I

A Role for Insulin on L-Arginine Transport in Fetal Endothelial Dysfunc-

tion in Hyperglycaemia

I Cellular and Molecular Physiology LaboratOl:r (CI"fPL) and Perinatology Research LaboratOlY (PRL), Department
of
Obstetrics and Gynaecology, Medical Research Centre (Cn1), School of Medicine, Faculty of Medicine, Pontificia Universidad Catolica de Chile, P.O. Box 114-D, Santiago, Chile; 1Department of Physiology, Faculty of Biological Sciences, Universidad de Concepcion, Chile

Abstract: Endothelial cells are key in the regulation of vascular tone through the release of vasoactive molecules, including nitric oxide (NO). NO is a gas synthesized from the cationic amino acid L-arginine via the endothelial NO synthase
(eNOS). The semi-essential amino acid L-arginine is a taken up by endothelial cells via systems y+ and y+L in primary
cultures of human umbilical vein endothelial cells (HUVEC). System y+is a family of membrane transporters including at
least five transport systems for cationic amino acids (CAT) of which HUVEC express human CAT-I (hCAT-I) and
hCAT-2B. Exposure of HUVEC to high extracellular concentrations of D-glucose increases L-arginine transport, hCAT-l
mRNA expression and eNOS activity. These phenomena are also related with increased production of reactive oxygen
species (ROS), thus supporting the possibility that changes in L-argininelNO signalling pathway result from elevated
ROS. It has been shown that insulin blocks D-glucose-increased L-arginine transport and cGMP accumulation in
HUVEC, whereas in this cell type insulin also modulates high D-glucose effects by activating the transcriptional factors
Spl and NFKB.These transcription factors have response elements in SLC7A] (for hCAT-I) gene promoter region, thus
representing 2 possible targets for regulation of the expression of this transporter by D-glucose and/or insulin in this cell
type. Recent evidences suggest that insulin blocks the stimulatory effect of D-gJucose on L-arginine transport by reducing
the transcriptional activity of SLC7A] via Spl-, NFKB-and ROS-dependent mechanisms. Thus, a role for these transcription factors in response to insulin is proposed in fetal endothelial cells exposed to hyperglycaemia.
Keywords: Glucose, hyperglycaemia,

diabetes, L-arginine, transport, human, endothelium.

Endothelial cells are of mesenchymal ongm forming a

lane epithelium named endothelium. For decades the endoelium was considered as a simply barrier between the
lood and other body tissues. However, this early vision has
now radically changed and currently holds the endothelium
a real organ, made up of approximately ten trillion cells,
,-hich fulfils multiple roles in the physiology and patho. hysiology of vascular tone, with au tocrine, paracrine and
c:J.docrine actions and involved in the processes of coagula:::on and fibrinolysis [1, 2]. Endothelial cells are involved in
:-egulation of vascular tone through the release of a number
f vasoactive substances, such as prostacyclin (PGlz) [3],
dotelin-l [4] and nitric oxide (NO) [3, 5]. Endothelium-=crived NO spreads to the underlying smooth muscle cell
~yer in vascular vessels where increases cGMP levels to
bsequently induce relaxation of the muscle leading to
odilatation [3,5,6]. Both in vivo and in vitro experiments
-c:w demonstrated that NO synthesis in endothelial cells is a
__ cess that could be stimulated by various molecules, in~ding insulin [7-9], D-glucose [10] and adenosine [6].
~ilarly,
NO synthesis and/or its bioavailability are lower
.".: ress correspondence
to this author at the Cellular and Molecular
_"iology Laboratory (CMPL), Department of Obstetrics and Gynaecol
:..' 'vIedical Research Centre (CIM), School of Medicine, Faculty of MediPontificia Universidad Cat6lica de Chile, P.O. Box 114-D, Santiago,
- ~: Tel: 562-3548116; Fax: 562-6321924; E-mail: sobrevia@med.puc.c1

in pathological conditions such as intrauterine growth restriction (IUGR) [11], diabetes mellitus [9,12] or atherosclerosis
[13 ].
The signalling mechanisms involved in NO synthesis
have been studied in several cell types including human umbilical vein endothelial cells (HUVEC). The gas NO is synthesized from the cationic, semi-essential amino acid Larginine in a metabolic reaction leading to equimolar formation of L-citrulline and NO [6, 14]. This reaction requires the
activity of endothelial NO synthases (NOS), a group of enzymes conformed by at least three isoforms i.e. neuronal
NOS (nNOS or Type I), inducible NOS (iNOS or type II)
and endothelial NOS (eNOS or Type III) [15]. In fact, there
is evidence that NOS activity may depend on the ability of
endothelial cells to take up its specific substrate L-arginine
via a variety of membrane transport systems [6, 10, 11, 1416]. L-Arginine is taken up by endothelial cells via membrane transport systems grouped as systems l, y+L, bO,+and
BO.+[6, 16-18]. It is well known that system y+ conforms a
family of proteins known as cationic amino acid transporters
(CATs) family (hereafter referred as 'CATs family'), conformed by CAT-I, CAT-2A, CAT-2B, CAT-3 and CAT-4
[17, 19]. CAT-l is ubiquitously expressed, while CAT-2A
and CAT -3 are constitutively expressed in liver and brain,
respectively, and CAT-2B is induced in a variety of cell
types in response to bacterial endotoxins and proinflammatory cytokines [6,17, 19-21]. CAT-4 derives from

r..-:;.

a sequence of cDNA that is 41-42% identical to other members of CATs family, but no transport activity has been yet
described [6,17]. CAT-I, CAT-2B and CAT-3 are functionally characterized as high affinity (Km ~100-400 f.lM), Na+..
independent transporters, while CAT-2A has a relatively low
affinity for cationic amino acids (Km ~2-5 mM). Interestingly, only 2 members of the CATs family have been functionally characterized in primary cultures of HUVEC i.e.
human CAT-l (hCAT-l) and hCAT-2B, while hCAT-2A
seems not to be expressed in this cell type [6, 10, 11, 17, 18].
In addition, hCAT-l protein and mRNA, and only hCAT-2B
mRNA have been detected in this cell type [17].

described
Th -.. ~. now suggested that SLC7Ai could
be formed by I xo -. \yhere transcription start site (ATG)
is located in exon -_ [_ ]. \- e have recently cloned a fragment of -6"0'
u ~
the ATG of SLC7 Ai in primary
cultures of HC\"EC and detected that this fragment of the
potential promo er of SCL Al contains several consensus
sequences for transcription factors that may be critical for the
regulation of its expression by insulin and/or D-glucose [23,
24] (Fig. 1).

Phylogenetically, the SLC7 ('solute carrier') family consists of 2 subfamilies formed by CATs and the amino acid
transporters associated to glycoproteins (HATs, heterodimeric amino acid transporters). CATs family members are
encoded by genes SLC7Ai, 2, 3 and 4, whose protein products contain 14 transmembrane domains [19]. Specifically,
the gene encoding hCAT -1 protein i.e. SLC7 Ai (located on
chromosome 13q 12-q 14), consists of an open reading frame
with 11 exons and 10 introns. However, towards the 5'-end
two additional untranslatable exons (-2 and -1) have been

L-Arginine Transport

-650
-581
-512
-443
-374
-305
-236
-167
-98

INSULIN AND D-GL 'COSE EFFECT

LIAL L-ARGININE/NO
PATHWAY

ON ENDOTHE-

Incubation of HUVEC primary cultures in an euglycaemic culture medium (i.e. containing -5 mM D-glucose) with
physiological resting concentrations of insulin (-0.1 nM)
increased the maximal transport velocity (Vmax) without significant changes in the apparent Km for L-arginine transport
[23]. This phenomenon was seen as a higher maximal transport capacity (i.e. ~naJKm) [17, 20, 25, 26] of the involved
membrane transporters for cationic amino acids [23]. The

--.

GTTAAGGTGAACTGCGCTCCAGCCTGGGCAATAGAGTAACACCCTGTCTCTAAAATGAAAAGAAAACAG

TTTAAACCTTTTAAGTGCATACCAAATCTTTTATTTTGGAGAAGGAAAACTGGTCTCGAGTTCCGTGTG
P53
AGCTCCCTGGGGCCCGCCGGGAGGGGGTTGGCACGGCCGGACCTGCAGCACTAGTTCTGGCCAGGGCGC
TGTGGGATCTGCAGGGGACCACAGGATGCTGTGGCGCGGTGCGCTCAGATTGGCGGAGAAACGGCCACA
EGR-1
NFKB (p50)
CGCCTACGGAGCTACTGAGAAGGCGAGCGGAGGCGCAGCCCGCCCGCCCGCCGCGGGAACCCCAGGTTG
GGGCGCTGGGCGCGCGAAGACTCAGCCGCCCCGCCCACCAAGGGCGCGTCGGTCCCCGGCCGCAGCCTC
CREB
Sp1
TGGGCTGGCAGCCGCCGCCGCGCCGCGCTCCCATTGGTGCCCGGCGGTGACGCGGCCGAGCGGGCCGGG
Sp1
Sp1
Sp1
GCTGCCTGGTCCGGGGGCGGGCGTGGGGCGCGGGGCGCGGAGCGCGAGGGGCGGGGGCCGGGCGCACTG
Elk-1
CTGATGAAACCTGGCGCCGGAACCCGCCAGCCCTCGGCGCCCATTCAGTCCGCGCAGGCAGGTGTGAGC

+109

GAGCGCGTCCGACAGTCTGTCTGTTCGCGATCCTGCCGGAGCCCCGCCGCCGCCGGCTTG

Fig. (1). Scheme of the -650 bp region from proposed transcription start site at SLC7 AI. The sequence of the region -650 bp from the
proposed transcription start site (*) of the potential promoter of the gene SLC7 A I (for human cationic amino acid transporter 1, hCAT-1) that
has been cloned is shown. Proposed first exon of the transcript extends between -650 to + 142 bp. The location of primers used to amplifYthi
region of the promoter is indicated by the arrows and corresponded to: sense ACG CGT TAA GGT GAA CTG CGC TCC, antisense CCA
TGG ATC GCG AAC AGA CAG ACT. Underlined are binding sites for transcription factors such as stimulatory protein 1 (Spl), nuclear
factor kappa B (NFKB), p53 tumor repressor factor, early growth response factor 1 (EGR-l), cyclic AMP response element-binding (CREB)
and the transcription factor with ETS domain (Elk- J).

(NT
1

ONOO.

L-Arginine

hCAT-1

Spl
NF,B

protein

"

Insulin

! j~
-- .....
/..

ROS

heAT'

mRNA

Fig. (2). Proposed regulatory mechanisms of hCAT-I expression and activity by high D-glucose and insulin in HUVEC. Exposure of
HUVEC to an elevated extracellular level of D-glucose (High D-glucose) increases the intracellular level of reactive oxygen species (ROS)
likely derived from NAD(P)H oxidase. ROS formation may stimulate via Sp I and NFkB transcription factors the SLC7 A I gene promoter
activity leading to increased hCAT-1 mRNA expression and protein abundance. These events result in an increased L-arginine transport via
heAT-I and nitric oxide (NO) and L-citrulline synthesis via the endothelial NO synthase (eNOS). The NO could rapidly react with ROS to
fonn peroxynitrite (ONOO) contributing to endothelial dysfunction. Insulin is proposed to protect the endothelial cell by blocking the effect
of D-glucose on the generation of intracellular ROS, reducing the effect of these molecules on SLC7Al expression and L-arginine transport.
Insulin under hyperglycaemia could also act as a repressor of D-glucose activated ROS generation protecting the endothelial cells from this
abnormal environment.

reported magnitude of the insulin stimulatory effect on Larginine transport (~5 fold) was comparable to the trans-rimulatory effect of L-lysine on L-arginine transport measured under zero-trans conditions for L-lysine in this cell type
[II, 23] (see Fig. (2. These results are complemented and
supported by parallel studies showing that insulin increased
dle hCAT-I mRNA number of copies [23] and protein abunance (Gonzalez M, Sobrevia L, unpublished data). These
-rudies suggest that insulin-induced L-arginine transport is
most likely due to increased expression and activity of
, CAT-! membrane transporters in HUVEC. In addition,
:l1Sulineffect on L-arginine transport was proposed as a phe:lOmenon resulting from a sequential activation of cell sig:1alling molecules, including phosphatidylinositol 3 kinase
PI3k), protein kinase C (PKC), NOS and mitogen-activated
rotein kinases p42 and p44 (p42/44mapk), which are known
to be involved also in the modulation of several other memrane transport systems in mammalian cells [6, 17].

ported that longer incubation periods (24 h) with high concentrations of extracellular D-glucose (~25 mM) increases
the ~nax of the L-arginine transport, an effect blocked by
inhibition of protein synthesis or when cells are preincubated with 1 nM insulin for 8 h [16]. The increase of Larginine transport induced by chronic incubation with Dglucose was also associated with increased hCAT-l mRNA
level and L_[3H] citrulline synthesis from L-eH] arginine
[24]. In preliminary assays, we have been able to detect a
potential effect of D-glucose at a transcriptional level modulating hCAT-! expression, a phenomenon that is also
blocked by insulin (Gonzalez M, Sobrevia L, unpublished
data). Thus, it is feasible that insulin could be triggering signalling pathways that will potentially interfere with an increased SLC7 Ai transcriptional activity in response to a high
D-glucose environment.

It has been reported that incubation of primary cultures of

~VEC
with increasing concentrations of extracellular Dglucose for a period of 2 minutes (acute effect) increased Lc:rginine transport, reaching a maximal effect at 25 mM D_ ucose [10]. The increase in L-arginine transport induced by
ute exposure of HUVEC to high D-glucose has been exlained as an increase in the activity ofhCAT-! transporters.
-;tis phenomenon is more likely due to plasma membrane
yperpolarization due to increased K+ efflux through ATP: nsitive K+ channels ([K+]ATP) [10]. It has also been re-

In endothelial cells from human aorta, long incubation

periods (7 days) with 25 mM D-glucose decreases eNOS
activity, protein abundance and mRNA level, effects that
was associated with reduced activity of eNOS promoter [27].
In HUVEC, chronic incubation with 25 mM D-glucose (up
to 24 h) increases eNOS protein abundance, an effect that
seems involve P13k and protein kinase B (PKB)/Akt activity
[24, 28]. Several studies report that in an early hyperglycaemic state, activation of these signalling molecules would lead
to cell survival, but after 24 h it will increase cell death by

eNOS Expression

and Activity

apoptosis, 'an effect regulated by activation of the nuclear

factor kappa B (NFKB) [28]. This differential response of
cells to states of hyperglycaemia could result from accumulation of reactive oxygen species (ROS), whose generation is
elevated in cells exposed to high extracellular concentrations
of D-glucose [28, 29]. On the other hand, in endothelial cells
from mouse lungs it has been reported that insulin could protect in a NO-dependent manner against endothelial dysfunction (estimated by variations of the electrical transendothelial resistance) induced by hydrogen peroxide (HzOz)
[30]. However, endothelial cells from bovine aorta (BAEC)
exhibit less NO synthesis induced by insulin when cells were
incubated with high concentrations of extracellular Dglucose, an effect that appears to depend on a signalling
pathway involving insulin receptor type 1 (lR-I), PI3k and
the inhibitor of the kinase subunit of nuclear factor kappa 13
(IKKB) [31]. In studies performed in primary cultures of
HUVEC, high D-glucose (25 mM, 24 h) increased cGMP
synthesis, an effect blocked by 1 nM insulin (8 h) [17]. In the
same cell type it has been shown that at this concentration
and time of exposure to insulin is enough to block the high
D-glucose-dependent inhibition of the membrane transport
of adenosine, an endogenous nucleoside that induces NOdepehdent vasodilatation in most vascular beds [32, 33]. All
together these results indicate that deleterious effects of
chronic exposure to high concentrations of extracellular Dglucose could be mediated by increased NO synthesis in
human umbilical vein endothelium. Whether the effect of
high D-glucose and the potential role of insulin as a protective factor in this phenomenon is either at a transcriptional
and/or post-transcriptional level has not yet been described
[9, 17,33].
INSULIN
AND
SYNTESIS

D-GLUCOSE

EFFECT

ON

ROS

Cell death by apoptosis induced by high concentrations

of extracellular D-glucose has been linked to the increased
production of ROS. This is reflected as increased nitrotyrosine formation and PKC activity in HUVEC incubated in
the presence of high concentrations of extracellular Dglucose, either under permanent (20 mM, 14 days) or intermittent (repeated periods of 24 hours with concentrations of
5 or 20 mM D-glucose for 14 days) incubation periods [34].
In BAEC, it has been shown that incubation with 25 mM Dglucose for 3 h increases ROS synthesis dependent of
NAD(P)H oxidase [35]. This study also shows that incubation with physiological concentrations of insulin for 3 h induces an even greater increase in the synthesis of ROS, although during the first hour of incubation with this hormone
is possible to detect a decline in the synthesis of ROS induced by D-glucose [35]. Thus, it is likely that an acute effect of insulin could be acting to protect from the damage
induced by overproduction of ROS in response to high concentrations of extracellular D-glucose. This effect of insulin
could probably be due to activation of NOS and increased
NO bioavailability in the endothelium. The mechanisms by
which ROS induces its effect include regulation of gene expression and post-translational modifications [36]. One of
the most studied transcription factor regulated by ROS is
NFKB, which is found in most cells at rest, and that rapidly
translocates to the nucleus inducing gene transcription after

its a 'y ::0::1. _'hB is also involved in the development of

insulin res'
. one of the first events that occur before the
establ"-hm t 0 diabetes mellitus [37]. Although we know
that imer D-glu 0 e or insulin increase L-arginine transport
and:\O
.'llth -is. a haracterization of the mechanisms behind the r ulting in reased ROS production and activation
of transcription fac ors, including d1e zinc finger promoterselectiYe transcription factor specific protein 1 (Spl), in response to these molecules is not well established. Unveiling
the intrinsic mechanisms behind modulation of gene transcriptional activity will give us clues to understand a potential protective effect of insulin before endothelial damage is
triggered by pathological states of hyper glycaemia.
D-GLUCOSE

AND I SULIN EFFECT

ON Spl ACTI-

VITY
Within a region of ~4000 bp upstream from the transcription start site of SLC7 AI, multiple consensus sites of various
transcription factors have been identified by in silica analysis
of sequence. Within d1ese factors, it is possible to identify
consensus sites for Smad-4, NFKB and Spl, among others,
which are regulated by insulin or D-glucose. Within this region d1ere are at least four consensus sites for Spl close to
the transcription start site of SLC7 AI. These sites could play
key roles as regulators of the transcription of this gene since
it lacks of TAT A box [22]. Also, there are 2 consensus sites
for NFKB around -3200 and -600 bp region from the transcription start site, which are potentially regulated by ROS.
Since there is experimental evidence suggesting that Spl is
involved in gene-specific responses to a variety of cellular
signals independent of the interaction with other inducible
transcription factors, and since this transcription factor is
apparently involved in the regulation of membrane transporters expression, such as SLC29AI for the human equilibrative
nucleoside transporters type 1 (hENTl) in HUVEC [38], in
preliminary experiments we have studied a region of 650 bp
upstream of the transcription start site in SLC7AI [39]. Spl
is activated by phosphorylation of serine and threonine residues, a phenomenon altered in response to various stimuli
that activate different signalling pathways. The amino acid
sequence of Spl contains consensus phosphorylation sites
for numerous protein kinases, including calmodulin kinases
(CamKs), casein kinases (CK) 1 and 2, protein kinase A
(PKA), PKC, and p42/44mapk [40]. Interestingly, it has been
reported that increase in the transcriptional activity of plasminogen activator inhibitor-l (PAl-I) induced by insulin
(100 nM, 16 hours) in HepG2 cells transfected with PAI-l
promoter, involves activity of PI3k, PKC and p42/44map\
among other signalling molecules [41]. In PAI-I gene at
least three consensus sites for transcription factors induced
by insulin has been identified, all of which co-localize with
putative consensus sites for SpI [41]. Thus, a potential role
for Sp 1 as modulator of PAl -1 gene expression is suggested.
In addition, in the same cell type, D-glucose incubation (~23
mM, 24 and 48 h) decreases the level of apolipoprotein A 1
(apoA-I) mRNA, an effect that was blocked by insulin. This
phenomenon was dependent on a region of the promoter
where an insulin response core element (IRCE) is present
[42]. SpI binds to this element and the signallinp pathway
triggered by insulin appears to involve p42/44map and PKC
activity, and Spl phosphorylation [43].

There is also evidence that SpI is essential for basal transcription of calmodulin gene and for the increase of transcriptional activity of this gene induced by insulin [44]. In
addition, insulin increases the o-glycosylation and phosphorylation of SpI in the HAllE hepatoma cell line, which
is reduced when cells are from streptozotocin-induced diabetic rats [45]. Recently, it has been shown that insulin (100
) increases PKC8 expression, a phenomenon that is under
::cgulation by PKCa in the skeletal muscle cell line L6 via a
:;:nechanism requiring Sp 1 and NFKB activation [46]. Since in
rimary cultures of HUVEC it has been reported that insulin
srimulation of hCAT - I -mediated L-arginine transport de_ nds on PI3k, PKC and p42/44mapk activity [23], it is likely
:hat SpI would be acting as a key transcription factor modu~ -ng SLC7Ai expression by insulin or high extracellular
:uncentrations of D-glucose in HUVEC (Table 1).
Preliminary experiments performed in HUVEC incubated
mM D-glucose (24 hours) and I nM insulin (for last
h of the 24 h period of incubation with high D-glucose)
-' ow increased SpI protein abundance in nuclear protein
_ :::-acts (Gonzalez M, Sobrevia L, unpublished data). Co_ -ubation of HUVEC monolayers with D-glucose and insu-

'm 25

II

Stimuli

Gene Blank

Cell Type

lin produced a greater increase of Sp I nuclear abundance,

which would possibly indicates that both insulin and Dglucose activated different signalling pathways to increase
Sp I activity in this cell type. Although it has not been possible to determine whether it also leads to an increase in phosphory lation or glycosy lation of Sp 1, we found increased Sp 1
binding to a region of the SLC7 Ai promoter containing four
consensus sites for SpI in tandem. This finding indicates that
at least part of the D-glucose- and insulin-increased hCAT-I
mRNA level could be due to increased expression and activity of Sp I on SLC7 Ai. Sp I activity seems to regulate not
only hCA T-1 expression, but could also participate in the
transcriptional regulation of eNOS. The promoter region of
eNOS has been characterized and is known to exhibit consensus sites for transcription factors such as activator protein-I (AP-I), GATA binding protein 2 (GATA-2), ETS
binding domain (Ets) family members, and members of the
Sp family (Spl and Sp3), among others [47]. On this background it is tempting to propose that the signalling pathways
induced by D-glucose and insulin might include activation of
Spl inducing expression of genes relevant to the endothelial
L-arginine/NO pathway.

Mechanism

Promoter

References

Activity
Insulin

PAl-l

Human hepatoblastoma

Increased

Increased Sp 1 binding to DNA

[41]

Increased

Increased Spl binding to IRCE motifs

[42]

HepG2
Insulin

Apo-Al

Human hepatoblastoma
HepG2

Insulin

Apo-Al

Human hepatoblastoma

Increased

Phpsphorylation

HepG2
Insulin

Calmodulin

Rat hepatoma H-4 lIE

of Sp 1 and increase of

[43]

IRCE binding
Increased

II

Promotor without Sp I binding sites, cannot

[44]

be stimulated by insulin
Insulin

PKC15

Skeletal muscle L6

Increased

Inhibition of expression and activity of Sp I

[46]

blocked the effect of insulin on PKCo

promoter
J-Glucose

TGF-j3l PAl-l

Rat mesangial cells

Increased

Inhibition of expression and activity of Sp I

[61]

blocked the effect of insulin on TGF-fil

and PAI-I promoter
J-Glucose

lR-l

Rat hepatocytes

Increased

Effect ofD-glucose

on promoter was

[62]

blocked when 3 or 4 binding sites of Sp I

were mutated
._ ose Insulin

Leptin

Adipocytes and hepa-

Increased

tocytes from rat

=>-Glucose

Acetyl-CoA

SL2 from Drosophila

Mutation ofSpl

response element, blocked

the D-glucose/insulin
Increased

[63]

effect

Mutation of Sp 1 binding sites, blocked the

[64]

effect of D-glucose
H,O,

Spl

Nuclear extracts from

n.d.

H,O, decreased the Spl binding to DNA

[65]

n.d.

H,O, decreased the Sp I binding to DNA

[66]

rat kidney
H,O,

Aldolase Pyruvate
kinase

Rat timocytes

INSULIN ~D

D-GLUCOSE

EFFECT

ON NFKB

Since it was described in 1986, the transcription factor

NFKB has been the subject of many studies due to its important role in inflammatory processes and other pathologies. In
the beginning NFKB was described as a specific protein of B
cells, but it is now known to be an ubiquitous transcription
factor [48]. NFKB activation is induced and independent of
protein synthesis, requiring post-translational changes for its
migration to the nucleus. Initially, NFKB was described as a
transcription factor that could be stimulated by several immunological stimuli, such as tumour necrosis factor (TN F),
lipopolysaccharide (LPS) [49, 50], interleukin-I (IL-I) [51],
or as a factor that activates T cells [52]. However, more recently it has been shown that the transcriptional activity of
several genes is increased via NFKB in response to a series of
stimuli that are unrelated with the immune response, such as
ultraviolet radiation, growth factors [53] or viral infections
[54]. The latent nature of NFKB is in relation with it association with the inhibitory protein kappa B inhibitor (IKB). The
release of this complex allows the migration of NFKB to the
nucleus [55]. Interestingly, it has been reported that incubation of BAEC in culture medium containing 30 mM Dglucose increases NFKB translocation toward the nucleus
[56]. In addition, in HUVEC it has been shown that hyperglycaemia also increased NFKB protein abundance in the
nucleus, and that this increase depends on the activity of
PI3kJAkt [57], signalling molecules that are determinant for
L-arginine transport and NO synthesis in response to insulin
in this cell type [17, 23]. Other studies also show that incubation of BAEC and human aortic endothelial cells (HAEC) in
30 mM D-glucose (16 hours) increases NFKB binding to the
DNA [58]. Thus, it seems clear that high D-glucose effect on
endothelial cells involves NFKB activation in a variety of
endothelia indicating that this phenomenon is not limited to a

Stimuli

Gene blank

Cell type

specific type of endothelium. On the other side, insulin has

been shOKl1 to either reduce NFKB binding to the DNA in
HAEC [59] or increase )!FKB-induced transcriptional activity of genes in '-ascular smooth muscle cells from bovine
aorta (YSMC) transfected with a vector containing response
elements to NFKB [60]. Thus, literature regarding the potential involvement of NFKB in cell response to insulin is wide
open and specific mechanisms are not well understood (Table 2).
CONCLUDING

REMARKS

It is proposed that insulin modulates L-arginine transport

and NO synthesis in human fetal endothelium via cell signalling mechanisms that respond to increased activity of Sp I
and NFKB transcription factors. The gene SLC7 Al coding for
hCA T-I membrane transporters express consensus sequences for binding of these transcription factors, particularly Sp I, suggesting that increased expression of hCA T-I in
response to elevated D-glucose and insulin could result from
increased expression of SLC7 AI. Nothing is known regarding ROS and the transcriptional activity of SLC7AI in response to elevated D-glucose or in response to insulin, even
when it is accepted that the pathological condition of hyperglycaemia leads to generation of abnormal levels of ROS in
HUVEC. These fmdings could be determinant in the dynamic of the regulation of expression and activity of Larginine membrane transporters (particularly hCA T-I) and
eNOS in human fetal endothelium derived from pregnancies
where abnormally elevated plasma D-glucose levels could be
found such as in gestational diabetes.

Supported by Fondo Nacional de Desarrollo Cientifico y

Tecnol6gico (FONDECYT 1070865, 1080534, 7070249)

Mechanism

Effect on

References

mRNA level
D-Glucose

NFJd3

BAEC

n.d.

Increased nuclear localization ofNFK.B

[56]

D-Glucose

COX-2

HUVEC

n.d.

Increased NFKB DNA binding

[57]

D-Glucose

NFKB

HAEC

n.d.

Increased NFKB DNA binding

[58]

HUVEC

Increased

Increased NFKB DNA binding

[67]

HAEC

Increased

Increased NFKB DNA binding

[68]

HUVEC

Increased

Increased NFKB DNA binding

[69]

L6 skeletal muscle

Increased

Inhibition ofNFKB activity blocked the

[46]

D-Glucose

Fibronectin

D-Glucose

VCAM-l

D-Glucose

Fibronectin

Insulin

?KCa

increase ofmRNA
Insulin

MC?-!

HAEC

Decreased

Decreased NfKB DNA binding

[59]

ROS

NFKB

HUVEC

n.d.

Inhibition ofROS synthesis blocked ROS-

[70]

induced NFKB activity

ROS

NFKB

HMEC.l

n.d.

LPS-increased

ROS increased NfKB DNA

[71]

binding
BAEC: bovine artery endothelial cells, HUVEC: human umbilical vein endothelial cells, HAEC: human artery endotbelial cells, HMEC.I: human dermal microvascular endotheli2l
cells, LPS: lipopolysaccharide, ROS: reactive oxygen species, n.d.: not determined.

d Comisi6n Nacional de Ciencia y Tecnologia (CONICYT

-~070213), Chile. M. Gonzalez holds a CONICYT-PhD
~!Jowship (Chile). We thank the researchers at the Cellular
Molecular Physiology Laboratory (CMPL) and Perina_ogy Research Laboratory (PRL) of the Pontificia Univerd Cat6lica de Chile (puq for their contribution in the
__ duction of the experimental data that has been cited
:=oughout the text. Authors also thank the personnel of the
o pital Clinico Pontificia Universidad Cat6lica de Chile
-,' ur ward for supply of umbilical cords.

[20]

[21]

[22]

[23]

[24]
Fishman AP. Endothelium: A distributed organ of diverse capabilities. Ann NY Acad Sci 1982; 401: 1-8.
Galley H, Webster N. Physiology of the endothelium. Br J Anaesth
2004; 93: 105-13.
Moncada S, Palmer RMJ, Higgs EA. The discovery of nitric oxide
as the endogenous nitrovasodilator. Hypertension 1988; 12: 36572.
Yanagisawa M, Kurihara H, Kimura S, Tomobe Y. A novel potent
vasoconstrictor
peptide produced by vascular endotelial cells.
Nature 1988; 332: 411-5.
Ignarro LJ, Buga GM, Wood KS, Byrns RE, Chaudhuri G. Endothelium-derived relaxing factor produced and released from artery
and vein is nitric oxide. Proc Natl Acad Sci 1987; 84: 9265-9.
Mann GE, Yudilevich DL, Sobrevia L. Rel,'Ulation of amino acid
and glucose transporters in endothelial and smooth muscle cells.
Physiol Rev 2003; 83: 183-252.
Steinberg HO, Baron AD. Vascular function, insulin resistance and
fatty acids. Diabetologia 2002; 45: 623-34.
Kuboki K, Jiang ZY, Takahara N, Ha SW, Igarashi M, Yamauchi
T, et af. Regulation of endothelial constitutive nitric oxide synthase
geneexpression in endothelial cells and in vivo: a specific vascular
action of insulin. Circulation 2000; 101: 676-81.
Desoye G, Hauguel-de Mouzon S. The human placenta in gestational diabetes mellitus. The insulin and cytokine network. Diabetes Care 2007; 30: 120-6.
Flores C, Rojas S, Aguayo C, Parodi J, Mann G, Pearson JD, et al.
Rapid stimulation of L-arginine transport by D-glucose involves
p42/44mapk and nitric oxide in human umbilical vein endothelium.
Cir Res 2003; 92: 64-72.
Casanello P, Sobrevia L. Intrauterine growth retardation is associated with reduced activity and expression of the cationic amino
acid transport systems y+/hCA T-l and y+/hCAT-2B and lower activity of nitric oxide synthase in human umbilical vein endothelial
cells. Circ Res 2002; 91: 127-34.
Durante W, Sen AK, Sunahara FA. Impairment of endotheliumdependent relaxation in aortae from spontaneously diabetic rats. Br
J Pharmacol 1988; 94: 463-8.
Bossaller C, Habib GB, Yamamoto H, Williams C, Wells S, Henry
PD. Impaired muscarinic endothelium-dependent
relaxation and
cyclic guanosine 5' -monophosphate
formation in atherosclerotic
human coronary artery and rabbit aorta. J Clin Invest 1987; 79:
170-4.
Guyao W, Morris SM. Arginine metabolism: nitric oxide and beyond. Biochem J 1998336: 1-17.
Alderton WK, Cooper CE, Knowles RG. Nitric oxide synthases:
structure, function and inhibition. Biochem J 200 I; 357: 593-615.
Sobrevia L, Mann GE. Dysfunction of the nitric oxide signalling
pathway in diabetes and hyperglycaemia. Exp Physiol 1997; 82:
423-52.
Casanello P, Escudero C, Sobrevia L. Equilibrative Nucleoside
(ENTs) and Cationic Amino acid (CATs) Transporters: implications in foetal endothelial dysfunction in human pregnancy diseases. Curr Vasc Pharmacol2007;
5: 69-84.
Arancibia-Garavilla
Y, Toledo F, Casanello P, Sobrevia L. Nitric
oxide synthesis requires activity of the cationic and neutral amino
acid transport system y+L in human umbilical vein endothelium.
Exp Physiol2003; 88: 699-710.
Verrey F, Closs EI, Wagner CA, Palacin M, Endou H, Kanai Y.
CATs and HATs: the SLC7 family of amino acid transporters. Eur
J Physiol2003; 447: 532-42.

[25]

[26]

[27]

[28]

[29]
[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

Deves R, Boyd CAR. Transporters for cationic amino acids in

animal cells: Discovery, structure and function. Physiol Rev 1998;
78: 487-545.
Palacin M, Estevez R, Bertran J, Zorzano A. Molecular biology of
mammalian plasma membrane amino acid transporters. Physiol
Rev 1998; 78: 969-1054.
Hammermann R, Brunn G, Racke K. Analysis of the genomic
organization of the human cationic amino acid transporters CA T-l,
CAT-2 and CAT-4. Amino Acids 2001; 21: 211-9.
Gonzalez M, Flores C, Pearson JD, Casanello P, Sobrevia L. Cell
signalling-mediating
insulin increase ofmRNA expression for cationic amino acid transporters-l and -2 and membrane hyperpolarization in human umbilical vein endothelial cells. Eur J Physiol
2004; 448: 383-94.
Vasquez R, Farias M, Lvis VJ, San MR, Vecchiola A, Casanello P,
et al. D-Glucose stimulation of L-arginine transport and nitric oxide synthesis results from activation of mitogen-activated protein
kinases p42/44 and Smad2 requiring functional type II TGF- Receptors in human umbilical vein endothelium. J Cell Physiol 2007;
212: 626-32.
Escudero C, Casanello P, Sobrevia L. Human equilibrative nucleoside transporters I and 2 may be differentially modulated by A2B
adenosine receptors in placenta microvascular endothelial cells
from preeclampsia. Placenta 2008; 29: 816-25.
Vasquez G, Sanhueza F, Vasquez R, Gonzalez M, San Martin R,
Casanello P,et al. Role of adenosine transport in gestational diabetes-induced L-arginine transport and nitric oxide synthesis in human umbilical vein endothelium. J Physiol2004; 560: 111-22.
Srinivasan S, Hatley ME, Bolick DT, Palmer LA, Edelstein D,
Brownlee M, et al. Hyperglycaemia-induced
superoxide production
decreases eNOS expression via AP-l activation in aortic endothelial cells. Diabetologia 2004; 47: 1727-34.
Ho FM, Lin WW, Chen BC, Chao CM, Yang CR, Lin LY, et al.
High glucose-induced
apoptosis in human vascular endothelial
cells is mediated through NF-kappaB and c-Jun NH2-terminal
kinase pathway and prevented by PI3K/AktieNOS pathway. Cell
Signal 2006; 18: 391-9.
Hadi HA, Suwaidi JA. Endothelial dysfunction in diabetes mellitus.
Vasc Health Risk Manag. 2007; 3: 853-76.
Rath S, Kalogeris T, Mai N, Zibari G, Alexander JS, Lefer D, et af.
Insulin prevents oxidant-induced endothelial cell barrier dysfunction via nitric oxide-dependent pathway. Surgery 2006; 139: 82-91.
Kim F, Tysseling KA, Rice J, Gallis B, Haji L, Giachelli CM, et af.
Activation of IKKbeta by glucose is necessary and sufficient to impair insulin signaling and nitric oxide production in endothelial
cells. J Mol Cell Cardiol2005; 39: 327-34.
Munoz G, San Martin R, Farias M, Cea L, Vecchiola A, Casanello
P, et al. Insulin restores glucose inhibition of adenosine transport
by increasing the expression and activity of the equilibrative nucleoside transporter 2 in human umbilical vein endothelium. J Cell
Physiol 2006; 209: 826-35.
San Martin R, Sobrevia L. Gestational diabetes and the adenosinelL-arginine/nitric oxide (ALANO) pathway in human umbilical
vein endothelium. Placenta 2006; 27: 1-10.
Quagliaro L, Piconi L, Assaloni R, Martinelli L, Motz E, Ceriello
A. Intermittent high glucose enhances apoptosis related to oxidative stress in human umbilical vein endothelial cells: the role of
protein kinase C and NAD(P)H-oxidase activation. Diabetes 2003;
52: 2795-804.
Yano M, Hasegawa G, Ishii M, Yamasaki M, Fukui M, Nakamura
N, et al. Short-term exposure of high glucose concentration induces
generation of reactive oxygen species in endothelial cells: implicatIOn for the oxidative stress associated with postprandial hyperglycemia. Redox Rep 2004; 9: 111-6.
Carnesecchi S, Carpentier JL, Foti M, Szanto 1. Insulin-induced
vascular endothelial growth factor expression is mediated by the
NADPH oxidase NOX3. Exp Cell Res 2006; 3 I 2: 3413-24.
Rutledge AC, Adeli K. Fructose and the metabolic syndrome:
pathophysiology and molecular mechanisms. Nutr Rev 2007; 65:
SI3-S23.
Puebla C, Farias M, Gonzalez M, Vecchiola A, Aguayo C, Krause
B, et al. High D-glucose reduces SLC29A1 promoter activity and
adenosine transport involving specific protein I in human umbilical
vein endothelium. J Cell Physiol2008; 215: 645-56.
Gonzalez M, Vecchiola A, Farias M, Casanello P, Sobrevia L
Insulin blockage of D-glucose-stimulation
of L-arginine trans

does not involves Spl binding to SLC7Alpromoter

region in human fetal endothelium. Physiol Mini-Rev 2006; I: 28 (Abstract).
Samson S, Wong NCW. Role of Spl in insulin regulation of gene
expression. J Mol Endocrinol 2002; 29: 265-79.
Banfi C, Eriksson P, Giandomenico G, Mussoni L, Sironi L, Hamsten A, et al. Transcriptional regulation of plasminogen activator
inhibitor type I gene by insulin: insights into the signaling pathway. Diabetes 2001; 50: 1522-30.
Murao K, Wada Y, Nakamura T, Taylor AH, Mooradian AD,
Wong NC. Effects of glucose and insulin on rat apolipoprotein A-I
gene expression. J Bioi Chern 1998; 273: 18959-65.
Lam JK, Matsubara S, Mihara K, Zheng XL, Mooradian AD,
Wong Ne. Insulin induction of apolipoprotein AI, role of Spi.
Biochemistry 2003; 42: 2680-90.
Solomon SS, Palazzolo MR, Takahashi T, Raghow R. Transcription factor Sp I is necessary for basal calmodulin gene transcription
and for its selective stimulation by insulin. Endocrinology 1997;
138: 5052-64.
Majumdar G, Harrington A, Hungerford J, Martinez-Hernandez
A,
Gerling IC, Raghow R, et at. Insulin dynamically
regulates
calmodulin gene expression by sequential o-glycosylation
and
phosphorylation of Spl and its subcellular compartmentalization
in
liver cells. J Bioi Chern 2006; 281: 3642-50.
Horovitz-Fried
M, Sampson SR. Involvement of PKCalpha in
insulin-induced
PKCdelta expression: Importance of SP-I and
NFkappaB transcription factors. Biochem Biophys Res Commun
2007; 352: 78-83.
Fish JE, Marsden PA. Endothelial nitric oxide synthase: insight
into cell-specific gene regulation in the vascular endothelium. Cell
Mol Life Sci 2005; 63: 144-62.
Grimm S, Baeuerle PA. The inducible transcription factor NFkappa B: structure-function
relationship of its protein subunits.
Biochem J 1993; 290: 297-308.
Crisostomo PR, Wang Y, Markel TA, Wang M, Lahm T, Meldrum
DR. Human mesenchymal stem cells stimulated by TNF-alpha,
LPS, or hypoxia produce growth factors by an NF kappa B- but not
JNK-dependent mechanism. Am J Physiol 2008; 294: C675-C682.
Nakao S, Oglata Y, Shimizu E, Yamazaki M, Furuyama S, Sugiya
H. Tumor necrosis factor alpha (TNF-alpha)-induced prostaglandin
E2 release is mediated by the activation of cyclooxygenase-2
(COX-2) transcription via NFkappaB in human gingival fibroblasts. Mol Cell Biochem 2002; 238: 11-8.
Jung YJ, Isaacs JS, Lee S, Trepel J, Neckers L. IL-I bela-mediated
up-regulation of HIF-lalpha
via an NFkappaB/COX-2
pathway
identifies HIF-I as a critical link between inflammation and oncogenesis. FASEB J 2003; 17: 21 15-7.
Schaecher K, Goust JM, Banik NL. The effects of calpain inhibition on IkB alpha degradation after activation of PBMCs: identification of the calpain cleavage sites. Neurochem Res 2004; 29:
1443-5 I.
Chetty A, Cao GJ, Nielsen He. Insulin-like growth factor-I signaling mechanisms, type I collagen and alpha smooth muscle actin in
human fetal lung fibroblasts. Pediatr Res 2006; 60: 389-94.
Kuhnel F, Zender L, Paul Y, Tietze MK, Trautwein C, Manns M, et
al. NFkappaB mediates apoptosis through transcriptional activation
of Fas (CD95) in adenoviral hepatitis. J Bioi Chern 2000; 275:
6421-7.

Baldwin AS Jr. The NF-kappa B and I kappa B proteins: new di;coveries and insights. Annu Rev Immunol1996; 14: 649-83.
Nishikawa T, Edelstein D, Du XL, Yamagishi S, Matsumura Kaneda Y, et al. Normalizing mitochondrial superoxide producti
blocks three pathways of hyperglycaemic damage. Nature 2000
404: 787-90.
Sheu ML, Ho FM, Yang RS, Chao KF, Lin WW, Lin-Shiau SY,
al. High glucose induces human endothelial cell apoptosis thro _
a phosphoinositide 3-kinase-regulated cyclooxygenase-2 pathwz;
Arterioscler Thromb Vasc BioI 2005; 25: 539-45.
Mohan S, Hamuro M, Koyoma K, Sorescu GP, Jo H, Natarajan . l
High glucose induced NF-kappaB DNA-binding activity in HAEC
is maintained under low shear stress but inhibited under high sh=
stress: role of nitric oxide. Atherosclerosis 2003; 171: 225-34.
Aljada A, Ghanim H, Saadeh R, Dandona P. Insulin inhibiNFkappaB and MCP-I expression in human aortic endothelia.
cells. J Clin Endocrinol Metab 2001; 86: 450-63.
Golovchenko I, Goalstone ML, Watson P, Brownlee M, Draznin B
Hyperinsulinemia enhances transcriptional activity of nuclear fa tor-kappaB induced by angiotensin II, hyperglycemia,
and advanced glycosylation end products in vascular smooth muscle cells.
Circ Res 2000; 87: 722-4.
Chae YM, Park KK, Magae J, Lee IS, Kim CH, Kim HC, el a~
Sp I-decoy oligodeoxynucleotide
inhibits high glucose-induced mesangial cell proliferation. Biochem Biophys Res Commun 200!
319: 550-5.
Fukuda H, Noguchi T, Iritani N. Transcriptional regulation of inS1..
lin receptor gene promoter in rat hepatocytes. Biochem Biophy:
Res Commun 2001; 280: 1274-8.
Fukuda H, Iritani N. Transcriptional regulation of leptin gene promoterinrat. FEBSLett 1999;455: 165-9.
Daniel S, Kim KH. Spl mediates glucose activation of the acetylCoA carboxylase promoter. J Bioi Chern 1996; 271: 1385-92.
Ammendola R, Mesuraca M, Russo T, Cimino F. The DNAbinding efficiency of Spl is affected by redox changes. Eur J Biochern 1994; 225: 483-9.
Schafer D, Hamm-Kunzelmann
B, Herrnfisse U, Brand K. Differences in DNA-binding efficiency of Sp I to aldolase and pyruva ~
kinase promoter correlate with altered redox states in resting ane
proliferating rat thymocytes. FEBS Lett 1996; 391: 35-8.
Xin X, Khan ZA, Chen S, Chakrabarti S. Glucose-induced AI..,:
activation mediates fibronectin synthesis in endothelial cells. Diabetologia 2005; 48: 2428-36.
Kouroedov A, Eto M, Joch H, Volpe M, Luscher TF, Cosentino F
Selective inhibition of protein kinase Cbeta2 prevents acute effec
of high glucose on vascular cell adhesion molecule-I expression human endothelial cells. Circulation 2004; 110: 91-6.
Chen S, Mukherjee S, Chakraborty C, Chakrabarti S. High gluco-~induced, endothelin-dependent
fibronectin synthesis is medial
via NF-kappa Band AP-l. Am J Physiol Cell Physiol 2003; 2
C263-72.
Matsunaga T, Hokari S, Koyama I, Harada T, Komoda T. 1\Tkappa B activation in endothelial cells treated with oxidized hig
density lipoprotein. Biochem Biophys Res Commun 2003; 30:'
313-9.
Chan EL, Murphy JT. Reactive oxygen species mediate endotoxIDinduced human dermal endothelial NF-kappaB activation. J SUl1"
Res 2003; III: 120-6.