
3 Institute for Research on Environment and Sustainability, Newcastle University, Devonshire Building, Devonshire Place, Newcastle Upon
Tyne NE1 7RU, UK
2 Department
Abstract
BACKGROUND: Previous studies showed differences in fatty acid (FA) and antioxidant profiles between organic
and conventional milk. However, they did not (a) investigate seasonal differences, (b) include non-organic, lowinput systems or (c) compare individual carotenoids, stereoisomers of -tocopherol or isomers of conjugated
linoleic acid. This survey-based study compares milk from three production systems: (i) high-input, conventional
(10 farms); (ii) low-input, organic (10 farms); and (iii) low-input non-organic (5 farms). Samples were taken
during the outdoor grazing (78 samples) and indoor periods (31 samples).
RESULTS: During the outdoor grazing period, on average, milk from the low-input systems had lower saturated
FAs, but higher mono- and polyunsaturated FA concentrations compared with milk from the high-input system.
Milk from both the low-input organic and non-organic systems had significantly higher concentrations of
nutritionally desirable FAs and antioxidants conjugated linoleic (60% and 99%, respectively) and -linolenic
(39% and 31%, respectively) acids, -tocopherol (33% and 50%, respectively) and carotenoids (33% and 80%,
respectively) compared with milk from the high-input system. Milk composition differed significantly between
the two low-input systems during the second half of the grazing period only; with milk from non-organic cows being
higher in antioxidants, and conjugated linoleic acid, and that from organic cows in -linolenic acid. In contrast,
few significant differences in composition were detected between high-input and low-input organic systems when
cows were housed.
CONCLUSIONS: Milk composition is affected by production systems by mechanisms likely to be linked to the
stage and length of the grazing period, and diet composition, which will influence subsequent processing, and
sensory and potential nutritional qualities of the milk.
Keywords: milk; low-input farming; organic farming; fatty acid profiles
INTRODUCTION
The fatty acid (FA) and fat-soluble antioxidant
composition in milk fat is known to affect processing
and sensory quality of dairy products,1,2 and may also
affect their nutritional value.3 5
The degree of saturation in milk fat has a bearing
on the hardness, texture and taste of manufactured
dairy products, particularly butter and cheese.6 The
presence of longer-chain saturated fatty acids (SFA)
increases the hardness of butter, while milk with a
high proportion of unsaturated FA content (typical
range 275400 g kg1 fat) tends to give softer products
(e.g., more spreadable butter). Unsaturated (especially

polyunsaturated) FAs are also more prone to oxidation, which results in the development of off-flavour
and reduced shelf-life in milk and dairy products.6
However, the sensory quality and shelf-life of milk and
dairy products is determined by the balance of unsaturated FAs and fat-soluble antioxidants, which protect
against oxidation and off-flavour development.6 8
High dietary intakes of SFA (which account for
6070% of milk fat) is a risk factor for development
of obesity, cardiovascular disease (CVD), impaired
insulin sensitivity and the metabolic syndrome.4 In
Correspondence to: Gillian Butler, School of Agriculture, Food and Rural Development, Newcastle University, Nafferton Farm, Stocksfield, Northumberland,
NE43 7XD, UK
E-mail: Gillian.Butler@ncl.ac.uk
(Received 26 July 2007; revised version received 15 January 2008; accepted 15 January 2008)
G Butler et al.
contrast, dietary intake of certain unsaturated fatty

acids, in particular conjugated linoleic acid (CLA)
and omega-3 fatty acids (n-3 FA), and fat-soluble
antioxidants (e.g., -tocopherol, carotenoids) has been
linked to potential health benefits.3,9,10 CLA and n3 FA have been shown to counteract the negative
physiological effects of SFA, and CLA has also been
linked to anticancer properties, reduced risk of type 2
diabetes, CVD and enhanced immune function.11 13
However, while CLA isomer C18:2 c9 t11 (CLA9)
was only linked to beneficial health impacts, another
CLA isomer, C18:2 t10 c12 (CLA10), was also
associated with some negative health impacts in cell
culture and animal models.13 In studies comparing the
impact of different (e.g., organic and conventional)
production systems on milk fat composition, it is
therefore important to compare concentrations of both
CLA isomers. Most previous comparative studies14 16
only reported concentrations of individual isomers or
total CLA and also did not report concentrations
of vaccinic acid (VA), the precursor for CLA. Milk
contains significant concentrations of VA and, since
a proportion can be readily converted to CLA9 in
the human body, the total potential CLA9 supply can
only be estimated if both VA and CLA9 levels are
known.17
Previous studies showed that the feeding regime
has a major effect on the FA profiles of milk,
but that other factors (including breed/genotype,
stage and number of lactations) may also influence milk composition.17 19 Dietary unsaturated fatty
acids are likely to undergo hydrogenation by rumen
microorganisms and long-chain fatty acids may be
subjected to desaturase activity in the mammary
gland.17 20 The FA profile of milk, therefore, is primarily determined by: (i) the balance of fatty acids
in the diet; (ii) the extent of rumen hydrogenation; and (iii) mammary desaturase activity. CLA
levels are linked to dietary supply of -linolenic
acid (LA) and linoleic acid.17 However, while
7090% of CLA9 (which constitutes >70% of total
CLA in milk) is generated from desaturation of
VA in the mammary gland, all other CLA isomers (including CLA10) are generated as intermediates of rumen biohydrogenation and are therefore
found at much lower concentrations than CLA9 in
milk.17
Fat-soluble antioxidants/vitamins present in milk
are derived from dietary sources, either from
(i) natural constituents in feedstuff (especially the
forage component of the diet)21 or (ii) synthetic
compounds added as supplements to the diet of
lactating cows.22 Carotenoids derived from fresh
forage are dominated by -carotene, but also
include lutein, zeaxantin, cryptoxanthin, lycopene
and -carotene.23 The main vitamin E activity in
fresh forage is associated with the RRR isomer
of -tocopherol (the only isomer synthesized by
plants), with some activity being associated with
1432
-, - and -tocopherol and -, ,- - and tocotrianol.24

Most high-input conventional dairy production
systems supplement diets with proprietary mineral
and/or vitamin products containing A vitamins,
vitamin D3 and E vitamins (in particular tocopherol); such supplements are prohibited in
organic production.25
The naturally occurring RRR isomer of tocopherol has a higher vitamin E activity (1.49
IU mg1 ) than synthetic vitamin E (1.0 IU mg1 ),
which contains equal proportions of the eight different stereoisomers of -tocopherol.24 Synthetic
-tocopherol products are referred to as all rac tocopherol and consist mainly of 2R stereoisomers.
Synthetic -tocopherol is absorbed with the same efficiency as the RRR stereoisomer of -tocopherol, but
levels of uptake into key tissues (e.g. the brain) are
lower.24 Also, a recent study with dairy cows found
higher -tocopherol concentrations in blood and milk
following supplementation of RRR compared with allrac -tocopherol and reported preferential transfer of
RRR isomers into milk by cows receiving the synthetic
isomer mix.22
Milk and dairy products from certified organic dairy
production systems have been reported to contain
higher concentrations of polyunsaturated fatty acids
(PUFA), LA (the main n-3 FA in milk), and/or
CLA, and fat-soluble antioxidants than those from
high-input conventional production.14 16 These studies did not include non-organic, low-input systems
in comparisons. However, an increasing number of
dairy farms in Europe, New Zealand/Australia and
North America are adapting lower-input production
methods similar to those used in organic farming, but
do not comply with all input restrictions prescribed
by organic farming standards.26 Most importantly,
these systems use mineral NPK fertilizers, but often
at reduced levels compared with conventional highinput systems. It is unclear whether such non-organic,
low-input systems can provide similar benefits in milk
composition to certified, organic dairy production systems.
Milk composition is known to change when switching from outdoor grazing to indoor forage-based
diets in winter;6,12,20,27 however, little is known
about whether this dietary change affects the differential in milk quality between organic and conventional systems reported previously.14 16 There is
also limited information on differences in the composition of fat-soluble antioxidants in milk from
high- and low-input dairy systems and the few studies available show contradictory results.14,28,29 Such
information would, however, be essential to assess
(i) the overall nutritional value of milk from lowinput systems and (ii) whether the higher unsaturated fat content of organic milk (and associated
risk of oxidation and off-flavour development) is
compensated for by higher concentrations of antioxidants.
J Sci Food Agric 88:14311441 (2008)
DOI: 10.1002/jsfa
Fatty acid and fat-soluble antioxidant concentrations in milk
The objectives this study were therefore to:

(i) compare the fatty acid and fat-soluble antioxidant
composition of milk from three UK production
systems certified-organic low-input (O-LI), nonorganic certified low-input (NO-LI) and standard
high-input (HI) conventional production systems,
during the outdoor grazing period; (ii) quantify
differences in fatty acid and fat-soluble antioxidant
content of milk between O-LI and HI systems,
during the winter indoor (conserved forage-based)
feeding period; and (iii) identify whether there are
differences in milk composition between certifiedorganic low-input (O-LI) and non-certified lowinput (NO-LI) systems that use spring block
calving systems and graze cows outdoors throughout
lactation.
EXPERIMENTAL
Farm details and milk survey design
One hundred and nine milk samples were collected
from 25 commercial farms categorized into three
different production systems. Management and production parameters were recorded for each farm
and sampling date using a standard questionnaire
(see Table 1 for the most important parameters
recorded). The number of cows in early lactation
(first 100 days) was also recorded. Live weights (LW)
of cows were estimated based on mean weights of
breeds (HolsteinFriesian = 650 kg; Jersey = 450 kg;
Ayrshire = 550 kg; Brown Swiss and Scandinavian
Red = 575 kg)30 and the proportion of each breed
in the genetic make-up of the herd. Total dry
matter intakes (DMI) were estimated from average milk yields (bulk tank contents divided by
the number of milking cows recorded by farmers)
Table 1. Differences in management and production system parameters between high-input conventional (HI), organically certified (O-LI) and
non-organic (NO-LI) low-input farms (mean values over all samples, with standard deviation in parentheses)
Production system
Parameters recorded
Herd characteristics
Herd size (milking cows)
Breed Indexa
% primiparous cows
Live weight of cows (kg)b
Dry matter intake (kg d1 )c
Diet composition
1. Outdoor period
Fresh forage (proportion DMI)
Conserved forage (proportion DMI)
Grass silagee
Maize silagee
Other silaged,e
Straw/haye
Concentrate (proportion of DMI)
Cereals
By-products g
Other concentratesh,i
Mineral supplements (g cow1 day1 )
Vitamin E supplement (iu cow1 day1 )
2. Indoor period
Fresh forage (proportion of DMI)f
Conserved forage (proportion of DMI)
Grass silagee
Maize silagee
Other silaged,e
Straw/haye
Concentrate (proportion of DMI)
Cereals
By-productsg
Other concentratesh,i
Mineral supplements (g cow1 day1 )
Vitamin E supplement (iu cow1 day1 )
HI
O-LI
NO-LI
252 (125)
0.0 (0)
25 (7)
650 (0)
19.5 (0.5)
160 (93)
0.2 (0.3)
27 (12)
610 (34)
17.6 (1.0)
322 (141)
0.3 (0.1)
30 (8)
588 (21)
16.9 (0.7)
0.37 (0.24)
0.29 (0.15)
0.84 (0.23)
0.08 (0.16)
0.95 (0.07)
0 (0)
0.73 (0.28)
0.10 (0.20)
0.13 (0.18)
0.04 (0.09)
0.72 (0.40)
0 (0)
0 (0)
0.28 (0.40)
0.34 (0.13)
0.08 (0.09)
0.05 (0.07)
0.31 (0.24)
0.30 (0.23)
0.40 (0.31)
142 (75)
450750
0.23 (0.40)
0.20 (0.40)
0.57 (0.49)
8 (17)
0
0.05 (0.14)
0.52 (0.50)
0.43 (0.53)
3 (13)
0
0 (0)
0.56 (0.08)
0.24 (0.38)
0.54 (0.30)
0.69 (0.29)
0.05 (0.12)
0.24 (0.28)
0.02 (0.04)
0.80 (0.19)
0 (0)
0.20 (0.19)
0 (0)
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
0
0.44 (0.08)
0.23 (0.10)
0.31 (0.17)
0.24 (0.16)
0.45 (0.24)
150 (53)
250674
0.42 (0.16)
0.07 (0.11)
0.51 (0.23)
22 (31)
0
Based on farm records and collected by questionnaire; a estimated proportion of non-HolsteinFriesian genetics in the herd; b estimated based
on breed index; c estimated based on live weight and milk yield; d whole-crop wheat, barley and/or oats, dry matter; e proportion of total conserved
forage intake; f when weather permitted, most organic herds were grazed in the day; g brewing and distillers waste and/or sugarbeet pulp; h bought
in or farm produced compound/mixed concentrate feeds; i no oilseed or fat supplementation was recorded by farmers; NA, not applicable (NO-LI
cows were grazed throughout the lactation).
J Sci Food Agric 88:14311441 (2008)

DOI: 10.1002/jsfa
1433
G Butler et al.
and assumed live weight (DMI = 0.025 LW + 0.125

milk yield). Grazing was calculated at the herd
level by difference: DMI (fresh grass) = total DMI
DMI (conserved forage + concentrate; recorded by
producers). Since cow live weight varied between
farming systems, recorded levels of dietary components were used to calculate proportions of total intake,
to allow a more relevant comparison between systems.
Tables 1 and 2 list diet composition for each production system during grazing and the housed periods of
this study.
Conventional high-input (HI) farms
Ten farms were selected representing common
conventional production and feeding systems in the
UK. HI farms used predominantly pure ryegrass
swards during the grazing period, winter diets based on
grass silage and higher concentrate:conserved forage
ratio diets during the indoor feeding period than
LI farms (see Table 1 for the diets used during the
outdoor grazing and indoor feeding periods). The HI
group did not include farms with extremely highinput/output systems (e.g., farms which use more than
50% of the diet coming from concentrates, regularly
milk three times per day and/or those that house
animals throughout their lactation). All farms were
all-year round-calving and had similar proportions of
cows in early lactation at all sampling dates.
Organically certified low-input (O-LI) farms
Ten farms were selected representing two principal
organic dairy systems found in the UK: (a) an all-yearround calving system (five farms) in which lactating
cows are grazed when conditions allow (spring to
autumn), but fed on conserved forage-based diets
during the winter indoor period (see Table 1); and
(b) a spring block calving system in which cows
Table 2. Diet composition in organic (O-LI) and non-organic (NO-LI)
low-input dairy production systems (spring calving herds only), at
different sampling dates during the outdoor period (mean values, with
standard deviation in parenthesis)
Production system
Sampling
date
Dietary components
(proportion of DMI)
August
O-LI
NO-LI
Fresh forage
Conserved forage
Concentrate
0.96 (0.04)
0 (0)
0.04 (0.04)
0.92 (0.08)
0 (0)
0.08 (0.08)
October
Fresh forage
Conserved forage
Concentrate
0.88 (0.11)
0.04 (0.06)
0.08 (0.08)
0.95 (0.08)
0 (0)
0.05 (0.08)
March
Fresh forage
Conserved forage
Concentrate
0.86 (0.20)
0.11 (0.15)
0.03 (0.06)
0.95 (0.07)
0 (0)
0.05 (0.07)
May
Fresh forage
Conserved forage
Concentrate
0.96 (0.06)
0 (0)
0.04 (0.06)
1.00 (0)
0 (0)
0 (0)
DMI, dry matter intake.
1434
are grazed throughout lactation (March to October)

and were only indoors when not lactating between
November to February. All-year-round calving farms
had similar proportions of cows in early lactation
at all sampling dates. Diets used in both organic
systems were similar during the outdoor grazing period
(Table 1); all O-LI farms used mixed grassclover
swards and did not apply mineral N or water-soluble
P fertilizers. Where appropriate, on the basis of soil
analyses, finely ground rock phosphate fertilizers were
applied.
Non-organically certified low-input (NO-LI) farms
Five farms representing the main non-organic, lowinput system found in the UK were selected. All
farms used a New Zealand-type production system26
with spring block calving, in which cows were grazed
throughout the lactation and no, or low levels of
concentrate and/or other feed supplements included
in the diet (see Table 1). As with the organic spring
block calving herds, cows were only housed when not
lactating between November and February. NO-LI
farms selected used mixed grassclover swards, but
applied up to 120 kg N ha1 per year of mineral N and
water-soluble P fertilizer at levels determined from soil
analyses.
Samples were taken in August and October in 2004
and in January, March and May in 2005 from all
farms. In January 2005 samples could only be collected
from O-LI and HI farms that used an all-year-round
calving system. Samples of milk were taken from the
stirred bulk tank after two milkings (representing a
24 h production period), at each participating farm
and frozen immediately after sampling and kept at
20 C until dispatched for analysis.
Extraction of fat from milk
The extraction of fat from the milk was carried
out as described by Havemose et al.,23 with minor
modifications. Milk fat was extracted from milk (2 mL)
by adding methanol (2 mL) and chloroform (4 mL).
The mixture was shaken vigorously for 1 min, then
centrifuged for 10 min at 3000 g at 4 C. The lower
phase containing the lipid fraction was isolated and
evaporated to dryness under nitrogen.
Methylation of fatty acids from milk
The methylation of fatty acids extracted from the
milk was carried out as described by Havemose
et al.,23 with minor modifications. Fat (approx. 10 mg)
was dissolved in sodium methylate solution (2 g L1
methanol) in sealed glass tubes filled with argon,
incubated at 60 C for 30 min, and then cooled on
ice. Saturated sodium chloride solution (4 mL) and
pentane (1 mL) were added. The samples were mixed
on a vortex mixer for 1 min and centrifuged at 1700 g
for 10 min. The upper pentane phase was collected and
used for gas chromatographic analysis.
J Sci Food Agric 88:14311441 (2008)
DOI: 10.1002/jsfa
Analysis of fatty acid composition by gas

chromatography
Separation and quantification of the fatty acids isolated
from milk was carried out as described by Havemose
et al.,23 with modifications. Samples (1 L) of the
pentane phase containing the fatty acid methyl esters
were analysed by gas chromatography (HP6890 GC
system, Hewlett Packard Co., Palo Alto, CA, USA)
with a flame ionization detector and a Supelco SI
2560 column (100 m 0.25 mm 0.20 m, Supelco,
Bellafonte, PA, USA). The inlet temperature was
275 C with a split ratio of 40:1, and the carrier gas
was helium with a constant flow of 1.5 mL min1 .
The starting temperature of 140 C was held for 5 min
and increased by 4 C min1 to an end temperature of
240 C. The detector temperature was 300 C.
The concentrations of saturated (SFA), monounsaturated (MUFA) and polyunsaturated (PUFA) fatty
acids and the ratio of n-3 and n-6 isomers of linolenic
acid (C18:3) were then calculated as a proportion of
total fatty acids recovered, based on the use of external standards. To calculate the n-3:n-6 FA ratio, the
concentration of the main n-3 FA (-LA) was divided
by the sum of the concentrations of the following n-6
FA isomers: 18:2 t9 t12, 18:2 t10 t12, 18:2 c9 c12,
18:3 c6 c9 c12 and 20:4 c5 c8 c11 c14.
Analysis of fat-soluble antioxidant composition
Fat-soluble antioxidants (-tocopherol, -carotene,
lutein and zeaxantin) were analysed using the
high-performance liquid chromatographic method
described by Havemose et al.23 Isomers of tocopherol were analysed using the methods described
by Meglia et al.22
Linear mixed-effects models31 were used to investigate
differences in milk quality parameters under the
different systems (HI, O-LI and NO-LI). These
models use two types of explanatory variables: fixed
effects, which affect the mean of the response
variable; and random effects, which affect the
variance of the response. In these analyses, farm
identifier was used as a random effect. Three
sets of analyses were undertaken: (i) comparison
of milk samples from all three systems (HI, OLI and NO-LI) taken during the outdoor grazing
period (samples from the spring block and allyear calving organic farms were pooled, because no
major differences could be detected in preliminary
analyses; results not shown); (ii) comparison of
samples taken from HI and all-year calving O-LI
farms during the indoor period when cows were
on conserved forage-based diets; and (iii) comparison
of samples taken from spring block calving OLI and NO-LI herds at four different sampling
dates using a two-factorial model (system and date),
adapted to account for repeated measures from
the four dates, to identify (a) whether at any time
during the grazing period milk quality differed
J Sci Food Agric 88:14311441 (2008)
DOI: 10.1002/jsfa
between the two LI systems and (b) interactions

between the two factors for any of the milk quality
parameters assessed. All proportion data were arcsine
transformed prior to statistical analysis, but means
presented were calculated from non-transformed data.
Pairwise comparisons of means were carried out,
where appropriate, using Tukeys honest significant
difference tests.
All statistical analyses were carried out using the R
statistical environment.32
RESULTS
Comparison of milk fat composition during the
outdoor period (fresh forage-based diets)
On average the total fat content was higher in milk
from LI systems compared with the HI system,
and was significantly higher for the NO-LI system
compared with the HI system (Table 3). When
the composition of milk fat was compared, on
average, the percentage of SFAs in milk fat was
lower, while percentages of both MUFA (of which
>80% was oleic acid C18:1 cis9) and PUFA were
higher in milk from LI systems, compared with
the HI system, and was significantly higher for
the NO-LI system compared with the HI system
(Table 3).
Percentages of the nutritionally desirable FAs (LA and CLA9) were significantly higher, while levels
of total n-6 PUFAs were significantly lower in milk
from both LI systems, when compared with milk
from HI farms (Table 3). As a result, the n3:n6 ratio
was also higher in milk from LI systems (Table 3).
CLA10 was found in low concentrations in milk
from all production systems and was not affected
by production system (Table 3). Differences between
O-LI and NO-LI were generally smaller than those
between HI and LI systems, but the percentage
of CLA was significantly higher in milk from NOLI systems and the percentage of total n-6 FA
was significantly higher in milk from O-LI systems
(Table 3).
The concentrations of most antioxidants (the
RRR stereoisomer of -tocopherol, -carotene,
lutein and zeaxanthin) were highest in milk from
NO-LI, at intermediate concentrations in milk
from O-LI and lowest in milk from HI systems (Table 3) during the outdoor period. Concentrations of the 2R stereoisomer of -tocopherol
were not significantly different between systems,
but were slightly lower in milk from NO-LI systems.
indoor period (conserved forage-based diets)
Since the spring, block-calving NO-LI and O-LI
systems did not produce milk during the indoor period
only milk from all-year calving O-LI and HI systems
was compared.
1435
G Butler et al.
Table 3. Fatty acid composition and fat-soluble antioxidant concentrations in milk from conventional high-input and organic and non-organic low
input dairy production systems, during the outdoor, fresh forage-based feeding period (mean values, with standard error of means in parentheses)
Production system
Low-input
Characteristic assessed
High-input
NO
ANOVA (P-value)
Number of samples
Milk yield/cow (kg)
Protein content (g kg1 )
Fat content (g kg1 )
24
34
20
26.2 (0.7)a
33.1 (2.3)c
39.6 (3.1)b
18.4 (0.8)b
34.1 (3.5)b
42.0 (6.9)ab
17.4 (0.9)b
35.9 (3.9)c
45.5 (9.0)a
691 (59)b
275 (54)b
59 (20)b
672 (55)ab
289 (51)ab
82 (17)a
660 (64)a
305 (57)a
78 (22)ab
Omega 3 and 6 FAs (g kg1 milk fat)

-LA C18:3 c9 c12 c15
6.2 (0.5)b
LA C18:3 c6 c9 c12
0.26 (0.01)
Total n-6
20.1 (1.3)a
n-3:n-6 ratio
0.37 (0.13)b
10.2 (0.3)a
0.26 (0.06)
15.2 (1.0)b
0.79 (0.09)a
9.0 (0.3)a
0.14 (0.01)
10.6 (0.4)c
0.88 (0.01)a
<0.0001
0.242
<0.0001
<0.0001
VA and CLA isomers (g kg1 milk fat)

VA C18:1 t11
22.5 (1.8)b
CLA C18:2 c9 t11
8.8 (0.7)c
CLA C18:2 t10 c12
0.31 (0.03)
35.5 (1.6)a
14.1 (0.6)b
0.33 (0.03)
41.9 (1.9)a
17. 5 (1.4)a
0.38 (0.07)
<0.0001
<0.0001
0.589
<0.0001
0.0006
0.0004
Fatty acid groups (g kg1 milk fat)
Total SFA
Total MUFA
Total PUFA
0.042
0.017
0.0017
Fat-soluble antioxidants (mg kg1 milk fat)
-Tocopherol
2R -toc
RRR -toc
Total -tocopherol
2.6 (0.1)
18.8 (0.8)c
21.4 (0.8)b
2.5 (0.3)
26.0 (0.9)b
28.5 (0.9)a
1.8 (0.2)
30.2 (1.0)a
32.0 (1.1)a
0.123
<0.0001
<0.0001
Carotenoids
-Carotene
Lutein
Zeaxantin
Total carotenoids
5.35 (0.33)c
0.46 (0.03)c
0.11 (0.01)c
5.91 (0.35)c
6.95 (0.29)b
0.77 (0.04)b
0.16 (0.01)b
7.88 (0.32)b
9.29 (0.48)a
1.14 (0.05)a
0.20 (0.01)a
10.64 (0.52)a
<0.0001
<0.0001
<0.0001
<0.0001
O, organic; NO, non-organically certified; SFA, saturated fatty acids; MUFA, monounsaturated fatty acids ( >80% oleic acid); PUFA, polyunsaturated
fatty acids; -LA, -linolenic acid; 2R -toc, 2R stereoisomers of -tocopherol; RRR -toc, 3R stereoisomers of -tocopherol; means within a row
with different letters are significantly different (P < 0.05).
In contrast to results from the outdoor rearing

period, there were few differences in milk composition
during the housed period. The percentages of total
SFA in milk fat were significantly higher (4%) and
MUFA significantly lower (10%) in milk from the
O-LI system compared with milk from HI systems
(Table 4). There was also a significantly lower (24%)
content of n-6 fatty acids and trends towards a higher
content (38%) of -linolenic acid (P = 0.052) and a
higher (30%) lutein content (P = 0.081) in O-LI milk
compared with HI milk (Table 4).
grazing period between O-LI and NO-LI spring
block calving dairy systems
Apart from CLA9 isomer (which was present in
significantly higher percentages in milk from NOLI farms on the August and May sampling dates),
significant differences in FA composition between OLI and NO-LI block calving systems were found only
late in the outdoor grazing period (August and October
sampling date, Fig. 1). The percentages of total SFA
1436
and LA were higher in milk from O-LI systems, while

percentages of MUFA, PUFA, VA and CLA9 were
higher in milk from NO-LI systems. No significant
differences in the percentages of CLA10 and n-6
FAs were detected (data not shown). There were also
significant interactions between LI production system
and date for PUFA (P = 0.020; Fig. 1(c)), VA (P =
0.029; Fig. 1(e)) and CLA (P = 0.030; Fig. 1(f)).
The concentration of most antioxidants changed
significantly over time, and at specific dates significant
differences in the concentrations of individual antioxidants between the two LI systems could be detected.
Concentrations of 2R toc were significantly higher in
milk from O-LI systems in May, while concentrations
of 3R toc were significantly higher in NO-LI systems
in October. Levels of total and all three individual
carotenoids were significantly higher in milk from NOLI-systems in August and May (and for lutein also in
October) (Fig. 2). A significant interaction between
LI production system and date was only identified
for the 2R stereoisomer of -tocopherol (P = 0.003;
Fig. 2(a)).
J Sci Food Agric 88:14311441 (2008)
DOI: 10.1002/jsfa

350
*
660
600
*
*
300
Oct
Mar
Aug
May
12
Oct
Mar
Aug
CLA (g kg-1 total FA)
VA (g kg-1 total FA)
(e)
*
40
Aug
Oct
Mar
Aug
May
Mar
May
(f)
*
20
*
10
20
Oct
30
(d)
10
*
90
May
60
(c)
60
250
Aug
ALA (g kg-1 total FA)
120
(b)
PUFA (g kg-1 total FA)
(a)
MUFA (g kg-1 total FA)
SFA (g kg-1 total FA)
720
Oct
Mar
May
Aug
Oct
Mar
May
Figure 1. Effect of organic (black bars) and non-organic (white bars) low-input production systems on the fatty acid composition of milk fat.
(a) SFA, saturated fatty acids; (b) MUFA, monounsaturated fatty acids; (c) PUFA, polyunsaturated fatty acids; (d) ALA, -linolenic acid; (e) VA,
vaccinic acid; (f) CLA, conjugated linoleic acid isomer C18:2 c9 t11; means for organic and non-organic low input systems are significantly
different according to Tukeys honest significant difference test. Error bars indicate standard error of mean values. Two-way ANOVA (with
production system and date as factors) identified significant differences (a) between production systems for VA (P = 0.041) and CLA (P = 0.012)
and (b) between dates for PUFA (P = 0.028), VA (P = 0.005) and CLA (P < 0.0001). Significant interactions between system and date were
identified for PUFA (P = 0.020), VA (P = 0.029) and CLA (P < 0.030).
*
30
25
20
1
Aug
Oct
12
Mar
Aug
May
Oct
1.5
(d)
*
*
Lutein (mg kg-1 fat)
b carotene (mg kg-1 fat)
(b)
Mar
1.0
0.5
4
Aug
Oct
Mar
May
(c)
10
5
Aug
Oct
0.3
(e)
15
May
Zeaxanthin (mg kg-1 fat)
Total carotenoids (mg kg-1 fat)
35
(a)
3R a toc (mg kg-1 fat)
2R a toc (mg kg-1 fat)
Mar
May
(f)
*
*
0.2
0.1
Aug
Oct
Mar
May
Aug
Oct
Mar
May
Figure 2. Effect of organic (black bars) and non-organic (white bars) low-input production systems on the levels of fat-soluble antioxidants in milk
fat. (a) 2R -toc, 2R stereoisomers of -tocopherol; (b) 3R -toc, 3R stereoisomers of -tocopherol; (c) total carotenoids; (d) -carotene; (e); lutein,
(f); zeaxantin; means for organic and non-organic low-input systems are significantly different according to Tukeys honest significant difference
test. Error bars indicate standard error of mean values. Two-way ANOVA (with production system and date as factors) identified significant
differences (a) between production systems for -carotene (P = 0.003), lutein (P = 0.004), zeaxantin (P = 0.027) and total carotenoids (0.002), and
(b) between dates for 2R -toc (P = 0.0005), 3R -toc (P = 0.0005), -carotene (P = 0.005), lutein (P = 0.0008), zeaxantin (P = 0.002) and total
carotenoids (0.003). A significant interaction between system and date was only identified for 2R -toc (P = 0.003).
DISCUSSION AND CONCLUSIONS

Effect of feeding regimes on milk fat
composition: outdoor grazing period
The finding of lower percentages of SFA and
contrasting higher percentages of MUFA in milk from
the NO-LI system and higher PUFA (specifically -LA
and CLA9) and antioxidant content (-tocopherol and
carotenoids) of milk from both LI systems, compared
J Sci Food Agric 88:14311441 (2008)
DOI: 10.1002/jsfa
with that from HI farms during the outdoor grazing

period, is not surprising in view of the contrasting
diets. The two LI systems used a high level of fresh
forage (>80% of DMI), with only half that level
(<40%) used in HI systems. Increasing the level of
fresh forage by similar margins was previously shown
to elevate nutritionally desirable PUFA, CLA, -LA
and antioxidant percentages in milk17 21,27 to those
1437
G Butler et al.
found in milk from LI and HI systems here. For

example, CLA concentrations were previously shown
to increase with the proportion of fresh grass intake,
while high proportions of maize silage and/or cerealbased concentrates reduced CLA content.17,18,33 Also
cutting and transport of grass to housed animals (a
practice used to increase milk yield in zero-grazing
systems) was also shown to decrease the CLA and VA
content of milk by 50% and that of LA content by
30%, compared to milk from cows grazing pasture.34
This response may have been due to rapid lipolysis of
PUFA after harvest and/or a modification of rumen
biohydrogentation.27
The finding that concentrations of CLA9 were
significantly higher in milk from LI than HI systems,
while concentrations of CLA10 were similar in both
systems, was likely to be caused by contrasting effects
of LI and HI diets on the biosynthesis of CLA9
which is mainly (7090%) generated from VA in
the mammary gland, and that of CLA10 which is
a minor intermediate of rumen biohydrogenation.19
Table 4. Fatty acid composition and fat-soluble antioxidant
concentrations in milk from conventional high-input and organic and
non-organic low-input dairy production systems, during the indoor
conserved forage-based feeding period (mean values, with standard
error of means in parentheses)
Characteristic
assessed
High-input
Low-input
organic
ANOVA
(P-value)
Number of samples
Milk yield/cow (kg)
Protein content (g kg1 )
Fat content (g kg1 )
21
10
26.5 (1.0)
33.0 (0.3)
40.8 (0.5)
19.1 (1.3)
33.1 (0.6)
42.1 (0.7)
0.0014
0.803
0.235
712 (6)
254 (5)
53 (2)
740 (11)
228 (10)
51 (4)
0.041
0.028
0.730
milk fat)
5.3 (0.5)
0.2 (0.02)
21.7 (1.3)
0.30 (0.04)
7.3 (0.9)
0.2 (0.03)
16.4 (0.7)
0.42 (0.06)
0.052
0.127
0.018
0.114
VA and CLA isomers (g kg1 milk fat)

VA C18:1 t11
16.4 (1.0)
CLA C18:2 c9 t11
6.2 (0.04)
CLA C18:2 t10 c12
0.31 (0.01)
17.5 (2.3)
7.8 (0.21)
0.34 (0.02)
0.636
0.111
0.139
Fatty acid groups (g kg1 milk fat)
Total SFA
Total MUFA
Total PUFA
1
Omega 3 and 6 FA (g kg
-LA C18:3 c9 c12 c15
LA C18:3 c6 c9 c12
Total n-6
n-3:n-6 ratio
Fat-soluble antioxidants (mg kg1 milk fat)
-Tocopherol
2R -toc
RRR -toc
Total -tocopherol
3.5 (0.4)
20.4 (0.9)
23.9 (1.0)
2.8 (0.4)
20.3 (1.5)
23.1 (1.6)
0.360
0.776
0.513
Carotenoids
B-carotene
Lutein
Zeaxantin
Total carotenoids
5.49 (0.41)
0.37 (0.03)
0.12 (0.01)
5.98 (0.44)
6.29 (0.64)
0.48 (0.06)
0.14 (0.01)
6.90 (0.68)
0.359
0.081
0.265
0.314
SFA, saturated fatty acids; MUFA, monounsaturated fatty acids

( >80% oleic acid); PUFA, polyunsaturated fatty acids; -LA, linolenic acid; 2R -toc, 2R stereoisomers of -tocopherol; RRR -toc,
3R stereoisomers of -tocopherol.
1438
Previous studies have shown that VA in the rumen

increases with increasing fresh forage and decreasing
concentrate levels in dairy diets, while CLA10
generation in the rumen is relatively unaffected by
changes in the diet except at very high levels of
concentrate feeding.17,20
The greater dietary contribution from fresh forage
is also the most likely explanation of elevated levels
of RRR tocopherol and carotenoids in milk from the
LI herds during the grazing period, compared to the
HI milk. Transfer of -carotene and -tocopherol into
milk was reported to be directly proportional to dietary
supply, being highest in spring grazing.21
Effect of feeding regimes on milk fat
composition: indoor period
Few significant differences and trends in milk fat
composition were found between HI and O-LI
production systems during the indoor period when
cows were fed conserved forage-based diets. This
may have been due to feeding regimes used by OLI and HI herds being more similar during the
indoor compared with the outdoor feeding period.
The higher SFAs and lower MUFA content of
organic milk during this feeding period are difficult
to explain, since previous studies have shown that
fresh forage intake (24% in organic as opposed to
none in conventional winter diets) increases dietary
PUFA supply.20,27 However, some previous studies
have reported lower biohydrogenation rates for highconcentrate indoor diets,17,20 suggesting that the
higher proportion of concentrate in the HI diets results
in lower biohydrogenation and thereby lower SFA and
higher MUFA, and that this effect overrides the effect
of higher fresh forage intake in the O-LI animals. In
order to allow milk from organic or LI production
systems to be marketed as having added nutritional
value throughout the year, efforts need to be made
to achieve higher concentrations of at least some
to the nutritionally desirable compounds during the
indoor feeding period, if year-round grazing is not an
option. This could be achieved by supplementation of
conserved forage-based winter diet with oil seeds (e.g.,
rapeseed, linseed, sunflower seed), a practice shown
to significantly improve -LA, VA, CLA9 and/or fatsoluble antioxidant concentrations in milk.12,17,33,35 37
Changes to the forage conservation methods may also
increase the content of desirable FAs. For example,
using hay rather then silage was also shown to increase
the -LA content in milk by up to 50%.33,38 It is
interesting to note that in the UK it is very difficult
to find farms feeding hay rather than silage, except
among very traditional organic producers that work
to biodynamic farming principles (which strongly
recommend the use of hay for milking cows).
Effect of vitamin feed supplements on
antioxidant concentrations in milk
Results of the study reported here suggest that the
addition of synthetic vitamin/antioxidant supplements
J Sci Food Agric 88:14311441 (2008)
DOI: 10.1002/jsfa
to feed in HI systems has a relatively minor effect on

antioxidant concentrations in milk. For example, milk
from HI herds, which received high levels of vitamin
E supplements (in our study between 450 and 750
IUs vitamin E per day) contained significantly lower
concentrations of total -tocopherol during grazing
than milk from farms working to organic farming
standards, which do not permit feed supplementation
with synthetic vitamins. It is particularly interesting
that the concentration of the 2R stereoisomer of tocopherol was not significantly higher in milk from the
HI systems. The 2R stereoisomers account for most of
the -tocopherol in synthetic vitamin E supplements,
but are virtually absent from natural sources of tocopherol such as forage. This indicates either poor
uptake of the 2R stereoisomers in the gastrointestinal
system and/or preferential/selective uptake/transfer of
3R stereoisomers from the blood into milk in the
udder, as reported previously.22
Potential effects of seasonal forage composition
and availability on milk fat
Differences in milk quality (both fatty acid profiles
and antioxidant levels) were also detected between
spring block calving O-LI and NO-LI systems which
appeared to have very similar dietary regimes. These
were more likely due to variation in the composition
and/or total forage availability between the two systems
over the season, since both systems grazed cows
throughout the lactation and used very low levels
of supplementary feeds such as conserved forage or
concentrate. The finding that, in August, milk from
O-LI systems had higher percentages of -LA than
milk from NO-LI systems is not surprising, and is
likely to be due to a combination of two factors.
Firstly, the use of mineral (especially N) fertilizers in
the NO-LI system, a practice which has been shown to
suppress the relative amounts of white clover in grass
clover swards,39,40 and secondly, the impact of higher
clover content causing elevation in concentrations of
n-3 FAs in milk compared with ryegrass.27 However,
it should be noted that most of the studies reviewed
by Dewhurst et al.27 that compared the effect of clover
and rye grass used ensiled forage, where reduced
lipolysis in clover would have a greater influence
over PUFA supply compared with fresh forage. The
significantly higher CLA and antioxidants in milk from
NO-LI systems are more difficult to explain, but may
be related to differences in the nutritional composition
of the herbage resulting from the grazing systems used
(e.g., the length of time allowed for pasture regrowth
between grazing periods), which has also been shown
to affect the fatty acid composition of milk.27 Milk
yields, protein and urea content in this study (data
not shown) did not differ at times when differences
in milk fat composition were detected between the
two LI systems. This suggests that differences in
milk fat composition were unlikely to be linked to
contrasting energy or protein supply levels. However,
since sward composition and total forage availability
J Sci Food Agric 88:14311441 (2008)
DOI: 10.1002/jsfa
were not monitored in the study reported here this will

have to be tested in future studies.
Potential effects of dairy genotypes on milk fat
composition
The higher proportion of fresh forage in the dairy
diet is likely to have been the main reason for
the differences in milk composition. However, since
contrasting dairy genotypes (breed index) were used
in different production systems this may also have
contributed to the differences in milk composition
recorded between systems.
There is relatively little quantification of the effect of
breed on fatty acid composition, although breed effects
on CLA and antioxidant content have been reported
to vary by up to 1520% between breeds.21,35 This
differential is considerably lower than the 6099%
for CLA9 and 30140% for antioxidants measured
between HI and LI systems recorded in this study.
The finding of substantial differences in milk fat
composition between HI and LI systems during the
outdoor grazing period, but similar milk composition
during the indoor feeding period, also suggests that
the differences in feeding regimes (rather than dairy
genotypes) were the main factors responsible for
the milk composition differences between systems.
However, the exact influence of breed relative to
dietary supply and possible interaction needs to be
determined in future studies.
Potential nutritional impacts of differences in
milk fat composition
Differences in nutritionally desirable FA and antioxidants between HI and LI systems during the grazing
period were generally quite large (65% and 45% for
-LA, 60% and 99% for CLA9, 33% and 50% for
-tocopherol, 30% and 74% for -carotene, 67% and
148% for lutein and 46% and 82% for zeaxanthin, for
O-LI and NO-LI systems, respectively). This confirms
previously published comparisons of conventional and
organic, low-input production systems carried out in
Germany, Italy and the UK.14 16
Consumption of milk and milk products from LI
systems produced during this period may therefore
contribute significantly to increasing the intake of these
compounds in line with nutritional recommendations.
Importantly, the higher percentages of nutritionally
desirable PUFA (CLA9 and -LA) found in milk from
LI systems did not coincide with a significant increase
in nutritionally less desirable PUFA (e.g., CLA10,
total n-6 FA). Also, the higher n-3 FA and lower n-6
FA percentages found in milk from LI systems resulted
in a higher n-3:n-6 FA ratio, which is also considered
nutritionally desirable.4,10,12,27,41
Even if trends of elevated -LA and lutein in organic
milk produced during housing were confirmed, it
is clear that consumption of organic milk produced
during the indoor winter period will not increase the
intake of nutritionally desirable compounds to the
same extent as low-input milks produced during the
outdoor grazing period.
1439
G Butler et al.
While CLA9 and n-3 FA have been linked to a

range of beneficial impacts on health,10 13 it should
be pointed out that it is currently uncertain whether
the main n-3 FA found in milk, -linolenic acid (LA;
C18:3 c9 c12 c15), has similar effects on human
health as the long-chain n-3 FAs found mainly in
fish oil (C20 or longer), which have been shown
to protect against coronary heart disease, associated
with improved neurological function and linked to
reduced risk of type 2 diabetes, hypertension and
certain cancers.10,12,41,42 These long-chain n-3 fatty
acids are known to be present at low levels in milk
fat27 and were not determined in this study. However,
there is now both direct and indirect evidence that
significant levels of longer-chain n-3 FAs, especially
eicosapentaenoic acid (EPA; C20:5 n-3) and to a lesser
extent docosahexaenoic acid (DHA; C22:6 n-3), are
generated from LA in humans.42
The impact of fat-soluble antioxidants/vitamins on
human health has been reviewed extensively.24,43 45
Beneficial effects of increased dietary -tocopherol (a
compound belonging to the vitamin E group) intake
on human health have mainly been linked to its ability
to reduce oxidative stress, which was shown to be a
risk factor for a number of chronic health conditions
including cardiovascular disease, cancer, impaired
immunity and premature ageing.45 Carotenoids can
act as precursors for vitamin A, although a range
of health benefits were linked to their antioxidant
properties, and thought to be independent from their
contribution to vitamin A generation.46
With respect to the current availability of milk from
LI systems for consumers, it should be emphasized
that milk from organic producers is identifiable and
widely available, while milk from the non-organically
certified LI farms is currently mixed with milk from
HI conventional systems in the supply chain and is
not available to consumers. Given the apparently high
nutritional quality of milk produced in NO-LI-systems
it is important that this practice is reviewed in order
to take advantage of the price premiums that can
currently be achieved by nutritionally enhanced food
products.47
When data for all sampling dates were pooled, the
concentration of -LA was elevated by 60% and that
of CLA9 by 64% in the organic compared to HI
milk (-LA; mean = 9.4, SE = 0.3 versus mean = 5.7,
SE = 0.3 g kg1 fat, P < 0.001 and CLA9; mean =
12.2, SE = 0.7 versus mean = 7.5, SE 0.4 g kg1 fat,
P < 0.001 for O-LI and HI milk, respectively). These
data may help explain why consumption of organic
dairy produce has been shown to have a significant
impact on the CLA content of breast milk in lactating
woman48 and on the eczema risk during the first
2 years of life.49 It is now important to (a) identify
exactly those production system components in
organic, LI and conventional farming systems that are
responsible for differences in milk composition and
(b) to allow agronomic strategies in dairy production
1440
to be optimized further with respect to compounds

that can be linked to positive health impacts.
ACKNOWLEDGEMENTS
The authors gratefully acknowledge financial support
from the European Community under the 6th framework programme Integrated Project QualityLowInputFood, FP6-FOOD-CT-2003-506358 and the UK
Red Meat Industry Forum (RMIF). The help and
advice of the Grasshoppers dairy producers group,
Acorn Dairies and all producers taking part in the
study are also gratefully acknowledged.
REFERENCES
1 Jones EL, Shingfield KJ, Kohen C, Jones AK, Lupoli B, Grandison AS, et al, Chemical, physical, and sensory properties of
dairy products enriched with conjugated linoleic acid. J Dairy
Sci 88:29232937 (2005).
2 Kristensen D, Hedegaard RV, Nielsen JH and Skibsted LH,
Oxidative stability of buttermilk as influenced by the fatty
acid composition of cows milk manipulated by diet. J Dairy
Res 71:4650 (2004).
3 Thorsdottir I, Hill J and Ramel A, Short communication:
seasonal variation in cis-9, trans-11 conjugated linoleic acid
content in milk fat from Nordic countries. J Dairy Sci
87:28002802 (2004).
4 Givens DI, The role of animal nutrition in improving the
nutritive value of animal-derived foods in relation to chronic
disease. Proc Nutr Soc 64:395402 (2005).
5 Havemose MS, Weisbjerg MR, Bredie WLP and Neilsen JH,
Oxidative stability of milk influenced by fatty acids,
antioxidants, and copper derived from feed. J Dairy Sci
89:19701978 (2006).
6 Chen S, Bobe G, Zimmerman S, Hammond EG, Luhman CM,
Boylston TD, et al, Physical and sensory properties of dairy
products from cows with various milk fatty acid compositions.
J Agric Food Chem 52:34223428 (2004).
7 Gonzalez S, Duncan SE, OKeefe SF, Sumner SS and Herbein JH, Oxidation and textural characteristics of butter
and ice cream with modified fatty acid profiles. J Dairy Sci
86:7077 (2003).
8 Lynch JM, Lock AL, Dwyer DA, Noorbakhsh R, Barbano DM
and Bauman DE, Flavour and stability of pasteurized milk
with elevated levels of conjugated linoleic acid and vaccenic
acid. J Dairy Sci 88:489498 (2005).
9 Parodi PW, Conjugated linoleic acid in food, in Advances
in Conjugated Linoleic Acid Research (2nd edn), ed. by
Christie WW, Sebedio JL and Adlof RO. AOCS Press,
Champaign, IL, pp. 101122 (2003).
10 Connor WE, Importance of n-3 fatty acids in health and
diseases. Am J Clin Nutr 7:171S175S (2000).
11 Pariza MW, The biological activities of conjugated linoleic acid,
in Advances in Conjugated Linoleic Acid Research (2nd edn),
ed. by Christie WW, Sebedio JL and Adlof RO. AOCS Press,
Champaign, IL, pp. 1220 (2003).
12 Lock AL and Bauman DE, Modifying milk fat composition of
dairy cows to enhance fatty acids beneficial to human health.
Lipids 39:11971206 (2004).
13 Wahle KWJ, Heys SD and Rotondo D, Conjugated linoleic
acids: are they beneficial or detrimental to health? Rec Prog
Lipid Res 43:553587 (2004).
14 Bergamo P, Fedele E, Iannibeli L and Marzillo G, Fat soluble
vitamin contents and fatty acid composition in organic and
conventional Italian dairy products. Food Chem 82:625631
(2003).
15 Ellis KA, Innocent D, Grove-White D, Cripps P and McLean
WG, Comparing the fatty acid composition of organic and
conventional milk. J Dairy Sci 89:19381950 (2006).
J Sci Food Agric 88:14311441 (2008)

DOI: 10.1002/jsfa

16 Jahreis G, Fritsche J and Steinhart H, Conjugated linoleic acid
in milk fat: high variation depending on production system.
Nutr Res 17:14791484 (1997).
17 Chilliard Y, Glasser F, Ferlay A, Rouel J and Doreau M, Diet,
rumen biohydrogenation and nutritional quality of cow and
goat milk fat. Eur J Lipid Sci Technol 109:828855 (2007).
18 Jensen RG, The composition of bovine lipids: January 1995 to
December 2000. J Dairy Sci 85:295350 (2002).
19 Walker GP, Dunshea FR and Doyle PT, Effects of nutrition and
management on the production and composition of milk fat
and protein: a review. Aust J Agric Res 55:10091028 (2004).
20 Dewhurst RJ, Targets for milk fat research: nutrient, nuisance
or nutraceutial? J Agric Sci 143:359367 (2005).
21 Jensen SK, Johannsen AKB and Hermansen JE, Quantitative
secretion and maximal secretion capacity of retinol, carotene and -tocopherol into cows milk. J Dairy Res
66:511522 (1999).
22 Meglia GE, Jensen SK, Lauridsen C and Waller KP, Tocopherol concentration and stereoisomer composition in
plasma and milk from dairy cows fed natural and synthetic
vitamin E around calving J Dairy Res 7:227234 (2006).
23 Havemose MS, Weisbjerg MR, Bredie WLP and Neilsen JH,
Influence of feeding different types of roughage on the
oxidative stability of milk. Int Dairy J 14:563570 (2004).
24 Schneider C, Review: chemistry and biology of vitamin E. Mol
Nutr Food Res 49:730 (2005).
25 Soil Association Certification, Organic Standards, No. 10.13.34.
Soil Association Certification, Bristol, UK (2005).
26 McCall DG and Clark DA, Optimized dairy grazing systems in
the northeast United States and New Zealand. II. System
analysis. J Dairy Sci 82:18081816 (1998).
27 Dewhurst RJ, Shingfield KJ, Lee MRF and Scollan ND,
Increasing the concentrations of beneficial polyunsaturated
fatty acids in milk produced by dairy cows in high-forage
systems. Anim Feed Sci Technol 131:168206 (2006).
28 Toledo P and Andren A, Content of beta carotene in organic
milk. J Food Agric Environ 1:122125 (2003).
29 Neilsen JH, Lund-Neilsen T and Skibsted L, Higher antioxidant content in organic milk than in conventional milk
due to feeding strategy, in Newsletter from Danish Research
Centre for Organic Farming. 2004:3. [Online]. Available:
http://www.darcof.dk/enews/sep04/milk.html [July 2007].
30 Oklahoma State University, Breeds of Livestock (2007). [Online].
Available: www.ansi.okstate.edu/breeds/cattle/ [27 March
2008].
31 Pinheiro JC and Bates DM, Mixed-Effects Models in S and S-Plus.
Springer, New York (2000).
32 R Development Core Team, A Language and Environment for
Statistical Computing. R Foundation for Statistical Computing,
Vienna, Austria (2005).
33 Shingfield KJ, Reynolds CK, Lupoli B, Tolvonen V, Yurawecz
MP, Delmonte P, et al, Effect of forage type and proportion
of concentrate in the diet on milk fatty acid composition in
cows given sunflower oil and fish oil. Anim Sci 80:225238
(2005).
J Sci Food Agric 88:14311441 (2008)

DOI: 10.1002/jsfa
34 Offer NW, Effects of cutting and ensiling grass on levels of

CLA in bovine milk, in Proceedings of the 13th International
Silage Conference, ed. by Gechie LM and Thomas C. Scottish
Agricultural College, Auchincruive, Ayr, UK, pp. 1617
(2002).
35 Dhiman TR, Nam S and Ure AL, Factors affecting conjugated
linoleic acid content in milk and meat. Crit Rev Food Sci Nutr
45:463482 (2005).
36 Collomb M, Schmid A, Sieber R, Wechsler D and Ryhanen EL,
Conjugated linoleic acids in milk fat: variation and physiological effects. Int Dairy J 16:13471361 (2006).
37 Collomb M, Sollberger H, Butikofer

U, Sieber R, Stoll W and
Schaeren W, Impact of a basal diet of hay and fodder beet
supplemented with rapeseed, linseed and sunflower seed on
the fatty acid composition of milk fat. Int Dairy J 12:549559
(2004).
38 Shingfield KJ, Salo-Vaa nanen P, Pahkala E, Toivonen V,
Jaakkola S, Piironen V, et al, Effect of forage conservation
method, concentrate levels and propylene glycol on the fatty
acid composition and vitamin content of cows milk. J Dairy
Sci 72:349361 (2005).
39 Frame J and Newbould P, Agronomy of white clover. Adv Agron
40:188 (1986).
40 Marriott CA, Seasonal variation in white clover content and
nitrogen fixing (acetylene reducing) activity in a cut upland
sward. Grass Forage Sci 43:253262 (1988).
41 Sanderson P, Finnegan YE, Williams CM, Calder PC, Brudge
GC, Wootton SA, et al, UK Food Standards Agency linolenic acid workshop report. Br J Nutr 88:573579 (2002).
42 Burdge GC and Calder PC, -Linolenic acid metabolism in
adult humans: the effects of gender and age on conversion
to longer-chain polyunsaturated fatty acids. Eur J Lipid Sci
Technol 107:426439 (2005).
43 Bendich A, Physiological role of antioxidants in the immune
system. J Dairy Sci 76:27892794 (1993).
44 Kayden HJ and Traber MG, Absorption, lipoprotein transport
and regulation of plasma concentrations of vitamin E in
humans. J Lipid Res 34:343358 (1993).
45 Willcox JK, Ash SL and Catignani GL, Antioxidants and
prevention of chronic disease. Crit Rev Food Sci Nutr
44:275295 (2004).
46 Spears JW, Micronutrients and immune function in cattle. Proc
Nutr Soc 59:587594 (2000).
47 Lampkin N, Measures M and Padel S, 2002/03 Farm Management Handbook, ed. by Lampkin N, Measures M and Padel S.
Organic Farming Research Centre, Ceredigion, UK (2002).
48 Rist L, Muller A, Barthel C, Snijders B, Jansen M, Simoes AP, et al, Influence of organic diet on the amount of
Wust
conjugated linoleic acids in breast milk of lactating women in
the Netherlands. Br J Nutr 97:735743.
49 Kummeling I, Thijs C, Huber M, van de Vijver LPL, Snijders BEP, Penders J, et al, Consumption of organic foods
and risk of atopic disease during the first 2 years of life in the
Netherlands. Br J Nutr 99:598605.
1441
J Sci Food Agric 88:14421447 (2008)
Protective effect of polyphenol-rich

extract prepared from Malaysian cocoa
(Theobroma cacao) on glucose levels and lipid
profiles in streptozotocin-induced diabetic rats
Azli Mohd Mokhtar Ruzaidi,1,2 Maleyki Mhd Jalil Abbe,1 Ismail Amin,1
Abdul Ghani Nawalyah1 and Hamid Muhajir3
1 Department
of Nutrition and Dietetics, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor,
Malaysia
2 Biotechnology Research Institute, Universiti Malaysia Sabah, 88999 Kota Kinabalu, Sabah, Malaysia
3 Department of Microbiology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor,
Malaysia
Abstract
BACKGROUND: Cocoa beans are used for preparing cocoa liquor and cocoa powder, which are the main
ingredients of cocoa-based products. Previous studies have reported the health benefits of cocoa polyphenols in
reducing the risk of cardiovascular diseases. However, there is no report on the efficacy of cocoa polyphenols on
diabetes mellitus. Therefore this study was designed to evaluate the protective effect of cocoa polyphenol-rich
extract (CE) on glucose levels and lipid profiles in streptozotocin (STZ)-induced diabetic rats. Male SpragueDawley rats were divided into diabetic control, diabetic CE and diabetic glibenclamide groups.
RESULTS: Three different dosages of CE (10, 20 and 30 mg per 100 g body weight) were administered orally once
a day for 1 week before STZ injection and for 3 weeks thereafter. The results showed that CE could normalise
the body weight loss caused by STZ. In the 20 mg CE-pretreated group there was a 143% increase in plasma
glucose levels, compared with a 226% increase in diabetic control rats. CE could also normalise total cholesterol,
triglycerides and high-density lipoprotein cholesterol at the end of the experiment compared with the baseline.
CONCLUSION: The present study suggests that pretreatment with CE from roasted cocoa beans could prevent
the development of diabetes induced by STZ injection in rats.
Keywords: Theobroma cacao; cocoa extract; glucose levels; hypoglycaemic
INTRODUCTION
There are several ways of preventing diabetes and/or
controlling its progression. Public and professional
awareness of the risk factors and symptoms of diabetes
is an important step towards its prevention and control.
There is increasing demand by patients for natural
products with antihyperglycaemic activity owing to
the side effects associated with insulin and oral
hypoglycaemic drugs.1,2 Therefore it has become
necessary to look for an economical as well as a
therapeutically effective use of natural products in
prevention and treatment, especially in developing
and underdeveloped countries.
The search for safer and more effective compounds
to protect -cells from inflammatory destruction
is still in progress. Several compounds such as
metallothionein, nicotinamide and ()-epicatechin

have been reported to inhibit the diabetogenic action
of streptozotocin (STZ) or alloxan in animal studies.3,4
Palm Vitee (palm oil vitamin E) has a protective action
against the toxic inflammation caused by STZ.5
Cocoa beans have been reported to be a rich source
of polyphenols, especially ()-epicatechin. Some of
the earliest studies established that the major flavanoids in cocoa beans were catechin, epicatechin,
the dimers epicatechin-(4 8)-catechin (procyanidin B-l) and epicatechin-(4 8)-epicatechin (procyanidin B-2) and the trimer [epicatechin-(4 8)]2 epicatechin (procyanidin C-l).6,7 In a previous study
we showed that a diet containing cocoa polyphenolrich extract reduced the glucose levels and lipid profiles in STZ-induced diabetic rats.8 In similar work,
Correspondence to: Ismail Amin, Department of Nutrition and Dietetics, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400 Serdang,
Selangor, Malaysia
E-mail: amin@medic.upm.edu.my
(Received 3 July 2007; revised version received 21 January 2008; accepted 21 January 2008)
Protective effect of polyphenol-rich cocoa extract in diabetic rats
Osakabe et al.9 demonstrated that proanthocyanidins derived from cocoa inhibited diabetes-induced
cataract formation. However, limited research has
been conducted on the protective effect of cocoa
polyphenol-rich extract (CE) against STZ diabetogenic action. Therefore the present study was focused
on evaluating the protective action of CE against the
destruction of insulin-producing -cells of the pancreas in STZ-induced diabetic rats.

Preparation of ethanolic extract
Raw (fermented and dried) Malaysian cocoa beans
were purchased from KL-Kepong Cocoa Products
Sdn. Bhd. (Port Klang, Selangor, Malaysia). The
beans were roasted in an air oven for 20 min
at 140 C.10 After cooling to room temperature,
the roasted beans were deshelled using a cocoa
breaker (Limprimita, John Gordon & Co., Laneashire
UK). The cotyledons were ground and defatted
with petroleum ether (b.p. 4060 C) in a Soxhlet
apparatus. The defatted cotyledons were air dried to
remove the solvent residue. The extract was prepared
by treating the defatted powder with 80% (v/v) ethanol
for 2 h. The ethanol residue was removed from the
extract using a rotary evaporator (Rotavor R-200,
Buchi,
Flawil, Switzerland) for 20 min at 70 C and
the resulting extract was lyophilised. This ethanolic
extract was considered to be cocoa polyphenol-rich8
and was used for total phenolic determination and the
animal study.
Determination of total phenolics
Total phenolic content was estimated according to the
FolinCiocalteu assay.11 Briefly, CE was dissolved
in 80% (v/v) ethanol and centrifuged (Rotofix
32, Hettich Zentrifugen, Tuttlingen, Germany) at
1000 g for 15 min. Following centrifugation, 100 L
of the supernatant was mixed with 0.75 mL of
FolinCiocalteu reagent (previously diluted 1:10
with distilled water) and allowed to stand at room
temperature for 5 min. Sodium carbonate solution
(0.75 mL) was then added to the mixture. After
standing for a further 90 min at room temperature,
the absorbance at 725 nm was recorded using a
UVvisible spectrophotometer (Anthelie Advanced
5, Secomam, Ales, France). A standard calibration
curve was constructed using 0.020.12 mg mL1 ()epicatechin (Sigma, St Louis, MO, USA). Results
were expressed as mg epicatechin equivalents g1
extract.
Animal study
Preparation of animals
This study has been approved by the Animal Care
and Use Committee of the Faculty of Medicine and
Health Sciences, Universiti Putra Malaysia. Fifty male
Sprague-Dawley rats (200350 g initial weight) were
purchased from Syarikat Usaha Cahaya Sdn. Bhd.
J Sci Food Agric 88:14421447 (2008)
DOI: 10.1002/jsfa
(Batu Caves, Selangor, Malaysia). The rats were

housed in individual plastic cages with stainless steel
covers and kept at room temperature (2428 C)
under a 12/12 h dark/light cycle. Animals were allowed
free access to their respective diets and water. All
rats were allowed 7 days to adapt to the environment
before being given the treatment. The experiment was
conducted for 28 days. Body weights, food intakes and
blood glucose levels were recorded weekly. The rats
were divided into five groups, each consisting of ten
rats (n = 10):
group 1 diabetic rats administered normal
(DC);
group 2 diabetic rats administered 10 mg
CE (DCE1);
CE (DCE2);
CE (DCE3);
glibenclamide (DG).
saline
mL1
mL1
mL1
mL1
CE (10, 20 and 30 mg mL1 ) and glibenclamide

(100 mg mL1 ) were suspended in 0.9% (w/v) normal
saline and given daily (1 mL per 100 g body weight)
to the experimental rats by gastric intubation using a
force-feeding needle. The animals were given CE once
daily for 7 days before STZ injection and for 21 days
thereafter. At day 7 the rats were given CE 1 h before
STZ injection.
Induction of diabetes
STZ (Sigma) was used for inducing diabetes in the
rats at day 7. After overnight fasting, the rats were
injected intravenously with 45 mg kg1 body weight of
STZ dissolved in 0.05 mol L1 citrate buffer (pH 4.5).
Rats injected with the same volume of 0.05 mol L1
citrate buffer served as the control group.
Determination of glucose levels and lipid profiles
At days 0, 9 and 28 of the experiment, 5 mL of
blood was collected from the abdominal aorta of each
animal, placed in a Vacutainer tube and centrifuged
(Universal 32 , Hettich Zentrifugen) at 1000 g for
10 min at room temperature. The supernatant was
collected and kept at 20 C for further analysis.
Plasma glucose levels and lipid profiles were measured
using a chemistry analyser (Automatic Analyser 902,
Hitachi, Tokyo, Japan).
Data were expressed as mean standard error of
mean (SEM). One-way analysis of variance (ANOVA)
was applied to determine differences between groups.
Duncans multiple range test was used to find
significant differences among means. Results were
considered significantly different at the level of P <
0.05.
1443
Table 1. Effect of cocoa extract (CE) on body weight of rats
Body weight (g)a

Group
Diabetic control (DC)
Diabetic + 10 mg CE (DCE1)
Diabetic + glibenclamide (DG)
Initial
Final
328.6 13.7b
325.8 13.4b
323.1 13.3b
320.8 11.8b
313.4 19.3b
222.0 38.0a
251.3 26.3a
280.3 29.2ab
251.0 8.2a
224.0 26.9a
Body weights were measured weekly. Values are expressed as mean

SEM. Different letters indicate significant differences (P < 0.05).
Body weight gain (g)
20
0
1
20
40
60
80
100
120
DC
DCE1
DCE2
DCE3
DG
25
d d
20
bc
DCE1
DCE2
Groups
DCE3
5
0
week 0
week 1
DG
week 4
Figure 2. Plasma glucose levels of diabetic rats pretreated with

cocoa extract (CE): DC, diabetic control; DCE1, diabetic + 10 mg CE;
DCE2, diabetic + 20 mg CE; DCE3, diabetic + 30 mg CE; DG,
diabetic + glibenclamide. Values with different letters are significantly
different (P < 0.05) between groups and weeks.
levels compared with the DC group at the end of the

experiment (day 28).
The plasma total cholesterol levels in all groups
were significantly higher (P < 0.05) at day 9 after
STZ injection compared with day 0 (Fig. 3). At the
end of the experiment (day 28) the total cholesterol
levels in all treated animals were normalised.
Figure 4 shows the effect of CE on plasma highdensity lipoprotein (HDL) cholesterol levels in STZinduced diabetic rats. After STZ injection, all rats
exhibited a significant decrease (P < 0.05) in HDL
cholesterol levels at day 9 compared with day 0. The
reduction in HDL cholesterol levels was in the range
5461%. Interestingly, HDL cholesterol levels were
normalised in CE- and glybenclamide-pretreated rats
at the end of the study. However, no significant change
in plasma low-density lipoprotein (LDL) cholesterol
levels was observed during the 4 week experimental
period (Fig. 5).
There were significant increases (P < 0.05) in
plasma triglyceride levels in DC, DCE1 and DG rats
after STZ injection (Fig. 6). However, in the DCE2
3.5
b b
2.5
2
1.5
1
0.5
0
DCE1
DCE2
DCE3
DG
Groups
Weeks
week 0
1444
cd
bc
bc
10
DC
Figure 1. Pattern of body weight in control rats and those pretreated

with cocoa extract (CE) and glibenclamide: DC, diabetic control;
DCE1, diabetic + 10 mg CE; DCE2, diabetic + 20 mg CE; DCE3,
diabetic + 30 mg CE; DG, diabetic + glibenclamide. The coefficient of
variation for all data was less than 24%. Body weights were
measured weekly.
bc
cd
15
DC
Plasma Total Cholesterol Level

(mmol L1)
RESULTS
The initial body weights of rats were in the range
200350 g. The body weights of each group of rats
were not significantly different before STZ injection
(Table 1). At 21 days after STZ injection the body
weights of DC, DCE1, DCE3 and DG rats were
significantly decreased (P < 0.05) compared with their
initial weights. However, there was no significant
decrease in body weight in the DCE2 group.
All rats exhibited a decrease in body weight gain
after STZ injection at week 1 (Fig. 1). The body
weights of DC and DG rats were drastically decreased
at week 2. However, in the CE-pretreated groups
(DCE1, DCE2 and DCE3) the body weight loss was
much lower compared with the DC group at weeks 2,
3 and 4, though there was no significant difference.
Figure 2 shows the protective effect of CE on
plasma glucose levels in STZ-induced diabetic rats.
At 2 days after STZ injection, i.e. at day 9, glucose
levels increased significantly (P < 0.05) in all groups
compared with the initial glucose levels. In the CEpretreated groups (DCE1, DCE2 and DCE3) and the
glibenclamide-pretreated group (DG) the increase was
significantly lower (P < 0.05) compared with the DC
group at day 9. The increments in glucose levels in
the DC, DCE1, DCE2, DCE3 and DG groups were
226, 163, 143, 156 and 148% respectively. There was
no significant increase in glucose levels in treated rats
at the end of the study (day 28) compared with day
9, except for the DCE3 group. Only the DCE2 group
showed a significant decrease (P < 0.05) in glucose
Plasma Glucose Level (mmol L1)
AMM Ruzaidi et al.
week 1
week 4
Figure 3. Plasma total cholesterol levels of diabetic rats pretreated

with cocoa extract (CE): DC, diabetic control; DCE1, diabetic + 10 mg
CE; DCE2, diabetic + 20 mg CE; DCE3, diabetic + 30 mg CE; DG,
J Sci Food Agric 88:14421447 (2008)

DOI: 10.1002/jsfa
1.2
c
1
bc
0.6
0.4
bc
bc
ab
0.8
DCE2
Groups
DCE3
0.2
0
DC
DCE1
week 0
week 1
DG
Plasma Triglyceride Level (mmol L1)
Plasma HDL-cholesterol Level

(mmol L1)
1
0.9
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
de
de
de
abc
abc
DC
DCE1
week 0
Plasma LDL-cholesterol Level

(mmol L1)
0.5
b
b
ab
ab
ab
ab
ab
0.4
ab ab
ab
ab ab
ab
0.3
0.2
0.1
0
DC
DCE1
week 0
DCE2
Groups
week 1
DCE3
DG
week 4
Figure 5. Plasma LDL cholesterol levels of diabetic rats pretreated

and DCE3 groups the elevation was significantly lower

(P < 0.05) compared with the DC group at day 9.
At the end of the experiment a normalisation of
plasma triglyceride levels was observed in CE- and
glibenclamide-pretreated rats.
DISCUSSION
STZ is a specific -cell toxin and can be used
to chemically induce hyperglycaemia in rats and
mice. It is taken up by pancreatic -cells via a
glucose transporter (GLUT2) and causes alkylation
of deoxyribonucleic acid (DNA).12,13 DNA damage
induces activation of poly adenosine diphosphate
(ADP)-ribosylation, a process that is more important
for the diabetogenicity of STZ than DNA damage
itself.14 Poly ADP-ribosylation leads to the depletion
of cellular nicotinamide adenine dinucleotide (NAD+ )
and adenosine triphosphate (ATP).15 Enhanced ATP
dephosphorylation after STZ treatment supplies a
substrate for xanthine oxidase (XOD), resulting in
the formation of superoxide radicals. Consequently,
J Sci Food Agric 88:14421447 (2008)
DOI: 10.1002/jsfa
abc
DCE2
Groups
DCE3
ab
abc
DG
week 4
Figure 4. Plasma HDL cholesterol levels of diabetic rats pretreated

0.6
cd
bcd
week 1
week 4
Figure 6. Plasma triglyceride levels of diabetic rats pretreated with

cocoa extract (CE): DC, diabetic control; DCE1, diabetic + 10 mg CE;
DCE2, diabetic + 20 mg CE; DCE3, diabetic + 30 mg CE; DG,
hydrogen peroxide and hydroxyl radicals are also

generated. Furthermore, STZ liberates toxic amounts
of nitric oxide (NO), which inhibits aconitase activity
and participates in DNA damage.15 As a result of the
action of STZ, -cells undergo destruction by necrosis.
In this study the total polyphenol content of CE
was in the range 190286 mg epicatechin equivalents
g1 extract. A previous study showed that cocoa beans
are rich in polyphenols such as ()-epicatechin, (+)catechin, quercetin and procyanidin.16 To evaluate the
protective effect of CE against STZ-induced diabetes
in rats, CE (10, 20 and 30 mg mL1 ) was force-fed
daily to the rats for 1 week before STZ injection. On
the last day of pretreatment (day 7), CE was given
to the rats 1 h before STZ injection. This procedure
was based on the findings of Baba et al.,17 which indicated that ()-epicatechin metabolite occurred at its
maximum level in plasma between 30 and 60 min
after rats were given a cocoa beverage. Our results
showed that CE administration significantly lowered
(P < 0.05) the hyperglycaemic action of STZ in the
DCE2 group. Treatment with CE also seemed to prevent body weight loss and improve body weight to
some extent. Thus pretreatment with CE could be
effective in preventing the development of hyperglycaemia following STZ injection. Kamtchouing et al.18
also reported that Anacardiaceae (Anacardium occidentale) extract showed a protective effect against
the diabetogenic action of STZ. Moreover, Gupta
et al.19 showed that neem seed extract had a protective effect on the heart and erythrocytes of diabetic
rats. It is suggested that CE may have reacted with or
scavenged STZ. Superoxide dismutase (SOD) is an
enzyme known to be part of the antioxidant defence
system of cells and a scavenger of free radicals. Vucic
et al.20 reported that the activity of SOD is low in
diabetes mellitus. CE may have acted by increasing
the resistance of -cells through activating SOD and
scavenging free radicals caused by STZ. This scenario
is supported by Sabu et al.,21 who found that green
1445
AMM Ruzaidi et al.
tea polyphenols improved SOD levels in diabetic rats.

The actual mechanisms of this pharmacological effect
have yet to be determined.
The selection of the dose of glibenclamide employed
in this study was based on previous research by
Nagappa et al.22 Glibenclamide is one of the most
widely used orally active drugs (sulfonylureas) for
the treatment of type 2 diabetes mellitus. The
acute hypoglycaemic action of glibenclamide involves
stimulation of insulin and inhibition of glucagon
secretion.23 However, glibenclamide is only effective
when there are still surviving -cells in the pancreas.
In the present study, glibenclamide tended to lower
plasma glucose levels, which may be due to activation
of pancreatic -cells to secrete insulin after a single
administration of glibenclamide. It could be suggested
that the diabetic rats in this study still have some
surviving -cells in the pancreas, though not sufficient
to significantly decrease the plasma glucose levels.
Generally, diabetic models are also used to investigate
successful
treatments
for
hypercholesterolaemia.24 Abnormalities in lipids and
lipoproteins play key roles in the development and
progression of atherosclerotic vascular diseases in
type 1 diabetes mellitus.25 The most common lipid
abnormalities in diabetes mellitus are changes in
plasma cholesterol and triglyceride levels, which certainly contribute to the development of cardiovascular
diseases.26 Hypercholesterolaemia and hypertriglyceridemia have been reported to occur in STZ-induced
diabetic rats in several studies.24,27,28
As to the protective role of CE against STZ
action, rats pretreated with CE and glibenclamide
did not seem to be protected from elevation of
plasma cholesterol levels by STZ. However, after
3 weeks of further treatment with CE, total cholesterol
levels decreased significantly (P < 0.05) and were
normalised in diabetic rats. In contrast, elevation
of triglyceride levels seemed to be significantly
suppressed (P < 0.05) by pretreatment with 20 and
30 mg mL1 CE in diabetic rats. Thus the present
study indicates that CE exhibits protective effects on
triglyceride levels in STZ-induced diabetic rats.
This study suggests that polyphenols, the main components of CE, may be involved in the improvement
of lipid profiles in diabetic rats. The main cause of
elevated cholesterol and triglyceride levels in STZinduced diabetic rats is insulin deficiency. It is well
known that, under normal circumstances, insulin activates the enzyme lipoprotein lipase (LpL), which
then hydrolyses very-low-density lipoprotein (VLDL)
cholesterol.29 However, in insulin-deficient diabetic
rats, LpL is not activated, resulting in hypercholesterolaemia and hypertriglyceridemia. Our present study
already suggests that the glucose-lowering effect of
CE is due to the stimulation of insulin secretion in
-cells. This result is in agreement with a previous
study which demonstrated that cocoa supplementation could increase postprandial insulin secretion
and, to greater extent, improve insulin resistance.30,31
1446
Thus it is possible that the hypocholesterolaemic

and hypotriglyceridemic effect of CE is also due
to an increase in insulin secretion. Although LDL
cholesterol levels did not seem to be affected by CE
treatment, total cholesterol levels were normalised in
diabetic rats after oral administration of CE. Therefore
it can be suggested that CE might possess hypocholesterolaemic and hypotriglyceridemic activity in
STZ-induced diabetic rats.
The most common abnormalities in humans with
poorly controlled type 1 or 2 diabetes are hypertriglyceridemia and low HDL cholesterol levels.32 HDL is the
smallest, densest lipoprotein with the lowest amount
of triglyceride. Lower total cholesterol and higher
HDL cholesterol levels represent a very desirable biochemical state for prevention of atherosclerosis and
ischaemic conditions.33 In its protective role against
STZ action, CE pretreatment did not seem to prevent
plasma HDL cholesterol levels from being reduced
by STZ, but the levels were significantly enhanced
(P < 0.05) after 3 weeks of further treatment with CE.
CONCLUSIONS
The underlying mechanisms responsible for the lack
of a protective effect of CE on lipid profiles are not
entirely understood and still to be determined. This
study indicated that crude cocoa bean extract containing polyphenols and other components might not have
a protective effect against hypercholesterolaemia, but
it does exert a hypocholesterolaemic effect in STZinduced diabetic rats.
ACKNOWLEDGEMENTS
The authors would like to acknowledge the financial
assistance provided by the Ministry of Science,
Technology and Innovation of Malaysia (project IRPA
01-02-04-0013-EA001) and the laboratory facilities of
Universiti Putra Malaysia.
REFERENCES
1 Holman RR and Turner RC, Oral agents and insulin in the
treatment of NIDDM, in Textbook of Diabetes, ed. by Pickup J
and Williams G. Blackwell, Oxford, pp. 467469 (1991).
2 Kameswara RB, Kesavulu MM, Giri R and Apparao C, Antidiabetic and hypolipidemic effects of Momardica cymbalaria
Hook. fruit powder in alloxan diabetic rats. J Ethnopharmacol
67:103109 (1999).
3 Bone AJ, Hii CST, Brown D, Smith W and Howell SL,
Assessment of the antidiabetic activity of epicatechin in
streptozotocin-diabetic and spontaneously diabetic BB/E rats.
Biosci Rep 5:215221 (1985).
4 Yang J and Cherian MG, Protective effects of metallothionein
on streptozotocin-induced diabetes in rats. Life Sci 55:4351
(1994).
5 Wan Nazaimoon WM and Khalid BAK, Palm vitamin E
reduced serum levels of glycated hemoglobin, advanced
glycosylation end-products and malondialdehyde of STZinduced diabetic rats. Diabetes Res Clin Prac 50:S357 (2000).
6 Osakabe N, Yamagishi M, Sanbongi C, Natsume M, Takizawa T and Osawa T, The antioxidative substances in cacao
liquor. Int J Vitam Nutr Res 44:313321 (1998).
J Sci Food Agric 88:14421447 (2008)

DOI: 10.1002/jsfa

7 Porter LJ, Ma Z and Chan G, Cacao procyanidins: major
flavonoids and identification of some minor metabolites.
Phytochemistry 130:16571663 (1999).
8 Ruzaidi A, Amin I, Nawalyah AG, Hamid M and Faizul HA,
The effect of Malaysian cocoa extract on glucose levels
and lipid profiles in diabetic rats. J Ethnopharmacol 98:5560
(2005).
9 Osakabe N, Yamagishi M, Natsume M, Yasuda A and Osawa T,
Ingestion of proanthocyanidins derived from cacao inhibits
diabetes-induced cataract formation in rats. Exp Biol Med
229:3339 (2004).
10 Jinap S, Wan Rosli WI, Russly AR and Nordin LM, Effect of
roasting time and temperature on volatile component profiles
during nib roasting of cocoa bean. J Sci Food Agric 77:441448
(1998).
11 Velioglu YS, Mazza G, Gao L and Oomah BD, Antioxidant
activity and total phenolics in selected fruits, vegetables, and
grain products. J Sci Food Agric 46:41134117 (1998).
12 Elsner M, Guldbakke B, Tiedge M, Munday R and Lenzen S,
Relative importance of transport and alkylation for pancreatic beta-cell toxicity of streptozotocin. Diabetologia
43:15281533 (2000).
13 Thulesen J, Orskov C, Holst JJ and Poulsen SS, Short-term
insulin treatment prevents the diabetogenic action of
streptozotocin in rats. Endocrinology 138:6268 (1997).
14 Sandler S and Swenne I, Streptozotocin, but not alloxan,
induces DNA repair synthesis in mouse pancreatic islets
in vitro. Diabetologia 25:444447 (1983).
15 Pieper AA, Verma A, Zhang J and Snyder SH, Poly (ADPribose) polymerase, nitric oxide and cell death. Trends
Pharmacol Sci 20:171181 (1999).
16 Sanbongi C, Osakabe N, Natsume M, Takizawa T, Gomi S and
Osawa T, Antioxidative polyphenols isolated from Theobroma
cacao. J Agric Food Chem 46:452457 (1998).
17 Baba S, Osakabe N, Natsume M, Yasuda A, Takizawa T,
Nakamura T, et al, Cocoa powder enhances the level of
antioxidative activity in rat plasma. Br J Nutr 84:673680
(2000).
18 Kamtchouing P, Sokeng SD, Moundipa PF, Watcho P, Jatsa
HB and Lontsi D, Protective role of Anacardium occidentale
extract against streptozotocin-induced diabetes in rats.
J Ethnopharmacol 62:9599 (1998).
19 Gupta S, Kataria M, Gupta PK, Murganandan S and
Yashroy RC, Protective role of extracts of neem seeds in
diabetes caused by streptozotocin in rats. J Ethnopharmacol
90:185189 (2004).
20 Vucic M, Gavell M, Bozikov V, Ashcroft JH and Rocic B,
Superoxide dismutase activity in lymphocytes and polymorphonuclear cells of diabetic patients. Eur J Clin Chem Biochem
35:517521 (1997).
J Sci Food Agric 88:14421447 (2008)

DOI: 10.1002/jsfa
21 Sabu MC, Smitha K and Kuttan R, Anti-diabetic activity of

green tea polyphenols and their role in reducing oxidative
stress in experimental diabetes. J Ethnopharmacol 83:109116
(2002).
22 Nagappa AN, Thakurdesai PA, Venkat Rao N and Singh J,
Antidiabetic activity of Terminalia catappa Linn fruits.
J Ethnopharmacol 88:4550 (2003).
23 Landstedt-Hallin L, Adamson U and Lins PE, Oral glibenclamide suppresses glucagon secretion during insulin-induced
hypoglycaemia in patients with type 2 diabetes. J Clin
Endocrinol Metab 84:31403145 (1999).
24 Ohara I, Tabuchi R, Onai K and Econ MH, Effects of modified rice bran on serum lipids and taste preference in
streptozotocin-induced diabetic rats. Nutr Res 20:5968
(2000).
25 Ginsberg HN, Lipoprotein physiology in nondiabetic and
diabetic states. Relationship to atherogenesis. Diabetes Care
14:839855 (1991).
26 Sachdewa A and Khemani LD, Effect of Hibiscus rosa sinensis
Linn. ethanol flower extract on blood glucose and lipid profile
in streptozotocin induced diabetes in rats. J Ethnopharmacol
89:6166 (2003).
27 Cho SY, Park JY, Park EM, Choi MS, Lee MK, Jeon SM,
et al, Alteration of hepatic antioxidant enzyme activities
and lipid profile in streptozotocin-induced diabetic rats by
supplementation of dandelion water extract. Clinical Chimica
Acta 317:109117 (2002).
28 Sharma SR, Dwivedi SK and Swarup D, Hypoglycaemic,
antihyperglycaemic and hypolipidemic activities of Caesalpinia
bonducella seeds in rats. J Ethnopharmacol 58:3944 (1997).
29 Rensen PC and Van Berkel TJ, Apolipoprotein E effectively
inhibits lipoprotein lipase-mediated lipolysis of chylomicronlike triglyceride-rich lipid emulsions in vitro and in vivo. J Biol
Chem 271:1479114799 (1996).
30 Brand-Miller J, Holt SHA, de Jong V and Petocz P, Cocoa
powder increases postprandial insulinemia in lean young
adults. J Nutr 133:31493152 (2003).
31 Grassi D, Necozione S, Lippi C, Croce G, Valeri L,
Pasqualetti P, et al, Cocoa reduces blood pressure and insulin
resistance and improves endothelium-dependent vasodilation
in hypertensives. Hypertension 46:398405 (2005).
32 Ginsberg HN, Diabetic dyslipidemia: basic mechanisms underlying the common hypertriglyceridemia and low HDL cholesterol levels. Diabetes 45:S27S30 (1996).
33 Luc G and Fruchart JC, Oxidation of lipoproteins and
atherosclerosis. Am J Clin Nutr 53:206S209S (1991).
1447
J Sci Food Agric 88:14481454 (2008)
Nutritional and sensory qualities of raw

meat and cooked brine-injected turkey
breast as affected by dietary enrichment with
docosahexaenoic acid (DHA) and vitamin E
`
Carmen Sarraga,
M Dolors Guardia,
Isabel Daz, Luis Guerrero and Jacint Arnau
IRTA, Food Technology, Finca Camps i Armet, E-17121 Monells, Girona, Spain
Abstract
BACKGROUND: This aim of this study was to evaluate the effects of feeding turkeys with docosahexaenoic acid
(DHA) and vitamin E on the fatty acid profile, proteolytic enzyme activities and oxidative status of raw breast
meat and cooked brine-injected breast meat. Four treatments were investigated: T1, basal diet (control); T2,
basal diet plus 15 g kg1 DHA; T3, basal diet plus 100 mg kg1 vitamin E; T4, basal diet plus 5.4 g kg1 DHA plus
100 mg kg1 vitamin E. A sensory analysis of cooked brine-injected breasts was conducted in order to assess the
sensory characteristics of these products and relate them to the expected nutritional benefits.
RESULTS: Among the four treatments tested, no differences were observed in enzyme activities. No activities
of cathepsin B, cathepsins B + L and catalase were detected in cooked brine-injected breast meat. Glutathione
peroxidase activity was reduced and superoxide dismutase activity was similar to that measured in raw meat. The
diets supplemented with DHA increased eicosapentaenoic acid and DHA levels in comparison with the control
in both raw and cooked products. The increase in n-3 polyunsaturated fatty acids (PUFAs) led to a reduction in
n-6/n-3 PUFA ratio to values between 1.01 0.11 and 2.94 0.47. In cooked brine-injected breast, treatment with
15 g kg1 DHA (T2) induced a considerable fishy flavour, while treatment with 5.4 g kg1 DHA plus 100 mg kg1
vitamin E (T4) induced a slight fishy flavour. However, fishy odour in T4 did not differ significantly from that of
the control.
CONCLUSION: By feeding turkeys with 5.4 g kg1 pure DHA plus 100 mg kg1 vitamin E, the nutritional quality
is improved through the introduction of a natural antioxidant and the reduction in n-6/n-3 PUFA ratio. With this
treatment the sensory characteristics were similar to those of control samples, except for the fishy flavour, which
could probably be masked by modifying the technological process.
Keywords: DHA; vitamin E; nutritional quality; enzyme activities; sensory quality; turkey meat
INTRODUCTION
Enrichment of diets with long-chain n-3 polyunsaturated fatty acids (PUFAs), specifically eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA),
gives potential benefits to consumers by reducing the
risk of a number of cardiovascular diseases1,2 and certain neuropsychiatric conditions.3 The n-6/n-3 PUFA
ratio should be reduced to below 4 for a healthy
human diet according to recent studies.4 6 Increasing
the intake of fish and derived products can achieve
this recommended n-6/n-3 PUFA ratio. However, fish
is not always available to or appreciated by many
consumers. In modern dietary trends, consumption
of turkey meat is indicated as an adequate source of
essential fatty acids with a low content of total lipids.
However, the n-3 content can be considered too low to
achieve a healthy n-6/n-3 PUFA ratio when birds are
fed on standard diets. Feeding monogastric animals
with n-3 PUFA-supplemented diets has been recommended as a feasible way to achieve this nutritional
objective.7,8 Vegetable sources of n-3 PUFAs seem
to be less efficient than marine sources in terms of
the modification of fat composition,9,10 although too
high dietary levels can produce some negative sensory
characteristics.11
Poultry meat is prone to oxidation owing to
its inherent relatively high content of PUFAs, so
an enhancement in n-3 content could lead to a
reduction in shelf life and sensory quality.12 14
Studies on the supplementation of diets with different
natural antioxidants such as -carotene, ascorbic
acid, rosemary extracts and oregano15 18 have been
carried out with varying degrees of success, and
dietary vitamin E has demonstrated a high efficiency
in preventing oxidative deterioration and reducing
the development of off-flavours in poultry meat.19,20
Correspondence to: Carmen Sarraga,

IRTA, Food Technology, Finca Camps i Armet, E-17121 Monells, Girona, Spain
E-mail: carmen.sarraga@irta.es
(Received 20 April 2007; revised version received 18 January 2008; accepted 15 February 2008)
Effect of DHA and vitamin E on turkey nutritional and sensory qualities
The oxidative status of meat can be estimated by

the activity of the enzymes glutathione peroxidase
(GSHPx), catalase (CAT) and superoxide dismutase
(SOD),21,22 among others. Moreover, cathepsins B
and L are considered to be the enzymes that are most
involved in texture development during the processing
of some meat products.23 As cathepsins B and L are
cystein proteinases, their activity can be affected by
the oxidative status of meat.24
Despite the numerous studies made on dietary
supplementation of poultry meat with DHA and
vitamin E, there has been hardly any research on
cooked brine-injected turkey products. Therefore the
objective of the present study was to evaluate the
proteolytic activity, antioxidant status and fatty acid
profile of raw breast meat and cooked brine-injected
breast meat from turkeys fed on different DHA- and
-tocopheryl-enriched diets. In addition, a sensory
quantitative descriptive analysis of the cooked brineinjected product was carried out to evaluate the
commercial potential of the different diets.

Birds and dietary treatments
One-day-old female turkeys of the BUT 9 strain were
used. They were housed in flat-deck batteries (6 cm2 )
in a flat-deck battery room. The birds were raised
according to routine practice in terms of light and
temperature and allowed ad libitum access to water
and feed. They were fed on three different basal diets
which contained lard as saturated fat and 20 mg kg1
vitamin E (Table 1) throughout the raising period,
which lasted 12 weeks. The birds were distributed
randomly in four experimental treatments. The test
period covered the fattening time during the last
4 weeks before slaughter.
Treatment 1 (T1): control birds fed on the basal
diets.
Treatment 2 (T2): birds fed on the basal diets with
50% of the lard replaced by 15 g kg1 pure DHA
from tuna oil (Algatrium , Brudy SL, Barcelona,
Spain).
Treatment 3 (T3): birds fed on the basal diets plus
100 mg kg1 -tocopheryl acetate.
Treatment 4 (T4): birds fed on the basal diets with
50% of the lard replaced by 0.54 g kg1 pure DHA
from Algatrium plus 100 mg kg1 -tocopheryl
acetate.
Seven birds from each treatment were slaughtered at
a commercial processing plant. The breast (Pectoralis
major) of each bird was removed and divided into
two sections. One half was vacuum packed in an
aluminium foil bag and stored at 20 C pending raw
meat analysis. The other half was used to prepare a
cooked product.
J Sci Food Agric 88:14481454 (2008)
DOI: 10.1002/jsfa
Table 1. Composition of basal diets
Ingredient (g kg1 )
Wheat
Lard
Soybean meal 48%
Extruded soybean
DL-Methionine
L-Lysine
Calcium carbonate
Dicalcium phosphate
Salt
Choline chloride 50%
Monensine (mg kg1 )
Minerals and vitaminsa
MEa (MJ kg1 )
Gross protein
Gross fibre
04 weeks
58 weeks
912 weeks
418.34
34.09
473.63
20
2.27
0.37
19.50
23.64
3.74
0.42
0.09
4
11.7
280
31
484.63
39.78
416.18
20
1.69
0.95
11.09
18.46
3.18
0.04
0.09
4
12.1
260
31
564.77
60
328.16
1.16
1.9
22.63
15.01
2.38
4
12.55
220
28
A 1 kg portion of feed contained the following: vitamin A, 12 000

IU; vitamin D3 , 2400 IU; vitamin E, 20 IU; vitamin K3 , 3 mg; thiamine,
2.2 mg; riboflavin, 8 mg; pyridoxine, 5 mg; vitamin B12 , 11 g; folic
acid, 1.5 mg; biotin, 150 g; calcium pantothenate, 25 mg; nicotinic
acid, 65 mg; Mn, 60 mg; Zn, 40 mg; I, 0.33 mg; Fe, 80 mg; Cu, 8 mg;
Se, 0.15 mg; ethoxyquin, 150 mg. Metabolisable energy.
Preparation of cooked brine-injected breast

product
Breast muscles were injected with 180 g kg1
brine consisting of sodium chloride and pentasodium tripolyphosphate, then tumbled at 7 rpm
under vacuum for 45 min at 25 C, followed
by a resting period of 18 h at 25 C. Afterwards, they were vacuum packed in plastic casings (CN330, Sealed Air, Passirana di Rho, Italy)
and closed at both ends. The cooking process
was carried out in a steam oven at 70 C until
the internal temperature of the product reached
68 C.
Extraction and activity of lysosomal proteolytic
enzymes
Lysosomal enzymes were extracted according to the
method of Etherington et al.25 A portion of ground
muscle was homogenised (1:4 w/v) in 50 mmol L1
sodium acetate buffer (pH 5) containing 1mmol L1
ethylene diamine tetraacetic acid (EDTA) and 2 mg
mL1 Triton X-100. The extract was stirred for
1 h at 4 C and then centrifuged (10 000 g). The
supernatant was filtered to remove debris and used as
the source of enzymes.
Cystein proteinases B and L were determined
fluorimetrically using the method of Etherington and Wardale.26 Cathepsins B and L were
assayed with the common substrate N-CBZ-Lphenylalanyl-L-arginine 7-amido-4-methylcoumarin
(Z-Phe-Arg-NHMec; Sigma, Madrid, Spain). Cathepsin B was measured with N-CBZ-L-arginyl-L-arginine
7-amido-4-methylcoumarin
(Z-Arg-Arg-NHMec;
Sigma). One unit of activity was defined as the amount
of enzyme hydrolysing 1 nmol substrate min1 g1
tissue at 37 C.
1449
C Sarraga et al.
Determination of antioxidant enzyme activities

The enzymatic extract was obtained according to the
procedure of DeVore and Greene.27 A portion of tissue
was homogenised (1:5 w/v) in 50 mmol L1 Tris-HCl
buffer (pH 7). The homogenate was centrifuged at
17 000 g for 30 min at 4 C. The supernatant was
recovered and filtered through deactivated glass wool.
Subsequent centrifugation of the filtrate at 100 000 g
for 1 h at 4 C gave the final supernatant extract used
for GSHPx, SOD and CAT activity assays.
GSHPx activity was assessed according to DeVore
and Greene.27 The assay medium included 0.5
units of glutathione reductase, 1 mmol L1 reduced
glutathione, 0.15 mmol L1 nicotinamide adenine
dinucleotide phosphate (NADPH) and 0.12 mmol
L1 hydrogen peroxide (H2 O2 ). The decrease in
absorbance at 340 nm was recorded for 5 min and
the activity was expressed as nmol NADPH oxidised
min1 g1 meat.
SOD activity was measured according to the method
of Marklund and Marklund,28 based on the ability of
SOD to inhibit the autoxidation of pyrogallol. The
rate of autoxidation was determined by the decrease
in absorbance measured at 420 nm. Enzyme activity
was calculated according to a SOD standard curve
(0200 ng). One unit of activity was defined as the
amount of enzyme inhibiting the autoxidation of
pyrogallol by 50%. The activity was expressed as units
SOD g1 meat.
CAT activity was determined by measuring the
decrease in H2 O2 at 240 nm over 5 min.29 One unit
of activity was defined as the amount of enzyme
decomposing 1 mol H2 O2 min1 . The activity was
expressed as mol H2 O2 decomposed min1 g1 meat.
Determination of thiobarbituric acid-reactive
substances (TBARS)
The assay method was based on the procedure of
Botsoglou et al.,30 modified according to the current
assay conditions. A 1 g sample was homogenised
in 20 mL of ultrapure water. After the addition of
5 mL of 0.25 g mL1 trichloroacetic acid (TCA), the
homogenate was left to stand at 4 C for 15 min
and then centrifuged at 12 000 g for 15 min at
4 C. The supernatant was filtered and 3.5 mL of
the filtrate was added to 1.5 mL of 6 mg mL1
thiobarbituric acid (TBA). The mixture was incubated
at 70 C for 30 min, chilled and the absorbance at
532 nm was recorded. The results, expressed as g
malondialdehyde (MDA) g1 tissue, were calculated
according to a standard curve (02.5 g MDA) of
hydrolysed 1,1,3,3-tetraethoxypropane (TEP).
Determination of -tocopherol levels
A portion of muscle was sonicated in n-hexane/2propanol (3:2 v/v) to extract -tocopherol. The sample
was centrifuged and the supernatant was evaporated
to dryness in a stream of nitrogen. The residue was
redissolved in 1 mL of n-hexane/ethyl acetate (80:20
v/v). A 20 L aliquot of the filtered extract was injected
1450
into the high-performance liquid chromatography

(HPLC) system.
Samples and standards (5 and 10 mg L1 tocopheryl acetate in mobile phase) were analysed by
normal phase HPLC using an LKB Bromma system
(Stockholm, Sweden) with an aminopropylsilica
NH2 -NP column (5 m, 250 mm 4.6 mm i.d.;
(Supelco-Sigma, Bellefonte PA, USA). The mobile
phase consisted of n-hexane/ethyl acetate (80:20 v/v)
at a flow rate of 1.2 mL min1 . Detection was by
fluorescence measurement at an excitation wavelength
of 290 nm and an emission wavelength of 330 nm.31
Fatty acid profile
Fatty acids were analysed according to Mach et al.32
Briefly, 1 mg of the internal standard tripentadecanoic
acid (Sigma-Aldrich, Madrid, Spain) was added
to 2 g of sample and homogenised in 100 mL of
chloroform/methanol (2:1 v/v) for 24 h. The mixture
was subsequently filtered through a separating funnel,
mixed with 0.1 g mL1 NaCl and extracted twice,
after which the solvent was evaporated. Fatty acid
methyl esters (FAMEs) were obtained by the ISO
method33 and analysed using an HP 5890 Series
II gas chromatograph (GC; Hewlett Packard SA,
Barcelona, Spain). Samples were introduced by split
injection into a BPX70 fused silica capillary column
(30 m 0.25 mm i.d., 0.25 m film thickness; SGE,
Milton Keynes, UK). Helium was the carrier gas at
30 cm s1 . The GC temperature was held at 150 C
for 1 min, then increased at 4 C min1 to 200 C and
held for 10 min. Individual fatty acids were identified
by comparison of their retention times with those
of standards (lipid standard: fatty acid methyl ester
mixture 189-19, Sigma-Aldrich).
Sensory analysis
A quantitative descriptive analysis was conducted by
a six-member trained panel.34,35 The panellists had a
minimum experience of 10 years in descriptive analysis
of a wide range of foods. The generation/selection of
descriptors was carried out by open discussion in
two previous sessions. Each panellist assessed the
different descriptors using a rating scale where 0
means absence and 10 very high intensity of the
descriptor. Sensory evaluations were conduced in a
standardised sensory testing room36 equipped with
ten individual sensory booths lit by red lights in
order to mask the colour effect when odour and
flavour attributes were evaluated. In each of the
seven sessions performed, each assessor evaluated
the same four products (one from each treatment),
which were coded using random three-digit numbers.
Slices of 2 mm from each sample were provided to the
assessors in individual plastic containers covered with
plastic film. The presentation order of samples and
the first-order and carry-over effect were blocked.37
The descriptors assessed were: darkness (evaluated in
individual booths using a standardised 8 W day light),
turkey odour, fishy odour, metallic flavour, turkey
J Sci Food Agric 88:14481454 (2008)
DOI: 10.1002/jsfa
J Sci Food Agric 88:14481454 (2008)

DOI: 10.1002/jsfa
Values are mean SD (n = 7 for each dietary treatment); ND, not detected. Means in the same row with different letters are significantly different (P < 0.05): lowercase letters indicate differences between treatments;
uppercase letters indicate differences between raw and cooked breasts. Experimental treatments: T1, basal diet; T2, basal diet + 15 g kg1 pure DHA; T3, basal diet + 100 mg kg1 vitamin E; T4, basal diet + 5.4 g kg1
pure DHA + 100 mg kg1 vitamin E. Units: a nmol substrate min1 g1 meat; b mol H2 O2 min1 g1 meat; c nmol NADPH min1 g1 meat; d units SOD g1 meat; e g MDA g1 meat; f g g1 meat.
ND
ND
ND
41 8.7B
136 12
2.42 0.4bB
1.39 0.2bB
ND
ND
ND
40 13B
134 8.5
1.45 0.2cB
1.89 0.3aB
ND
ND
ND
46.3 13B
141 14
4.68 1.0aB
0.78 0.1cB
ND
ND
ND
39.5 23B
141 13
2.09 0.6bcB
1.25 0.3b
0.77 0.2
2.79 0.78
1.45 1.6
205 70A
154 8.4
0.31 0.1bA
1.85 0.3bA
0.89 0.16
2.65 0.43
0.98 0.5
199 67A
161 12
0.58 0.1aA
1.11 0.3cA
Cathepsin
Cathepsins B + La
CATb
GSHPxc
SODd
TBARSe
Vitamin Ef
1.02 0.15
2.11 0.52
0.69 0.4
200 61A
155 11
0.22 0.1bA
1.29 0.2c
0.74 0.23
2.45 0.55
1.13 0.7
227 85A
153 7.5
0.16 0.06bA
2.31 0.3aA
T3
T2
T4
T1
Cooked breast product
T3
T2
T1
Ba
Parameter

The activities of the most representative cystein
proteinases and antioxidant enzymes are shown in
Table 2. No differences among treatments were found
in any of the enzymes studied, neither in raw breast
nor in cooked breast, although there were evident
differences between raw and cooked breast samples.
Cathepsin B and B + L and CAT activities were not
detected and GSHPx activity was severely reduced in
cooked breast samples. In agreement with previous
results for cooked breast turkey22 and porcine cooked
ham,39 SOD activity was not affected by the thermal
process, it being the most stable among the enzymes
studied.
Results of vitamin E determination suggested an
interactive effect between vitamin E and DHA, since
vitamin E accumulation was significantly higher in T3
than in T4 in both raw and cooked meat, taking into
account that the supplementation dose of 100 mg kg1
was the same in both treatments. This finding could
be explained by the rapid consumption of vitamin E
in meat from the DHA-supplemented diet due to the
high oxidative instability, which prevents antioxidant
accumulation. Results from T1 and T2 showed
significant differences in cooked breast (P < 0.05) but
not in raw meat. Except for the control samples,
cooked brine-injected breasts showed a lower level of
vitamin E than raw meat because of the dilution effect
of the brine and the effect of the cooking process on
vitamin E degradation.
TBARS values were closely related to the supplementation of the diets. As expected, significant
differences were observed between raw and cooked
breast. Cooked product presented the highest TBARS
value in samples from birds fed with 15 g kg1 DHA.
The lowest TBARS level was found with the vitamin
E-supplemented diet (T3). An intermediate level was
found in samples of T4 where vitamin E and DHA had
Raw breast meat
All data were analysed using the MEANS and GLM
procedures of the SAS statistical package.38 One-way
analysis of variance (ANOVA) was performed for
each product (raw and cooked breasts) in order to
assess differences between treatments. Then, for each
treatment, an additional one-way ANOVA was carried
out in order to assess differences between products.
For sensory data the ANOVA was performed with
the mean values from the six assessors for each
session. In this case the two-way ANOVA model
included treatment, session and their interaction as
fixed effects. No significant interaction was observed
between treatment and session. Mean comparisons
were performed using the Tukey test.
Table 2. Proteolytic (cathepsin B and L) and antioxidant (CAT, GSHPx and SOD) enzyme activities, TBARS and vitamin E levels in raw meat and cooked brine-injected breast from turkeys fed on different
supplemented diets
flavour, fishy flavour, salty flavour and rancid flavour.

The products were evaluated 10 min after slicing,
and the average assessors score for each sample was
recorded.
T4
1451
Values are mean SD (n = 7 for each dietary treatment). Experimental

treatments: T1, basal diet; T2, basal diet + 15 g kg1 pure DHA; T3,
basal diet + 100 mg kg1 vitamin E; T4, basal diet + 5.4 g kg1 pure
DHA + 100 mg kg1 vitamin E.
1452
18.36 0.75b
0.91 0.08bA
5.31 1.35abB
1.12 0.34b
5.68 1.97b
2.94 0.47b
19.80 1.13ab
0.90 0.09b
6.25 1.36a
0.30 0.06c
1.12 0.37c
11.77 0.74a
15.85 0.95c
0.92 0.15bA
4.25 0.81ab
2.75 0.19a
13.90 1.76a
1.15 0.13c
20.80 1.43a
1.23 0.17aA
4.05 1.51bB
0.28 0.25c
1.30 1.45c
12.12 0.87a
18.33 1.06b
0.75 0.15B
6.91 1.28aA
1.31 0.14b
6.92 1.61b
2.89 0.54c
20.37 0.69a
0.91 0.10
6.86 1.48a
0.37 0.11c
1.58 0.61c
10.75 0.58b
T3
T2
T3
T4
T1

Raw breast meat
Values are mean SD (n = 7 for each dietary treatment). Means in the same row with different letters are significantly different (P < 0.05): lowercase letters indicate differences between treatments; uppercase
letters indicate differences between raw and cooked breasts. Experimental treatments: T1, basal diet; T2, basal diet + 15 g kg1 pure DHA; T3, basal diet + 100 mg kg1 vitamin E; T4, basal diet + 5.4 g kg1 pure
DHA + 100 mg kg1 vitamin E.
9.18 2.52
8.40 1.65
9.04 3.30
8.67 2.47
14.67 0.97c
0.73 0.13B
4.77 1.12b
3.05 0.43a
15.63 2.05a
1.01 0.11d

T1
T2
T3
T4
20.28 1.62a
0.93 0.18B
6.23 1.51abA
0.45 0.39c
1.27 0.83c
11.74 0.54a
8.30 2.86
7.89 1.74
8.09 1.61
8.82 3.67
Linoleic (18:2n-6)
-Linolenic (18:3n-3)
Arachidonic (20:4n-6)
EPA (20:5n-3)
DHA (22:6n-3)
n-6/n-3 ratio
Raw breast meat

T1
T2
T3
T4
T2
Fatty acid concentration (mg g1 )
T1
Treatment
Fatty acid (%)
Table 3. Total fatty acid concentrations in raw meat and cooked

brine-injected breast from turkeys fed on different supplemented diets
Table 4. Percentages of n-6 and n-3 fatty acids in raw meat and cooked brine-injected breast from turkeys fed on different supplemented diets
been added. The supplementation with 100 mg kg1

vitamin E contributed to the decrease in TBARS levels
when T2 was compared with T4 (P < 0.05) in both
raw and cooked samples.
The total fatty acid concentrations (mg g1 ) found
in samples were not affected by different treatments
(Table 3). The profile of n-6 and n-3 fatty acids in raw
and cooked turkey is shown in Table 4. Raw meat in
the two DHA-supplemented treatments (T2 and T4)
showed a significantly lower level of linoleic acid in
comparison with T1 and T3. The lowest percentage
of 18:2n-6 was detected in T2, while T4 showed an
intermediate value. Similar tendencies were observed
in cooked products.
The diets supplemented with 15 g kg1 (T2) and
5.4 g kg1 (T4) pure DHA from a marine source
increased the EPA and DHA levels in relation to
the control level for both raw and cooked turkey.
With the exception of -linolenic acid, the n-3 PUFA
percentages were maintained after the cooking process,
because no differences were found between raw breast
and cooked brine-injected product.
The reduction in n-6 and large increase in n-3
PUFAs resulted in a significant reduction in n-6/n-3
PUFA ratio in T2 and T4 to values between 1.01 and
2.94 respectively (Table 4). No significant difference
was observed between raw breast and cooked brineinjected breast. It is worth noting that the reduction
in n-6/n-3 PUFA ratio was in accordance with the
dietary DHA amount.
Results from the sensory analysis of cooked breast
products are shown in Table 5. Samples from birds
fed on the vitamin E-supplemented diet (T3) showed
a significant increase in darkness, as was reported by
Ruiz et al.40 in raw broiler meat. Rancidity was very
low, possibly because samples were consumed within
1 week after elaboration and 10 min after slicing. The
batches enriched in DHA were slightly less rancid
than the control group, maybe because of a masking
effect due to their stronger fishy flavour. The main
differences among dietary treatments were in turkey
T4
C Sarraga et al.
J Sci Food Agric 88:14481454 (2008)

DOI: 10.1002/jsfa

Table 5. Sensory analysis of cooked brine-injected breast product
from turkeys fed on DHA- and vitamin E-supplemented diets
Attributea
T1
T2
T3
T4
Darkness 3.3 1.0b 3.5 1.3b 3.9 1.1a

Odour
Turkey 2.7 1.3ab 0.9 0.9c 3.1 1.7a
Fishy
0.6 1.3b 4.9 2.3a 0.4 1.1b
2.3 1.5b
0.9 1.3b
Flavour
Metallic
Turkey
Fishy
Salty
Rancid
1.6 1.7
2.9 2.1b
1.5 1.5b
3.2 1.7
0.1 0.2b
1.6 1.3
3.4 2ab
0.3 0.7c
3.2 1.3
0.4 0.6a
1.2 1.1
0.5 0.8c
7.1 1.7a
3.8 1.9
0.1 0.1b
1.1 0.8
3.9 2.5a
0.2 0.6c
3.1 1.1
0.3 0.6ab
3.2 1.1b
Values are mean SD (n = 7 for each dietary treatment). Means in

the same row with different letters are significantly different (P < 0.05).
Experimental treatments: T1, basal diet; T2, basal diet + 15 g kg1
pure DHA; T3, basal diet + 100 mg kg1 vitamin E; T4, basal
diet + 5.4 g kg1 pure DHA + 100 mg kg1 vitamin E.
a Assessed according to a scale from 0 (absence) to 10 (intense).
and fishy flavours and odours. Turkey flavour and

odour had the lowest values in T2 samples compared
with the other treatments owing to the presence of fishy
notes. Samples supplemented with vitamin E (T3)
showed the highest score, which was only significantly
different from T2 and T4.
Fishy flavour followed the opposite pattern of turkey
flavour. Samples from birds fed with 15 g kg1 DHA
presented the highest level, which was perceived as an
intermediate value in T4 and nearly absent in T1 and
T3. Fishy flavour was also significantly higher in T4
than in T1 and T3.
Maruri and Larick41 suggested that the negative
effects of PUFA-enriched diets on the sensory profile
could be reduced by supplementation with vitamin
E. Nevertheless, Trout42 reported that vitamin E is
not so effective at minimising fishy flavours when fish
oil is added to the animal diet and recommended a
fish oil withdrawal period before slaughter. According
to Rymer and Givens,8 feeding with marine algae
can result in better sensory efficacy than feeding
with fish oil to improve consumer acceptability. Thus
the quality and composition of the DHA source
seem to be basic parameters that influence off-flavour
production. In addition to these suggestions, the offflavour perception of cooked brine-injected breast
could be eliminated by modifying the technological
process via the addition of smoke or other antioxidant
compounds.
CONCLUSIONS
Feeding turkeys with 5.4 g kg1 pure DHA plus
100 mg kg1 vitamin E improves the nutritional quality
of raw meat and cooked brine-injected breast owing
to the increase in vitamin E and the reduction in n6/n-3 PUFA ratio. With this treatment the sensory
characteristics of cooked brine-injected turkey breasts
were similar to those of control samples, except for a
slight fishy flavour.
J Sci Food Agric 88:14481454 (2008)
DOI: 10.1002/jsfa
ACKNOWLEDGEMENTS
Financial support for this work was provided by
FEDER and INIA (Government of Spain) project
CAL02-00. Algatrium was donated by Brudy SL
(Barcelona, Spain). The authors wish to thank Narcs
Sas, Eugeni Anselmet and Quim Arbones for their
technical assistance.
REFERENCES
1 Moreno JJ and Mitjavila MT, The degree of unsaturation of
dietary fatty acids and the development of atherosclerosis.
J Nutr Biochem 14:182195 (2003).
2 Sanders TAB, Gleason K, Griffin B and Miller GJ, Influence
of an algal triacylglycerol containing docosahexaenoic acid
(22:6n-3) and docosapentaenoic acid (22:5n-6) on cardiovascular risk factors in healthy men and women. Br J Nutr
95:525531 (2006).
3 Young G and Conquer J, Omega-3 fatty acids and neuropsychiatric disorders. Reprod Nutr Dev 45:128 (2005).
4 Mantzioris E, Cleland LG, Gibson RA, Neumann MA, Demasi
M and James MJ, Biochemical effects of a diet containing
foods enriched with n-3 fatty acids. Am J Clin Nutr 72:4248
(2000).
5 Williams C, Dietary fatty acids and human health. Ann
Zootechnol 49:165180 (2000).
6 Harbige LS, Fatty acids, the immune response, and autoimmunity: a question of n-6 essentiality and the balance between
n-6 and n-3. Lipids 38:323341 (2003).
7 Raes K, DeSmet S and Demeyer D, Effect of dietary fatty acids
on incorporation of long chain polyunsaturated fatty acids
and conjugated linoleic acid in lamb, beef and pork meat: a
review. Anim Feed Sci Technol 113:199221 (2004).
8 Rymer C and Givens DI, n-3 Fatty acid enrichment of edible
tissue of poultry: a review. Lipids 40:121130 (2005).
9 Hulan HW, Ackman RG, Ratnayake WM and Proudfoot FG,
Omega-3 fatty acid levels and general performance of
commercial broilers fed practical levels of redfish meal. Poultry
Sci 68:153162 (1989).
10 Schreiner M, Hulan HW, Razzazi-Fazeli E, Bohm

J and
Moreira RG, Effect of different sources of dietary omega3 fatty acids on general performance and fatty acid profiles
of thigh, breast, liver and portal blood of broilers. J Sci Food
Agric 85:219226 (2005).
11 Lopez-Ferrer
S, Baucells MD, Barroeta AC and Grashorn MA,
n-3 Enrichment of chicken meat using fish oil: alternative
substitution with rapeseed and linseed oils. Poultry Sci
78:356365 (1999).
12 Mooney JW, Hirschler EM, Kennedy AK, Sams AR and van
Elswyk ME, Lipid and flavour quality of stored breast meat
from broilers fed marine algae. J Sci Food Agric 78:134140
(1998).
13 Bou R, Guardiola F, Tres A, Barroeta AC and Codony R, Effect
of dietary fish oil, -tocopheryl acetate, and zinc supplementation on the composition and consumer acceptability of
chicken meat. Poultry Sci 83:282292 (2004).
14 Lee S, Faustman C, Djordjevic D, Faraji H and Decker EA,
Effect of antioxidants on stabilization of meat products
fortified with n-3 fatty acids. Meat Sci 72:1824 (2006).
15 Ruiz JA, Perez-Vendrell AM and Esteve-Garca E, Effects of
-carotene and vitamin E on the oxidative stability in leg
meat of broilers fed different supplemental fat. J Agric Food
Chem 47:448454 (1999).
16 Yu L, Scanlin L, Wilson J and Schmidt G, Rosemary extracts
as inhibitors of lipid oxidation and colour change in cooked
turkey products during refrigerated storage. Food Chem Toxicol
67:582585 (2002).
17 Botsoglou NA, Govaris A, Botsoglou EN, Grigoropoulou SH
and Papegeorgiou G, Antioxidant activity of dietary oregano
essential oil and -tocopherol acetate supplementation in
1453
C Sarraga et al.
18
19
20
21
22
23
24
25
26
27
28
long-term frozen stored turkey meat. J Agric Food Chem

51:29302936 (2003).
Young JF, Stagsted J, Jensen SK, Karlsson AH and Henckel P,
Ascorbic acid, -tocopherol and oregano supplements reduce
stress-induced deterioration of chicken meat quality. Poultry
Sci 82:13431351 (2003).
Carreras I, Guerrero L, Guàrdia MD, Esteve-Garca E, Garca
Regueiro JA and Sarraga C, Vitamin E levels, thiobarbituric
acid test and sensory evaluation of breast muscles from broilers
fed -tocopheryl acetate and -carotene supplemented diets.
J Sci Food Agric 84:313317 (2004).
Sarraga C, Carreras I, Garca Regueiro JA, Guàrdia MD and
Guerrero L, Effects of -tocopheryl acetate and -carotene
dietary supplementation on the antioxidant enzymes, TBARS
and sensory attributes of turkey meat. Br Poultry Sci
46:700707 (2006).
Maraschiello C, Sarraga C and Garca Regueiro JA, Glutathione peroxidase activity, TBARS and -tocopherol in
meat from chickens fed different diets. J Agric Food Chem
47:867872 (1999).
Carreras I, Castellari C, Valero A, Garca Regueiro JA and
Sarraga C, Influence of enrofloxacin administration on the
proteolytic and antioxidant enzyme activities of raw and
cooked turkey products. J Sci Food Agric 85:24072412
(2005).
Arnau J, Guerrero L and Sarraga C, The effect of green ham
pH and NaCl concentration on cathepsin activities and the
sensory characteristics of dry cured hams. J Sci Food Agric
77:387392 (1998).
Sarraga C and Garca Regueiro JA, Membrane lipid oxidation
and proteolytic activity in thigh muscles from broilers fed
different diets. Meat Sci 52:213219 (1999).
Etherington DJ, Taylor MAJ, Wakefield DK, Cousins A and
Dransfield E, Proteinase (cathepsin B, D, L and calpains)
levels and conditioning rates in normal, electrically stimulated
and high ultimate pH chicken muscle. Meat Sci 28:99109
(1990).
Etherington DJ and Wardale RJ, The mononuclear cell population in rat muscle: its contribution to the lysosomal enzyme
activities of whole muscle extracts. J Cell Sci 58:139148
(1982).
DeVore VR and Greene BE, Glutathione peroxidase in postrigor
bovine Semitendinosus muscle. J Food Sci 47:14061409
(1982).
Marklund S and Marklund G, Involvement of the superoxide
anion radical in the autoxidation of pyrogallol and a
conventional assay for superoxide dismutase. Eur J Biochem
47:469474 (1974).
1454
29 Mei L, Crum AD and Decker EA, Development of lipid and

protein oxidation and incubation of antioxidant enzymes in
cooked pork and beef. J Food Lipids 1:273283 (1994).
30 Botsoglou NA, Fletouris DJ, Papageorgiou GE, Vassilopoulos VN, Mantis AJ and Trakatelis AG, Rapid, sensitive and
specific thiobarbituric acid method for measuring lipid peroxidation in animal tissue, food and feedstuff samples. J Agric
Food Chem 42:19311937 (1994).
31 Casademont G and Garcia Regueiro JA, Residuos en productos
animales. Problematica de su control analtico. Eurocarne
75:4558 (1999).
32 Mach N, Devant M, Bach A, Daz I, Font-Furnols M, Oliver
MA, et al, Increasing the amount of omega-3 fatty acid of
meat from young Holstein bulls through nutrition. J Anim Sci
84:30393048 (2006).
33 ISO, Animal and Vegetable Fats and Oils Preparation of Methyl
Esters of Fatty Acids. ISO 5509(E), pp. 16 (1978).
34 Stone H, Sidel J, Oliver S, Woolsey A and Singleton RC,
Sensory evaluation by quantitative descriptive analysis. Food
Technol 28:2434 (1974).
35 Cross HR, Moen R and Stanfield MS, Training and testing
judges for sensory analyses of meat quality. Food Technol
32:4854 (1978).
36 ISO, Sensory Analysis General Guidance for the Design of Test
Rooms. ISO 8589, pp. 19 (1989).
37 Macfie HJ, Bratchell N, Greenhoff H and Vallis LV, Designs to
balance the effect of order of presentation and first-order carry
over effects in hall test. J Sens Stud 4:129149 (1989).
38 SAS, SAS/STAT Users Guide: Release 8.03. SAS Institute, Cary,
NC (2000).
39 Sarraga C, Guàrdia MD, Daz I, Guerrero L, Garca Regueiro
JA and Arnau J, Nutritional and sensory quality of porcine
raw meat, cooked ham and dry-cured shoulder as affected
by dietary enrichment with docosahexaenoic acid (DHA) and
-tocopheryl acetate. Meat Sci 76:377384 (2007).
40 Ruiz JA, Guerrero L, Arnau J, Guàrdia MD and EsteveGarca E, Descriptive sensory analysis of meat from broilers
fed diets containing vitamin E or -carotene as antioxidants
and different supplemental fats. Poultry Sci 80:976982
(2001).
41 Maruri JL and Larick DK, Volatile concentration and flavour of
beef as influenced by diet. J Food Sci 57:12751281 (1992).
42 Trout GR, Biochemistry of lipid and myoglobin oxidation in
post-mortem muscle and processed meat products effects
on rancidity. Proc. 49th ICoMST, pp. 5055 (2003).
J Sci Food Agric 88:14481454 (2008)

DOI: 10.1002/jsfa
J Sci Food Agric 88:14551463 (2008)
Microbiological hazards
involved in fresh-cut lettuce processing
Adriano G da Cruz,1 Sergio A Cenci2 and Maria Cristina A Maia3
1 Programa
em Ciencia
de Pos-Gradua
c ao
de Alimentos, Instituto de Qumica, Universidade Federal do Rio de Janeiro, CEP 21949-900,
Rio de Janeiro, Brazil
2 Embrapa Agroindustria
de Alimentos, Av. das Americas,

CEP 23020-470, 29501 Guaratiba, Rio de Janeiro, Brazil
3 Departamento de Engenharia Bioqumica, Escola de Qumica, Universidade Federal do Rio de Janeiro, CEP: 21949-900, Rio de Janeiro,
Brazil
Abstract
BACKGROUND: The increasing consumption of produce all over the world has resulted in increasing concern by
the regulatory agencies with respect to the level of safety performed by the processors. The objective of the present
study was to investigate the hazards involved in the various steps of fresh-cut lettuce processing (reception/selection
of raw material, washing, rinsing, sanitisation and final product) by means of microbiological analyses of microbial
groups used as indicators of hygienic conditions and of pathogens.
RESULTS: High microbial loads of mesophilic and psychrotrophic bacteria and Pseudomonas spp. were found
in the ram reception (6 log colony-forming units (CFU) g1 ), which were reduced by a single logarithmic cycle
for the last two microbial groups after the sanitisation step (P < 0.05), the latter being ineffective against the first
microbial group (P > 0.05). Lower counts of yeasts and moulds, total coliforms (35 C) and faecal coliforms (44 C)
were observed in the initial step (3.494.53 log CFU g1 , 0.651.55 log most probable number (MPN) g1 and
0.500.90 log MPN g1 respectively), these values increasing significantly after the sanitisation step for yeasts and
moulds (5 log CFU g1 ) but remaining unaltered for coliforms (P > 0.05). Salmonella spp. were not found in any
of the experiments carried out, while the presence of Escherichia coli was observed in the final product.
CONCLUSIONS: Practices compromising the hygienic quality of the final product during commercial storage
were observed and corrective measures suggested. To the best of the authors knowledge, these are the first data
on microbiological safety in Brazilian fresh-cut processing plants.
Keywords: fresh-cut lettuce; processing; safety
INTRODUCTION
Minimally processed vegetables (MPVs) have become
popular amongst Brazilians. Although no official
specific numbers exist for the production and
consumption of these foods, it is known that the
ready-to-eat food industry in Brazil increased by 148%
between 1998 and 2000.1,2 This is due to a change
in the behaviour of Brazilian society, in which 49% of
women now work outside the home, be it of necessity
or choice, apart from the facilities this type of product
provides, such as economy of time and reduction
of residues. Lettuce (Lactuca sativa) is amongst the
most highly consumed vegetables in Brazil, with a
production of 9091 t in the state of Rio de Janeiro
in 1997, being an obligatory ingredient in salads,
sandwiches and other items found in self-service
restaurants.3 It is, nevertheless, known as a vehicle
for pathogens and toxins, being one of the main leafy
vegetables involved in cases of salmonellosis in the
USA. A recent study showed the survival of Salmonella

baildon in this product even after storage for 12 h at
4 C and exposure to 200 mg kg1 chlorine.4 In Sao
Paulo, Brazil, 61% of the samples of this vegetable
analysed registered populations of faecal coliforms
above 102 colony-forming units (CFU) g1 , while in
Campinas, Brazil, this index only reached 3.2% of the
total, with a mean population of 1.2 most probable
number (MPN) g1 , the positivity index oscillating
according to the season of the year, being 62.5%
in summer and 12.5% in winter.5,6 In Nebraska,
USA, 72 clients of a restaurant were infected with
Escherichia coli O157:H7 and, after epidemiological
studies, minimally processed lettuce was implicated
as the probable source.7 A routine operation in a
restaurant in California, USA resulted in an interstate
food poisoning outbreak in which 61 people took
sick and at least 21 were interned in hospital,
three developing serious complications, the food
em Ciencia
Correspondence to: Adriano G da Cruz, Programa de Pos-Gradua

c ao
de Alimentos, Instituto de Qumica, Universidade Federal do Rio de Janeiro,
CEP 21949-900, Rio de Janeiro, Brazil
E-mail: food@globo.com
(Received 21 August 2007; revised version received 1 November 2007; accepted 1 February 2008)
AG da Cruz, SA Cenci, MCA Maia
vehicle being contaminated lettuce.8 Karenlampi and

Hanninen9 reported better survival of Campylobacter
jejuni strains in lettuce compared with other MPVs
for times sufficient to cause food poisoning. Croci
et al.10 reported better survival of the hepatitis A
virus in this vegetable as compared with other
products, and washing did not reduce the count.
Doller et al.11 reported a food poisoning outbreak
involving 34 people in a restaurant in Germany, caused
by Cyclospora cayetanensis, a parasitic protozoa, after
consumption of a salad containing imported minimally
processed lettuce, resulting in clinical symptoms such
as diarrhoea and vomiting and the need to take leave
from work for an average period of 80 days. A survey
carried out in the USA from 1973 to 1997 showed
25 food poisoning outbreaks caused by lettuce as the
vehicle, resulting in 2078 sick people, 181 interned
in hospital and six deaths, corresponding to 29% of
the food poisoning outbreaks in the period caused by
a single source.12 Although in Canada there are no
specific statistical data available for this vegetable, it
is known that there is a significant annual variation
with respect to the occurrence of food poisoning
outbreaks with MPVs as the vehicle, leading to
an underestimation of the data.13 Another survey
between 1982 and 2002, with the sole objective of
discriminating the sources of food poisoning outbreaks
related to E. coli O157:H7 in the USA, identified that
21% of these were related to MPVs, 74% occurring
between the months of July and October and 34%
being associated with lettuce.14 In Brazil, although
the consumption of this type of food is on the rise,
no data are available on food poisoning outbreaks
related to MPVs, nor is there any information on the
hygienic quality of the processing carried out by the
agro-industries.
The main sources of pathogenic bacteria in salads
elaborated with fresh raw vegetables are the food
handlers and the processing environment.15 The fact
that these products are consumed by people with an
elevated degree of sensibility, such as families with a
high educational level, including children and elderly
individuals, whose motivation for purchasing such
products is convenience and speed of preparation,16
has increased the concern of the food industry
and regulatory agencies with respect to the safety
of such products. The objective of the present
study was to identify the hazards involved in the
various steps of minimal processing of lettuce by
means of microbiological analyses of microbial groups
used as indicators of hygienic conditions and of
pathogens, with the aim of determining the sources
of contamination and possible hazards offered by
processing.

Lettuce samples
The study was carried out in an MPV production
unit located in the state of Sao Paulo in the southeast
1456
of Brazil. This unit cultivates and processes various

products such as lettuce, carrot, kale, tomato and
mixed salads, their consumer market being the two
largest centres in Brazil, i.e. Sao Paulo and Rio de
Janeiro. Iceberg lettuce was chosen for this study
owing to its importance in the diet of the Brazilian
population, plus the fact that it is processed both as a
single product and as an ingredient of salads, being of
economic importance in agro-industrial sales. Lettuce
samples were taken aseptically in duplicate during each
of the different steps of the minimal processing carried
out in the production unit, as described below. The
temperature of the processing plant was approximately
10 C during the execution of the study.
Raw material reception/selection: carried out manually by handlers who discarded external and damaged leaves.
Washing: carried out with a detergent specific for
vegetables, prepared according to the manufacturers instructions.
Rinsing: carried out with running water at a mean
temperature of 10 C.
Sanitisation: carried out using ozone at a nonstandardised concentration and a mean temperature
of 10 C.
Final product: plastic packaged in a passive way and
stored in a cold chamber at 2 C until distributed.
The samples were transported in insulating
polystyrene containers under refrigeration to the Laboratory of Food Microbiology of Embrapa (Rio de
Janeiro, Brazil) and analysed immediately on arrival.
Each microbiological analysis was carried out in duplicate using ten samples per experiment and two samples
per processing step. Since the experiment was repeated
three times, a total of 30 samples were analysed.
Microbiological analyses
The microbiological tests consisted of analyses of
microbial groups used as indicators of hygienic
conditions (mesophilic bacteria, yeasts and moulds,
total coliforms and faecal coliforms), pathogens (E. coli
and Salmonella spp.) and inherent micro-organisms
of interest for the minimal processing of vegetables
(Pseudomonas spp. and psychrotrophic bacteria).
Lettuce samples (25 g) were weighed into sterile
stomacher bags, diluted with 225 mL of buffered
peptone water (Merck, Rio de Janeiro, Brazil) and
stomached. Aerobic and psychrotrophic plate counts
were performed using Plate Count Agar (PCA; Merck)
and subsequent incubation at 35 C for 48 h and
at 5 C for 710 days respectively. Total and faecal
coliforms were determined by the MPN method
using triplicate Brilliant Green agar (BG; Merck)
and E. coli broth (EC; Merck) and subsequent
incubation at 35 C for 48 h and at 44 C for
24 h respectively. Escherichia coli was confirmed by
subculturing the gas-positive tubes from EC broth into
Eosin Methylene Blue agar (EMB; Merck) at 37 C
for 24 h and performing appropriate biochemical tests.
J Sci Food Agric 88:14551463 (2008)
DOI: 10.1002/jsfa
Microbiological hazards in fresh-cut lettuce processing
Pseudomonas spp. counts were performed using KingB agar (KB; Merck) and subsequent incubation at
35 C for 48 h. Yeasts and moulds were determined
using Potato Dextrose Agar (PDA; Merck) with
40 g L1 tartaric acid solution and incubation at
2225 C for 5 days. Additionally, for Salmonella spp.
determination, lettuce samples (25 g) were weighed
into sterile stomacher bags, diluted with 225 mL
of buffered peptone water (Merck), stomached and
incubated overnight at 35 C. A 1 mL aliquot of
the pre-enriched sample was subsequently inoculated
into 10 mL of mannitol Selenite Cysteine broth
(SC; Merck) and Tetrationate broth (TT; Merck)
and incubated at 42 and 35 C respectively. Then
1 mL of an appropriate dilution was spread-plated
onto SalmonellaShigela agar (SS; Merck), Hektoen
enteric agar (HEK; Merck) and Brilliant Green agar
(BG; Merck). These plates were incubated at 37 C
for 24 h. Typical colonies were picked from each plate
and inoculated into Triple Sugar Iron agar (TSI;
Merck) and Lysine Iron Agar (LIA; Merck) slants.
Each culture showing presumptive-positive TSI and
LIA results was submitted to appropriate biochemical
tests of confirmation.
Microbiological data were transformed into log MPN
g1 or log CFU g1 according to the microbial group.
Data were subjected to one-way analysis of variance
(ANOVA), followed by the Tukey test in the case
of significant differences. Probability P < 0.05 was
considered significant.

Tables 16 show the results of the microbiological
analyses of the various microbial groups carried
out during the minimal processing of lettuce. High
microbial loads of mesophilic and psychrotrophic
bacteria and Pseudomonas spp. were found in the ram
reception (6 log CFU g1 ), which were reduced by
a single logarithmic cycle for the last two microbial
groups after the sanitisation step (P < 0.05), the
latter being ineffective against the first microbial
group (P > 0.05). Lower counts of yeasts and
moulds, total coliforms and faecal coliforms were
observed in the initial step (3.494.43 log CFU g1 ,
Table 1. Total mesophilic aerobic bacteria counts (log CFU g1 )
Raw reception
Washing
Rinsing
Sanitisation
Packaged product
II
III
6.88a
6.89a
6.83a
6.78a
6.49a
6.57a
6.47a
5.59a
6.43a
6.52a
6.38a
6.39a
7.04b
6.11a
6.22a
Different letters in the same column indicate statistically significant

differences according to the Tukey test (P < 0.05).
J Sci Food Agric 88:14551463 (2008)

DOI: 10.1002/jsfa
Trial
Processing step
Raw reception
Washing
Rinsing
Sanitisation
Packaged product
II
III
6.13a
6.14a
6.10a
6.08a
5.86a
6.54b
6.49a
6.35a
6.45a
5.59b
6.58acd
6.47ac
6.52acd
6.62ad
5.73b

Table 3. Total yeast and mould counts (log CFU g1 )
Trial
Processing step
Raw reception
Washing
Rinsing
Sanitisation
Packaged product
II
III
3.49a
3.55a
3.50a
3.57a
4.41a
4.53a
4.28c
4.50b
4.58a
4.77a
4.20a
4.35b
4.51ac
4.77a
5.06a

Table 4. Total Pseudomonas spp. counts (log CFU g1 )
Trial
Processing step
Raw reception
Washing
Rinsing
Sanitisation
Packaged product
II
III
6.13a
6.15a
6.65b
6.20a
6.38a
6.07a
6.78b
6.26c
6.09a
5.91d
6.11acd
6.88b
6.27ac
6.12acd
5.94ad

Table 5. Total coliform counts (log MPN g1 )
Trial
Processing step
Raw reception
Washing
Rinsing
Sanitisation
Packaged product
II
III
0.65a
1.55a
1.44a
0.74a
0.55a
1.55d
1.61ad
1.73a
1.41b
1.28c
1.49c
1.65bd
1.74d
1.42a
1.25a

Trial
Processing step
Table 2. Total psychrotrophic bacteria counts (log CFU g1 )
0.651.55 log MPN g1 and 0.500.90 log MPN g1

respectively), these values increasing significantly after
the sanitisation step for yeasts and moulds (4.415.06
log CFU g1 ) but remaining unaltered for coliforms
(P > 0.05). Salmonella spp. were not found in any
of the trials carried out (30 samples analysed), while
the presence of E. coli was observed in the packaged
product (two samples).
1457

Table 6. Fecal Coliform count (log MPN g1 )
Trial
Processing step
Raw reception
Washing
Rinsing
Sanitisation
Packaged product
II
III
0.63a
0.58a
0.53a
0.58a
0.38a
0.90a
0.83a
0.59a
0.92a
0.73a
0.50a
0.55a
0.47a
0.80a
0.60a

The micro-organisms found in MPVs should

not prejudice the consumer, since they are also
present in the raw material in the field. Thus high
counts of Pseudomonas spp., Erwinia herbicola and
lactic acid bacteria such as Leuconostoc mesenteroides
and Lactobacillus spp. are commonly detected, the
first normally being found in greater numbers and
corresponding to 5090% of the microbial load.17
Coliforms usually represent a smaller proportion of
the initial bacterial contamination, as do yeasts and
moulds.18 The results obtained in the present study
indicated that Pseudomonas spp. represented 90% of
the bacterial count on average.
In general, the results suggested the need for
refinement of the food safety prerequisite programmes
such as Good Manufacturing Practices (GMP) and
Sanitation Standard Operational Procedures (SSOP)
carried out by the production unit, since the data
indicated that the sanitisation step was not producing
a significant reduction in numbers of the various
microbial groups (P > 0.05) with respect to the
final product, the counts remaining high, thus
compromising product quality and shelf-life stability
and leading to an acceleration of product deterioration.
It must be emphasised that in the minimal
processing of vegetables the function of the sanitisation
step is not to eliminate the microbial population
normally present, since that would be impossible. The
idea is to maintain this parameter at low levels so that
it can exert a positive role in the competition with
pathogenic micro-organisms, impeding or inhibiting
their growth throughout product shelf-life and thus
retarding deterioration. In this context it is essential
that the initial quality of the raw material be high and
that the product be handled and packaged adequately,
without temperature abuse, since the initial microbial
load and product condition will have a considerable
effect on product shelf-life.17
The high counts found for the various microbial
groups in the raw material on reception, i.e. mesophilic
bacteria (6.386.88 log CFU g1 ), psychrotrophic
bacteria (6.136.58 log CFU g1 ), yeasts and
moulds (3.494.53 log CFU g1 ), Pseudomonas spp.
(6.076.13 log CFU g1 ), total coliforms (0.651.55
log MPN g1 ) and faecal coliforms (0.500.90 log
MPN g1 ), suggested the need for integrated action
at the field level by implementing quality norms such
1458
as Good Agricultural Practices (GAP), since a high

microbial load in the raw material makes the action
of the sanitising agent used in the process nonviable, whatever it may be, even if there is strict
control of the conditions used during refrigerated
storage of the product. In addition, the counts
raise an alert for the presence of pathogenic microorganisms with psychrotrophic characteristics, e.g.
Yersinia spp., Listeria spp. and Aeromonas ssp. De
Curtis et al.19 reported the presence of Listeria spp.
in 25% of MPVs sampled in Caracas, Venezuela,
30% of which were Listeria monocytogenes. Kaneko
et al.20 investigated the microbiological quality of
various ready-to-eat products, including vegetables
before and after minimal processing, in supermarkets
in Tokyo and found that mesophilic counts in the postprocessed vegetables ranged from 103 to 107 CFU g1 ,
with 50% of the samples positive for coliforms,
and E. coli and Bacillus cereus present in 9.2%
of the samples. Before processing, L. monocytogenes
was found in only two samples. The authors also
concluded that, of the samples analysed, the vegetables
showed a greater degree of contamination before
processing, with a mesophilic count in the range
102 107 CFU g1 , which remained unaltered after
processing and storage at 10 C for 3 days. Thunberg
et al.21 analysed various MPVs sold in retail outlets
in the USA and found mesophiles in the range from
2.0 106 to 5.0 108 CFU g1 , with lettuce showing
the highest counts and 8996% of the bacteria present
being Gram-negative. Yeasts and moulds were found
in lower numbers, Salmonella spp. and Campylobacter
spp. were shown to be absent and Listeria ssp.
(including L. monocytogenes) were isolated in the
experiments.
A previous study carried out by our group in
the same production unit identified various faults in
the execution of GAP, which were translated as a
potential to obtain raw materials with high microbial
loads, representing a public health hazard.22 Different
results were found for producers in Iowa, USA, where
the adoption of measures such as the use of water
with a high degree of potability (tested at intervals
by official laboratories) for irrigation and sanitisation
of the equipment and utensils, adequate composting
practices and training of the handlers for the operations
showed an effect leading to greater adherence to the
GAP norms, although some adjustments were still
necessary.23
The adoption of quality systems in the minimal
processing of vegetables obligatorily passes through
a quality guarantee at the field level, signifying the
unrestricted adoption of GAP in order to obtain
raw materials with minimal physical, chemical and
microbiological hazards for the processing units. In
addition, it can serve as a marketing instrument
for the product, adding value to the product and
giving greater impact when faced with competitors,
and an important factor in conquering new markets.
Kokkinakis and Fragkiadakis24 investigated the effect
J Sci Food Agric 88:14551463 (2008)
DOI: 10.1002/jsfa
of adopting quality systems (GAP-certified raw

material) in catering establishments in Greece.
Establishments that acquired GAP-certified products
presented significantly better microbiological quality
than the others, as expressed by low counts of
total coliforms and mesophilic bacteria, low E. coli
populations and the absence of L. monocytogenes.
These values were reduced even more by processing
the products, reaching 0% E. coli and maintaining
the absence of L. monocytogenes in the final product.
On the other hand, establishments not maintaining
this practice showed increases in the microbial load of
coliforms and mesophilic bacteria and 38% presence
of L. monocytogenes in the final product.
Little et al.25 reported 82% acceptable microbiological quality in imported minimally processed lettuce
commercialised in England, verifying the absence of
diverse pathogens such as E. coli O157:H7, Shigella
spp., Salmonella spp., Campylobacter spp. and Vibrio
spp. in 100% of the samples, which indicated adoption
of the quality norms in the field and in the industries
of the products analysed. A subsequent, wider study in
the same country in 2002, with 3852 samples of salads
elaborated with MPVs, indicated 99.3% of samples
with satisfactory or acceptable microbiological quality,
only 0.7% being condemned owing to the presence of
E. coli and Listeria spp. at levels above 102 CFU g1
and a positive result for Salmonella spp.26 Similar
results were observed in Mexico, where the absence
of pathogens such as Shigella spp., Salmonella spp.
and E. coli O157:H7 was observed in the analysis of
various fresh cuts of domestic origin, with only 1% of
samples positive for L. monocytogenes.27 These results
show that it is possible to achieve the food safety
and quality assurance requirements in MPVs. Nevertheless, the results obtained in the present study are
in agreement with various earlier studies that report
mesophilic bacterial loads of 36 CFU g1 .18
Tauxe et al.28 indicated that the interaction of
four factors was responsible for the survival, growth
and inactivation of micro-organisms in fresh cuts:
the characteristics of the micro-organisms present;
the physiological state of the vegetables and their
resistance to the microbial metabolic process; the
characteristics of the processing environment; and
the effects of the processing steps on the microbial
population. Thus an overall analysis from the raw
material in the field to the final, ready-to-eat product
becomes necessary for a successful process assurance
programme.
Another relevant factor observed was the nonexistence of parameters associated with the action
of the sanitising agent (contact time, temperature
and concentration) during the process. As observed
visually, immersion of the vegetables in the ozone
sanitisation tank failed to obey any standardisation
with respect to contact time or temperature, being
random and depending on the will of the handler.
This situation contributed to the results obtained,
since various recent studies have shown the efficiency
J Sci Food Agric 88:14551463 (2008)
DOI: 10.1002/jsfa
of ozone with/without other organic agents in

decreasing and/or inactivating the microbial count
and/or pathogens in MPV plants, without prejudice to
the sensory quality of the vegetable, with results many
times superior to those of chlorine.29 39 Thus a change
in the process layout was suggested, substituting the
first step of washing with a detergent specific for
vegetables, with washing with chlorine associated with
ozone in the sanitisation step, to take advantage of
the synergistic effect of the sanitising agents, since
many studies have shown the efficiency of the use
of chlorine in MPV washing, especially for lettuce,
with an improvement in the safety level of the process
and without prejudice to the sensory quality.40 43 A
lower temperature in the washing tank, close to 5 C,
was also suggested, since higher temperatures create
conditions for the internalisation of pathogens present
in the vegetable by chance, which would probably
not be removed in the subsequent sanitisation step
with ozone.44 Internalisation of pathogens in MPVs
is of great concern, control being more effective by
controlling the microbial load of the raw material in
the field.44
Additional experiments have become necessary to
determine the optimal values for the parameters of
the sanitising agents, for a better analysis of the
process with respect to the reduction in microbial
load. As a starting point, the adoption of values
in the range from 100 to 200 ppm chlorine was
suggested, with continuous monitoring of the pH
throughout the processing line, since the germicidal
form of chlorine is potentised in hypochlorous
acid (HClO), which, since it is a weak acid,
is susceptible to dissociation in aqueous solution.
Allende et al.45 showed a significant reduction in
psychrotrophic micro-organisms and coliforms (3
and 2 log CFU g1 respectively) after washing
with 160180 g g1 chlorinated water at 10 C for
1 min in a minimally processed red lettuce line,
demonstrating the importance of this step. Soriano
et al.46 analysed 144 lettuce samples from university
restaurants in Spain, obtaining values between 103
and 107 CFU g1 for mesophilic organisms and from
<3 to >2400 MPN g1 for faecal coliforms, with
Aeromonas hydrophila, Pseudomonas aeruginosa, E. coli
and Staphylococcus aureus also being detected in 10.4,
2.8, 25.7 and 22.9% of the samples respectively.
Washing with sodium hypochlorite and potassium
permanganate reduced the mesophilic count by one
logarithmic cycle and the total coliform count by two
logarithmic cycles. Simons and Sanguansri47 warned
that the washing system should take the characteristics
of the product into consideration, so lettuce, being a
fragile, delicate product, should be washed gently to
avoid physical damage.
The rinsing process presented significantly higher
counts for faecal coliforms and yeasts and moulds
(P < 0.05) and was inefficient for the other microbial
groups analysed (P > 0.05), suggesting that the quality
of the water used by the industry was inadequate. In
1459
fact, this water was merely filtered through a sand

filter, which was not periodically changed, suffering
no chemical disinfection before contact with the
vegetables. A previous study detected the presence
of total and faecal coliforms (0.48 and 1.20 log
MPN per 100 mL respectively) in this water supply,
not complying with the conditions required for food
processing.48 Howard and Gonzalez49 warned that
water quality is of extreme importance, since water
serves as a vehicle for many pathogenic microorganisms, and that all operations in which it takes
part in washing or rinsing processes deserve special
attention by the processors. McKnight50 emphasised
that the potability of the water should be assured in
all steps of the food production chain, from start to
finish, and that this parameter should be documented
and regularly monitored. Leoni et al.51 suggested
that the microbiological quality of the washing water
could be used as an indicator of the microbiological
quality of the vegetables. On analysing samples from
a processing unit, they found faecal coliforms, E. coli
and Enterococcus spp. in 42.9, 40.0 and 77.1% of the
samples respectively, demonstrating the existence of
faecal material in the vegetables.
The lower counts found for yeasts and moulds
(34 log CFU g1 ) throughout the processing
steps can be explained by the characteristics of the
vegetables, i.e. low acidity and high water activity,
conditions in which yeasts and moulds compete badly
with bacteria and can be eliminated or reduced
by good manufacturing practices in the processing
line, especially by optimising the operations involving
the cutting and removal of external leaves with a
minimum of damage to the vegetable, plus continuous
sanitisation of the handlers and utensils and of the air
present in the processing line. The need to implement
these actions must also be emphasised in order to
minimise the potential danger of these organisms
in producing metabolites such as mycotoxins, which
could be present in the final product, representing
a hazard to public health, in addition to reducing
the time in which the product is fit for consumption.
Tournas52 carried out a mycological analysis of various
fresh-cut products commercialised in Washington,
USA and found a high prevalence of this microbial
group, especially in lettuce, with counts between 3.11
and 5.97 log CFU g1 . The isolation of Alternaria spp.,
Cladosporium spp. and Penicillium spp. was observed
in 10.3, 23.3 and 5.1% of the samples respectively,
these indices being 12.5, 40.0 and 20.0% for lettuce,
which, allied to their capacity to grow at refrigeration
temperatures, suggests a situation of alert with respect
to the production of mycotoxins.
The centrifuge was considered to be a potential
source of contamination, since a significant increase
in the microbial load (P < 0.05) was shown during
this step, maintaining the previously observed levels
or a non-significant decrease (P > 0.05) for yeasts
and moulds and the other microbial groups in the
final product. This reinforces the need for periodic
1460
sanitisation of this equipment, as expressed in a

written procedure understandable by all the handlers,
since it reflects directly on the hygienic quality of
the final product. The operational conditions, e.g.
rotational speed, should also be standardised. This
step contributes to the removal of excess water from
the surface of the vegetable and, if done badly, has
a direct implication on the maintenance of optimal
conditions for microbial growth in the final product
and also for the activity of enzymes naturally present
in the vegetable.
Badly sanitised equipment represents a potential
source of contamination in the food industry and
should be taken into account for the safety of the
process. Garg et al.53 carried out microbiological
analyses on various MPVs sampled from processing
lines before and after their passage through various
equipments/utensils (cutters, peelers, slicers and
centrifuges) and showed an increase of two logarithmic
cycles in the microbial count, the lettuce cutter (from
4.25 to 6.15 log CFU g1 ) and onion slicer (from
3.6 to 5.08 log CFU g1 ) presenting the greatest
increases, reflecting the source of contamination
they represented. Kaneko et al.20 analysed various
equipments/utensils in vegetable processing units
before and after sanitisation, obtaining increases of two
logarithmic cycles in the microbial load after passage
of the vegetables through these equipments. Allende
et al.45 reported increases of 1.24 log CFU g1 for
psychrotrophs and 1.0 log CFU g1 for coliforms in
a recent experiment on a minimally processed red
lettuce line and confirmed the increase in microbial
load in the final product after passage of the product
through the centrifuge. Previous experiments by this
research group revealed the precarious hygienic quality
of the equipments and utensils of the production line in
the agro-industry studied specifically the centrifuge
and transport belt with an elevated index of total
and faecal coliforms, confirming previously discussed
hypotheses.48
Jay54 pointed out that the mesophilic count is commonly used to determine the hygienic quality of
foods, an elevated count being a sign of unwholesomeness of the food, caused by at least one of the
following factors: contaminated raw material; unsatisfactory processing with abuse of the time/temperature
binomial; and precarious hygienic conditions of the
process, equipment and handlers. In addition, since
the majority of pathogenic bacteria are mesophilic,
high counts signify that there were adequate conditions for them to multiply. However, in the minimal
processing of vegetables, such data are of limited value
and do not necessarily reflect the true number of live
microbial cells and their action on the shelf-life of
the product. For this type of food, psychrotrophic
bacteria are the group which predominate and are
responsible for product deterioration and are therefore a good indicator of the hygienic quality of the
process, since their analysis simulates the conditions
found in the processing plants, i.e. low-temperature
J Sci Food Agric 88:14551463 (2008)
DOI: 10.1002/jsfa
environments.17 Szabo et al.55 analysed 120 samples

of minimally processed lettuce samples in Australian
supermarkets and found counts of 103 109 CFU g1
for mesophilic organisms, with 76% of the samples in
the range 105 107 CFU g1 , and the presence of L.
monocytogenes and of A. hydrophila and Yersinia enterocolitica in 36 and 71 samples respectively. Froder
et al.6 found 51 and 68% of minimally processed salads marketed in Sao Paulo, Brazil with populations of
mesophilic and pyschrotrophic micro-organisms above
106 CFU g1 respectively.
Jay54 defined total coliforms as a group of bacteria
of the Enterobacteriaceae capable of fermenting
lactose with the production of gas when incubated
at 3537 C for 48 h, normally found in faeces and
soil and on the surface of vegetables, where they
survive longer than pathogenic bacteria such as E. coli
and Salmonella spp. High counts of total coliforms
in MPVs can indicate that the raw material was
cultivated in soil rich in organic matter and/or with
an abnormal bacterial incidence on the vegetable, not
indicating, however, a problem related to product
quality and being of limited use in a programme for
the microbiological quality of minimally processed
foods, serving only as an indicator of the efficiency of
the sanitisation process.17
The faecal coliform group of bacteria corresponds
to that part of the total coliforms with the capacity
to continue fermenting lactose with the production of
gas when incubated at a temperature of 4445.5 C.
They normally grow in human and animal intestines
and are associated with faecal material,54 the main
representative being E. coli, which is thus used as an
indicator of faecal contamination. In food processing,
especially in the minimal processing of vegetables,
the presence of E. coli indicates contamination by a
source that could contain pathogenic enterobacteria
such as Salmonella spp. and Shigella spp., resulting in
the product being rejected for human consumption
owing to being in an unsatisfactory sanitary condition
according to the norms of Brazilian legislation.56 Thus
it is important to test for faecal coliforms positive for
E. coli.17
In the particular case of the production unit under
study, low counts of total and faecal coliforms were
observed during the processing steps, specifically
0.651.74 and 0.470.92 log MPN g1 respectively.
These results were not in accordance with other
research, as normally a high incidence of this microbial
group is observed in foods of vegetable origin,
suggesting an occasional situation. Acevedo et al.57
observed higher counts on analysing salads elaborated
with fresh vegetables, finding 5.16 log MPN g1
of total coliforms and 4.66 log MPN g1 of faecal
coliforms and the absence of E. coli, which could
be related to the local cultivation conditions of the
vegetables.
Nevertheless, the presence of E. coli in the product
serves as a signal for concern with processing safety,
its presence in the final product step being attributed
J Sci Food Agric 88:14551463 (2008)
DOI: 10.1002/jsfa
to handlers in the final product packaging sector,

demonstrating the need for training of the handlers
in hygiene and food microbiology as part of the
refinement of GMP, one of the non-conforming items
detected in the audit.48
Many buyers impose limits on the mesophilic and
total coliform counts when buying raw materials
of vegetable origin destined for minimal processing, rejecting samples above these limits. It must be
understood that the existence of a microbiological
monitoring programme with a systematic interpretation of the results, aiming to improve the sanitisation
programmes of the processing line, is of great utility
and that high counts make sense when considered
together with a poor history of processing results,
encouraging improvements aimed at the new limits.17
Salmonella spp. were not detected in any of the trials.
This could be related to the methodology used, which,
although official, includes a large number of steps,
and also to the low level of competitiveness in the
presence of other microbial groups, it being important
to develop methodologies with greater sensitivity,
since the shelf-life of MPVs is intrinsically short.
In addition, one should not ignore the possibility
of continuous monitoring and a greater number of
analyses, especially with respect to the handlers, who
could become non-symptomatic carriers, excreting
in their faeces for a long period of time. Various
studies have reported the presence of Salmonella spp.
at rates varying from 7.5 to 68%, with lettuce showing
the highest incidence.58 Salleh et al.59 showed the
presence of Salmonella spp. in 35% of raw vegetables
commercialised in Selangor, Malaysia, of which S.
weltevreden, S. agona, S. senftenberg and S. Albany
were the most commonly isolated serotypes.
Up to the present date, Brazilian legislation has
not set specific microbiological standards for MPVs,
and only recently was the intention announced to
create legislation for GMP in agro-industries of
these products at the level of the state of Sao
Paulo. It contemplates guidance with respect to the
layout of the establishment, with prior obligation
to register in the sanitation organs, and to raw
material quality, periodic checking of water potability,
effluent treatment, sanitary installations, handling
area, obligation to have a laboratory for analyses,
packaging and labelling, and a Sanitary Certificate
being awarded annually to those establishments
complying with the specified demands,60 showing the
concern of the authorities. However, if these products
were inserted in the category fresh vegetables, in
natura, prepared, sanitised, refrigerated or frozen for
direct consumption with the recommended maximum
limit of 2 log CFU g1 for faecal coliforms and the
absence of Salmonella spp., 100% of the samples
obtained in the final product step would comply
with these limits,56 representing a dangerous situation
considering the results obtained, and aggravated by
the positive result for E. coli. The establishment
of standards specific for these products in Brazilian
1461
legislation is essential, respecting the peculiarities

involved in their processing and attributing maximum
standards for microbial groups such as mesophilic and
psychrotrophic bacteria and for pathogens such as
L. monocytogenes and E. coli amongst others. Studies
similar to the present one should be carried out
simultaneously in other processing plants in Brazil
to provide a greater number of results for use in the
elaboration of this legislation.
CONCLUSIONS
The results of this research show the level of safety
offered by an MPV production unit, especially with
respect to the minimal processing of lettuce, being a
pioneer study with respect to Brazilian agro-industries.
Practices compromising the hygienic quality of the
product and its period of commercial storage were
detected, all of which are covered by food safety
programmes such as GMP and SSOP. Corrective
actions must be taken in order to produce products
with no hazard to public health.
REFERENCES
1 Branco A, Dole investe US$ 100 mil. em legumes. Gazeta
Mercantil, 23, Sao Paulo (1997).
2 Nascimento EFN, Molica EM and de Moraes JS, Hortalicas
minimamente processadas mercado e produca o. Braslia
(2000).
3 Embrapa, Controle de qualidade em alface (Lactuca sativa)
cultivada em sistema hidroponico.

Braslia (1999).
4 Weissinger WR, Chantarappanont W and Beuchat LR, Survival
and growth of Salmonella baildon in shredded lettuce and diced
tomatoes and effectiveness of chlorinated water as sanitizer.
Int J Food Microbiol 62:123131 (2000).
5 Porto E and Elroa MNU, Occurence of Listeria monocytogenes in
vegetables. Dairy, Food, Environ Sanit 21:282285 (2001).
6 Froder H, Martins CG, de Souza KLO, Landgraf M, Franco
BDG and Destro MT, Minimally processed vegetables salads:
microbial quality evaluation. J Food Protect 5:12771280
(2007).
7 Wachtel MR and Charkowski AO, Cross-contamination of
lettuce with Escherichia coli O157:H7. J Food Protect
65:465470 (2002).
8 De Wall CS, Safe food from a consumer perspective. Food
Control 14:7579 (2003).
9 Karenlampi R and Hanninen ML, Survival of Campylobacter
jejuni on various fresh produce. Int J Food Microbiol
97:187195 (2004).
10 Croci L, de Medici D, Scalfaro C, Flore A and Toti L, The
survival of hepatitis A virus in fresh produce. Int J Food
Microbiol 73:2934 (2002).
11 Doller PC, Dietrich K, Filipp N, Brockmann S, Dreweck C,
Vonthein R, et al, Cyclosporiasis outbreak in Germany
associated with the consumption of salad. Emerg Infect Dis
8:992994 (2005).
12 Sivapalasingam S, Friedman CR, Cohen L and Cauxe RV,
Fresh-produce: a growing cause of outbreaks of foodborne
illness in the United-States, 1973 through 1997. J Food Protect
67:23422353 (2004).
13 Sewell AM and Farber JM, Foodborne outbreaks in Canada
linked to produce. J Food Protect 64:18631877 (2001).
14 Rangel JM, Sparling PH, Crowe C, Griffin PM and Swerdlow DL, Epidemiology of Escherichia coli O157:H7 outbreaks,
United States, 19822002. Emerg Infect Dis 11:60308
(2005).
1462
15 Fain RF, A review of the microbiological safety of fresh-salads,

Dairy, Food, Environ Sanit 16:146149 (1996).
16 Ragaert P, Verbeke W, Devlieghere F and Debever J, Consumer
perception and choice of minimally processed vegetables and
packaged fruits. Food Qual Pref 14:259270 (2004).
17 International Fresh-cut Produce Association, Food Safety
Guidelines for the Fresh-cut Industry (3rd edn). International
Fresh-cut Produce Association, Washington, DC (1998).
18 Nguyen-the C and Carlin F, The microbiology of minimally
processed fresh fruits and vegetables. Crit Rev Food Sci Nutr
34:371401 (1994).
19 De Curtis ML, Franceschi O and De Castro N, Listeria
monocytogenes in vegetables minimally processed ready-to-use.
Arch Latino Am Nutr 52:282287 (2002).
20 Kaneko K-I, Hayashidani H, Ohtomo Y, Kosuge J, Kato M,
Takahashi K, et al, Bacterial contamination of ready-to-eat
foods in fresh products in retail shops and food factories.
J Food Protect 62:644649 (1999).
21 Thunberg RL, Tran TT, Bennett RW, Matthews RN and
Belay N, Microbial evaluation of selected fresh produce
obtained in retails markets. J Food Protect 65:677682 (2002).
22 Da Cruz AG, Cenci SA and Maia MCA, Good agricultural
practices in a Brazilian produce plant. Food Control
17:781788 (2006).
23 Ellis JD, Strohbehn CH and Henroid Jr DH, Assessing on-farm
food handling practices of Iowa grown produce and eggs in
regard to food safety. Food Protect Trends 25:758761 (2005).
24 Kokkinakis EN and Fragkiadakis GA, HACCP effect on
microbiological quality of minimally processed vegetables:
a survey in six mass-catering establishments. Int J Food Sci
Technol 42:1823 (2006).
25 Little C, Roberts D, Youngs E and de Louvois J, Microbiological quality of recall imported unprepared whole lettuces: a
PHLS Food Working Group study. J Food Protect 62:325328
(1999).
26 Sagoo SK, Little CL, Gillespie LA and Mitchell RT, Microbiological study of ready-to-eat salad vegetables from retail
establishments uncovers a national outbreak of salmonellosis.
J Food Protect 66:403409 (2003).
27 Johnston LM, Jaykus L-A, Moll D, Anciso J, Mora B and
Moe CL, A field study of the microbiological quality of
domestic and Mexican origin. Int J Food Microbiol 112:8395
(2006).
28 Tauxe R, Kruse H, Hedberg C, Potter M, Madden J and
Wachsmuth K, Microbial hazards and emerging issues
associated with produce: a preliminary report to the National
Advisory Committee on Microbiological Criteria for Foods.
J Food Protect 60:14001408 (2006).
29 Kim JG, Yousef AE and Dave S, Application of ozone for
enhancing the microbiological safety and quality of foods:
a review. J Food Protect 62:10711087 (1999).
30 Kim J-G, Yousef AE and Chism GW, Use of ozone to inactivate
microorganisms on lettuce. J Food Safety 19:734 (1999).
31 Siveira NFA, Berbari SG, Prestes EB, Bliska FMM and Silva N,
Efeito do uso do ozonio

na a gua de lavagem para desinfecca o
de alface minimamente processada. Anais do XIX Congresso
de Ciencia e Tecnologia de Alimentos, Recife (2004).
32 Singh N, Singh RK, Bhunia AK and Stroshine RL, Efficacy of
chlorine dioxide, ozone and thyme essential oil or a sequential
washing in killing Escherichia coli O157:H7 on lettuce and
baby carrots. LWT Food Sci Technol 35:720729 (2002).
33 Garcia A, Mount JR and Davidson PM, Ozone and chlorine
treatment of minimally processed lettuce. J Food Sci
68:27472751 (2003).
34 Baur S, Klaiber R, Hammes WP and Carle R, Sensory and
microbiological quality of shredded packaged iceberg lettuce
as affected by pre-washing procedures with chlorinated and
ozonated water. Innov Food Sci Emerg Technol 5:4555
(2004).
35 Beltran D, Selma MV, Marin A and Gil MJ, Ozonated water
extends the shelf-life of fresh-cut lettuce. J Agric Food Chem
53:56545663 (2005).
J Sci Food Agric 88:14551463 (2008)

DOI: 10.1002/jsfa

36 Uyttendaele M, Neyts K, Vanderswalmen H, Notebaert E and
Debevere J, Control of Aeromonas on minimally processed
vegetables by decontamination with lactic acid, chlorinated
water or thyme essecial oil solution. Int J Food Microbiol
90:263271 (2006).
37 Yuk HG, Yoo MY, Moon KD, Marshall DL and Oh DH,
Effect of combined ozone and organic acid treatment for
control of Escherichia coli O157:H7 and Listeria monocytogenes
on lettuce. J Food Sci 71:M83M87 (2006).
38 Koseki S and Isobe S, Effect of ozonated water treatment on
microbial control and on browning of iceberg lettuce (Lactuca
sativa L.). J Food Protect 69:154160 (2006).
E and Gil MI,
39 Selma MV, Beltran D, Allende A, Vera-Chacon
Elimination by ozone of Shigella sonnei in shredded lettuce
and in water. Food Microbiol 24:492499 (2007).
40 Berbari SA, Paschoalino JE and Silveira NFA, Effect of chlorine
in the washing water for desinfection of minimally processed
lettuce. Cienc Tecnol Alim 21:197201 (2001).
41 Li Y, Brackett RE, Shewfelt RL and Beuchat LR, Changes in
appearance and natural microflora on iceberg lettuce treated
in warm, chlorinated water and then stored at refrigeration
temperatures. Food Microbiol 18:299308 (2001).
42 Delaquis PJ, Fukumoto LR, Toivonen PMA and Cliff MA,
Implications of wash water chlorination and temperature for
the microbiological and sensory properties of fresh-cut iceberg
lettuce. Postharv Biol Technol 31:8191 (2004).
43 Baur S, Klaiber R, Hammes WP and Carle R, Effect of
temperature and chlorination of pre-washing on shelf-life and
physiological properties of ready-to-use lettuce. Innov Food
Sci Emerg Technol 6:171182 (2005).
44 Aruscavage D, Lee K, Miller S and LeJeune JT, Interactions
affecting the proliferation and control of human pathogens on
edible plants. J Food Sci 71:R89R94 (2006).
45 Allende A, Aguayo E and Artes F, Microbial and sensory quality
of commercial fresh red lettuce through the production chain
and shelf life. Int J Food Microbiol 91:109117 (2004).
46 Soriano JM, Rico H, Molto JC and Manes J, Assessment of the
microbiological quality and wash treatments of lettuce served
in University restaurants. Int J Food Microbiol 58:123128
(2000).
47 Simons LK and Sanguansri P, Advances in the washing of
minimally processed vegetables. Food Aust 49:7580 (1997).
J Sci Food Agric 88:14551463 (2008)

DOI: 10.1002/jsfa
48 Da Cruz AG, Cenci SA and Maia MCA, Pre-requesitos para

implementaca o do sistema APPCC em uma unidade
produtora de vegetais minimamente processados. Cienc Tecnol
Alim 26:104109 (2006).
49 Howard LR and Gonzalez AR, Food safety and produce
operation: what is the future? HortScience 36:3339 (2001).
50 McKnight S, Issues in water and safety. Food Protect Trends
22:512513 (2002).
51 Leoni E, Legnani PP and Lucano A, Analysis of a critical control
point in the production and distribution line of fresh vegetable
products. Ind Alim 42:361366 (2003).
52 Tournas VH, Moulds in fresh and minimally processed
vegetables and sprouts. Int J Food Microbiol 99:7177 (2005).
53 Garg N, Churey JJ and Splittstoesser DF, Effect of processing
conditions on the microflora of fresh-cut vegetables. J Food
Protect 53:701703 (1990).
54 Jay JM, Modern Food Microbiology. Springer, New York, NY
(2005).
55 Szabo EA, Scurrah KJ and Burrows JM, Survey for psychrotrophic bacterial pathogens in minimally processed lettuce. Lett Appl Microbiol 30:456460 (2000).
56 Agencia Nacional de Vigilancia Sanitaria, Regulamento tecnico
microbiologicos
sobre padroes
para alimentos. Resoluca o Dire
tiva Colegiada No. 12. [Online]. Ministerio da Saude,
Brazil
(2001). Available: http://www.anvisa.gov.br [13 February
2007].
57 Acevedo L, Mendoza C and Oyon R, Total and fecal coliform,
some enterobacteria, Staphylococcus sp and moulds in salads
for hot-dogs sold in Maracay, Venezuela. Arch Latino Am Nutr
51:366370 (2001).
58 Francis GA, Thomas C and OBeirne D, The microbiological
safety of minimally processed vegetables. Int J Food Sci Technol
34:122 (1999).
59 Salleh NA, Rusul G, Hassan Z, Reezal A, Isa SH, Nishibuchi M,
et al, Incidence of Salmonella in raw vegetables in Selangor,
Malaysia. Food Control 14:475479 (2003).
60 De Brito PF, Guimaraes AB, Salate CA and Alonso CAM,
Legislaca o para agroindustrias de vegetais minimamente
processados. Anais do I Simposio bero-Americano de Vegetais
Frescos e Cortados, Piracicaba, pp. 4149 (2006).
1463
J Sci Food Agric 88:14641471 (2008)
Effects of nitrogen application

on malt modification and dimethyl sulfide
precursor production in two Japanese barley
cultivars
Masahito Nanamori,1,2 Ryoichi Kanatani,1 Makoto Kihara,1 Kazumitsu Kawahara,1
Katsuhiro Hayashi,1 Toshihiro Watanabe,2 Takuro Shinano3 and Mitsuru Osaki2
1 Department
of Bioresources Research and Development, Sapporo Breweries Ltd, 37-1 Nittakizaki, Ota, Gunma 370-0393, Japan
School of Agriculture, Hokkaido University, Kitaku, Sapporo 060-0859, Japan
3 Creative Research Initiative Sousei, Hokkaido University, Kitaku, Sapporo 001-0021, Japan
2 Graduate
Abstract
BACKGROUND: Nitrogenous components have a great influence on both malt and beer qualities. Barley storage
proteins are degraded during the germination process, in which amino acids and small peptides are released.
Some of these compounds relate to dimethyl sulfide precursor production in the malting process. In this study,
barley and malt qualities were investigated using two Japanese barley cultivars, Sukai Golden and Mikamo Golden,
with several different nitrogen (N) treatments.
RESULTS: Nitrogen top-dressing treatments efficiently increased N and sulfur (S) concentrations in grains. A
difference in malt modification was induced by these treatments without any change in protease activity in malts.
S-Methyl methionine (SMM) concentration in malt of Sukai Golden with low-N treatment was 1.82.1 times
higher than that with higher-N treatments. Methionine concentration in malts was not significantly affected by N
treatments of both cultivars, while grain S level was not consistent under any treatments.
CONCLUSION: Results show that low-N treatment increases SMM concentration in malts despite major Scontaining amino acids of malts being not highly affected by the difference in nutrient status of grains. Further
investigations are necessary into aspects of both metabolic profiles in barley germination and SMM degradation
in the kilning process.
Keywords: nitrogen fertilisation; barley quality; malt modification; dimethyl sulfide precursor; S-methyl
methionine
INTRODUCTION
High-molecular-weight compounds such as starches
and proteins in barley grain are degraded as germination proceeds and are used for subsequent seedling
development. These compounds are also fermented
with yeasts in brewing. In the brewing process it is
important to understand the malting traits in order
to control the malt qualities as well as the final beer
quality.
Barley with high nitrogen (N) content causes low
recovery of extracts from malts and may influence the
formation of haze in the finished beer. On the other
hand, barley with low N content causes malnutrition
of yeasts and affects the foam stability of the finished
beer. Thus precise regulation of the N content in the
seed is very important for the beer-brewing process.
Storage proteins in barley are degraded into peptides

and amino acids by four endoproteases.1 One of the
most important proteases is cysteine protease, because
it is considered to have the strongest influence on
malt qualities such as soluble nitrogen (SN) in wort.2
The degradation of storage proteins by proteases is
of importance in malting, because SN in wort is
essential for fermentation by yeasts. The Kolbach
index (KI), which indicates the degree of solubilisation
of storage proteins in malts, has a great influence on
beer quality.3 The patterns of uptake of individual
amino acids formed by proteolysis in malting and
mashing are categorised into four groups.4 In a study
on the effects of individual amino acids, Edney and
Langrell5 reported that the amino acid content in the
wort had no influence on the final attenuation limit,
Correspondence to: Masahito Nanamori, Department of Bioresources Research and Development, Sapporo Breweries Ltd, 37-1 Nittakizaki, Ota, Gunma
370-0393, Japan
E-mail: masahito.nanamori@sapporobeer.co.jp
(Received 29 November 2007; revised version received 21 January 2008; accepted 25 January 2008)
Effects of nitrogen application on Japanese barley cultivars
but that a difference in barley cultivars had a significant

influence on the final attenuation limit. However, it has
been suggested that amino acids such as methionine
and lysine affect the fermentation performance.6,7
Dimethyl sulfide (DMS), which gives a boiled vegetable flavour to beer, is formed from its precursors
S-methyl methionine (SMM) and dimethyl sulfoxide
(DMSO). SMM is involved in the methionine cycle
in plant metabolism, and it was shown that SMM
contributed to phloem sulfur (S) transport in wheat
during maturation, with 80% of the S in the grain
being transported as SMM.8 There have been several
reports on the physiological role of SMM,9,10 but it
has not yet been fully elucidated. SMM is synthesised in germinating barley seed from L-methionine
and S-adenosyl-L-methionine. The reaction is catalysed by S-adenosyl-L-methionine:L-methionine Smethyltransferase (MMT), which is localised in the
shoot, scutellum and aleurone cells but not in the root
or endosperm.11 After the germination period, some
of the synthesised SMM decomposes into DMS or
DMSO during the kilning process and wort boiling,
and then DMSO is reduced to DMS by yeasts during
fermentation.12
The protein content in barley and its malting traits
are of great importance in the influence of N compounds on beer quality. Barley with 912% protein
content is believed to be favourable for making malts in
Japan, so adequate field management is necessary. Barley protein content is affected by several factors such as
temperature, rainfall, amount of fertiliser and timing
of its application. In particular, the management of N
fertilisation is important in controlling barley protein
content, and N fertilisation affects -amylase activity and malt qualities.13 Barley protein content also
affects endosperm texture and constituents including
-glucan and arabinoxylan in the grain.14 It is desirable
to understand the barley qualities and its malting traits
before using such material in malt-houses and breweries. Beer quality depends on the barley, and barley
quality is dependent on the growing conditions in the
field. The aim of this study was to investigate the influence of N fertilisation on malt qualities, particularly
focusing on malt modification and dimethyl sulfide
precursor (DMSP) production, using two Japanese
barley cultivars.

Barley cultivation
A field trial was carried out in the 20052006
growing season. Two Japanese barley cultivars, Sukai
Golden and Mikamo Golden, were grown in a test
plot of Sapporo Breweries Ltd in Gunma, Japan
(36 16 N, 139 18 E). Sukai Golden is a well-modified
cultivar with rapid germination. Mikamo Golden has
a well-balanced modification property and the largest
cultivated acreage of Japanese malting barley cultivars.
An N basal dressing of 30 or 60 kg N ha1 was
applied as urea. Plants were grown with or without an
J Sci Food Agric 88:14641471 (2008)
DOI: 10.1002/jsfa
N top-dressing of 30 kg N ha1 at the booting stage in

each basal treatment respectively: 30/0 means 30 kg
N ha1 of basal dressing without top-dressing; 30/30
means 30 kg N ha1 of basal dressing with 30 kg N
ha1 of top-dressing; 60/0 means 60 kg N ha1 of
basal dressing without top-dressing; 60/30 means
60 kg N ha1 of basal dressing with 30 kg N ha1 of
top-dressing. Phosphorus and potassium were applied
as a basal dressing of 60 kg ha1 (equivalent amount
of P2 O5 or K2 O respectively) for all treatments. Each
treatment was carried out with three replicates.
Measurement of N and S concentrations
Barley and malt samples were milled and digested with
sulfuric acid and copper sulfate for N measurement.
Total N was determined by the Kjeldahl method.15
Malt protein was calculated by multiplying the total N
of malts by 6.25. For S measurement, barley samples
were analysed using a Vario Max CNS analyser (Elementar Analysensysteme GmbH, Hanau, Germany).
Micro-malting and malt analysis
Barley samples were malted on a micro-scale (using a
250 g barley sample) according to Kihara et al.2
a) Steeping casting moisture was targeted to reach
43.0% for all samples. Since hydration was
expected to be variable among samples, the
steeping time was estimated for each sample
preliminarily. Samples were intermittently put into
the Automatic Micro-malting machine (Phoenix
Biosystems, Adelaide, Australia) to allow them
to be steeped for the required time to reach the
desired moisture level. Steeping consisted of a
repeated cycle of 5 h immersion and 7 h air rest
(non-immersion period with over 95% humidity),
both at 15 C. No aeration was applied in the
steeping period.
b) Germination 15 C for 115 h with continuous
water spraying.
c) Kilning 100% fresh air/0% recirculation for
13.5 h at 55 C; 100%/0% for 8 h at 65 C;
50%/50% for 3.5 h at 75 C; 50%/50% for 4 h
at 83.5 C.
Rootlets were removed prior to analysis. Malt moisture, wort colour (WC), boiled wort colour (BWC),
extract (fine grind, 0.2 mm), SN, apparent attenuation
limit (AAL), diastatic power (DP), Hartong index (VZ
45 C), viscosity, wort -glucan (WBG) and friability
were determined according to standard methods of
the European Brewing Convention (EBC).15 SMM,
DMSO and DMS were determined according to standard methods of the American Society of Brewing
Chemists (ASBC).16
Barley -glucan analysis
For measurement of the -glucan concentration in
barley grain, 750 L of water was added to 25 mg of
ground barley and the sample was incubated in boiled
1465
M Nanamori et al.
water for 60 min. After cooling, 750 L of concentrated

HCl was added and the sample was incubated in
boiled water again for 10 min. After centrifugation
at 18 500 g for 15 min at 25 C the supernatant
was collected and used for the measurement. The
determination of -glucan in the extract was achieved
by detecting the fluorescence in the reaction between
-glucan and calcoflour using a flow injection analysis
(FIA) system.17
Amino acid analysis
Amino acids were extracted according to Kihara
et al.17 with slight modification. Malt samples were
milled and 25 mg of milled sample was mixed with
1 mL of cold water. The sample was then incubated at
5 C for 15 h. The extract was ultrafiltered and used
for high-performance liquid chromatography (HPLC)
analysis. The fluorescence reaction was achieved using
Waters AccQ Fluor Reagent (6-aminoquinolyl-Nhydroxysuccinimidyl carabamate) and the concentration was determined by detecting the fluorescence at
395 nm.
Enzyme extraction
Malt protease was extracted using a buffer containing
10 mmol L1 Tris-HCl (pH 6.8) and 10 mmol
L1 dithiothreitol (DTT). A 20 mg ground malt
sample was incubated in the extraction buffer at
4 C overnight. After centrifugation at 18 500 g for
10 min at 4 C the supernatant was collected as the
crude extract and used for the assay according to
Kihara et al.2
Malt -amylase and barley -amylase were extracted
in the same way as malt protease except for the
composition of the extraction buffer. The extraction
buffer for malt -amylase contained 50 mmol L1
malate (pH 5.4), 50 mmol L1 NaCl, 2 mmol
L1 CaCl2 and 0.77 mmol L1 sodium azide. The
extraction buffer for barley -amylase contained
20 mmol L1 sodium acetate (pH 5.5) and 10 mmol
L1 DTT.
Enzyme activity
Malt protease activity was measured using resorufinlabelled casein as the substrate (Roche Diagnostics
GmbH, Mannheim, Germany).18 Casein solution
(4 g L1 , pH 5.0) containing 20 mmol L1 succinic
acid and 20 mmol L1 CaCl2 was mixed with
the crude extract. The mixture was incubated at
37 C for 4 h, then the reaction was stopped by
adding 50 g L1 trichloroacetic acid (TCA). After
centrifugation at 18 500 g for 10 min at 5 C the
supernatant was collected and diluted by a factor
of 2.5 with 0.5 mol L1 Tris-HCl buffer (pH
8.8). Subsequently the absorbance at 574 nm was
measured.
For the measurement of malt -amylase activity the
reaction was started by mixing a solution containing
p-nitrophenyl maltoheptaoside and -glucosidase with
the crude extract. Trisodium phosphate was added
1466
to stop the reaction after incubation at 37 C for

10 min, followed by measurement of the absorbance
at 405 nm.
Before the assay of barley -amylase activity the
crude extract was diluted by a factor of 500 with
50 mmol L1 3-[N-Morpholino] propanesulfonic acid
(MOPS) buffer. The reaction was started by mixing a
solution containing p-nitrophenyl--maltoheptaoside
and -glucosidase with the diluted extract. Tris was
added to stop the reaction after incubation at 37 C for
10 min, then the absorbance at 405 nm was measured.
The experimental data were first subjected to two-way
analysis of variance (ANOVA). After confirmation
that there was no significant interaction, the data were
then subjected to one-way ANOVA for each cultivar.
When a significant effect of N treatment was suggested,
the difference was determined by the least significant
difference (LSD) procedure (P < 0.05).
RESULTS
Grain yield and nutrient status in grains
Grain yield in each treatment was increased by basal
dressing and/or top-dressing of N fertiliser (Table 1).
Basal dressing increased the yield of Sukai Golden
efficiently, while the total amount of N fertiliser
had a significant positive influence on the yield of
Mikamo Golden. Nitrogen concentration in grains was
effectively increased by top-dressing, indicating the
importance of the timing of N application (Table 2).
Basal dressing did not affect grain N concentration
when top-dressing was applied in both cultivars. Sulfur
concentration was also affected by top-dressing in
Sukai Golden, and the change in S concentration
corresponded with that in N concentration. However,
the effect of N fertilisation was not statistically
significant in Mikamo Golden.
Malt quality
Protein content in malts corresponded with N
concentration in grains (Table 3). Nitrogen topdressing increased malt protein equally well in both
cultivars. On the other hand, malt extract generally
correlated negatively with malt protein. In this study,
malt extract decreased as malt protein increased.
Sukai Golden had slightly higher malt extract than
Mikamo Golden. DP, which mainly reflects -amylase
and -amylase activities, correlated positively with
malt protein content. No significant difference in
AAL within treatments was observed. SN, which
includes amino acids and small peptides, was higher
when malt protein was higher in all treatments.
KI was significantly lower in the 30/0 treatment
of Mikamo Golden, while there was no change in
Sukai Golden. SN and KI were higher in Sukai
Golden than in Mikamo Golden, indicating faster
degradation of nitrogenous components of the former
cultivar. Friability was decreased by top-dressing, the
J Sci Food Agric 88:14641471 (2008)
DOI: 10.1002/jsfa

Table 1. Grain yield (kg ha1 ) in each N treatment
N treatment
Cultivar
Sukai Golden
Mikamo Golden
30/0
30/30
60/0
60/30
3.67 0.31c
3.63 0.39b
4.28 0.35b
4.33 0.30ab
4.80 0.19b
4.38 0.19ab
5.40 0.11a
5.07 0.15a
Treatments: 30/0, 30 kg N ha1 of basal dressing without top-dressing; 30/30, 30 kg N ha1 of basal dressing with 30 kg N ha1 of top-dressing;
60/0, 60 kg N ha1 of basal dressing without top-dressing; 60/30, 60 kg N ha1 of basal dressing with 30 kg N ha1 of top-dressing. Values are
mean SE of three replicates. The effect of N treatment was determined separately between cultivars by LSD (P < 0.05).
Table 2. Nitrogen and sulfur concentrations (mg g1 DW) in grain of each N treatment
N treatment
Cultivar/nutrient
Sukai Golden
Nitrogen
Sulfur
N/S ratio
Mikamo Golden
Nitrogen
Sulfur
N/S ratio
30/0
30/30
60/0
60/30
14.8 0.3b
1.38 0.02c
10.7
17.0 0.1a
1.51 0.03a
11.3
15.6 0.1b
1.41 0.02bc
11.0
16.8 0.2a
1.46 0.02ab
11.5
15.1 0.4b
14.1 0.02
10.6
17.4 0.3a
1.50 0.02
11.6
16.2 0.5ab
1.48 0.04
10.9
17.2 0.3a
1.52 0.04
11.3
Values are mean SE of three replicates. The effect of N treatment was determined separately between cultivars by LSD (P < 0.05).
Table 3. Malt quality in each N treatment
N treatment
Cultivar/parameter
Sukai Golden
Moisture (%)
WC (EBC)
BWC (EBC)
Extract (%)
AAL (%)
Hartong 45 C (%)
DP ( WK)
Protein (%)
SN (%)
KI
Friability (%)
WBG (mg L1 )
Viscosity (mPa s)
pH
Mikamo Golden
Moisture (%)
WC (EBC)
BWC (EBC)
Extract (%)
AAL (%)
Hartong 45 C (%)
DP ( WK)
Protein (%)
SN (%)
KI
Friability (%)
WBG (mg L1 )
Viscosity (mPa s)
PH
30/0
30/30
60/0
60/30
4.5 0.1a
3.8 0.2ab
6.6 0.5ab
84.6 0.1a
86.5 0.6
40.7 2.1
242 8a
8.8 0.2c
0.757 0.022c
53.6 0.9
97.3 0.1a
54 1b
1.49 0.01ab
6.04 0.02ab
4.0 0.2b
4.3 0.3a
7.9 0.6a
84.1 0.2b
84.6 0.4
42.9 0.8
270 6ab
10.4 0.1a
0.873 0.014a
52.7 0.1
93.0 1.8b
61 1a
1.50 0.00a
6.00 0.01a
4.3 0.0ab
3.6 0.1b
6.2 0.3b
84.5 0.1ab
86.2 0.9
38.8 1.1
272 7ab
9.4 0.1b
0.786 0.009bc
52.3 0.8
98.9 0.5a
52 1c
1.49 0.00b
6.05 0.00b
4.5 0.1a
3.6 0.2b
6.1 0.3b
84.3 0.2ab
85.5 0.5
38.5 1.2
295 24b
10.1 0.2a
0.827 0.013ab
51.2 0.6
95.5 1.4ab
50 1d
1.48 0.00b
6.05 0.01b
4.5 0.1
4.5 0.1a
6.0 0.2
83.9 0.1a
84.1 0.4
36.4 0.3
252 4c
9.0 0.3b
0.679 0.015b
47.2 0.4a
90.2 2.9a
90 4b
1.51 0.01
6.14 0.01a
4.6 0.1
4.4 0.2ab
6.4 0.2
82.7 0.4b
83.7 0.3
38.5 0.4
296 12ab
10.5 0.3a
0.769 0.019a
45.7 0.5b
76.5 2.9b
125 6a
1.53 0.01
6.10 0.01b
4.4 0.1
4.1 0.1bc
6.0 0.3
83.3 0.2ab
83.4 0.2
38.2 1.5
268 2bc
10.0 0.3ab
0.729 0.028ab
45.8 0.4b
88.2 1.5a
115 5a
1.52 0.01
6.11 0.01b
4.6 0.1
4.0 0.1c
5.9 0.2
82.8 0.2b
84.0 0.0
36.9 0.1
303 21a
10.6 0.3a
0.771 0.018a
45.6 0.1b
78.1 2.6b
116 2a
1.51 0.00
6.11 0.01b
Malt was analysed by EBC-recommended methods. Values are mean SE of three replicates. The effect of N treatment was determined separately
between cultivars by LSD (P < 0.05). WC, wort colour; BWC, boiled wort colour; AAL, apparent attenuation limit; DP, diastatic power; SN, soluble
nitrogen; KI, Kolbach index; WBG, wort -glucan.
J Sci Food Agric 88:14641471 (2008)

DOI: 10.1002/jsfa
1467
M Nanamori et al.
effect being more prominent in Mikamo Golden than

in Sukai Golden. WBG was highest in the 30/30
treatment of both cultivars.
DMSP concentration in malts
SMM concentration was highest in the treatment
with low N in both cultivars, with the difference
being more obvious in Sukai Golden (Fig. 1(A)).
SMM concentration in the 30/0 treatment of Sukai
Golden was 1.82.1 times higher than that in
other treatments. SMM is heat-labile and partly
decomposes during kilning into DMS. Interestingly,
DMS concentration in malt had an inverse relation
with SMM concentration, so that DMS concentration
in the 30/0 treatment was lower than that in any other
7.0
SMM (mg kg-1)
6.0
a
5.0
ab
4.0
c
b
3.0
bc
2.0
1.0
0.0
(B)
Sukai Golden
Mikamo Golden
8.0
7.0
ab
ab
DMSO (mg kg-1)
6.0
5.0
4.0
3.0
2.0
1.0
0.0
(C)
Sukai Golden
Mikamo Golden
Amino acid concentration

SMM, which may affect the final concentration of
DMS, is synthesised from methionine. Concentrations
of 19 amino acids, including methionine, in malts
were measured, and Table 4 shows the ratio of
each against protein concentration in malt. Amino
acid concentration tended to be higher in malts
with high protein content. However, there was no
significant difference in methionine concentration
among treatments.
Enzyme activity
Several types of protease are involved in the
degradation of storage proteins in barley germination,
with cysteine protease having the strongest influence
on malt qualities.2 However, total protease activity
has to be considered in the degradation of nitrogenous
compounds. In the present study, protease activity in
malts was not affected by N treatments, and there
were no differences in activity between Sukai Golden
and Mikamo Golden (Fig. 3).
The activities of malt -amylase and barley amylase were not significantly influenced by N treatments (Fig. 4(A) and 4(B) respectively). However,
there was an indication that these enzyme activities
increased as protein content increased.
7.0
60
6.0
a
5.0
DMS (mg kg-1)
-Glucan concentration in grains

To clarify the relationship between barley -glucan
concentration and malt modification, the -glucan
concentration in grains was determined (Fig. 2).
Barley -glucan concentration was stable despite the
change in nitrogenous status in both cultivars. Sukai
Golden had lower -glucan concentration, around
7276% of that in Mikamo Golden.
ab
4.0
3.0
ab
2.0
1.0
0.0
Sukai Golden
Beta-glucan (mg g-1 DW)
(A)
treatment (Fig. 1(C)). DMSO concentration in the

30/0 treatment of Sukai Golden was slightly higher
than that in other treatments, but the difference
was not significant (Fig. 1(B)). In Mikamo Golden,
DMSO concentration in the 30/30 treatment was
significantly higher than that in the 60/30 treatment.
50
40
30
20
10
Mikamo Golden
0
Figure 1. DMSP ((A) SMM, (B) DMSO, (C) DMS) concentrations in
malt of each N treatment: 30/0, white bars; 30/30, diagonal bars;
60/0, dotted bars; 60/30, black bars. Values are mean SE of two
replicates. The effect of N treatment was determined separately
between cultivars by LSD (P < 0.05).
1468
Sukai Golden
Mikamo Golden
Figure 2. -Glucan concentration in grain of each N treatment: 30/0,

white bars; 30/30, diagonal bars; 60/0, dotted bars; 60/30, black bars.
Values are mean SE of three replicates.
J Sci Food Agric 88:14641471 (2008)

DOI: 10.1002/jsfa

Table 4. Amino acid (AA) ratio against protein concentration (%) in malt of each N treatment
N treatment
Cultivar/AA
Sukai Golden
Gly
Ala
Val
Leu
Ile
Ser
Thr
Lys
Arg
Asp
Asn
Glu
Gln
Cys
Met
Phe
Tyr
Pro
His
Mikamo Golden
Gly
Ala
Val
Leu
Ile
Ser
Thr
Lys
Arg
Asp
Asn
Glu
Gln
Cys
Met
Phe
Tyr
Pro
His
30/0
30/30
60/0
60/30
0.22 0.01
0.64 0.06
0.86 0.01a
0.98 0.01
0.56 0.01
0.45 0.02
0.52 0.03
0.58 0.01a
0.95 0.03
0.77 0.05
1.47 0.04
0.83 0.03
1.98 0.12
0.07 0.01
0.23 0.01
1.23 0.01
0.79 0.01
4.19 0.27
0.39 0.01
0.20 0.01
0.54 0.03
0.81 0.02b
0.99 0.02
0.55 0.00
0.46 0.02
0.46 0.01
0.49 0.02c
0.87 0.01
0.69 0.03
1.37 0.11
0.72 0.01
2.08 0.07
0.05 0.00
0.22 0.01
1.18 0.01
0.76 0.01
4.18 0.11
0.35 0.01
0.21 0.01
0.54 0.01
0.86 0.02a
1.01 0.01
0.56 0.00
0.48 0.01
0.48 0.01
0.56 0.01ab
1.02 0.04
0.70 0.01
1.45 0.12
0.77 0.03
2.17 0.02
0.06 0.01
0.22 0.00
1.23 0.00
0.79 0.01
4.72 0.39
0.40 0.02
0.22 0.00
0.51 0.03
0.83 0.02ab
0.98 0.02
0.55 0.01
0.47 0.01
0.45 0.01
0.52 0.01b
0.95 0.04
0.65 0.01
1.45 0.06
0.77 0.01
2.24 0.06
0.06 0.00
0.21 0.00
1.21 0.03
0.78 0.01
4.46 0.32
0.38 0.01
0.21 0.02
0.57 0.01a
0.69 0.09
0.75 0.07
0.42 0.05
0.37 0.04
0.42 0.01
0.47 0.07
0.74 0.06
0.67 0.04
1.14 0.10ab
0.65 0.04
1.42 0.14
0.03 0.03
0.21 0.01
0.84 0.10
0.62 0.07
3.81 0.11ab
0.33 0.03
0.21 0.00
0.53 0.02ab
0.73 0.02
0.75 0.03
0.44 0.02
0.37 0.01
0.42 0.02
0.46 0.02c
0.85 0.08
0.64 0.02
1.49 0.06a
0.62 0.02
1.51 0.06
0.01 0.01
0.19 0.01
0.86 0.02
0.62 0.02
3.72 0.07ab
0.35 0.01
0.17 0.01
0.45 0.00b
0.64 0.02
0.71 0.01
0.40 0.00
0.33 0.00
0.37 0.00
0.41 0.02
0.68 0.04
0.59 0.04
1.02 0.13b
0.56 0.03
1.36 0.02
0.05 0.00
0.19 0.01
0.82 0.01
0.60 0.01
3.09 0.23b
0.31 0.02
0.20 0.01
0.51 0.05ab
0.68 0.02
0.72 0.03
0.42 0.02
0.36 0.01
0.40 0.03
0.43 0.01
0.83 0.05
0.60 0.03
1.38 0.17ab
0.61 0.04
1.55 0.07
0.03 0.01
0.18 0.01
0.82 0.03
0.61 0.02
3.93 0.42a
0.33 0.01
Values are mean SE of three replicates. The effect of N treatment was determined separately between cultivars by LSD (P < 0.05).
DISCUSSION
Nitrogen basal dressing increased grain yields, more
prominently in Sukai Golden than in Mikamo Golden
(Table 1). However, N and S concentrations in grains
were not affected significantly by basal dressing in both
cultivars (Table 2). Nitrogen concentration in grains
was increased efficiently by top-dressing as reported
by Chen et al.13 It was shown that the timing of
N application is important for the nutrient status in
grain (Table 2). Nitrogen applied as basal dressing
was utilised mainly during the vegetative stage for
plant growth, while that applied as top-dressing was
translocated into grain efficiently. Grain S concentration correlated with grain N concentration as reported
by Zhao et al.19 Therefore translocation of N may have
a positive relation with S translocation in barley.
J Sci Food Agric 88:14641471 (2008)
DOI: 10.1002/jsfa
The effects of cultivar and N fertilisation on malt

qualities have been studied. Malt extract declined
almost linearly with increasing N application.20 Agu21
discussed the relationships between barley N level and
wort properties and showed that barley with higher N
content had a slower rate of endosperm modification
and lower extract yield, while barley with lower N
content had a faster rate of endosperm modification
and higher extract yield. In the present study, malt
extract declined as protein content in barley increased,
and the decline in Mikamo Golden was more dramatic
than that in Sukai Golden, indicating that Sukai
Golden is more manageable in terms of malt quality
(Table 3).
Both barley -amylase activity and malt -amylase
activity tended to correlate with protein content in
1469
M Nanamori et al.
Protease activity
(pmol min-1 mg-1 DW)
15
12
9
6
3
0
Sukai Golden
Mikamo Golden
(A)
250
Alpha-amylase activity
(nmol min-1 mg-1 DW)
Figure 3. Protease activity in malt of each N treatment: 30/0, white

bars; 30/30, diagonal bars; 60/0, dotted bars; 60/30, black bars.
Protease activity was defined as the activity degrading 1 pmol
resorufin-labelled casein min1 . Values are mean SE of three
replicates.
200
150
100
50
(B)
1.5
Beta-amylase activity
(nmol min-1 mg-1 DW)
1.2
Sukai Golden
Mikamo Golden
Sukai Golden
Mikamo Golden
0.9
0.6
0.3
0.0
Figure 4. Activities of starch-hydrolysing enzymes ((A) malt

-amylase, (B) barley -amylase) of each N treatment: 30/0, white
bars; 30/30, diagonal bars; 60/0, dotted bars; 60/30, black bars. Both
enzyme activities were defined as the activity degrading 1 nmol
substrate min1 . Values are mean SE of three replicates.
both cultivars, although there were no statistically

significant differences (Fig. 4). DP indicates the
level of starch-degrading ability, which refers to the
combined activities of -amylase, -amylase, limit
dextrinase and -glucosidase. It has been shown
that -amylase is the only DP enzyme to correlate
with DP.22 Our results support the possibility of the
contribution of both -amylase and -amylase to DP.
1470
However, -amylase might contribute more than amylase to the changes in malt DP, because -amylase
activity showed larger fluctuations, suggesting the ratelimiting role of -amylase.
Leach et al.14 showed that barley with high protein
content tended to have higher SN level and lower KI.
Our results show that high protein content induces
high SN in wort (Table 3). However, KI in Sukai
Golden was not affected significantly by N treatment.
This suggests that the barley protein content is critical
for these cultivars in the aspect of N nutrient for
yeasts. Amino acid content also tended to be higher
in high-protein barley, but this did not affect the
fermentability (Tables 3 and 4). Thus these barley
cultivars resulted in less sensitivity of fermentability to
N fertilisation even though the extract declined with
increasing protein content.
-Glucan and protein content in barley is affected by
environmental factors, which contributed the largest
component of the variation in those compounds.23
Wang et al.24 showed that there are cultivar and
environmental variations of -glucan content in both
malt and grain, but they are much higher in malt
than in grain. Barley -glucan concentration was
lower in Sukai Golden than in Mikamo Golden
(Fig. 2). Nitrogen treatment did not affect the
levels of -glucan in either cultivar. These results
indicate that the difference in modification between
N treatments is not due to the change in barley
-glucan concentration. On the other hand, MolinaCano et al.25 reported that a mutant that had low
-glucan content improved its malting quality and
extract yield by enhancing germination speed and
hence starch degradation. Rapid germination and good
modification in Sukai Golden may be due to lower glucan concentration, which enables easier enzymatic
attacks on the endosperm.
WBG was significantly affected by N treatments
(Table 3). Although -glucanase contributes to glucan degradation, the factors influencing the
differences in WBG were not revealed in this study,
because the -glucanase activity fluctuated greatly
(data not shown). Friability decreased with increasing
protein content in both cultivars, the effect being larger
in Mikamo Golden than in Sukai Golden. Although it
is obvious that higher protein content induces lower
friability in malts, the marked decrease in friability
in Mikamo Golden might be indicative of uneven
modification, although the reason is unclear.
SMM and DMSO are precursors of DMS. The
former is thermally decomposed into DMS during
the kilning process and wort boiling. Although the
majority of DMS generated in the malting process is
released in wort boiling, DMS generated after wort
boiling might remain in the finished beer. DMSO
is also derived from SMM and can be reduced
to DMS during fermentation by yeasts. Therefore
SMM concentration in malt is believed to be a key
factor for DMS production. Our results show that
low-N treatment increases SMM concentration in
J Sci Food Agric 88:14641471 (2008)
DOI: 10.1002/jsfa
malt (Fig. 1). The response to N treatment differed

in the two cultivars. Interestingly, there was an
inverse relationship between SMM and DMS in
malt. Dethier26 showed that SMM and methionine
increased in parallel in germinating barley, although
there was a lag period between the two compounds.
Protein is degraded in starchy endosperm, releasing
methionine, which diffuses into the germ where SMM
can be synthesised. Dethier26 suggested that SMM
synthesis is strongly dependent on the methionine
content in the corresponding fraction. However,
neither methionine concentration in malt nor total
DMSP (SMM, DMSO and DMS) differed among
N treatments in our study (Table 4, Fig. 1). As
N and S concentrations in grain increased with N
top-dressing, the N/S ratio in grain also increased
(Table 2). This indicates that the relative amount of
S in grain was higher when N top-dressing was not
applied. Zhao et al.19 showed that S application to
S-deficient malting barley crop increased DMSP in
the malt and hence could have a significant impact
on the flavour of the beer. Our results suggest that
barley can maintain a homeostasis of SMM synthesis
from methionine in germination despite the difference
in N status in grain. It was interesting that SMM
concentration in the malt from barley with low N and
S content was high. Yang and Schwarz27 suggested
that steeping and germination temperature influences
the synthesis and levels of SMM in green malt but
that kilning temperature determines the final levels
of SMM and DMSO in malt. The degradation of
SMM in low-N malt may not be enhanced during
kilning. Further investigation is necessary into detailed
metabolic profiles in barley germination and/or SMM
degradation in kilning to elucidate factors influencing
the DMSP concentration in malt.
ACKNOWLEDGEMENTS
We are grateful for the cooperation of Mr Kiyoshi
Takoi and Ms Kimiko Otake in the analysis of barley
and malt qualities. We also thank Dr Isao Kishinami
for advice in writing this paper.
REFERENCES
1 Jones BL, Marinac LA and Fontanini D, Quantitative study of
the formation of endoproteolytic activities during malting and
their stabilities to kilning. J Agric Food Chem 48:38983905
(2000).
2 Kihara M, Saito W, Okada Y, Kaneko T, Asakura T and Ito K,
Relationship between protease activity during malting and
malt quality. J Inst Brew 108:371376 (2002).
3 Enari TM, Proteinases and peptidases of malt and their
influence on wort composition and beer quality. Cerevisia
11:1928 (1986).
4 Clapperton JF, Simple peptides of wort and beer. J Inst Brew
88:244252 (1971).
5 Edney MJ and Langrell DE, Effect of fermentable sugars and
amino acids on fermentability of malts made from four barley
varieties. Tech Q MBAA 42:101106 (2005).
6 Lekkas C, Stewart GG, Hill A, Taidi B and Hodgson J, The
importance of free amino nitrogen in wort and beer. Tech Q
MBAA 42:113116 (2005).
J Sci Food Agric 88:14641471 (2008)

DOI: 10.1002/jsfa
7 Lekkas C, Stewart CG, Hill AE, Taidi B and Hodgson J,

Elucidation of the role of nitrogenous wort components in
yeast fermentation. J Inst Brew 113:38 (2007).
8 Bourgis F, Roje S, Nucio ML, Fisher DB, Tarczynski MC,
Li C, et al, S-Methylmethionine plays a major role in phloem
sulfur transport and is synthesized by a novel type of
methyltransferase. Plant Cell 11:14851498 (1999).
9 Gyetvai E, Racz I, Lasztity D, Szalai G, Janda T, Marton L,
et al, Effect of S-methylmethionine as a protective compound
on the metabolism of agricultural plants at low temperature.
Acta Biol Szeged 46:9596.
10 Manegus F, Lilliu I, Brambilla I, Bonfà M and Scaglioni L,
Unusual accumulation of S-methylmethionine in aerobicetiolated and in anoxic rice seedlings: an 1 H-NMR study.
J Plant Physiol 161:725732 (2004).
11 Pimenta MJ, Kaneta T, Larondelle Y, Dohmae N and
Kamiya Y, S-Adenosyl-L-methionine:L-methionine S-methyltransferase from germinating barley. Purification and localization. Plant Physiol 118:431438 (1998).
12 Annes BJ and Bamforth CW, Dimethyl sulfide a review. J Inst
Brew 88:244252 (1982).
13 Chen JX, Dai F, Wei K and Zhang GP, Relationship between
malt qualities and -amylase activity and protein content as
affected by timing of nitrogen fertilizer application. J Zhejiang
Univ Sci B 7:7984 (2006).
14 Leach R, Li Y, Edney M, Izydorczyk M, Egi A and Sawatzky K,
Effects of barley protein content on barley endosperm texture,
processing condition requirements, and malt and beer quality.
Tech Q MBAA 39:191202 (2002).
15 EBC, Analytica-EBC. European Brewery Convention, Brussels
(1998).
16 ASBC, Methods of Analysis of the American Society of Brewing
Chemists (8th rev. edn). American Society of Brewing
Chemists, St Paul, MN (1999).
17 Kihara M, Okada Y, Iimure T and Ito K, Accumulation and
degradation of two functional constituents, GABA and betaglucan, and their varietal differences in germinated barley
grains. Breed Sci 57:8589 (2007).
18 Ahokas H and Naskali L, Variation of -amylase, -amylase,
-glucanase, pullulanase, proteinase and chitanase activity in
germinated samples of the wild progenitor of barley. J Inst
Brew 96:2731 (1990).
19 Zhao FJ, Fortune S, Barbosa VL, McGrath SP, Stobart R,
Self M, et al, Sulphur requirement of malting barley: effects on
yield and quality and diagnosis of sulphur deficiency. HGCA
Project Rep 369 (2005).
20 Eagles HA, Bedggood AG, Panozzo JF and Martin P, Cultivar
and environmental effects on malting quality in barley. Aust J
Agric Res 46:831844 (1995).
21 Agu RC, Some relationships between malted barleys of different
nitrogen levels and the wort properties. J Inst Brew
109:106109 (2003).
22 Evans DE, Lance RCM, Eglinton JK, Logue SJ and Barr AR,
The influence of beta-amylase isoform pattern on betaamylase activity in barley and malt. Proc 45th Aust Cereal
Chemistry Conf, pp. 357368 (1995).
23 Zhang GP, Chen JX, Wang JM and Ding SR, Cultivar and
environmental effects on -glucan and protein content in
malting barley. J Cereal Sci 34:295301 (2001).
24 Wang J, Zhan G, Chen J and Wu F, The changes of -glucan
content and -glucanase activity in barley before and after
malting and their relationships to malt qualities. Food Chem
86:223228 (2004).
25 Molina-Cano JL, Roca de Togores F, Royo C and Perez A,
Fast-germinating low -glucan mutants induced in barley
with improved malting quality and yield. Theor Appl Genet
78:748754 (1989).
26 Dethier M, In vivo and in vitro investigations of the synthesis
of S-methylmethionine during barley germination. J Am Soc
Brew Chem 49:3137 (1991).
27 Yang B and Schwarz P, Factors involved in the formation of two
precursors of dimethylsulfide during malting. J Am Soc Brew
Chem 56:8592 (1998).
1471
J Sci Food Agric 88:14721481 (2008)
Basis for the new challenges of growing

broccoli for health in hydroponics
1,2
Diego A Moreno,1 Carmen Lopez-Berenguer,

M. Carmen Martnez-Ballesta,2
Micaela Carvajal2 and Cristina Garca-Viguera1
1 Department
of Food Science and Technology, CEBAS-CSIC, Campus Universitario de Espinardo, PO Box 164, Espinardo 30100-Murcia,
Spain
2 Department of Plant Nutrition, CEBAS-CSIC, Campus Universitario de Espinardo, PO Box 164, Espinardo 30100-Murcia, Spain
Abstract
BACKGROUND: Variations in the contents of phytochemicals with biological activity in broccoli could originate as
a result of genetic and environmental factors. An understanding of the effects of growth conditions on the bioactive
compounds in broccoli is essential for improving its quality and nutritive value. Using salinity (40 mmol L1 NaCl),
and foliar sprayed compounds (methionine, tryptophan and chitosan) as different stress conditions, broccoli
developed in soilless culture in the greenhouse was analysed for biologically active phytochemicals (glucosinolates,
caffeoyl-quinic, ferulic and sinapic derivatives and vitamin C).
RESULTS: The application of elicitors during head formation could be beneficial for the enrichment in
phytochemicals in broccoli. Management practices for increasing a given phytochemical (e.g., glucoraphanin
or glucobrassicin) may be related to a decreased level of natural antioxidants (hydroxycinnamic acids). Growing
broccoli hydroponically in the greenhouse in winter (Mediterranean climate) needs the supporting treatment of
abiotic stress during development (i.e., NaCl, elicitors).
CONCLUSION: The use of hydroponic growth conditions for broccoli and the application of stress factors
(elicitors) at head induction and during development may serve the purpose of enhancing its nutritional quality to
deliver a health-promoting food.
Keywords: Brassica oleracea var. italica; hydroxycinnamic acids; flavonoids; glucosinolates; vitamin C; soilless
culture
INTRODUCTION
Today, consumers are more proactive and conscious
in managing their health and the prevention of dietrelated diseases. Many of these diseases are at epidemic
levels, making the prevention of these lifestyle diseases
attractive markets to exploit for both the food and
pharmaceutical industries.
The consumption of diets containing five to ten
servings of fruits and vegetables daily is the foundation
for cancer prevention, and combinations of tomato
and broccoli in the Dunning R3327-H prostate
adenocarcinoma model was more effective at slowing
tumour growth than either tomato or broccoli alone.
This supports public health recommendations to
increase the intake of a variety of health-giving fruits
and vegetables.1
Broccoli, the worldwide-known immature flower
vegetable of Brassicaceae (Brassica oleracea L. (Italica group)), is also well recognized as a healthpromoting vegetable owing to its high content of
beneficial biologically active compounds. Numerous
epidemiological studies indicate that brassicas in general, and broccoli in particular, have potential for
chemoprevention of degenerative diseases and certain
types of cancer since they are rich sources of glucosinolates and dietary natural antioxidants: vitamins,
flavonoids and hydroxycinnamic acids.2,3
Variations in the contents of phytochemicals with
biological activity in broccoli could originate from
genetic and environmental factors: variability of accessions, cultivars, organ, inflorescence development,
temperature and radiation, growth system, fertilization
practices, post-harvest storage and processing.4 11 In
this respect, water and dissolved salts are essential
to plant growth, but water reuse and high evaporation rates in arid or semi-arid regions such as
southeastern Spain (Murcia) concentrate the salts
and salinization occurs. Broccoli is considered moderately sensitive/tolerant to salinity.12 Looking into
the glucosinolate composition of broccoli leaves and
inflorescences, soilless-grown broccoli treated with
Correspondence to: Diego A Moreno, Department of Food Science and Technology, CEBAS-CSIC, Campus Universitario de Espinardo, PO Box 164,
Espinardo 30100-Murcia, Spain
E-mail: dmoreno@cebas.csic.es
(Received 27 June 2007; revised version received 30 January 2008; accepted 4 February 2008)
Phytonutrients in hydroponically grown broccoli
40 mmol NaCl in outdoor cultivation showed higher

glucosinolate content than untreated plants.13
The lack of reproducibility of phytochemical
analysis or activities is a major obstacle when plants
are regrown in the field, resampled and re-extracted
over the years. The biochemical profiles of plants
harvested at different times and locations vary greatly
and whole plant elicitation may also increases the
amounts of natural products widely used in different
areas of research. However, hydroponic cultivation
is fast, simple and applicable to a great majority of
plant species. Chemical composition and bioactivity
could be readily reproduced if plants are regrown and
re-elicited under standard greenhouse conditions.13 15
It is well known that different stresses, location
climates, microenvironments and physical and chemical stimuli (often called elicitors) qualitatively and
quantitatively alter the content of bioactive secondary
metabolites, and whole-plant elicitation increases the
amounts of bioactive compounds in foods of plant
origin.14 16 Clearly, genotypic variations observed in
different plant species imposed both substantial variation and a genetic limit on the production of bioactive
compounds. However, elicitation may be able to
increase the production of some bioactive compounds
up to the genetic limit.15 To date, there are almost
no reports on the effect of methionine or tryptophan
elicitation or fertilization on glucosinolate-producing
vegetable crops. Scheuner et al.17 showed that methionine foliar fertilization increased the glucosinolate
content in broccoli, but not in radish hypocotyls of
greenhouse-grown plants. Chitosan has been reported
as stimulating the growth and yield of soybean sprouts
without adverse effects on vitamin C or their postharvest characteristics.18 Nonetheless, chitosan did
not improve the production of glucotrapeolin hydrolysis products and the recorded levels were very close
to control values in Farsetia aegyptia cultures.19
Studies on broccoli have been carried out either
in open-air cultivation or in the growth chamber,
but to date little is known about growing broccoli
hydroponically in the greenhouse for the production
of bioactive compounds of interest for human health.
The objective of this investigation was to determine
the effects of different stress factors under soilless
hydroponic growth conditions on the contents of
glucosinolates, phenolic compounds (flavonoids and
hydroxycinnamic acids) and vitamin C in broccoli.
An understanding of the effects of growth conditions
on bioactive compounds in broccoli is essential for
improving its quality and nutritive value.

Conditions of plant growth
The object of our investigations was Marathon
broccoli (Brassica oleracea (Plenck) Italica Group,
cv. Marathon). The plants were cultivated in the
autumnwinter season (October 2006 to February
2007) in the greenhouse of the CEBAS-CSIC located
J Sci Food Agric 88:14721481 (2008)
DOI: 10.1002/jsfa
in Espinardo (Murcia, Spain) under a semi-arid

Mediterranean climate.
Broccoli and design of experiments
Broccoli seeds obtained from Ramiro Arnedo SA
(Murcia, Spain), were pre-hydrated with aerated,
deionized water for 2 h and germinated in vermiculite,
at 28 C in an incubator, for 2 days. They were
then transferred to a controlled-environment growth
chamber with a 16 h light8 h dark cycle, and air
temperatures of 25 and 20 C, respectively. The
relative humidity (RH) was 60% (day) and 80%
(night) and photosynthetically active radiation (PAR)
was 400 mol m2 s1 , provided by a combination
of fluorescent tubes (Philips TLD 36W/83, NY,
USA and Sylvania F36W/GRO Munich, Germany);
metal halide lamps (Osram HGI.T400W, Munich,
Germany). After 5 days, the seedlings were placed in
15 L containers with continuously aerated Hoagland
nutrient solution (published elsewhere), replaced
completely every week.12,13
Broccoli (49-day-old) plants were transplanted
to the greenhouse (day 0 after transplanting; 0
DAT). The experiments were conducted under
a non-controlled environment in an aluminiumframed greenhouse with polycarbonate panels in a
single gable structure. The humidity achieved in the
greenhouse averaged 65%/85% (day/night) and the
air temperature 16/9 C (Table 1). The greenhouse
was vented when the temperature exceeded the norm.
Daily mean temperature and relative humidity were
calculated from measurements taken every 10 min
using dataloggers (AFORA SA, Barloworld Scientific,
Murcia, Spain). A total of 25 Marathon broccoli
plants were placed in a randomized design, using five
plants per treatment, with each plant being grown
in a perlite-filled 15 L container, spaced from each
other, resulting in a density of 4 plants m2 . All
plants were grown under the same conditions and
irrigated with complete Hoagland solution twice a
week under natural light conditions, until 14 DAT
(Table 2). At that moment, the application of 40 mmol
NaCl in the nutrient solution started as treatment T1
(five plants), chosen because the previous studies,
provided by Lopez-Berenguer
et al.,12,13 had shown
that 40 mmol NaCl increased glucosinolate levels in
leaves (metabolic active leaves) and inflorescences
(commercial size heads) of broccoli. The untreated
control (five plants) and remaining plants did not show
any symptom of deficiency or toxicity. Plants being
treated with NaCl were also randomly subdivided into
groups of five and subjected to the different stress
conditions (also called elicitors) once approximately
30% of the plants reached head induction (0.30.5 cm
head arc diameter; 5256 DAT). The plants were
sprayed with 40 mL of elicitor dissolved in 0.04%
ethanol. A full description of the treatments is given in
Table 2.
At harvest (75 DAT) all the plants were collected.
Plants were separated into three parts: leaves
1473
DA Moreno et al.
Table 1. Experimental conditions in the greenhouse (day/night) for growing Marathon broccoli hydroponically
Plant age (DAT)a
( C)b
Air temperature
Relative humidity (%)b
a
b
114
1527
2942
4356
5770
7075
16.3/11.7
45.2/82.6
15.4/9.4
64.5/81.3
13.4/7.5
66.6/82.2
16.7/8.7
66.2/93.2
15.7/9.0
68.1/87.1
15.8/9.1
83.1/90.1
21.6/12.4
62.2/82.1
Days after transplanting (DAT) to greenhouse; 7-week-old plants = 0 DAT.

Average values of the time period.
Table 2. Description of treatments
Key
Control
T1
T1 +E1
T1 +E2
T1 +E3
Treatment
DATa
NaCl treatedb (DAT)
Elicitor treatedc (DAT)
Complete Hoaglands nutrient solution

40 mmol NaCl added to nutrient solution
200 mmol DL-methionine (Alfa Aesar GmbH & Co. KG, Kralsruhe,
Germany)
200 mmol DL-tryptophan (Alfa Aesar GmbH & Co. KG, Kralsruhe,
Germany)
1 g L1 chitosan (from crab shells; Sigma-Aldrich Qumica SA,
Tres Cantos, Madrid)
075
014
014
1575
1575
5256
014
1575
5256
014
1575
5256
Days after transplanting (DAT) to greenhouse; 7-week-old plants = 0 DAT.

40 mmol NaCl added to Hoaglands complete nutrient solution.
c Broccoli plants were sprayed at 11:00 a.m. and at 1520 cm distance, to minimize differences due to daily fluctuations (solution in 0.04% ethanol).
a
(leaf blades and petioles), stalks/stems and heads

(inflorescences). For analytical purposes, the sampled
organs of each treatment were cut into pieces and
mixed thoroughly, to be again separated into five
well-mixed replicates per treatment. Fresh weight was
determined. The plant material was then flash frozen
using liquid nitrogen and kept at 80 C and dried
in a freeze-drier Alpha (Type 14, Christ, Osterode
am Harz, Germany). Dry weight was then determined
and plant material was ground to a fine powder and
stored at 20 C for further analysis.
Extraction and determination of phenolic
compounds
Freeze-dried powder samples (1 g) were homogenized
with 25 mL of 70% methanol three times. The
homogenates were filtered through a cheesecloth
and kept in ice. The homogenates were centrifuged
(4000 g, 5 min, 4 C) and the supernatants were
evaporated under vacuum at 30 C to approximately
1 mL and diluted to 2 mL with water. The supernatants were filtered through a 0.45 m Millex-HV
filter (Millipore, Bedford, MA, USA). The extracted
samples (20 L) were analysed on a Waters highperformance liquid chromatography (HPLC) system
(Waters Cromatografa SA, Barcelona, Spain) consisting of a W600E multi-solvent delivery system,
inline degasser, W717plus autosampler and a W2996
photodiode array detector, using a Luna C18 column (25 0.46 cm, 5 m particle size; Phenomenex,
Macclesfield, UK) with a security guard C18-ODS
(4 3.0 mm) cartridge system (Phenomenex). The
mobile phase was a mixture of 1 mL L1 TFA (A) and
acetonitrile/TFA (99.9:0.1, v:v) (B). Phenolic compounds were eluted off the column in 35 min. The
1474
flow rate was 1 mL min1 in a linear gradient starting

with 0% B 05 min, reaching 17% B in 15 min, 17%
B at 17 min, 25% B at 22 min, 35% B at 30 min and
50% B at 35 min. Chromatograms were recorded at
320 and 360 nm.20,21 Caffeoyl-quinic derivatives were
quantified as chlorogenic acid (5-caffeoyl-quinic acid,
Sigma, St Louis, MO, USA), flavonoids as quercetin
3-rutinoside (Sigma) and sinapic acid and ferulic
derivatives as sinapinic acid (Sigma).
Extraction and determination of vitamin C
Ascorbic (AA) and dehydroascorbic (DHAA) acid
contents were determined as described by Vallejo
et al.10,21 Briefly, 200 mg of freeze-dried sample was
homogenized in a vortex stirrer for 20 s with 10 mL of
extractant solution consisting of MeOHH2 O (5:95)
plus citric acid 2.1%, ethylenediaminetetraacetic acid
(EDTA) 0.05% and NaF 0.01%; the homogenate
was filtered through a cheesecloth and the pH
adjusted to 2.22.4 by addition of 6 mol HCl. The
extract was centrifuged (3.600 g for 15 min at
4 C) and the supernatant was recovered, filtered
through a C18 Sep-Pack cartridge (Waters, Milford,
MA, USA), previously activated with 10 mL of
methanol followed by the same volume of water
and then the same volume of air, and filtered
through a 0.45 m polyethersulfone filter (MillexHV, Millipore). HPLC analysis of vitamin C (AA +
DHAA) was achieved after derivatization of DHAA
into the fluorophore 3-(1,2-dihydroxyethyl)furo(3,4b) quinoxaline-1-one (DFQ) with fresh daily prepared
1,2-ortophenylenediamine (OPDA). OPDA solution
was added to the water-soluble fraction eluted from a
C18 solid-phase extraction cartridge Sep-Pak (1:3,
v:v). Samples were incubated for 37 min at room
J Sci Food Agric 88:14721481 (2008)
DOI: 10.1002/jsfa
temperature in the dark, and 20 L analysed with

a Merck-Hitachi (Tokyo, Japan) HPLC, equipped
with an L-4000 UV detector and an L-6000 pump.
Separations of DFQ and AA were achieved on a
Kromasil 100 C18 column (25 0.4 cm; 5 m particle
size; Tecnokroma, Barcelona, Spain). The mobile
phase was methanolwater (5:95, v:v) containing
5 mmol cetrimide and 50 mmol potassium dihydrogen
phosphate at pH 4.5. The flow rate was 0.9 mL min1 ;
the detector wavelength was initially set at 348 nm, and
after elution of DFQ was manually shifted to 261 nm
for AA detection.
Extraction and determination of glucosinolates
We followed the procedure as fully described in
Martnez-Sanchez et al.22 for extraction of intact
glucosinolates.3 Briefly, freeze-dried samples (50 mg)
were extracted with 1.5 mL of 70% MeOH, and placed
in a sonicator bath for 10 min to improve the methanol
extraction. The mixture was heated at 70 C for 30 min
with a heating bath and shaking every 5 min with a vortex stirrer, and centrifuged (30 min, 17 500 g, 4 C).
Supernatants were collected and methanol completely
removed using a rotary evaporator; the obtained dry
material was redissolved in 1 mL ultrapure water and
filtrated through 0.45 m Millex-HV filter. Each sample (20 L) was analysed in a Waters HPLC system
(Waters Cromatografa SA, Barcelona, Spain) under
the same conditions mentioned above for polyphenolic compounds. Chromatograms were recorded at
227 nm. Samples were identified using the previously
described intact glucosinolate LC-MS method and
quantified by HPLCdiode array detection (HPLCDAD) using sinigrin (sinigrin monohydrate from
Sinapis nigra, Phytoplan Diehm & Neuberger GmbH,
Heidelberg, Germany) as standard.
All data were subjected to analysis of variance
(ANOVA) using Statgraphics version 7.0 software
(Manugistics, Inc.). The data shown are mean values
and the significance of the differences was compared
using a multiple comparison test at LSD P < 0.05
probability level (Duncans multiple range test).

Broccoli parameters at harvest
The harvested inflorescences (commercial size heads)
were significantly heavier in the T1 + E2 treatment,
surpassing the inflorescences of the control plants by
25% in fresh mass (Table 3). The T1 and T1 + E1
were intermediate treatments between T1 + E2 and
the control, only 12% and 8% higher, respectively.
The T1 + T3 inflorescences did not differ from the
untreated control. The fresh weight of the young fully
expanded leaves (metabolically active leaves) showed
a similar result, with T1 + E2 and T1 + E1 being
J Sci Food Agric 88:14721481 (2008)
DOI: 10.1002/jsfa
Table 3. Biomass parameters (g per plant) of greenhouse-grown

Marathon broccoli at harvest
Treatment
Broccoli head
Leaves
Control
T1
T1 +E1
T1 +E2
T1 +E3
165.79ba
188.70ab
183.33ab
211.77a
168.89b
324.37c
352.14bc
427.36ab
483.48a
341.11bc
ANOVA P-value
LSD (P < 0.05)
P < 0.05
26.05
P < 0.05
101.57
Means (n = 5) within a column followed by the same lower-case

letter are not significantly different at P < 0.05 according to Duncans
multiple range test.
49% and 32% higher than the control, respectively

(Table 3).
Taking into account that the collected inflorescences
were all of a very similar size (120135 mm
diameter in average), changes in fresh mass could
be related more to density of the inflorescences.
The application of abiotic stress through 40 mmol
L1 NaCl in the nutrient solution (T1) and the
additional application of methionine (T1 + E1) or
tryptophan (T1 + T2) would then prove positive in
some way for the inflorescence biomass of broccoli
grown hydroponically; this fact would be of interest
in the event that a higher content of phytochemicals
could be found in such inflorescences. On the contrary,
the application of Chitosan (T1 + E3), showed values
similar to the control.
Hydroxycinnamic acid derivatives and flavonoids
Hydroxycinnamoyl derivatives were identified by their
chromatographic behaviour and UV spectra, using
HPLC-MS and chromatographic comparisons with
authentic markers.20,21 The pattern found in broccoli
was similar to that previously described by other
authors.8 A number of individual flavonoids (1015,
depending on the treatment) were detected but not
fully identified, mainly quercetin and kaempferol
glycosides, in agreement with previous reports on
broccoli.20,21
The total flavonoid contents in broccoli inflorescences were significantly affected by the treatments
(Table 4), T1 + E3 being the highest (by 52%) against
the control. The caffeoyl-quinic derivatives were also
higher in T1 + E3 than in the control, with intermediate values for the rest of the treatments. The same
was found for the sinapic and ferulic derivatives, with
the majority of the compounds also being higher in
T1 + T3 and T1 + E1 than in the control. The 1,2diferuloylgentiobiose (3) was similar in the control
and T1 + E1, and higher than the remaining treatments. On average, total phenolic contents reflected
the results of the individual compounds (Fig. 1), and
in T1 + E3 (chitosan-sprayed salt-stressed broccoli)
the total phenolic content was improved by 44%, followed by T1 + E1 (methionine-sprayed NaCl-treated
plants), a 39% higher than the inflorescences in the
1475
1476
control. The results of polyphenolics in broccoli were

probably not related to a dilution effect, even though
T1 + E3 inflorescences were smaller (Table 3). The
correlation coefficients between individual and total
phenolics and the weight of inflorescences were not
significant (P > 0.1; data not shown). Thus, the application of elicitors (methionine and chitosan) during
head formation could be beneficial for the enrichment
in phytochemicals in broccoli grown hydroponically,
and the effect was additional to the salt-induced stress
in these plants, since T1 + E1, T1 + E2, and T1 + T3
were all significantly higher (total phenols; Fig. 1) than
T1 and the untreated control.
When looking at the effects on leaves the metabolic
factory of the plant, but in terms of phytochemical
farming, treated as a byproduct of the broccoli agrifood activity the hydroxycinnamic acids in young
fully expanded leaves (Table 5) were also significantly
affected by treatments. The total content of flavonoids
was much higher than in the inflorescences (Table 4),
but in this case the control, salt-stressed T1 and
elicited T1 + E1 leaves were similar in content while
the leaves of T1 + E2- and T1 + E3-sprayed plants
were surpassed by the control. The trend was very
similar for the caffeoyl-quinic derivatives and sinapic
and ferulic derivatives (Table 5). Figure 2 shows the
total content of phenolics in broccoli leaves, where
T1 + E2 and T1 + T3 were surpassed by the control
by 41% and 25%, respectively.
The flavonoids in greenhouse-grown broccoli are
stated to be present at lower levels than in field
cultures.23 Broccoli produced in late summer and
early autumn field crops in different parts of Europe
presented different flavonol contents, ranging from
1.56.5 mg 100 g1 fresh weight8 to 5.79.6 mg
100 g1 fresh weight (Marathon broccoli).4 Growing
broccoli hydroponically in the greenhouse during the
autumn/winter in southeastern Spain, we found that
total flavonoid contents were higher than previously
60
Inflorescence Total phenols

(mg 100 g-1 of fresh weight)
a C1 (neochlorogenic acid) and C2 (chlorogenic acid); sinapic and ferulic derivatives: 1 (1,2-disnapoylgentiobiose); 2 (1-sinapoyl-2-feruloylgentiobiose); 3 (1,2-diferuloylgentiobiose); 4 (1,2,2 -trisinapoylgentiobiose);
5 (1,2 -disinapoyl-2-feruloylgentiobiose); 6 (1-Sinapoyl-2,2 -diferuloylgentiobiose); 7 (1,2,2 -trisinapoylgentiobiose); 8 (1,2,2 -triferuloylgentiobiose); compound identification according to HPLC-DAD-MS analysis.21
b Means (n = 5) within a column followed by the same lower-case letter are not significantly different at P < 0.05 according to Duncans multiple range test.
P < 0.001
0.09
P < 0.01
0.07
P < 0.001
0.16
P < 0.001
0.20
P < 0.001
0.25
P < 0.001
0.09
P < 0.001
0.21
P < 0.001
0.22
ANOVA P-value
LSD (P < 0.05)
P < 0.001
3.96
P < 0.001
0.29
P < 0.001
0.39
0.05c
0.28ab
0.26ab
0.19b
0.32a
0.29ab
0.23bc
0.33a
0.18c
0.33a
1.41b
1.23c
1.68a
1.07c
1.77a
1.81b
1.84b
2.28a
1.53c
2.30a
0.24c
1.39a
0.79b
0.28c
0.18c
0.64a
0.54b
0.58ab
0.40c
0.54b
2.22c
2.45b
2.62ab
1.86d
2.82a
1.91b
2.61a
2.59a
2.04b
2.62a
Control
T1
T1 +E1
T1 +E2
T1 +E3
33.86b
36.26ab
32.44b
37.89a
1.07c
1.23c
1.74b
1.59b
2.11a
2.80a
2.94a
3.03a
2.18b
3.06a
7
6
5
4
1
C1
24.97cb
Treatment
Total flavonoids
C2
Sinapic and ferulic derivativesa

Caffeoyl-quinic derivativesa
Table 4. Total flavonoids, caffeoyl-quinic derivatives, and individual sinapic and ferulic derivative levels (mg 100 g1 fresh weight) in the inflorescences of greenhouse-grown Marathon broccoli
DA Moreno et al.
40
Control
T1
T1 + E1
T1 + E2
T1 + E3
LSD(P<0.05)= 4.59
ab
b
c
da
20
0
Treatments
Figure 1. Total phenolics (mg 100 g1 of fresh weight) in the
inflorescences of greenhouse-grown Marathon broccoli. a Means
(n = 5; P < 0.001) with the same lower-case letter are not significantly
different at P < 0.05 according to Duncans multiple range test.
J Sci Food Agric 88:14721481 (2008)

DOI: 10.1002/jsfa
J Sci Food Agric 88:14721481 (2008)

DOI: 10.1002/jsfa
100
LSD(P<0.05)= 11.556
Foliar Total phenols (mg100g-1 f.w.)
a C1 (neochlorogenic acid) and C2 (chlorogenic acid); sinapic and ferulic derivatives: 1 (1,2-disnapoylgentiobiose); 2 (1-sinapoyl-2-feruloylgentiobiose); 3 (1,2-diferuloylgentiobiose); 4 (1,2,2 -trisinapoylgentiobiose);
5 (1,2 -disinapoyl-2-feruloylgentiobiose); 6 (1-sinapoyl-2,2 -diferuloylgentiobiose); 7 (1,2,2 -trisinapoylgentiobiose); 8 (1,2,2 -triferuloylgentiobiose); compound identification according to HPLC-DAD-MS analysis.21
b Means (n = 5) within a column followed by the same lower-case letter are not significantly different at P < 0.05 according to Duncans multiple range test.
0.05b
0.07ab
0.09a
0.06b
0.05b
P < 0.05
0.03
0.27a
0.34a
0.38a
0.27a
0.23a
P > 0.05
0.19
1.32bc
1.64a
1.54ab
1.27c
1.15c
P < 0.01
0.24
1.35b
2.03a
2.00a
1.58b
1.51b
P < 0.001
0.28
0.35bc
0.43ab
0.44a
0.25d
0.32cd
P < 0.001
0.08
0.05ab
0.04b
0.06a
0.05ab
0.04b
P < 0.001
0.01
5.06ab
5.26a
5.65a
3.66c
4.35bc
P < 0.01
0.90
5.16ab
6.05a
5.22ab
4.25c
4.48bc
P < 0.01
0.91
Control
T1
T1 +E1
T1 +E2
T1 +E3
ANOVA P-value
LSD (P < 0.05)
51.15ab
55.14a
49.65a
34.32b
40.35b
P < 0.001
8.30
5.03a
4.39a
4.65a
3.62b
3.53b
P < 0.001
0.67
4.25a
4.38a
3.99a
2.96b
3.25b
P < 0.01
0.73
7
6
5
4
1
C1
Treatment
Total flavonoids
C2
Sinapic and ferulic derivativesa

Caffeoyl-quinic derivativesa
Table 5. Total flavonoids, caffeoyl-quinic derivatives, and individual sinapic and ferulic derivative levels (mg 100 g1 fresh weight) in young fully expanded leaves of greenhouse-grown Marathon broccoli
80
a
aa
Control
T1
T1 + E1
T1 + E2
T1 + E3
60
40
20
Treatments
Figure 2. Total phenolics (mg 100 g1 of fresh weight) in young fully

expanded leaves of greenhouse-grown Marathon broccoli. a Means
(n = 5; P < 0.001) with the same lower-case letter are not significantly
reported. The agronomic conditions (growing in the

greenhouse during winter) should be taken into
consideration if we are intending to obtain broccoli
for raw material/ingredients for the development of
functional foods or phytochemically rich vegetables,
growing the plants under the controlled greenhouse
environment and with the putative use of stress factors
(elicitors), increasing the content of phytochemicals in
broccoli.
The results of the phenolic contents in the leaves
could be not be explained by a possible dilution
of the phytochemicals with development, because of
the absence of correlation between these parameters
(P > 0.05; data not shown). Instead, we could find
at least part of the explanation in the physiological
function of the leaves in a stressed plant, and
the sourcesink relationships for the biosynthesis
and translocation of different phytochemicals to the
inflorescences, to maximize the resource-use efficiency
of the plant.24
Vitamin C
The AA and the dehydroascorbic acid DHAA in the
broccoli inflorescences were affected by the treatments, but not the total content of vitamin C
(Fig. 3). Our Marathon inflorescences were less rich
in vitamin C than the field-produced inflorescences
(74107 mg 100 g1 fresh weight),20,21 although the
content could be considered as normal (2580 mg
100 g1 fresh weight).25 The remarkable data of the
T1 + E3 (chitosan) inducing the significant highest
and lowest AA and DHAA levels, respectively, confirmed the effects of this elicitor with no negative effect
on ascorbate,18 but the general trend is the absence of
effects on the total content of vitamin C, which is also a
positive outcome. The effects on young fully expanded
leaves were quite different (Fig. 4), because the higher
content of vitamin C in leaves than in the inflorescences was owed to the high to high levels of DHAA,
1477
and in this case the T1 + E3 treatment induced the

lowest content of vitamin C in leaves. The highest
vitamin C content was found in the control plants, not
different from T1 + E1 or T1 + E2. A possible explanation of these results may be related to the source/sink
trends between leaves and inflorescences in broccoli
(weak positive correlation coefficients of r 2 < 0.4; data
not shown). From these results, it looks as though the
changes in vitamin C and its components (AA and
DHAA) could be more related to the environmental growth conditions (Table 1) than to the imposed
stress factor treatments (Table 2, Fig. 4). Ascorbic
acid declined under full sunlight conditions in mustard greens, and supplementing natural light with blue
or sodium vapour light increased ascorbic acid concentrations in broccoli. Rainy, cloudy, cool conditions also
decrease ascorbic acid.26 In such conditions, similar
to our experimental setup, the relationships between
size and phytonutrient concentrations may or may not
always be linear, and may not always be negative for
ascorbic acid.
Glucosinolates
The broccoli inflorescences (Table 6) contained
the aliphatic glucosinolates glucoiberin (GI), glucoraphanin (GR) and glucoerucin (GE), as well
as the indole glucosinolates 4-hydroxy-glucobrassicin
(HGB), glucobrassicin (GB), 4-methoxyglucobrassicin (MGB) and neoglucobrassicin (NGB). The
main glucosinolates were glucoraphanin and glucobrassicin, but other glucosinolates found in very small
amounts (glucoalyssin, gluconapin, etc.) were taking
into account only for the total content of glucosinolates
(Table 6). Both aliphatic and indole glucosinolates
were affected by the treatments, and T1 + E1 induced
significantly higher amounts of the aliphatic glucosinolates GI (by 47%) and GR (by 21%) than the control.
T1 + E2 also surpassed the control by 24% for GE.
The indole glucosinolates were similar between the
control, T1 (40 mmol NaCl) and T1 + E1, with significantly higher amounts of HGB, GB, MGB and
NGB than T1 + E2, and with T1 + E3, the treatment
with the lowest content in total glucosinolates.
Inflorescence Vitamin C (mg 100 g-1 of fresh weight)
DA Moreno et al.
80
Control
T1
T1 + E1
T1 + E2
T1 + E3
60
LSD(P<0.05)= 13.47
40
LSD(P<0.05)= 5.11
a
ab
bcz
bc
c
20
LSD(P<0.05)= 7.12
a a a
a
0
AA
DHAA
Total Vitamin C
Figure 3. Ascorbic acid (AA), dehydroascorbic acid (DHAA), and total

vitamin C (mg100 g1 of fresh weight), in the inflorescences of
greenhouse-grown Marathon broccoli. a Means (n = 5; AA P < 0.01;
DHA P < 0.05) with the same lower-case letter are not significantly
GR concentration in the broccoli inflorescences was

significantly increased compared to the control when
methionine (T1 + E1) was applied at the time of head
formation. In previous reports of greenhouse-grown
broccoli under controlled conditions and fertilized
with methionine, the same kind of response was
found.17 In any case, differences in total contents were
not relevant if compared to the untreated control.
The metabolically active leaves showed that GR
was highest in the T1 + E1 treatment (Table 7),
surpassing the control by 78%, whereas GI and GE
were significantly the lowest in T1 + E3. The indole
glucosinolates showed a similar variation between
treatments, with HGB, GB, MGB and NGB being
higher in control, T1, T1 + E1 and T1 + E2, and
lowest in T1 + E3, as repeated in the total content of
glucosinolates, and similar to what was found for the
inflorescences (Table 5).
Table 6. Aliphatic, indole and total glucosinolates (mg 100 g1 fresh weight) in the inflorescences (broccoli heads) of greenhouse-grown Marathon
broccoli
Aliphatic glucosinolatesa
Treatment
Control
T1
T1 +E1
T1 +E2
T1 +E3
ANOVA P-value
LSD (P < 0.05)
GI
GR
GE
14.62bb
14.61b
21.55a
15.63b
13.88b
38.12bc
42.73ab
46.12a
33.01c
33.62c
15.72b
15.50b
16.37b
19.56a
10.56c
P < 0.01
4.26
P < 0.01
6.33
P < 0.001
2.95
Indole glucosinolatesa
HGB
22.10abc
25.55ab
25.37a
20.44bc
17.86c
P < 0.05
5.12
GB
MGB
NGB
Total glucosinolates
68.36a
59.07b
52.49c
43.40d
49.68c
17.10a
16.68a
14.17b
12.61b
9.928c
58.47a
38.82b
36.52b
25.36c
23.03c
260.94a
235.39a
234.58a
201.82b
178.45b
P < 0.001
6.08
P < 0.001
2.35
P < 0.001
6.23
P < 0.001
29.46
GI: 3-methylslfinylpropyl-glucosinolate; GR: 4-methylsulfinylbutyl-glucosinolate; GE: 4-methylthiobutyl-glucosinolate; HGB: 4-hydroxyindol-3ylmethyl-gls; GB: 3-indolylmethyl-gls; MGB: 4-methoxy-3-indolylmethyl-gls; NGB: N-methoxy-3-indolylmethyl-gls.
b
Means (n = 5) within a column followed by the same lower-case letter are not significantly different at P < 0.05 according to Duncans multiple
range test.
1478
J Sci Food Agric 88:14721481 (2008)

DOI: 10.1002/jsfa

Table 7. Aliphatic, indole and total glucosinolates (mg 100 g1 fresh weight) in the young fully expanded leaves of greenhouse-grown Marathon
broccoli
Aliphatic glucosinolatesa
Treatment
GI
GR
GE
HGB
GB
MGB
NGB
Total glucosinolates
24.56ab
17.81b
15.80b
26.54a
10.09c
17.93b
16.64b
31.98a
15.42b
10.32c
18.01a
18.73a
16.17a
15.39ab
12.54b
18.21a
10.27bc
12.27b
12.44b
7.67c
26.90bc
35.26bc
48.78a
36.09b
26.24c
27.91a
26.79a
25.61a
22.86ab
18.72b
15.97cd
21.91ab
18.97bc
23.24a
14.68d
208.95a
221.89a
207.83a
206.66a
140.77b
P < 0.001
5.78
P < 0.001
5.10
P < 0.05
3.51
P < 0.001
2.818
P < 0.001
9.62
P < 0.05
5.41
P < 0.01
4.17
P < 0.001
21.69
Control
T1
T1 +E1
T1 +E2
T1 +E3
ANOVA P-value
LSD (P < 0.05)
Indole glucosinolatesa
GI: 3-methylslfinylpropyl-glucosinolate; GR: 4-methylsulfinylbutyl-glucosinolate; GE: 4-methylthiobutyl-glucosinolate; HGB: 4-hydroxyindol-3ylmethyl-gls; GB: 3-indolylmethyl-gls; MGB: 4-methoxy-3-indolylmethyl-gls; NGB: N-methoxy-3-indolylmethyl-gls.
b Means (n = 5) within a column followed by the same lower-case letter are not significantly different at P < 0.05 according to Duncans multiple
range test.
Foliar Vitamin C (mg 100g-1 f.w.)
80
Control
T1
T1 + E1
T1 + E2
T1 + E3
60
LSD(P<0.05)= 6.57
a
a
LSD(P<0.05)= 6.04
b
a
LSD(P<0.05)= 2.20
40
ab
c
bz
20
c
d
c
c
0
AA
DHAA
Total Vitamin C
Figure 4. Ascorbic acid (AA), dehydroascorbic acid (DHAA), and total

vitamin C (mg 100 g1 of fresh weight), in young fully expanded
leaves of greenhouse-grown Marathon broccoli. a Means (n = 5;
P < 0.001) with the same lower-case letter are not significantly
Numerous studies on single vegetables and phytochemicals have demonstrated that pre-harvest variables are factors that have the potential to influence the
phytochemical content in the final produce.5,11,27,28
In using immature broccoli flower crops for the production of glucosinolate-enriched raw plant material,
for functional foods or supplements, cultivation of
its cultivars (e.g. Marathon, Shogun) in seasons
with relatively low daily mean temperatures (about
14 C; springtime in Germany) has been recommended, combined with rising daily mean irradiation
up to 450 mol m2 s1 of the photosynthetic photon flux density.28 Broccoli could be produced in
Murcia (Spain) in the fall/winter and early spring
seasons,8,11,20 at temperatures within that range
(Table 1). The effects of treatments on individual and
total glucosinolates of the inflorescences and leaves in
this experiment (greenhouse soilless culture) could be
due to the changing sourcesink relationship of photoassimilates, and glucosinolate exchange between the
J Sci Food Agric 88:14721481 (2008)
DOI: 10.1002/jsfa
individual plant organs is also possible, since the reason

for the different responses amongst the glucosinolate
groups could be because the various enzymes involved
in the synthesis of each glucosinolate are affected differently depending upon treatment and environmental
conditions,7 helping to clarify why the control, T1,
T1 + E1 and T1 + E2 presented similar glucosinolate
contents (individual and total glucosinolates in the
inflorescences and leaves).
In most markets broccoli is sold on a per head basis,
not by weight. Total and individual glucosinolates
per head may be an essential criterion in considering
enhancement of phytochemicals (i.e., glucosinolates)
in certain broccoli genotypes.27 In our work, there
is no significant correlation between individual or
total glucosinolate content and head weight, and
there has been no indication of a dilution effect,
only a weak correlation between GE and head weight
(r 2 = 0.439, P < 0.05) or between leaf weight and
total glucosinolates (r 2 = 0.415, P < 0.05).
Management practices such as nutrient supply have
been investigated for their specific influences on the
contents of glucosinolates and aroma volatiles by using
broccoli and radish as examples.8,11,29 An increased
level of mineral nutrients (i.e., nitrogen, mineral and
organic fertilization) in a field experiment with broccoli
decreased the content of aliphatic glucosinolates.
Using Hoaglands solution for broccoli may have
supplied enough nutrients to maintain a high level
of glucosinolates in control and treated plants (T1,
T1 + E1, T1 + E2), but not in T1 + E3, where the
influence of chitosan could account for the effect on
glucosinolates and phenolics more importantly than
the plant nutrient status.
Significant effects of the treatments on phytochemical content in broccoli indicate that the management
practices for increasing one given phytochemical (i.e.,
glucoraphanin and glucobrassicin for chemoprevention) may be related to a decreased level of natural antioxidants (i.e., hydroxycinnamic acids). The
response in the inflorescences for total glucosinolates
(lowest in T1 + E3) and total phenolics (highest in
T1 + E3) was somehow corroborated or supported by
1479
DA Moreno et al.
the correlation between total glucosinolates and the

total flavonoids (r 2 = 0.518; P < 0.01) and phenolics (r 2 = 0.418; P < 0.05) as a negative relationship.
For the leaves, phenolics and glucosinolates were not
significantly related (r 2 < 0.1). Obtaining broccoli that
delivers high amounts of bioactive phytochemicals and
chemoprotective potency as a feasible goal therefore
needs the consideration of all the factors (i.e., environmental conditions, abiotic stress treatments, elicitors)
responsible for the wide variation in phytochemical
contents at harvest.27,28
CONCLUSIONS
To satisfy the increasing health consciousness of
consumers worldwide, the demand for broccoli
enriched with phytochemicals available as fresh
produce or raw material for functional foods and
supplements would need the integration of total
quality management strategy with respect to the
genetic and environmental effects on the formation
of bioactive compounds, selecting the correct time
of planting and harvesting as well as the use of
abiotic stress (NaCl), during the vegetative period
and additional factors during head induction and
development (i.e., sprayed elicitors), for the induction
of phytochemical biosynthesis, to manipulate the
response of plants to different environmental factors,
and to enhance the amount of dietary antioxidants
and phytonutrients (i.e., human wellness compounds)
which along with consumption of five or more servings
per day of fruits and vegetables will make for a healthier
population. From our experience at this point,
growing broccoli hydroponically in the greenhouse
as a winter crop in Spain (Mediterranean climate)
needs the supporting treatment of abiotic stress during
development (i.e., NaCl). Additionally, the use of
stress factors at head induction and development (i.e.,
elicitors) may serve the purpose of enhancing the
nutritional quality to deliver a health-promoting food.
ACKNOWLEDGEMENTS
The authors wish to thank the CICYT National Programme for financial support of this work (AGL20066499/AGR). Part of this work was also funded by
CSIC (Proyecto Intramural 200470E038). Carmen
Lopez-Berenguer thanks the Regional Government of
Murcia for funding through Science and Technology
Seneca. Diego A
for PhD grants of the Fundacion
Moreno thanks the European Social Fund (ESF) and
y Ciencia and
the Spanish Ministerio de Educacion
CSIC for funding through the Ramon y Cajal S&T
Martnez-Sanchez
Programme. We thank Ascension
and Santiago Perez-Balibrea for their valuable help
and technical assistance.
10
11
12
13
14
15
16
17
18
REFERENCES
1 Canene-Adams K, Lindshield BL, Wang S, Jeffery EH, Clinton SK and Erdman JW Jr, Combinations of tomato and
1480
19
broccoli enhance antitumor activity in Dunning R3327-H

prostate adenocarcinomas. Cancer Res 67:836843 (2007).
Higdon JV, Delage B, Williams DW and Dashwood RH, Cruciferous vegetables and human cancer risk: epidemiological
evidence and mechanistics basis. Pharmacol Res 55:224236
(2007).
Moreno DA, Carvajal M, Lopez-Berenguer

C and GarcaViguera C, Chemical and biological characterisation of
nutraceutical compounds of broccoli. J Pharmaceut Biomed
Anal 41:15081522 (2006).
GliszczynskaSwiglo
A, Kaluzewicz A, Lemanska
K,
Knaflewski M and Tyrakowska B, The effect of solar radiation on the flavonol content in broccoli inflorescence. Food
Chem 100:241245 (2007).
Jeffery EH, Brown AF, Kurilich AC, Keck AS, Matusheski N,
Klein BP et al, Variation in content of bioactive compounds
in broccoli. J Food Comp Anal 16:323330 (2003).
Sanwal SK, Laxminarayana K, Yadav DS, Rai N and Yadav
RK, Growth, yield, and dietary antioxidants of broccoli as
affected by fertilizer type. J Veg Sci 12:1326 (2006).
Schonhof I, Klaring H-P, Krumbein A, Clauen W and
Schreiner M, Effect of temperature increase under low radiation conditions on phytochemicals and ascorbic acid in
greenhouse grown broccoli. Agric Ecosys Environ 119:103111
(2007).
Vallejo F, Tomas-Barberan FA and Garca-Viguera C, Potential bioactive compounds in health promotion from broccoli
cultivars grown in Spain. J Sci Food Agric 82:12931297
(2002).
Vallejo F, Tomas-Barberan FA and Garca-Viguera C, Glucosinolates and vitamin C content in edible parts of broccoli florets
alter domestic cooking. Eur Food Res Technol 215:310316
(2002).
Vallejo F, Tomas-Barberan FA and Garca-Viguera C, Healthpromoting compounds in broccoli as influenced by refrigerated transport and retail sale period. J Agric Food Chem
51:30293034 (2003).
Vallejo F, Tomas-Barberan FA, Benavente-Garca AG and
Garca-Viguera C, Total and individual glucosinolate contents in inflorescences of eight broccoli cultivars grown under
various climatic and fertilisation conditions. J Sci Food Agric
83:307313 (2003).
Lopez-Berenguer
C, Garca-Viguera C and Carvajal M, Are
root hydraulic conductivity responses to salinity controlled by
aquaporins in broccoli plants? Plant Soil 279:1323 (2006).
Lopez-Berenguer
C, Moreno DA, Carvajal M and GarcaViguera C, Effect of salt stress on glucosinolate content in
broccoli plants, in First International Conference on Glucosinolates: Glucosinolate Biology, Chemistry and Biochemistry and
its Application to Human Health and Agriculture, Max Planck
Institute for Chemical Ecology and the Phytochemical Society
of Europe, Jena, Germany (2006).
Demmig-Adams B and Adams WW III, Antioxidants in
photosynthesis and human nutrition. Science 298:21492153
(2002).
Poulev A, ONeal JM, Logendra S, Pouleva RB, Timeva V,
Garvey AS et al, Elicitation, a new window into plant
chemodiversity and phytochemical drug discovery. J Med
Chem 46:25422547 (2003).
Van Dam NM, Witjes L and Svatos A, Interactions between
aboveground and belowground induction of glucosinolates in
two wild Brassica species. New Phytol 161:801810 (2004).
Scheuner ET, Schmidt S, Krumbein A, Schonhof I and
Schreiner M, Effect of methionine foliar fertilization on
glucosinolate concentration in broccoli and radish. J Plant
Nutr Soil Sci 168:275277 (2005).
Lee Y-S, Kim Y-H and Kim S-B, Changes in the respiration,
growth, and vitamin C content of soybean sprouts in the
response to chitosan of different molecular weights. HortSci
40:13331335 (2005).
Vallejo F, Garca-Viguera C and Tomas-Barberan FA, Changes
in broccoli (Brassica oleracea L. var italica) health-promoting
J Sci Food Agric 88:14721481 (2008)

DOI: 10.1002/jsfa
20
21
22
23
24
compounds with inflorescence development. J Agric Food

Chem 51:37763782 (2003).
Al-Gendy AA and Lockwood GB, Production of glucosinolate
hydrolysis products in Farsetia aegyptia suspension cultures
following elicitation. Fitoterapia 76:288295 (2005).
Vallejo F, Tomas-Barberan FA and Garca-Viguera C, Effect
of climatic and sulphur fertilisation conditions, on phenolic
compounds and vitamin C, in the inflorescences of eight
broccoli cultivars. Eur Food Res Technol 216:395401 (2003).
Martnez-Sanchez A, Allende A, Bennet RN, Ferreres F and
Gil MI, Microbial, nutritional and sensory quality of rocket
leaves as affected by different sanitizers. Postharvest Biol
Technol 42:8697 (2006).
Wildanger W and Hermann K, Flavonole und Flavone der
Gemusearten.
I. Flavonole der Kohlarten. Eur Food Res
Technol 152:134137 (1973).
Hikosaka K, Leaf canopy as a dynamic system: ecophysiology
and optimality in leaf turnover. Ann Bot 95:521533 (2005).
J Sci Food Agric 88:14721481 (2008)

DOI: 10.1002/jsfa
25 Singh J, Rai M, Upadhyay AK, Bahadur A, Chauraisa SNS and

Singh KP, Antioxidant phytochemicals in broccoli (Brassica
oleracea L. var. italica Plenck) cultivars. J Food Sci Technol
43:391393 (2006).
26 Lester GE, Environmental regulation of human health nutrients
(ascorbic acid, -carotene, and folic acid) in fruits and
vegetables. HortSci 41:5963 (2006).
27 Farnham MW, Wilson PE, Stephenson KK and Fahey JW,
Genetic and environmental effects on glucosinolate content
and chemoprotective potency of broccoli. Plant Breeding
123:6065 (2004).
28 Schreiner M, Vegetable crop management strategies to increase
the quantity of phytochemicals. Eur J Nutr 44:. 8594 (2005).
29 Krumbein A, Schonhof I, Ruhlmann

J and Widell S, Influence
of sulphur and nitrogen supply on flavour and health-affecting
compounds in Brassicaceae, in Plant Nutrition: Developments
in Plant and Soil Sciences, Vol. 92, ed. by Horst WJ et al.
Kluwer, Dordrecht, pp. 294295 (2002).
1481
J Sci Food Agric 88:14821485 (2008)
Short Communication
Anti-sickling potential of Aloe vera extract
Agunna Everest Ejele and Pascal Chukwuemeka Njoku
Department of Chemistry, Federal University of Technology, PMB 1526, Owerri, Nigeria
Abstract: The effect of Aloe vera extract on the gelling time of human HbSS erythrocytes was investigated. The
results showed that A. vera extract increased the gelling time of HbSS blood and inhibited sickling in vitro. In
addition, a linear relationship was found between extract concentration and gelling time, suggesting that A. vera
extract may have great potential in the management of sickle cell disease.
Keywords: Aloe vera; sickle cell disease; red blood cells; gelling time
INTRODUCTION
Several attempts have been made to reduce or totally
inhibit the occurrence of painful crisis in sickle
cell disease using various drugs.1,2 However, it has
been difficult to obtain an effective and safe antisickling drug for use in sickle cell therapy, because
many drugs employed in the treatment of sickle cell
disease are effective only at high concentrations.2 This
has led to various attempts to introduce indigenous
herbs in the therapy of sickle cell disorders. In this
regard, Sofowora and Isaacs3 found that an extract
from the root of Fagara zanthoxyloides had antisickling properties and reduced the frequency of
painful crisis. Since then, several papers on the use
of medicinal plants as remedies for painful crisis in
sickle cell therapy have been published.4 6 Ekeke
and Shode4 reported that a boiled extract from the
edible bean Cajanus cajan (Fiofio in Igbo) of the
family Papilionaceae brought enormous relief to a
sickle cell patient. The extract not only inhibited
sickling in vitro in sodium metabisulfite (Na2 S2 O5 )
solution but also reverted pre-sickled erythrocytes to
their normal morphology. Another medicinal plant
that has proved effective in the management of
sickle cell disease is an extract of the leaves of
Terminalea catappa L. (Indian almond) of the family
Combretaceae.5 The extract was found to inhibit
osmotically induced haemolysis of human erythrocytes
in a dose-dependent manner. Mgbemene and Ohiri5
reported that a 1.0 mg mL1 solution of the extract
was effective in preventing and reversing the sickling of
human HbS erythrocytes induced by 2% (w/v) Sodium
metabisulphite (Na2 S2 O5 ) solution. Recently, Njoku
and Ejele6 reported the prophylactic effect of a liquid
extract of Telferia occidentalis (Ugu in Igbo) in the
prevention of painful sickle cell crisis and showed
a 95% reduction in the frequency of occurrence of
sickle cell disease and a 100% reduction in painful
crisis among five homozygous volunteers aged 510

who were studied for a period of 8 months.
In this paper we report on the anti-sickling potential
of Aloe vera extract, popularly referred to as a
pharmacy in a plant.

Aloe vera extract
Whole fresh leaves of A. vera obtained from the
open market in Owerri (Imo State, Nigeria) were
used in this study. About 25 g of sun-dried leaves
were extracted with 250 mL of ethanol for 12 h in a
Soxhlet extractor equipped with a reflux condenser.
The ethanolic extract was concentrated to 100 mL
by distillation, cooled and filtered and the filtrate
was used without further purification. Preliminary
phytochemical tests carried out on the filtrate showed
that alkaloids, tannins, saponins and glycosides were
present. However, we did not isolate or separate any
of the active principles.
Cajanus cajan extract
Fresh seeds of the local edible bean C. cajan obtained
from the open market in Owerri were used in this
study. About 35 g of sun-dried edible beans were
extracted with 250 mL of ethanol for 12 h in a
Soxhlet extractor equipped with a reflux condenser.
The ethanolic extract was concentrated to 100 mL by
distillation, cooled and filtered and the filtrate was
used without further purification.
Sickling test
This test is based on the morphological change in HbS
blood containing red blood cells when deoxygenated.
When the cells of sickle cell blood are exposed to
reduced oxygen tension through the use of a reducing
Correspondence to: Agunna Everest Ejele, Department of Chemistry, Federal University of Technology, PMB 1526, Owerri, Nigeria
E-mail: monyeejele@yahoo.com
(Received 25 April 2006; revised version received 29 May 2007; accepted 6 June 2007)
agent such as Na2 S2 O5 solution,4 the erythrocytes

assume a characteristic sickle shape.
Venous blood was used in this study. Blood samples
were obtained from healthy donors as well as sickle cell
patients at the Federal Medical Centre, Owerri. Whole
blood containing ethylene diamine tetraacetic acid
(EDTA) as anticoagulant was centrifuged for about
5 min, the upper supernatant layer was discarded and
the packed red blood cells were used for the gelling
experiments.
A 1 mL aliquot of HbAA red blood cells (RBCs) was
mixed with two drops of freshly prepared 2% (w/v)
NaS2 O5 solution with the aid of an applicator stick on
a microscope slide labelled A, covered with a coverslip
and sealed with molten paraffin wax to exclude air and
prevent drying. The slide was then incubated at 37 C
for 10 min and observed for sickling and RBC count.
This was used as control 1.
A 1 mL aliquot of HbSS RBCs was mixed with two
drops of freshly prepared 2% (w/v) NaS2 O5 solution
with the aid of an applicator stick on a microscope slide
labelled B, covered with a coverslip and sealed with
molten paraffin wax to exclude air and prevent drying.
The slide was then incubated at 37 C for 10 min and
observed for sickling and RBC count. This was used
as control 2.
The same procedure was followed for microscope
slides labelled C1 C5 , but here a 1 mL aliquot of
HbSS RBCs was mixed with two drops of freshly
prepared 2% (w/v) NaS2 O5 solution and different

amounts of A. vera extract (see Table 1).
Thereafter the slides were viewed under a microscope and RBCs were counted with a haemocytometer
to determine the number of unsickled RBCs mL1
blood. The number of unsickled RBCs was used as an
index of sickling.
The above experiments were repeated using C. cajan
extract (see Table 2).
Gelation of sickle cell blood
In these experiments the effect of A. vera extract
on sickle cell blood was determined and the time of
gelation of erythrocytes in vitro was obtained.
Ten test tubes labelled AJ were used and arranged
in order. In test tube A a 0.5 mL aliquot of RBCs
was mixed with two drops of 2% (w/v) Na2 S2 O5
solution. The mixture was stirred gently and the time
at which gelling occurred was noted. This was taken
as the blank. The same procedure was used for test
tubes BJ, to which different concentrations of A.
vera extract were added. The time taken for the blood
samples in test tubes BJ to gel was determined (see
Table 3).

Table 1 shows the results of the sickling test carried
out on HbSS erythrocytes to which different volumes
(number of drops) of the ethanolic extract of A. vera
Table 1. Anti-sickling characteristics of Aloe vera extract
Red blood cell count

(106 L1 )
Sickling test
Sample
Volume of extract (drops)
HbAA
HbSS
HbAA
HbSS
Slide A
Slide B
Slide C1
Slide C2
Slide C3
Slide C4
Slide C5
2
4
6
8
10
5.0
4.8
4.9
5.0
5.2
5.4
2.0
1.65
1.86
2.35
2.45
2.50
Negative
Negative
Negative
Negative
Negative
Negative
Positive
Positive
Positive
Positive
Positive
Positive
Commenta
#
+++
++
++
+
+
+
Key: +++ , marked degree of sickling; ++ , moderate degree of sickling; + , low degree of sickling; # , no sickling observed.
Table 2. Anti-sickling characteristics of Cajanus cajan extract
Red blood cell count

(106 L1 )
Sickling test
Sample
Volume of extract (drops)
HbAA
HbSS
HbAA
HbSS
Slide A
Slide B
Slide C1
Slide C2
Slide C3
Slide C4
Slide C5
2
4
6
8
10
5.0
4.2
4.4
4.7
4.9
5.0
2.0
1.35
1.46
1.54
1.85
2.00
Negative
Negative
Negative
Negative
Negative
Negative
Positive
Positive
Positive
Positive
Positive
Positive
Commenta
#
+++
++
++
+
+
+
Key: +++ , marked degree of sickling; ++ , moderate degree of sickling; + , low degree of sickling; # , no sickling observed.
J Sci Food Agric 88:14821485 (2008)

DOI: 10.1002/jsfa
1483
AE Ejele, PC Njoku
Table 3. Changes in gelling time due to addition of Aloe vera extract
Sample
A. 0.5 mL of blood + 2
drops of 2%NaS2 O5
B. 0.5 mL of blood + 2
drops of 2%NaS2 O5
C. 0.5 mL of blood + 2
drops of 2%NaS2 O5
D. 0.5 mL of blood + 2
drops of 2%NaS2 O5
E. 0.5 mL of blood + 2
drops of 2%NaS2 O5
F. 0.5 mL of blood + 2
drops of 2%NaS2 O5
G. 0.5 mL of blood + 2
drops of 2%NaS2 O5
H. 0.5 mL of blood + 2
drops of 2%NaS2 O5
I. 0.5 mL of blood + 2
drops of 2%NaS2 O5
J. 0.5 mL of blood + 2
drops of 2%NaS2 O5
Aloe vera extract

added (v/v)
Gelling time
(min)
1 drop of 1% solution
15
20
25
27
31
35
37
40
50
had been added. It can be seen that at all levels the

extract inhibited the sickling of erythrocytes induced
by two drops of 2% (w/v) Na2 S2 O5 , although to
varying degrees. For example, slides C1 and C2 , which
contained two and four drops of A. vera extract
respectively, showed a marked degree of sickling,
whereas slides C3 C5 , which contained sixten
drops of the extract, showed a much lower degree
of sickling. It was also observed that the number
of RBCs counted via the haemocytometer increased
markedly with increasing volume of A. vera extract
from C1 to C5 . Similar results were obtained for the
ethanolic extract of C. cajan (Table 2). Although the
mechanism involved is not yet known, this observed
increase in the number of unsickled RBCs may be
explained in terms of a reversion of sickled erythrocytes
as the concentration of the extract increased.4 A
similar observation was made earlier by Ekeke and
Shode,7 who studied the effect of phenylalanine on
pre-sickled HbSS erythrocytes suspended in 0.15 mol
L1 phosphate buffer at pH 6.5.
Table 3 shows the results of the gelation rate test on
HbSS blood in the presence of different concentrations
of A. vera extract and gives the time taken for the
HbSS blood sample to clot under these conditions. It
can be seen that, as the concentration of the extract
was increased from 1 to 100% (v/v), the gelling time
increased from 15 to 50 min. In other words, there is
a linear relationship between the gelling time and the
concentration (% v/v) of A. vera extract. The ability of
an agent or compound to increase the gelling time of
human HbSS blood can be taken as a measure of its
anti-sickling potential and determines its capability of
retarding the aggregation of erythrocyte cells in blood
vessels and increasing the number of unsickled RBCs.
Such reduction in aggregation rate is related to gelation
1484
inhibition. Na2 S2 O5 is a strong gelation-promoting

agent, so any compound that inhibits the gelation of
HbSS erythrocytes in the presence of Na2 S2 O5 will be
a powerful gelation inhibitor.4,7
The gelling of human HbSS blood cells results from
weak non-covalent tetramertetramer interactions,
which hold the deoxygenated HbSS molecules
together.1,2 These interactions may be classified into
electrostatic forces, hydrogen bonds, van der Waals
forces and hydrophobic effects and may be disrupted
by the addition of a variety of reagents, including salts,
urea and sucrose.8 Such reagents help to solubilise
and stabilise proteins by making proteinsolvent
interactions more favourable than proteinprotein
contacts.2 The degree of sickling inhibition observed
in the present study appeared to be a linear function
of the concentration of A. vera extract, because an
increase in the extract concentration (% v/v) increased
the gelling time of the HbSS blood sample. Therefore
this study indicates that A. vera extract may contain
some active chemical agents that are possible gelation
inhibitors.
Various researchers have studied the anti-sickling
potential of several indigenous medicinal plants.3 6
Ekeke and Shode4 demonstrated that a boiled or
methanolic extract of the local edible bean C. cajan
brought enormous relief to a known sickle cell patient.
They showed that the extract inhibited sickling in vitro
in the presence of Na2 S2 O5 solution, a strong reducing
agent, which on its own is capable of inducing sickling
in human HbSS blood.4 In a more recent study,
Ekeke et al.7 carried out an amino acid analysis on
the water-soluble fraction of a methanolic extract
of C. cajan and showed that this fraction contained
several free amino acids, which they thought were
responsible for most of the anti-sickling properties of
the extract. In addition, the authors7 demonstrated
that the methanolic (water-soluble) extract contained
as much as 26.3% of phenylalanine and concluded that
the presence of phenylalanine alone could account
for about 70% of the anti-sickling potency of C.
cajan extract. Earlier studies have shown that several
compounds, including amino acids such as Phe,9 LAsn, L-Gln and Ser,10 sugars such as glucose as well as
salts such as potassium cyanate and sodium chloride,8
also possess anti-sickling properties to various degrees.
We have not evaluated the amino acid composition of
Table 4. Comparison of anti-sickling potential of Aloe vera and
Cajanus cajan extracts
Volume of
Sample
Slide C1
Slide C2
Slide C3
Slide C4
Slide C5
Red blood cell

count (106 L1 )
Sickling time
(min)
extract (drops) A. vera C. cajan A. vera C. cajan

2
4
6
8
10
1.66
1.80
2.30
2.40
2.50
1.35
1.46
1.54
1.85
2.00
10.15
10.20
10.50
10.56
11.00
10.00
10.15
10.30
10.50
10.75
J Sci Food Agric 88:14821485 (2008)

DOI: 10.1002/jsfa
the ethanolic extract of A. vera in the present study, but

we have compared the anti-sickling properties of the
ethanolic extracts of C. cajan and A. vera (Table 4).
There appears to be no significant difference in the
anti-sickling properties of the two extracts.
CONCLUSION
It is common knowledge that sickle cell disease is
always associated with pain, and painful crisis is
one of the characteristic features of this disease.
Although there have been tremendous advances in the
basic molecular understanding of sickle haemoglobin
and the processes of gelation and sickling, it is
disappointing to note that so little basic scientific
research has been carried out on the treatment and
management of sickle cell disease, as reflected in the
area of improved medical care for patients.
The results obtained from this study have shown that
A. vera extract can increase the gelling time of HbSS
blood and inhibit sickling in vitro and may indeed
have great potential in the management of sickle cell
disease.
2 Pasvol G, Cellular Mechanism for protective effect of HbSS

against P. falicparum malaria. Nature 274:701708 (1978).
3 Sofowora EA and Isaacs WA, Reversal of sickling and cremation
in erythrocytes by root extract of Fagara Zathoxyloides.
Lloydia 34:383389 (1971).
4 Ekeke GI and Shode FO, Phenylalanine is the predominant
anti-sickling agent in Cajanus Caja seed extract. Planta Med
56:4143 (1990).
5 Mgbemene CN and Ohiri FC, Anti-sickling potential of
Terminalia Catappa leaf extract. Pharmaceut Biol 37:152156
(1999).
6 Njoku PC and Ejele AE, Prophylactic effect of liquid extract of
Telfereia Occi-dentalis in the prevention of painful sickle cell
crisis. J Sci Ind Stud 1:812 (2003).
7 Ekeke GI and Shode FO, Edible legumes as nutritionally
beneficial antisickling agents. Journal of Biochemistry and
Molecular Biology 56:111113 (1999).
8 Freedman ML, Weissmann G, Gorman BD and CunninghamRundles W, Effects of amino acids on gelation kinetics and
solubility of sickle hemoglobin. Biochemica Biophysica Research
community 22:637643 (1973).
9 Noguchi CT and Schechter AN, The treatment of sickle cell
disease. A historical and chronological literature of the
therapies applied since 1910. Tropical and Geographical
Medicine 74:126 (1977).
10 Rumen NM, Antisickling effect of dietary thiocyanate on
prophylactic control of sickle anemia. Journal of Nat. Medical
association 45:10531056 (1975).
REFERENCES
1 Serjeant GR, Sickle Cell Disease. Oxford University Press, Oxford
(1985).
J Sci Food Agric 88:14821485 (2008)

DOI: 10.1002/jsfa
1485

Effect of storage methods on coagulant activity and quality of cardoon extracts

Hochgeladen von

Dokumentinformationen

Originalbeschreibung:

Originaltitel

Copyright

Verfügbare Formate

Dieses Dokument teilen

Dokument teilen oder einbetten

Freigabeoptionen

Stufen Sie dieses Dokument als nützlich ein?

Sind diese Inhalte unangemessen?

Copyright:

Verfügbare Formate

Effect of storage methods on coagulant activity and quality of cardoon extracts

Hochgeladen von

Copyright:

Verfügbare Formate

Journal of the Science of Food & Agriculture

Volume 88 Issue 8 , Pages 1301 - 1485 (June 2008)

Journal of the Science of Food and Agriculture

J Sci Food Agric 88:13011306 (2008)

Effect of lyophilisation, refrigerated

Luis Tejada,1 Montserrat Vioque,2 Rafael Gomez

Correspondence to: Luis Tejada, Universidad Catolica

2008 Society of Chemical Industry. J Sci Food Agric 00225142/2008/$30.00

Crude vegetable coagulant obtained from directly

coagulant activity in terms of coagulation times, pH

MATERIALS AND METHODS

Effects of storage on quality of C. cardunculus L. extracts

was performed for storage method and storage time;

RESULTS AND DISCUSSION

Figure 1. Mean values for pH of crude aqueous extract from

Figure 2. Mean values for clotting activity of crude aqueous extract

J Sci Food Agric 88:13011306 (2008)

the study (Fig. 2). This was probably due to elevated

Lactic acid bacteria

J Sci Food Agric 88:13011306 (2008)

Effects of storage on quality of C. cardunculus L. extracts

counts displayed more irregular behaviour, with

76.45% of total variance, was positively correlated

Figure 3. Representation of variables studied in the plane defined by

Figure 4. Principal component analysis. Representation of extracts in

7 Fernandez-Salguero J, Sanchez E, Gomez

flowers from various species of cardoon Cynara L. Milchwissenschaft 56:1619 (2001).

Vioque M and Gomez

Fernandez-Salguero J, Tejada L and Gomez

Tejada L, Sanchez E, Gomez

J Sci Food Agric 88:13011306 (2008)

Journal of the Science of Food and Agriculture

J Sci Food Agric 88:13071317 (2008)

Keywords: Polycyclic aromatic hydrocarbons (PAHs); smoked cheese; HPLC/FLD

and frying are high temperature processes potentially

2008 Society of Chemical Industry. J Sci Food Agric 00225142/2008/$30.00

Although smoked cheese is a popular delicacy in

Chemicals and materials

A vacuum evaporator (Buchi

J Sci Food Agric 88:13071317 (2008)

Smoked processed cheese

N/A, not applied; , information not available.

E (Samples collected from

White cheese with smoked

Liquid smoke flavouring

Friction smoke technique

PAHs is smoked cheese

Table 2. FLD settings for PAH detection

Performance characteristics and quality assurance

RESULTS AND DISCUSSION

Repeatability was calculated as a relative standard deviation (RSD,

J Sci Food Agric 88:13071317 (2008)

PAHs is smoked cheese

to obtain accurate data even at low concentration

PAHs such as Naph, Ace and Fln (see Table 3). It

Sum of 12 PAHs (g kg-1)

Sum of carcinogenic PAHs

Background level (sum of 8 carcinogenic PAHs)

Sum of carcinogenic PAHs (g kg-1)

J Sci Food Agric 88:13071317 (2008)

Estimate; analyte concentration below limit of quantification.

PAHs ranged from 2.3 to 57 g kg1 and from