NAL1 allele from a rice landrace greatly increases yield

in modern indica cultivars

Daisuke Fujitaa,b,c,1, Kurniawan Rudi Trijatmikoa,2, Analiza Grubanzo Taglea, Maria Veronica Sapasapa, Yohei Koidea,b,3,
Kazuhiro Sasakia,b, Nikolaos Tsakirpalogloua, Ritchel Bueno Gannabana, Takeshi Nishimurad, Seiji Yanagiharab,
Yoshimichi Fukutab, Tomokazu Koshibad, Inez Hortense Slamet-Loedina, Tsutomu Ishimarua,b,
and Nobuya Kobayashia,b,c,4
a
Plant Breeding, Genetics, and Biotechnology, International Rice Research Institute, Metro Manila, Philippines; bJapan International Research Center for
Agricultural Sciences, 1-1 Ohwashi, Tsukuba, Ibaraki 305-8686, Japan; cNational Agriculture and Food Research Organization, Institute of Crop Science, 2-1-18
Kannondai, Tsukuba, Ibaraki 305-8518, Japan; and dDepartment of Biological Sciences, Tokyo Metropolitan University, Hachioji, Tokyo 192-0397, Japan

Increasing crop production is essential for securing the future food

supply in developing countries in Asia and Africa as economies and
populations grow. However, although the Green Revolution led to
increased grain production in the 1960s, no major advances have
been made in increasing yield potential in rice since then. In this
study, we identied a gene, SPIKELET NUMBER (SPIKE), from a
tropical japonica rice landrace that enhances the grain productivity of indica cultivars through pleiotropic effects on plant architecture. Map-based cloning revealed that SPIKE was identical to
NARROW LEAF1 (NAL1), which has been reported to control vein
pattern in leaf. Phenotypic analyses of a near-isogenic line of a popular indica cultivar, IR64, and overexpressor lines revealed increases
in spikelet number, leaf size, root system, and the number of vascular bundles, indicating the enhancement of source size and
translocation capacity as well as sink size. The near-isogenic line
achieved 1336% yield increase without any negative effect on
grain appearance. Expression analysis revealed that the gene
was expressed in all cell types: panicles, leaves, roots, and culms
supporting the pleiotropic effects on plant architecture. Furthermore, SPIKE increased grain yield by 18% in the recently released
indica cultivar IRRI146, and increased spikelet number in the genetic background of other popular indica cultivars. The use of
SPIKE in rice breeding could contribute to food security in indica-growing regions such as South and Southeast Asia.
qTSN4

experiments (9, 13, 15). However, no novel cloned gene has been
reported to increase grain yield in indica cultivars (17). Here, we
identied a gene in a tropical japonica landrace and used the
allele to increase the grain yield of modern indica cultivars at
the crop level through a breeding concept developed by International Rice Research Institute (IRRI) breeders more than
20 y ago.
In 1989, a breeding program for New Plant Type (NPT) rice
was launched at IRRI to increase the yields of modern indica
cultivars by using genetic material from tropical japonica landraces (18). Several Indonesian tropical japonica landraces
which are characterized by large panicles, large leaves, a vigorous
root system, thick stems, and few unproductive tillershave
been used in international breeding programs. However, despite
these features, the NPT cultivars yield less than modern indica
cultivars, mainly because of low grain fertility and low panicle
number (19, 20). To genetically dissect and elicit the valuable
traits of NPT cultivars, we backcrossed the NPT cultivars including YP9 (IR68522-10-2-2) against modern indica cultivar
IR64 to develop introgression lines (ILs) (Fig. S1). BC3-derived
ILs, which had favorable yield-related traits and few undesirable
Signicance

| gene validation | pleiotropy | marker-assisted breeding

This work reports discovery of a unique gene important for rice

agriculture. A signicant yield enhancement in rice modern
cultivar was achieved by identication of a gene, SPIKELET
NUMBER (SPIKE) in Indonesian rice landrace. The SPIKE increased grain yield of an indica cultivar IR64, which is widely
grown in the tropics, over four seasons at the eld level and
improved plant architecture without changing grain quality or
growth period, which are important for regional adaptability.
These results indicate nding of SPIKE will be extremely valuable for contributing to increase grain production of indica
rice cultivars.

he worlds population is expected to surpass 9 billion in 2050

(http://esa.un.org/unpd/ppp/index.htm). Most of this increase
will occur in the developing countries of Asia and Africa. By
2035, a 26% increase in rice production will be essential to feed
the rising population (1, 2). Rice (Oryza sativa L.) is a staple food
of more than 3 billion people, mainly in Asia. Predominantly,
indica cultivars are grown in southern China, Southeast Asia, and
South Asia, occupying approximately 70% of the rice-producing
area in the world, whereas japonica cultivars are grown mainly in
East Asia (3, 4). Because of urbanization and industrialization,
an increase in the yield of indica cultivars is a pressing need in
Southeast and South Asia (5). Additionally, good grain quality
(inuencing market value) and high yield are essential for the
adoption of new cultivars in local areas (6).
The grain yield of rice is determined by spikelet number per
panicle, panicle number per plant, grain weight, and spikelet
fertility. Although many quantitative trait loci (QTLs) for yield
components have been identied (www.gramene.org), few have
so far been isolated. To date, at least nine genes or loci for yieldrelated traits in rice have been isolated from natural variation:
Gn1a and APO1 for number of grains (79); GS3, GW2, and
qSW5 for grain size (1012); DEP1 and WFP for panicle architecture (13, 14); SCM2 for strong culm (15); and Ghd7 for late
heading and number of grains (16). APO1, SCM2, and DEP1
increased grain yield in a japonica genetic background in eld
www.pnas.org/cgi/doi/10.1073/pnas.1310790110

Author contributions: D.F., Y.F., I.H.S.-L., T.I., and N.K. designed research; D.F., K.R.T., A.G.T.,
M.V.S., Y.K., K.S., N.T., R.B.G., S.Y., and T.I. performed research; T.N., T.K., and I.H.S.-L.
contributed new reagents/analytic tools; D.F., K.R.T., A.G.T., and I.H.S.-L. analyzed data;
and D.F., I.H.S.-L., T.I., and N.K. wrote the paper.
The authors declare no conict of interest.
*This Direct Submission article had a prearranged editor.
Freely available online through the PNAS open access option.
1

Present address: Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku,

Fukuoka 812-8581, Japan.

Present address: Indonesian Center for Agricultural Biotechnology and Genetic Resources Research and Development, Jl. Tentara Pelajar 3A, Bogor, West Java 16111,
Indonesia.

Present address: The Hakubi Center for Advanced Research/Graduate School of Agriculture, Kyoto University, Kitashirakawa, Sakyo-ku, Kyoto 606-8502, Japan.

To whom correspondence should be addressed. E-mail: nobuya@affrc.go.jp.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.

1073/pnas.1310790110/-/DCSupplemental.

PNAS | December 17, 2013 | vol. 110 | no. 51 | 2043120436

AGRICULTURAL
SCIENCES

Edited* by Gurdev S. Khush, University of California, Davis, CA, and approved November 4, 2013 (received for review June 11, 2013)

traits, were selected by eld observation (21). Using the ILs, we

identied 21 QTLs for yield components such as total spikelet
number per panicle (TSN), grain weight, and panicle number.
Among the QTLs, qTSN4, for high TSN, was commonly detected
on the long arm of chromosome 4 in ve NPT lines derived from
different tropical japonica cultivars (22). Additionally, a nearisogenic line (NIL) for qTSN4 from YP9, derived from tropical
japonica landrace Daringan with an IR64 genetic background,
had more spikelets per panicle and more branches than IR64.
In this study, we isolated the gene for qTSN4 through mapbased cloning to facilitate its use in breeding. The phenotypic
effects of the gene were validated in transgenic plants and by
expression analysis. To conrm the effect on practical grain yield
in the eld, we evaluated yield and related traits by using NILs
with genetic backgrounds of popular indica cultivars.

High-Resolution Linkage Mapping and Identication of SPIKE. To

identify a gene for SPIKE, we conducted high-resolution linkage
analysis by using 7,996 BC4F3 plants evaluated for TSN. The
candidate region lay between markers Ind4 and Ind12 (18.0
kbp), in which the Rice Genome Annotation Project database at
Michigan State University predicts three genes (Fig. 2A). In
addition to TSN, the suggested gene was associated with an increase in secondary branch number and leaf width (Fig. S3). Expression analysis in a young panicle revealed that only Os04g52479
(Nal1: NARROW LEAF 1; ref. 23) was expressed (Fig. S4) and,
thus, is the most probable candidate for SPIKE. Analysis of the
predicted amino acid sequence of SPIKE revealed three amino
acid substitutions between IR64 and NIL-SPIKE, one of them in
the trypsin-like serine and cysteine protease domain (Fig. S5).
Further, the SPIKE protein shows >84% identity with proteins of
Brachypodium, wheat, sorghum, and maize, and high similarity in
the trypsin-like serine and cysteine protease domain. This similarity suggests conservation of the biochemical function of the
SPIKE protein family among these species.

Results
Characterization of NIL-SPIKE. We characterized qTSN4, designated here as SPIKE, by using an NIL for SPIKE, NIL-SPIKE
(Fig. 1A). NIL-SPIKE had larger panicles (Fig. 1B), leaves (Fig.
1C), and panicle necks than IR64 (Fig. 1D). Among yieldrelated traits, it had higher TSN (Fig. 1E), ag leaf width (FLW;
Fig. 1F), root dry weight (RDW; Fig. 1G), and rate of lled
grain (Fig. S2A), but had lower panicle number per plant and 1,000grain weight (Fig. S2 B and C). Notably, along with the rate of lled
grain, the grain appearance was improved (Fig. 1H), presumably owing to a strengthening of assimilate supply to the
larger number of spikelets by an increase in vascular bundle
number (VBN; Fig. 1I). Consequently, the grain yield per m2
(GYS) of the NIL was consistently higher than that of IR64
over four cropping seasons, signicantly so in three of the four
seasons (Fig. 1J). The average GYS of the NIL was 28%
higher in the dry season and 24% higher in the wet season
than that of IR64 (400 g/m2). Therefore, the increase in
GYS in the NIL without a decline in grain appearance was
achieved through the enlargement of sink size (high TSN),
source size (broad FLW and high RDW), and translocation capacity (high VBN). Additionally, days-to-heading was unchanged
(Fig. S2D). Thus, SPIKE is highly useful for improving yield without changing locally adapted traits.

Expression Analysis of SPIKE. SPIKE was consistently expressed in

several organs (Fig. 2B). To analyze the expression of SPIKE during
plant development, we expressed the -glucuronidase (GUS) reporter gene under the control of the native SPIKE promoter in
transgenic IR64 plants. Histochemical analysis revealed GUS activity in the coleoptile, vascular bundle at the panicle neck and culm,
leaves (Fig. S6 AC), crown roots, lateral roots (Fig. 2C), and young
panicles (Fig. 2D). Aside from the coleoptile, the pattern of GUS
expression coincided with the organs enlarged in NIL-SPIKE.
Quantitative RT-PCR (qRT-PCR) revealed that the expression
of SPIKE in young panicles at various stages was consistently
higher in NIL-SPIKE than in IR64, and double that of IR64 at
the 21- to 50-mm stage (P = 0.05; Fig. 2E). The results suggest
that the increase in SPIKE expression at the young panicle
stage increased spikelet number.
Gene Validation of SPIKE Through Transgenic Analysis. To validate
our results and to gain insight into the function of SPIKE, we
generated overexpressor lines (using a constitutive promoter) and
silencing lines (using articial microRNA: amiRNA). A DNA
fragment containing the cDNA of SPIKE from NIL-SPIKE fused

D
IR64

***
Root dry weight (g)

1.6

150

1.2

100

0.8

50
0

0.4

IR64 NIL

12

IR64 NIL

**

10
8
6
4
2
0

IR64 NIL

14

I
Brown rice

12
10
8
6
4

**

2
0

IR64 NIL

IR64NIL

NIL-SPIKE

J
700

25
20

***

15
10
5
0

IR64 NIL

600

Grain yield (g/m2)

2.0

NIL-SPIKE

Number of vascular bundles

Flag leaf width (cm)

Spikelet number per panicle

200

IR64

Chalky
Normal

NIL-SPIKE

Rate of grain chalkiness (%)

IR64

36%
**

13%
n.s.

35%
**

20%
*

500
400
300
200
100
0

434 591 414 467 377 509 380 454

IR64 NIL IR64 NIL IR64 NIL IR64 NIL
2010DS 2010WS 2011WS 2012DS

Fig. 1. Characterization of yield-related traits of a NIL for SPIKE. (A) Plant morphologies. (B) Panicle structures. (C) Flag leaves. (D) Cross-sections of panicle
neck. (Scale bars: A, 20 cm; B, 10 cm; C, 5 cm; D, 500 m.) (EJ) Comparisons between IR64 and NIL-SPIKE of spikelet number per panicle (n = 8) (E), ag leaf
width (n = 9) (F), root dry weight at maturity (n = 10) (G), rate of chalkiness in brown rice (H), number of vascular bundles in panicle neck (n = 20) (I), and grain
weight per m2 among two dry (DS) and wet seasons (WS) (J). Percentages above bars in J are yield increases of the NIL relative to IR64. Values are means, with
whiskers showing SD. (SEM in J). Signicant at ***0.1%; **1%; *5%; n.s., not signicant.

20432 | www.pnas.org/cgi/doi/10.1073/pnas.1310790110

Fujita et al.

RM3423 AGT3

RM6909

220 kbp

n=7996

2 mm 6 mm 14 mm

E 2.5

Crown roots

Ind4 Ind12 RM17486 RM17487 AGT3

RM3423
10

10

12

18 kbp

ATG

Root

SPIKE
Ubiquitin

Relative expression of SPIKE

RM5503

Os04g52479

SPIKE

Lateral roots

TGA

Young panicle

IR64
NIL
IR64
NIL
IR64
NIL
IR64
NIL

4L

Leaf
sheath

CEN
4S

Leaf

SPIKE

Culm

Os04g52500
Os04g52504

Lateral roots

n.s.

>21 mm

Young panicle
n.s.
n.s.

2.0
1.5
1.0
0.5
0
IR64NIL IR64NILIR64NIL IR64 NIL

Enhancing Grain Yield in indica Cultivars Through SPIKE. To evaluate

the efcacy of SPIKE at increasing yield in different genetic
backgrounds, we introgressed it into a high-yielding indica cultivar, IRRI146 (released as NSIC Rc158 in the Philippines)
(24). Recurrent backcrossing to IRRI146 and marker-assisted
selection (MAS) produced the IRRI146-SPIKE NIL (Fig. 4 A
and B). Because IRRI146-SPIKE has 98% genetic identity to
IRRI146, the pleiotropic effects of SPIKE in IRRI146 were
similar to those in NIL-SPIKE. GYS, TSN, and FLW of IRRI146SPIKE were signicantly higher than those of IRRI146 (Fig. 4 C

NIL-SPIKE

Multi-copies
Ubi:SPIKE

amiRNA1

IR64

NIL-SPIKE

Multi-copies
Ubi:SPIKE

amiRNA1

D
c

250
200

150
100
50
161

0 IR64

G
100

177

210

Ubi:SPIKE
Single Multi

80
60

40

20
87
0 NIL

40

19

2.5
Flag leaf width (cm)

IR64

C
Spikelet number per panicle

Spikelet number per panicle

nal1 (loss-of-function) mutant Fn188 similarly showed reduced

TSN and FLW relative to its wild type, Taichung 65 (Fig. S8).
These results demonstrate that SPIKE (allele of Nal1 from tropical
japonica) enlarges the panicle and ag leaf in correspondence with
expression. Although Nal1 was reported to relate to auxin polar
transport (23), we observed no differences in indoleacetic acid (IAA)
biosynthesis or transport between IR64 and NIL-SPIKE (Fig. S9).

2.0

1.5
1.0
0.5

1.7 1.8 2.2

0 IR64
Ubi:SPIKE

Single Multi

H
Flag leaf width (cm)

with the ubiquitin promoter (Ubi:SPIKE) was introduced into IR64

by transformation. The overexpressor transgenic plants showed
a similar phenotype to NIL-SPIKE, including large panicles and
broad ag leaves (Fig. 3 A and B). Plants carrying a single copy had
signicantly greater TSN and FLW than IR64 (Fig. 3 C and D).
Plants carrying multiple copies had signicantly greater TSN and
FLW than those with a single copy, suggesting increasing TSN and
FLW along with expression of SPIKE. A signicant higher transcript in the event carrying multiple copies of SPIKE cDNA was
observed (Fig. S7A). This result suggests the gene dosage effect of
SPIKE on the plant phenotype. Concomitantly, TSN and FLW of
T0 Ubi:SPIKE plants increased with copy number (Fig. S7 CE).
In contrast, transformation of two amiRNA precursors that
targeted the rst (amiRNA1) and fourth exons (amiRNA4) of
SPIKE into NIL-SPIKE to down-regulate SPIKE (Fig. 3 E and F
and Fig. S7B) produced transgenic plants with signicantly lower
TSN and narrower leaves than NIL-SPIKE (Fig. 3 G and H). The

1.6

a
b

1.2
0.8
0.4
1.5 0.9
0 NIL

1.1

Fig. 3. Transgenic analysis for SPIKE through overexpression and gene silencing. (A) Morphologies of IR64 plant and Ubi:SPIKE plant in which SPIKE is
overexpressed by the ubiquitin promoter. (B) Panicle structures of IR64 and Ubi:SPIKE. Spikelet number per panicle (C) and ag leaf width (D) of IR64 (n = 17)
and Ubi:SPIKE plants carrying a single copy (n = 20) and ve copies (n = 13). (E) Morphologies of NIL-SPIKE plant and transgenic plant in which SPIKE is
silenced by amiRNA. (F) Panicle structures of NIL-SPIKE and transgenic plants. Spikelet number per panicle (G) and ag leaf width (H) of NIL-SPIKE (n = 5) and
of amiRNA1 (n = 4) and amiRNA4 transgenic plants (n = 3). Values are means, with whiskers showing SD. Results of TukeyKramer test for multiple comparisons at the 5% level are shown in C, D, G, and H. (Scale bars: A and E, 20 cm; B and F, 5 cm.) Means labeled with different letters (a, b, c) differ signicantly.

Fujita et al.

PNAS | December 17, 2013 | vol. 110 | no. 51 | 20433

AGRICULTURAL
SCIENCES

Fig. 2. Map-based cloning and expression analysis of SPIKE. (A) A high-resolution map narrowed the SPIKE locus to an 18.0-kbp region between Ind4 and
Ind12. The candidate gene is indicated in red. The squares indicate an artifact of gene model prediction. Numbers below the map show the number of
recombinants. (B) Semiquantitative expression analysis of SPIKE in culm, leaf, leaf sheath, and root of IR64 and NIL-SPIKE (NIL). (C and D) Production of GUS
driven by the NIL-SPIKE promoter in cross-sections of crown roots and lateral roots (C) and young panicles (D). (Scale bars: C, 50 m; D, 2 mm.) (E) Quantitative
expression analysis of SPIKE in 3- to 5-, 6- to 10-, 11- to 20-, and 21- to 50-mm stages of young panicle of IR64 and NIL-SPIKE. Expression is calibrated to the
3- to 5-mm panicle stage of IR64. Values are means of three replications, with whiskers showing SEM. Signicant at *5%; n.s., not signicant.

1 2 3 4 5 6 7 8 9 101112

1 2 3 4 5 6 7 8 9 101112 1 2 3 4 5 6 7 8 9 101112

F
Popular cultivars in Southeast Asia
PSBRc18 (Philippines), TDK1 (Laos), Ciherang (Indonesia)

200

150

PSBRc18

TDK1
TDK1
-SPIKE

P=0.0002

***

200

150
100

50
0

250

Spikelet number

100

0.4

50
0

BR11
BR11
-SPIKE

250

150

0.8

50

Popular cultivars in South Asia

Swarna (India), BR11 (Bangladesh)

200

1.2

***

100

P=0.0224

***

1.6

P=0.0002

150

50

Swarna
Swarna
-SPIKE

50

PSBRc18
-SPIKE

50

250
200

100

Spikelet number

100

E2.0

IRRI146

565
IRRI146SPIKE

200
100 479
0

150

IRRI146-SPIKE

IRRI146SPIKE

400
300

200

IRRI146

500

***

IRRI146SPIKE

600

D250
Spikelet number per panicle

IRRI146

Grain yield (g/m2)

C700

IRRI146

Flag leaf width (cm)

New plant type YP4

150

100

P=0.0462

Ciherang
-SPIKE

200

250

Ciherang

Spikelet number

P=0.0184

Spikelet number

250

SPIKE

IRRI146
YP4

Spikelet number

SPIKE

Fig. 4. SPIKE increases grain yield in indica genetic background. (A and B) Gene location (blue ellipses) and plant morphology of New Plant Type cultivar YP4
(A) and IRRI146 and IRRI146-SPIKE (B). (Scale bars: 20 cm.) (CE) Comparison between IRRI146 and IRRI146-SPIKE of grain weight per m2 (C), spikelet number
per panicle (D), and ag leaf width (E) (n = 10). (F) Comparison of spikelet number per panicle between indica cultivars with and without SPIKEPSBRc18
(from Philippines, n = 10), TDK1 (from Laos, n = 10), Ciherang (from Indonesia, n = 13), Swarna (from India, n = 17), and BR11 (from Bangladesh, n = 27)
characterized in the eld at IRRI, Philippines. Values are means, with whiskers showing SE. Signicant at ***0.1%; **1%; *5%.

E). SPIKE from YP9 was similarly introduced into ve popular

indica cultivars with different genetic and geographic backgrounds.
Its effects were conrmed on the different genetic background of
popular indica cultivars: PSBRc18 (IR51672-62-2-1-1-2-3) from
Philippines, Ciherang from Indonesia, TDK1 from Laos, BR11
from Bangladesh, and Swarna from India. The plants homozygous for SPIKE had signicantly higher TSN (Fig. 4F) than the
recurrent parent.
Discussion
During the last decade, many genes for yield-related traits in rice
have been isolated on the basis of genome sequence information.
Such genes associated with enlarging sink size have been identied by evaluating yield-related traits such as spikelet number,
panicle branch number, and grain weight (716). However, grain
yield is a complex trait controlled by many genetic factors related
to yield components (25, 26). It has been unclear whether a single gene could increase grain yield in the genetic backgrounds of
different elite cultivars, and no genes have been reported to increase grain yield of indica rice at the crop level in the eld (17).
To exploit genes for complex traits, trait-specic ILs that have
been developed through backcross breeding with phenotypic
selection offer a powerful approach (27). In our previous study,
genetic factors underlying grain yield were effectively detected by
using trait-specic ILs with an IR64 genetic background in a new
approach that combines breeding selection with genetic analysis
(21). The 334 ILs with high yield potential had been selected
from backcrossed populations and had a few segments introgressed from NPT sources. Through selection of backcrossed
progeny based on eld observation, we eliminated unfavorable
agronomic traits such as low panicle number and low grain fertility inherited from the NPT sources. The selected ILs, which
had large numbers of favorable genes for grain productivity,
tended to have higher grain yields than IR64. Approximately
29% of the ILs had SPIKE, suggesting that NPT SPIKE is a major
factor for increasing grain yield among the ILs (21). Additionally,
20434 | www.pnas.org/cgi/doi/10.1073/pnas.1310790110

NIL-SPIKE, which was developed from IL YTH326, stably increased grain yield in the IR64 genetic background at the crop
level in the eld. This approach opens the way to efciently identifying genes that increase grain yield.
SPIKE had pleiotropic effects on several traits, increasing
TSN, FLW, RDW, panicle neck diameter, and VBN, but decreasing the 1,000-grain weight and panicle number. Among
components of sink size, SPIKE notably increased secondary
panicle branches as well as Gn1a (7). The consequent increase
in spikelets on secondary branches usually increases competition for assimilate supply, resulting in abortion (28, 29). To
our surprise, however, the grain fertility of NIL-SPIKE was improved compared with that of IR64. This improvement might be
explained by increased VBN contributing to assimilate supply to
spikelets on the secondary branches. NPT breeding aims at an
ideal plant architecture characterized by fewer, larger panicles
and large leaves (18). These morphological effects of SPIKE were
mostly corresponding to ideal plant architecture in NPT breeding.
The introduction of SPIKE into indica elite cultivars gave the
desired morphological effects. This study reports a gene that
increases grain yield of indica rice through enlarging sink size,
source size, and translocation capacity.
Many QTLs for morphological traits, including leaf size, spikelet
number, panicle number, and root volume, occur in a cluster on
the long arm of chromosome 4 (http://qtaro.abr.affrc.go.jp). In this
region, where SPIKE was identied, several QTLs for TSN have
been detected, among which the alleles from japonica or tropical
japonica cultivars increased TSN (3038). Hitherto, no gene for
TSN or grain yield in this cluster has been isolated (39). Through
high-resolution mapping, we identied SPIKE, which inuences
TSN and FLW. Transgenic analysis revealed that SPIKE was
identical to Nal1, which affects vein patterning in leaves and
polar auxin transport (23). SPIKE, identied from natural variation, is a unique allele from tropical japonica, whereas nal1,
identied from a mutant line, is a loss-of-function mutation. The
nal1 mutant was reduced in TSN compared with wild type, whereas
Fujita et al.

Materials and Methods

Plant Materials. Through backcross breeding, we developed 334 BC3-derived
ILs, which have variation in agronomic traits inherited from NPT cultivars, in
the genetic background of indica cultivar IR64 (21). We selected an IL with
high TSN: YTH326 (IR84640-11-110-6-4-2-2-4-2-2-3-B), derived from NPT
cultivar YP9 (IR68522-10-2-2), which was derived from a cross between
indica cultivar Shennung 89-366 and tropical japonica landrace Daringan (Fig.
S1). Using a BC4F2 population derived from a cross between IR64 and YTH326,
we identied qTSN4, for high TSN, between SSR markers RM3423 and
RM17492 on the long arm of chromosome 4 (22). NIL-SPIKE was developed by
self-pollination of a plant selected from the BC4F2 population and was used
for evaluating agronomic traits, transformation, and expression.
Line Fn188, carrying nal1, was provided by Kyushu University under the
National Bioresource Project (www.nbrp.jp). Fn188 had been developed
from BC3 progeny derived from a cross between an nal1 mutant as the
donor parent and japonica cultivar Taichung 65 as the recurrent parent. The
nal1 locus has been mapped between markers C1100 and C600 on the long
arm of chromosome 4 (41). Fn188 was used for agronomic characterization
to compare with the effects of SPIKE, because we considered Nal1 to be
same to SPIKE.
Development of IRRI146-SPIKE. A high-yielding indica cultivar, IRRI146
(IR77186-122-2-2-3), has been released as NSIC Rc158 in the Philippines
(24). Progeny of a cross between NPT IR65564-22-2-3 from tropical japonica
Bali Ontjer and IRRI146 were backcrossed to IRRI146 three times. In each
generation, MAS was conducted by using SPIKE-anking markers RM5503
and RM6909. A whole-genome survey of 96 BC3F1 plants using 116 polymorphic SSR markers that covered all chromosomes was conducted. One
BC3F1 plant was selected and self-pollinated to develop a NIL for SPIKE in the
IRRI146 genetic background. This IRRI146-SPIKE was compared with the recurrent parent for agronomic traits and grain yield.
Development of indica Cultivars with SPIKE. SPIKE was introgressed into ve
popular cultivars through backcrossing and MAS: PSBRc18 (IR51672-62-2-1-12-3) (Philippines), Ciherang (Indonesia), TDK1 (Laos), BR11 (Bangladesh), and
Swarna (India) (24). Progeny of the cross between YP9 and each cultivar
were backcrossed to the popular cultivar twice. In each generation, MAS was
conducted by using the SPIKE-anking markers Ind2 and RM17487. Plants
homozygous for SPIKE were selected from each BC2F2 population and
evaluated for TSN in a eld at IRRI.
Phenotypic Evaluation of SPIKE. All plants were grown in a eld at IRRI, Los
Baos, Laguna, the Philippines, and evaluated for 1,000-grain weight, PN,
FLW, and TSN at maturity as described (21). The panicle rachis was sectioned

Fujita et al.

at 1 cm below the neck, and VBN were counted under a stereomicroscope.

RDW of plants that were grown in pots was measured at maturity.
To evaluate grain yield, we grew IR64, NIL-SPIKE, IRRI146, and IRRI146SPIKE in a randomized plot with four replications per line. The area of each
plot was at least 4.8 m2; three plants were transplanted per hill at 21 d after
sowing at 20 cm between hills and 25 cm between rows. As a basal dressing,
30 kg/ha each of N, P, and K were applied the day before transplanting, and
30 kg/ha of N was applied twice as a topdressing at 2 and 4 wk after
transplanting. At maturity, 1.0 m2 of rice plants (20 hills in each plot) was
harvested, and plants were dried in an oven at 70 C for 5 d. GYS was calculated on a 14% moisture content basis. Grain chalkiness was evaluated
with a Grain Inspector (Cervitec 1625 Grain Inspector, FOSS Analytical) with
four replications per line.
High-Resolution Linkage Map. The genomic DNA of 7996 BC4F3 plants generated from BC4F2 plants heterozygous for SPIKE was extracted from fresh
leaves by a simple method. The genomic DNA of 1,073 BC4F3 plants with
recombination between anking markers RM17450 and RM3836 was individually extracted from freeze-dried leaves by the cetyl trimethylammonium bromide method. Selected 41 BC 4F3 plants that occurred with
recombination between RM3423 and AGT3 were self-pollinated to generate
BC4F4 lines to be used for a progeny test. Among the BC4F4 lines, homozygous
plants from representative recombinants were selected and evaluated for
TSN and FLW. Twenty-two DNA markers were used for map construction
(Table S1).
Transformation of SPIKE. A fragment encompassing the full-length coding
region of SPIKE was amplied from cDNA derived from young panicles of
NIL-SPIKE by using primer pair 8M17-c1. The fragment was ligated into the
binary vector pCAMBIA1300int-prUbi1-tNOS (provided by Emmanuel Guiderdoni, Centre de Coopration Internationale en Recherche Agronomique pour
le Dveloppement, Montpellier, France) between the maize ubiquitin promoter and the nopaline synthase terminator to generate the overexpression
vector. Using Agrobacterium-mediated transformation, we introduced the
vector into IR64 (42). The regenerated plants were evaluated for transgene
copy numbers by Southern blot analysis. For gene silencing of SPIKE, the
amiRNA approach was used (43). Two 21-bp amiRNA sequencesamiRNA1
(TATAAGAAGTATGCTGCGCTA, for the rst exon of SPIKE) and amiRNA4
(TTAATATCAAGTTCCAGACGC, for the fourth exon)were designed by using
Web MicroRNA Designer 3 software (http://wmd3.weigelworld.org/cgi-bin/
webapp.cgi). The amiRNA precursors were generated through site-directed
mutagenesis by using overlapping PCR (Table S1) with plasmid pNW55 as
a template, as described (43). The precursors were ligated into the binary
vector pCAMBIA1300int-prUbi1-tNOS to generate the silencing vectors. Using
Agrobacterium-mediated transformation, we introduced the vectors into NILSPIKE (42). The transgenic plants (T0) were transplanted into pots, and T1 plants
were transplanted in a screenhouse at 20 cm between hills and 30 cm between
rows. These plants were evaluated for TSN and FLW.
To generate the promoter:GUS vector, we amplied a 1,918-bp fragment
upstream from the ATG codon of SPIKE by using primer pair UP6-1. The
amplied fragment was ligated into the binary vector pCAMBIA0380
(Cambia) upstream of the GUS reporter gene. This vector was introduced
into IR64 by Agrobacterium-mediated transformation (42). Organs of the
regenerated plants were sampled to analyze GUS activity as described (44).
Expression Analysis and IAA Transport. Total RNA from each organ was
extracted by using an RNeasy Plant Mini Kit (Qiagen). To identify a candidate
gene for SPIKE, we performed RT-PCR by using 1 g of total RNA. PCR was
performed by using 1 L of cDNA with the gene-specic primers for each
candidate (Table S1). For comparison of expression in different organs, total
RNA of young panicle, culm, leaf sheath, leaf, and root was extracted at the
panicle initiation stage. RT-PCR was performed with 500 ng of total RNA by
using primer pair seq8M17-56 and a ReverTra Ace qPCR RT Kit (Toyobo).
qRT-PCR reactions were carried out with one-fth cDNA mixtures by using
primer pair seq8M17-56 with LightCycler 480 SYBR Green I Master Mix on
a LightCycler 480 System (Roche Applied Science). The data were normalized
to the expression of a house hold gene, Ubiquitin (Os01g22490).
The rate of IAA biosynthesis in IR64 and NIL-SPIKE coleoptiles was investigated by measuring the amount of IAA that was transported from cut
coleoptiles to an agar block (described in Fig. S9) by gas chromatography
selected ion monitoringmass spectroscopy (GC-SIM-MS) as described (45,
46). To investigate polar IAA transport in IR64 and NIL-SPIKE coleoptiles, we
applied 3 M IAA to the top of coleoptile sections (1.53.0 mm) for 30 min,
then incubated the coleoptiles on an agar block for 10 min and measured
the transported IAA by GC-SIM-MS as above.

PNAS | December 17, 2013 | vol. 110 | no. 51 | 20435

AGRICULTURAL
SCIENCES

the unique allele from tropical japonica in Nal1 showed increased

TSN. The fact suggested that the activity of auxin transport at
panicle initiation stage might be related to TSN. Through increase
in TSN, the grain yield of NIL-SPIKE was increased as a consequence. Therefore, SPIKE was a unique isolated allele for grain
productivity from natural variation and located on the QTL cluster
region of chromosome 4.
The effect of a gene is generally inuenced by both the genetic
background and the environment. To understand the effect of
SPIKE in different genetic backgrounds, we introduced it into ve
indica cultivars popular in South and Southeast Asian countries
and some of them (Swarna, BR11, PSBRc18, and Ciherang) are
grown in millions hectares (24, 40). The improvement of grain
yield of these cultivars is an important breeding objective in this
region. SPIKE increased TSN in all of these cultivars, conrming
its effectiveness in various genetic backgrounds. Additionally,
SPIKE would increase grain yield in all popular cultivars because
at least TSN in these popular cultivars were increased by SPIKE.
To conrm effects of SPIKE in the broad area, multienvironment
trials using NIL-SPIKE are ongoing in the Philippines, Laos,
Indonesia, and subtropical Japan. In future study, the breeding
lines with SPIKE needs to be characterized at different locations
and management levels for understanding increase of yield potential in eld. SPIKE would increase grain yields of further indica
cultivars in South and Southeast Asia through MAS breeding, thus
contributing to food security in these regions.

ACKNOWLEDGMENTS. We thank Drs. A. Dobermann, H. Leung, E. Nissil,

B. Hardy, S. Heuer, D. S. Brar, and G. S. Khush for support and suggestions; seeds of the nal1 mutant (Fn188) were provided by Dr. A. Yoshimura;
and we thank Drs. M. Ashikari, M. Obara, Y. Yamagata, Y. Kato, and
M. J. Telebanco-Yanoria for their suggestions and encouragement. This

paper reports the results obtained in an IRRIJapan Collaborative Research Project supported by the Ministry of Foreign Affairs and the Ministry of Agriculture, Forestry, and Fisheries of Japan. The work was
supported by Japan Society for the Promotion of Science Fellows Grantin-Aid 23-7274.

1. Cassman KG, Dobermann A, Walters DT, Yang H (2003) Meeting cereal demand while
protecting natural resources and improving environmental quality. Annu Rev Environ
Resour 28:315358.
2. Seck PA, Diagne A, Mohanty S, Wopereis MCS (2012) Crops that feed the world 7:
Rice. Food Secur 4(1):724.
3. Zhao K, et al. (2011) Genome-wide association mapping reveals a rich genetic architecture of complex traits in Oryza sativa. Nat Commun 2:467.
4. Huang X, et al. (2012) A map of rice genome variation reveals the origin of cultivated
rice. Nature 490(7421):497501.
5. Zeigler RS, Barclay A (2008) The relevance of rice. Rice 1(1):310.
6. Fitzgerald MA, McCouch SR, Hall RD (2009) Not just a grain of rice: The quest for
quality. Trends Plant Sci 14(3):133139.
7. Ashikari M, et al. (2005) Cytokinin oxidase regulates rice grain production. Science
309(5735):741745.
8. Ikeda-Kawakatsu K, et al. (2009) Expression level of ABERRANT PANICLE ORGANIZATION1
determines rice inorescence form through control of cell proliferation in the meristem.
Plant Physiol 150(2):736747.
9. Terao T, Nagata K, Morino K, Hirose T (2010) A gene controlling the number of primary rachis branches also controls the vascular bundle formation and hence is responsible to increase the harvest index and grain yield in rice. Theor Appl Genet
120(5):875893.
10. Fan C, et al. (2006) GS3, a major QTL for grain length and weight and minor QTL for
grain width and thickness in rice, encodes a putative transmembrane protein. Theor
Appl Genet 112(6):11641171.
11. Song XJ, Huang W, Shi M, Zhu MZ, Lin HX (2007) A QTL for rice grain width and
weight encodes a previously unknown RING-type E3 ubiquitin ligase. Nat Genet 39(5):
623630.
12. Shomura A, et al. (2008) Deletion in a gene associated with grain size increased yields
during rice domestication. Nat Genet 40(8):10231028.
13. Huang X, et al. (2009) Natural variation at the DEP1 locus enhances grain yield in rice.
Nat Genet 41(4):494497.
14. Miura K, et al. (2010) OsSPL14 promotes panicle branching and higher grain productivity in rice. Nat Genet 42(6):545549.
15. Ookawa T, et al. (2010) New approach for rice improvement using a pleiotropic QTL
gene for lodging resistance and yield. Nat Commun 1:132.
16. Xue W, et al. (2008) Natural variation in Ghd7 is an important regulator of heading
date and yield potential in rice. Nat Genet 40(6):761767.
17. Miura K, Ashikari M, Matsuoka M (2011) The role of QTLs in the breeding of highyielding rice. Trends Plant Sci 16(6):319326.
18. Khush GS (1995) Breaking the yield frontier of rice. GeoJournal 35(3):329332.
19. Peng S, Cassman KG, Virmani SS, Sheehy J, Khush GS (1999) Yield potential trends of
tropical rice since the release of IR8 and the challenge of increasing rice yield potential. Crop Sci 39(6):15521559.
20. Peng S, Khush GS, Virk P, Tang Q, Zou Y (2008) Progress in ideotype breeding to
increase rice yield potential. Field Crops Res 108(1):3238.
21. Fujita D, et al. (2009) Development of introgression lines of an indica-type rice variety,
IR64, for unique agronomic traits and detection of the responsible chromosomal
regions. Field Crops Res 114(2):244254.
22. Fujita D, Tagle AG, Ebron LA, Fukuta Y, Kobayashi N (2012) Characterization of nearisogenic lines carrying QTL for high spikelet number with the genetic background of
an indica rice variety IR64 (Oryza sativa L.). Breed Sci 62(1):1826.
23. Qi J, et al. (2008) Mutation of the rice Narrow leaf1 gene, which encodes a novel
protein, affects vein patterning and polar auxin transport. Plant Physiol 147(4):
19471959.
24. Brennan JP, Malabayabas A (2011) Impacts of IRRI germplasm on the Philippines
since 1985. International Rice Research Institutes Contribution to Rice Varietal Yield

Improvement in South-East Asia. ACIAR Impact Assessment Series Report No. 74 (Aust
Cent Intl Agric Res, Canberra, Australia), pp 2543.
Septiningsih EM, et al. (2003) Identication of quantitative trait loci for yield and
yield components in an advanced backcross population derived from the Oryza sativa
variety IR64 and the wild relative O. rupogon. Theor Appl Genet 107(8):14191432.
Thomson MJ, et al. (2003) Mapping quantitative trait loci for yield, yield components
and morphological traits in an advanced backcross population between Oryza rupogon and the Oryza sativa cultivar Jefferson. Theor Appl Genet 107(3):479493.
Zhang H, et al. (2013) Simultaneous improvement and genetic dissection of grain
yield and its related traits in a backbone parent of hybrid rice (Oryza sativa L.) using
selective introgression. Mol Breed 31(1):181194.
Ishimaru T, Matsuda T, Ohsugi R, Yamagishi T (2003) Morphological development of
rice caryopses located at the different positions in a panicle from early to middle
stage of grain lling. Funct Plant Biol 30(11):11391149.
Lisle AJ, Martin M, Fitzgerald MA (2000) Chalky and translucent rice grains differ in
starch composition and structure and cooking properties. Am Assoc Cereal Chem
77(5):627632.
Wu P, Zhang G, Huang N (1996) Identication of QTLs controlling quantitative
characters in rice using RFLP markers. Euphytica 89(3):349354.
Li Z, Pinson SRM, Park WD, Paterson AH, Stansel JW (1997) Epistasis for three grain
yield components in rice (Oryza sativa L.). Genetics 145(2):453465.
He P, et al. (2001) Comparison of molecular linkage maps and agronomic trait loci
between DH and RIL populations derived from the same rice cross. Crop Sci 41(4):
12401246.
Latte HR, Courtois B, Arraudeau M (2002) Genetic improvement of rice in aerobic
systems: Progress from yield to genes. Field Crops Res 75(2-3):171190.
Hittalmani S, et al. (2003) Identication of QTL for growth- and grain yield-related
traits in rice across nine locations of Asia. Theor Appl Genet 107(4):679690.
Yamagishi J, Miyamoto N, Hirotsu S, Laza RC, Nemoto K (2004) QTLs for branching,
oret formation, and pre-owering oret abortion of rice panicle in a temperate
japonica x tropical japonica cross. Theor Appl Genet 109(8):15551561.
Takai T, Fukuta Y, Shiraiwa T, Horie T (2005) Time-related mapping of quantitative
trait loci controlling grain-lling in rice (Oryza sativa L.). J Exp Bot 56(418):21072118.
Zou GH, et al. (2005) Grain yield responses to moisture regimes in a rice population:
Association among traits and genetic markers. Theor Appl Genet 112(1):106113.
Ding X, Li X, Xiong L (2011) Evaluation of near-isogenic lines for drought resistance
QTL and ne mapping of a locus affecting ag leaf width, spikelet number, and root
volume in rice. Theor Appl Genet 123(5):815826.
Yonemaru J, et al. (2010) Q-TARO: QTL annotation rice online database. Rice 3(2-3):
194203.
Singh US, et al. (2013) Field performance, dissemination, impact and tracking of
submergence tolerant (Sub1) rice varieties in South Asia. SABRAO J 45(1):112131.
Yoshimura A, Ideta O, Iwata N (1997) Linkage map of phenotype and RFLP markers in
rice. Plant Mol Biol 35(1-2):4960.
Hiei Y, Komari T (2006) Improved protocols for transformation of indica rice mediated
by Agrobacterium tumefaciens. Plant Cell Tiss Org 85(3):271283.
Warthmann N, Chen H, Ossowski S, Weigel D, Herv P (2008) Highly specic gene
silencing by articial miRNAs in rice. PLoS ONE 3(3):e1829.
Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: -glucuronidase as
a sensitive and versatile gene fusion marker in higher plants. EMBO J 6(13):
39013907.
Mori Y, Nishimura T, Koshiba T (2005) Vigorous synthesis of indole-3-acetic acid in the
apical very tip leads to a constant basipetal ow of the hormone in maize coleoptiles.
Plant Sci 168(2):467473.
Nishimura T, Mori Y, Furukawa T, Kadota A, Koshiba T (2006) Red light causes a reduction in IAA levels at the apical tip by inhibiting de novo biosynthesis from tryptophan in maize coleoptiles. Planta 224(6):14271435.

20436 | www.pnas.org/cgi/doi/10.1073/pnas.1310790110

25.

26.

27.

28.

29.

30.
31.
32.

33.
34.
35.

36.
37.
38.

39.
40.
41.
42.
43.
44.

45.

46.

Fujita et al.