Sie sind auf Seite 1von 9

BCHS 4306

Exam #1
September 24, 2009
This exam consists of 33 questions worth a total of 99 points and 2 bonus questions
(34 and 35).
All questions are multiple-choice. Each question has only ONE answer so choose
the best answer.
There are a total of 9 pages in this exam.
Make sure you bubble in your PEOPLESOFT ID number AND name on your scantron.
Your exam score will be linked to the last 4-digits of the number you bubble in.
Good luck!
Name_________________________
Peoplesoft ID#_____________________

Corrections
Question 17 convert all Us to Ts
Question 14 has two correct answers
18. Which of the following relationships show negative regulation?
a. Lactose and Lac repressor (I)
b. cAMP and CAT - CAP
c. AraC protein and AraI in the Arabinose operon
d. a and b
e. a and c
26. Which of the following is TRUE about catabolite repression?
a. functions to increase the expression of metabolic genes when glucose is absent
b. needs AMP - cAMP
c. the ATP to AMP (cAMP) conversion is inhibited by glucose
d. needs CAP
e. all of the above

1. Which of the following is NOT a difference between DNA and RNA?


a. Thymine vs. Uracil
b. Sugar is deoxyribose vs. ribose
c. 2-OH
d. 3-OH
e. Double stranded vs. single stranded
Answer: d
2. Which of the following if FALSE about the 3-OH group?
a. is found at the growing end of DNA
b. is found at the growing end of RNA
c. is where the splice donor site joins the branch site
d. is found on ribonucleotide triphosphates (rNTPs)
e. is found on deoxyribonucleotide triphosphates (dNTPs)
Answer: c
3. Which of the following is NOT COMMON to DNA Pol III and DNA Pol I?
a. needed for the accurate synthesis of the leading strand.
b. needed for the accurate synthesis of the lagging strand.
c. 3-5 exonuclease activity
d. Polymerizes dNTPs
e. 5-3 exonuclease activity
Answer: e
4. OKAZAKI fragments are associated with?
a. the lagging strand
b. the leading strand
c. intron splicing
d. epigenetic modifcation
e. transcription
Answer: a
5. Which of the following is FALSE about the LEADING strand associated with DNA
replication?
a. undergoes continuous synthesis
b. undergoes discontinuous synthesis
c. needs DNA Ligase to connect the fragments
d. is synthesized in the 5 to 3 direction
e. starts off with an RNA primer
Answer: b
6. Which of the following does NOT need an RNA primer?
a. Replication of the leading strand
b. Telomere lengthening
c. Transcription
d. a and b

e. b and c
Answer: c
7. Which of the following is NOT an error free repair system?
a. Double stranded break followed by non-homologous end joining
b. Double stranded break followed by homologous recombination
c. Nucleotide excision repair
d. Base excision repair
e. Mismatch repair
Answer: a
8. Shown below is a double stranded DNA region that needs to be repaired.
CGATTGCC_ ATTGGCACAGT
GCTAACGGGTAACCGTGTCA
Which of the following is FALSE?
a. The mutation created an apyrimidinic site
b. The mutation created an apurinic site
c. The mutation will be repaired through base excision repair
d. The repair needs AP endonuclease
e. The repair needs DNA polymerase and ligase
Answer: b
9. Which of the following is NOT a difference between replication and transcription?
a. Needs a primed template strand to initiate synthesis
b. Needs a polymerase to catalyze the reaction
c. Unravels the entire DNA molecule
d. Unravels only a part of the DNA molecule to make a bubble
e. All of the above
Answer: b
10. Which of the following is NOT associated with directing RNA polymerases to the
promoter for transcription initiation?
a. needs TATA-box
b. TATA binding factor TFIID
c. snRNA
d. subunit of RNA polymerase holoenzyme
e. TATA binding factor TFIIB
Answer: c
11. Which of the following is not a modification associated with RNA processing?
a. 3 polyadenylation
b. 5 capping
c. intron splicing
d. 7-methyl guanosine cap
e. epigenetic silencing
Answer: e

12. Which of these is NOT associated with eukaryotic RNA splicing?


a. 5-GU splice donor site in intron
b. 2-OH on branch point
c. DNA ligase
d. 3 -AG acceptor site in intron
e. Lariat intermediate
Answer: c
13. Which of the following is TRUE about rho-dependent transcription termination?
a. needs an operator and a repressor
b. needs to form a stem loop structure
c. needs a protein rho factor to bind to a rho utilization site on the RNA
d. needs a GC rich region followed by an AT rich region before termination site
e. all of the above
Answer: c
14. Which of the following is TRUE about the 2-OH group?
a. is found at the growing end of DNA
b. is found at the growing end of RNA
c. is where the splice donor site joins the branch site
d. is found on ribonucleotide triphosphates (rNTPs)
e. is found on deoxyribonucleotide triphosphates (dNTPs)
Answer: c and d
Questions 15-17: Shown below is the coding strand that is used to make the
mRNA and protein for gene A.
5CAGATTTCCGAACTCGAG3
15. The sequence of the mRNA is?
a. 5CAGATTTCCGAACTCGAG3
b. 5CAGAUUUCCGAACUCGAG3
c. 3GUCUAAAGGCUUGAGCUC5
d. 3CAGAUUUCCGAACUCGAG5
e. 3CAGATTTCCGAACTCGAG5
Answer: b
16. The sequence of the template strand is?
a. 5GTCTAAAGGCTTGAGCTC3
b. 5CAGAUUUCCGAACUCGAG3
c. 5-CTCGAGTTCGGAAATCTG-3
d. 3GUCUAAAGGCUUGAGCUC5
e. 3-CTCGAGTTCGGAAATCTG-5
Answer: c

17. If the template strand is also the leading strand during DNA replication what is
the sequence of the lagging strand?
a. 5GTCTAAAGGCTTGAGCTC3
b. 5CAGAUUUCCGAACUCGAG3 (5CAGATTTCCGAACTCGAG3)
c. 5-CTCGAGTTCGGAAATCTG-3
d. 3GUCUAAAGGCUUGAGCUC5 (3GTCTAAAGGCTTGAGCTC5)
e. 3-CTCGAGTTCGGAAATCTG-5
Answer: b

18. Which of the following relationships show negative regulation?


a. Lactose and Lac repressor (I)
b. cAMP and CAP
c. AraC protein and AraI in the Arabinose operon
d. a and b
e. a and c
Answer: e
Questions 19-22: Select the choice (a-e) which would best describe the predicted
phenotype of the genotypes given below.
19. i+ p+ o+ z+ y+ / i+ p+ oc z+ y+

Lactose

a.
b.
c.
d.
e.

-galactosidase (Z)
Present
absent

permease (Y)
present
absent

+
+
+
+

+
+
+
-

+
+

+
+
-

Answer: a
20. is p+ o+ z+ y- / i+ p+ o+ z- y+

Lactose
a.
b.
c.
d.
e.
Answer: b

-galactosidase (Z)
Present
absent

permease (Y)
present
absent

+
+
+
+

+
+
+
-

+
+

+
+
-

21. i+ p- o+ z+ y+ / i+ p+ oc z+ y-

Lactose

a.
b.
c.
d.
e.
Answer: e

-galactosidase (Z)
Present
absent

permease (Y)
present
absent

+
+
+
+

+
+
+
-

+
+

+
+
-

22. i+ p+ o- z- y+ / i+ p+o+ z+ y+

Lactose
a.
b.
c.
d.
e.
Answer: d

-galactosidase (Z)
Present
absent

permease (Y)
present
absent

+
+
+
+

+
+
+
-

+
+

+
+
-

23. A eukaryotic gene is regulated by a cis acting element that is placed 100 Kb
from the 3-end of the gene. When activated it increases the transcription of that
gene by 100-fold. What type of element is this?
a. promoter
b. promoter proximal element
c. silencer
d. enhancer
e. operator
Answer: d
24. Which of the following is a trans-acting element?
a. Enhancer
b. Lac promoter
c. Lac repressor
d. Lac operator
e. Trp promoter
Answer: c

25. The amino acid sequence of the leader fragment of a protein is shown below.
What kind of regulation may this operon be under?
Met-thy-Phe-Ala-Ser-Glu-Glu-Glu-Glu-Glu-Glu-Cys
a. catabolite repression
b. inducible operator/promoter system
c. attenuation
d. allosteric regulation
e. none of the above
Answer: c
26. Which of the following is TRUE about catabolite repression?
a. functions to increase the expression of metabolic genes when glucose is absent
b. needs cAMP
c. the ATP to cAMP conversion is inhibited by glucose
d. needs CAP
e. all of the above
Answer: e
27. Which of the following is FALSE about the regulation of the AraC controlling the
Arabinose operon?
a. is an allosteric effector
b. can act as a positive regulator
c. shows attenuation
d. can act as a negative regulator
e. none of the above
Answer: c
28. Which of the following is TRUE about X-inactivation?
a. Occurs in females and never in normal males
b. is random
c. creates Barr bodies
d. needs Xist RNA
e. all of the above
Answer: e
29. The fetus of a pregnant woman is found to have three Barr bodies and is
determined to be male. Which of the following result is from the fetus?
a. XXXX
b. XXY
c. XXXY
d. XXXXY
e. XY
Answer: d

30. Which of the following is TRUE about genetic imprinting?


a. occurs in males and females
b. inactivation is based on parental origin
c. imprints are erased in the germline
d. involves chromatin silencing through epigenetic mechanisms
e. all of the above
Answer: e
31. Which of the following is TRUE about Position effect variegation?
a. involves epigenetic silencing
b. occurs in males and females
c. involves spreading of silencing
d. can inactivate genes that are brought near the centromere
e. all of the above
Answer: e
32. Which of the following is COMMON to X-inactivation, position effect variegation
and genetic imprinting?
a. involves enhancers
b. involves the Lac repressor
c. involves epigenetic silencing
d. involves TATA binding factor TFIID
e. none of the above
Answer: c
33. Epigenetic silencing is associated with?
a. chromatin silencing
b. histone methylation
c. histone acetylation
d. a and b
e. a and c
Answer: d
BONUS QUESTIONS (34-35)
34. A mutant bacterial strain is able to constitutively make cAMP without having to
breakdown ATP. Which of the following statements is TRUE about the LAC Operon
when you compare wild type and mutant in the presence of glucose and lactose
together?
a. Lac Operon is ON at LOW levels in the wild type bacteria
b. Lac Operon is ON at HIGH levels in the mutant bacteria
c. Lac Operon is ON at LOW levels in the mutant bacteria
d. a and c
e. a and b
Answer: e

35. Shown below are different ways in which the situation of uniparental disomy
(UPD) can be created. A trisomic zygote is created with two chromosomes from
dad containing a recessive allele for eye color (that gives blue eyes) and one
chromosome from mom containing a dominant allele for eye color (giving brown
eyes). This trisomic zygote is resolved into a disomic zygote by a loss of one of the
3 chromosomes to yield a newborn. Which of the following is FALSE about the
newborn?

a. if the newborn is blue eyed it has the condition of UPD


b. if the newborn is brown eyed it is normal bi-parental
c. there is 2/3 chance the person is blue eyes
d. there is 1/3 chance the person has UPD
e. there is 2/3 chance the person is normal bi-parental
Answer: c