Available online at www.sciencedirect.

com

Veterinary Parasitology 155 (2008) 161167

www.elsevier.com/locate/vetpar

Short communication

Detection of Neospora caninum in dog organs using real

time PCR systems
Farida Ghalmi a,c, Bernard China b,d,*, Rachid Kaidi e,
Georges Daube b, Bertrand Losson a
a

University of Liege, Faculty of veterinary Medicine, Department of Infectious Diseases, Parasitology, Sart Tilman, B43, 4000 Liege, Belgium
b
University of Liege, Faculty of veterinary Medicine, Department of Food sciences, Microbiology, Sart Tilman, B43b, 4000 Liege, Belgium
c
National Veterinary School of Algiers, BP 161 Hassen Badi El-Harrach, Algiers, Algeria
d
Scientific Institute of Public Health, Clinical Biology, rue J. Wytsman 14, 1050 Brussels, Belgium
e
University Saad Dahlab of Blida, Veterinary Sciences Department, Blida, Algeria
Received 29 January 2008; received in revised form 3 April 2008; accepted 9 April 2008

Abstract
Neospora caninum is a parasite responsible for paresis in dogs. The dog can harbour enkysted parasites in several organs. The
detection of N. caninum was performed using 3 different real time PCR systems all amplifying the NC5 DNA region. One system
was based on Sybr1green, one on PlexorTM technology and the last on Taqman1 probe. Comparison of the three methods indicated
that the detection limit was 1 equivalent genome on pure DNA but that this detection limit increased in the presence of foreign DNA
using the Sybrgreen and Plexor systems. Therefore, the Taqman system was chosen to detect N. caninum in liver and spleen of
naturally infected dogs. The overall prevalence was 32.2%. Comparison between PCR results and serological results using IFAT
showed that among the 28 PCR positive dogs only 9 were seropositive and that 8 seropositive dogs were PCR negative. Therefore
serology can underestimate the real carriage in dogs. However, PCR methods must be improved in terms of sensitivity and inhibition
problems.
# 2008 Elsevier B.V. All rights reserved.
Keywords: Neospora caninum; Dog; Real time PCR; Organs

1. Introduction
Neospora caninum is a heteroxenous cyst-forming
apicomplexan parasite responsible for diseases in
animals. The major clinical manifestations are hind
limb paralysis in dog and abortion in cattle worldwide
(Dubey et al., 2006). The dog is the definitive host and
the cattle are the intermediate host (Georgieva et al.,
2006). Dogs are infected by ingestion of contaminated
* Corresponding author at: Scientific Institute of Public Health,
Clinical Biology, rue J. Wytsman 14, 1050 Brussels, Belgium.
Tel.: +32 2 642 53 85; fax: +32 2 642 56 45.
E-mail address: b.china@iph.fgov.be (B. China).
0304-4017/$ see front matter # 2008 Elsevier B.V. All rights reserved.
doi:10.1016/j.vetpar.2008.04.007

food of bovine origin. In dogs, the parasite can reach

organs such as the brain, spinal cord, retina, muscles,
thymus, heart, liver, kidney, stomach, adrenal gland, and
skin (Peters et al., 2000) where it can form cysts and
persist for a long time leading to chronic disease
(Georgieva et al., 2006). Reactivation of the parasite can
occur when the immune system of the host is depressed
(Georgieva et al., 2006). Serology is the principal
method of N. caninum diagnosis. It includes IFAT
considered as the Gold standard (Dubey and Schares,
2006), ELISA including a lot of variations and
commercially available kits (Dubey and Schares,
2006), DAT (Packham et al., 1998) and Western blot
as a confirmation test. Nevertheless, serology is an

162

F. Ghalmi et al. / Veterinary Parasitology 155 (2008) 161167

indirect diagnosis test. Moreover, in case of early or

chronic infection with cysts formation, the serology
could be negative even if the parasite is present in the
host. Therefore, direct diagnosis methods can be useful.
These methods include immunohistochemistry, animal
infection or PCR (Dubey and Schares, 2006). PCR has
been demonstrated to be more sensitive to immunohistochemistry (Dubey and Schares, 2006). Classical PCR
where the amplification and the detection are separated
was the first technique described in N. caninum
amplification (Payne and Ellis, 1996; Yamage et al.,
1996). Semi-nested or nested PCR was also developed to
increase the sensitivity (Buxton et al., 1998; Baszler et al.,
1999). The major targets were the locus Nc5, a repetitive
sequence present in the N. caninum genome and the ITS1
locus present in ribosomal DNA operons (Gondim et al.,
2004). Real time PCR systems using a specific Taqman
probe (Collantes-Fernandez et al., 2002) or hybridisation
probes (Muller et al., 2002) were also described. In this
study, the Nc5 sequence was selected since the ITS1 is
potentially more variable (Gondim et al., 2004). A
sensitive detection method of N. caninum in dog organs
by real time PCR using either specific Taqman1 probe,
PlexorTM or Sybr1green systems was described.
2. Materials and methods
2.1. Reference material
N. caninum strain NC-1 (Dubey et al., 1988) was used
to produce reference DNA. Briefly, NC-1 tachyzoites
(ATCC50843; Dubey et al., 1988) were used to infect
vero cells (ATCC CRL-1587). The growing tachyzoites
led to the vero cells lyses and the tachyzoites were
withdrawn. The total content of the culture flask was
centrifuged (1500  g for 20 min) and the pellet were
resuspended in phosphate buffered saline (PBS, pH 7.4)
and flushed through a 25 gauge needle in order to lyse to
vero cells. The tachyzoites were harvested by centrifugation (1500  g for 20 min). The pellets were resuspended
in PBS (pH 7.4) and the number of tachyzoites in the
suspension was determined using a haemocytometer.
2.2. Indirect fluorescence antibody test
The IFAT was performed as previously described
(Dubey et al., 1988). Briefly, 104 tachyzoites per well
were used to coat a 10-wells tefloned slide. The slides
were washed and 20 ml of diluted sera (1/501/800)
were added to the wells for 25 min at 37 8C. After
washing, a FITC-conjugated anti-dog IgG (Sigma
Aldrich, St Louis, USA) was added and incubated as

above. After washing, the slides were mounted and

positive tachyzoites were looked for under epifluorescence microscope (400).
2.3. Organs
From November 2004 to June 2005, 87 dogs from a
dog pound in Algiers were euthanised by pentobarbital
overdose and the liver, the spleen and the mesenteric
lymph nodes were removed by surgery. The samples
were conserved transported to the lab on ice in a cooling
bag. In the lab, the organs were stored at 20 8C till
DNA extraction. Moreover, none of the studied dogs
showed neosporosis symptoms.
2.4. DNA extraction
The DNA was extracted from 50 mg of each organ or
from NC-1 tachyzoitzes (4  106 ml1) using a phenol
chloroform based method (Sambrook et al., 1989). The
organs were incubated in a lysis buffer (Tris 10 mM,
EDTA 100 mM, pH 8, SDS 0.5%) containing proteinase
K (0.1 mg ml1) at 56 8C for 18 h. The lysate was
extracted twice with a phenol/chloroform/isoamylic
alcohol (25/24/1, v/v/v) solution. The DNA was
precipitated with ethanol in the presence of 3 M sodium
acetate. After centrifugation (13,000  g for 30 min),
the pellets were washed with 70% ethanol. The final
DNA pellets were resuspended in 200 ml Tris EDTA
buffer. The DNA concentration was spectrophotometrically estimated (Nanodrop 100, Isogen, The Netherlands). Finally the DNA was stored at 20 8C until use.
For NC-1 DNA extraction, the DNA was extracted using
the same protocol as above on 1 ml of pelleted
tachyzoites but the lysis time was reduced to 3 h.
2.5. PCR systems
The primers were selected on base of the NC5
sequence (Genbank accession number X84238). For the
different real time PCR systems, the amplifications
were performed on ABI7000 (Applied Biosystems,
Foster City, CA, USA). The PCR efficiency has been
calculated by using the slope of the standard curve
E = (1  101/slope)  100.
2.6. Sybrgreen system
For the Sybrgreen real time system the primers were
modified from NP7-NP4 system (Baszler et al., 1999)
using the Oligo6 software (Medprobe, Oslo, Norway).
Upper primer: 561U20: GGGAGTTGGTAGCGGT-

F. Ghalmi et al. / Veterinary Parasitology 155 (2008) 161167

GAGA and lower primer: 806L20: GCCTCCCAATGCGAACGAAA. The optimal annealing temperature was
59.9 8C, the expected amplicon Tm was 89.7 8C and the
amplicon size was 265 bp as calculated by Oligo6
software (Medprobe, Oslo, Norway). The PCR mix was
12.5 ml of Itaq Sybrgreen mix 2 (BioRad, Nazareth,
Belgium), 0.25 ml of each primer (50 mM), 5 ml of target
DNA and PCR grade water to 25 ml. The cycles were: 1
(50 8C for 2 min), 1 (95 8C for 3 min.), 50 (95 8C for
15 s, 60 8C for 1 min). The amplification reaction was
followed by a melting curve (from 60 to 95 8C).
2.7. Plexor system
For Plexor system the primers were selected using the
Plexor primer design software (www.promega.com/
PlexorTM resources/). The primers were purchased
from Eurogentec (Seraing, Belgium). NC5PLEX: 6FAM-ACAGAACACTGAACTCTGGATAAGTATCA
and NC5FRIEND: GGATACGTGGTTTGTGGTTAGTCATTC. The Tm and the size of the amplicon were
83.2 8C and 101 bp, respectively, as calculated by the
Oligo6 software. The primers were resuspended together
in MOPS EDTA buffer at a concentration of 5 mM using
buffer purchased from the Plexor qPCR system
(Promega, Madison, WI, USA). The primer stock
solution was stored in dark. The reaction mix was
12.5 mM Plexor master mix 2, 1 ml of primers solution
(5 mM) and 6.5 ml of nuclease free water. The
amplification was performed from 5 ml target DNA.
The thermal cycling program was 1 (95 8C for 2 min)
and 50 (95 8C for 5 s, 60 8C for 35 s). The amplification
reaction was followed by a dissociation protocol. The raw
data of amplification (DRn) and dissociation were
exported to the Plexor analysis software (available for
download at: www.promega.com/PlexorTM resources/).
2.8. Taqman system
The primers and probes were selected using the
Primer Express software (Applied Biosystems, Foster
City, CA, USA). NC5-550: GGGTGAACCGAGGGAGTTG, NC5-596: ACGTGAGGAATGACTAACCACAA, NC5 probe: FAM-AGCGGTGAGAGGTGGGATACGTGG. The Primers stock solution was
50 mM and the probe stock solution was 20 mM. The
real time PCR mix was: 12.5 ml of qPCR master mix 2
(Eurogentec, Seraing, Belgium), 0.25 ml of each primer,
0.25 ml of NC5 probe, 5 ml of DNA, and 6.75 ml of
nuclease free water. The amplification thermocycling
was: 1 (50 8C for 2 min), 1 (95 8C for 10 min), and
50 (95 8C for 15 s, 58 8C for 1 min).

163

Moreover an internal PCR control was constructed

using the hsp60 gene of Bifidobacterium thermophilum
since a probe was already available in the lab. The gene
was amplified using hybrid primers: Cineoup: GGGTGAACCGAGGGAGTTG-TGTGGAGACCAAAGGACCAGAT and Cineodwn: ACGTGAGGAATGACTAACCACAACATCCTGGCCGACCTTGT. The DNA
of B. thermophilum (ATCC25866) was amplified by
classical PCR using the following mix: 2 ml of target
DNA, 0.2 ml of fideliTaq (usb, Cleaveland, OH, USA),
2 ml of 10 buffer, 0.2 ml of each primers (40 mM),
dNTPs 2.5 mM 1.6 ml; 13.8 ml nuclease free water. The
amplification thermocycling was performed in a mastercycler gradient (Eppenddorf, Hamburg, Germany) and
consisted of 1 (94 8C for 5 min), 40 (94 8C for 30 s,
58 8C for 30 s, 72 8C for 60 s), 1 (72 8C for 5 min) and
keep at 4 8C. A tenth of the amplification product was
reamplified in the same condition using the primers NC5550 and NC5-596. The obtained 142 bp PCR product was
purified (Qiaquick PCR purification kit, Qiagen, Venlo,
The Netherlands) and decimally diluted. The lowest
amplifiable IPC concentration was determined by real
time PCR using NC5-550 and NC5-596 as primers and
CIprobe: NED-ACGATTTCCGCTGCT-MGB as probe.
The mix was 12.5 ml of qPCR master mix 2
(Eurogentec, Seraing, Belgium), 0.25 ml of each primer,
0.25 ml of CI probe, 5 ml of DNA, 6.75 ml of nucleasefree water. The thermocycling was performed as above.
The selected IPC dilution was 1018 with an average Ct
value of 42.44. For N. caninum from dog organs the PCR
mix was: 12.5 ml of qPCR master mix 2 (Eurogentec,
Seraing, Belgium), 0.25 ml of each primer, 0.25 ml each
probe, 2 ml of IPC, and 6.5 ml of nuclease free water. The
DNA amplification was performed on 5 ml DNA.
2.9. DNA sequencing
The PCR product was purified (Qiaquick purification
kit, Qiagen, Venlo, The Netherlands) and sequenced
(DYEnamic ET Dye Terminator Cycle Sequencing Kit,
Amersham Biosciences, Diegem, Belgium) using the
PCR primers. The sequencing products were analysed
by capillary electrophoresis (MegaBACE 500, Amersham Biosciences, Diegem, Belgium).
3. Results and discussion
3.1. PCR systems comparison
Beside the Sybrgreen (Schneeberger et al., 1995) and
Taqman (Holland et al., 1991) systems a new
technology, the Plexor system, has been tested (Jonhson

164

F. Ghalmi et al. / Veterinary Parasitology 155 (2008) 161167

et al., 2004; Sismour et al., 2004). This technology use a

primer labelled with a fluorescent reporter and a modified
base (iso-dC) at the 50 end. As amplification proceeds,
fluorescence is reduced by site-specific incorporation of
iso-dG tagged with the fluorescent quencher dabcyl
opposite the iso-dC base in the modified primer. The
close proximity of the dabcyl to the fluorescent reporter
results in a reduction of the fluorescent signal. Therefore
in the Plexor approach, contrary to the two others
technologies, the fluorescence decreases during the
amplification. As in Sybrgreen technology, a dissociation
curve was carried out after the amplification in order to
check the amplification specificity by the amplicon
fusion temperature determination. These three technol-

ogies were used to detect N. caninum DNA. First of all,

the different PCR systems have been tested on pure
tachyzoites DNA. The NC-1 DNA was extracted from
4  106 tachyzoites and resuspended in 200 ml to a
concentration of 2  104 equivalent genome per ml. The
PCR were performed on 5 ml of serial dilution of this
suspension. The amplification reactions contained 105,
104, 103, 102,101 and 100 equivalent genomes, respectively (Fig. 1). All the systems were able to detect one
equivalent genome. For Plexor and Sybrgreen systems,
the specificity of the amplification has been checked
using a dissociation curve (Fig. 1). Since the observed Tm
was slightly lower than the expected Tm, the specificity
of the amplification was positively confirmed by

Fig. 1. PCR systems on pure N. caninum DNA. PCR have been performed from 107 (7), 106 (6), 105 (5), 104 (4), 103 (3), 102 (2), 101 (1), 100 (0)
equivalent genomes of NC-1 N. caninum DNA. (A) Dissociation curve (dF/dT) in function of the temperature (8C) for sybrgreen amplifcation. The
melting temperature of the amplicons was 86.1 8C. Standard curve for Sybrgreen (B), Plexor (D) and Taqman (F) amplification, respectively. Ct
values in function of the logarithm of DNA copies number (log N). The curve equation is indicated with the determination coefficient (R2) and the
PCR efficiency (E). (C) Dissociation curve (dF/dT) in function of the temperature (8C) for Plexor amplification. The melting temperature of the
amplicons was 79.9 8C). (E) Taqman amplification curves. The fluorescence in function of the cycle number. The horizontal line corresponds to the
fluorescence threshold.

F. Ghalmi et al. / Veterinary Parasitology 155 (2008) 161167

amplicon sequencing (data not shown). Nevertheless, the

Taqman system was the only system were the PCR
efficiency could be truly calculated on the all DNA
dilutions as for the two other systems, the measured
fluorescence was due to the specific amplification and
primers dimers (Fig. 1). Therefore the PCR efficiency
was only calculated on the 5 first dilutions for Plexor and
Sybrgreen system. The calculated PCR efficiency was
100% for Taqman system and 97% for Sybrgreen and
Plexor systems (Fig. 1). Since the aim was to amplify N.
caninum DNA from dog tissues, the following step was to
estimate the detection limit when N. caninum DNA was
mixed with organ DNA. Therefore, N. caninum DNAwas
mixed with chicken liver DNA (100 mg ml1) in order to
obtain 0, 1, 10, 1000, 10,000, and 100,000 equivalent
genome in 500 ng of liver DNA. The different real time

165

PCR was performed (Fig. 2). Only the Taqman PCR

system was able to detect one equivalent genome but with
a Ct value of 45.53 (0.4). In Plexor and Sybrgreen
systems, the detection limit was 10 equivalents genome
per PCR reaction. It is most probably related to the higher
specificity of the Taqman amplification due to the
presence of the specific probe allowing to fish the right
amplicon even among non-specific amplicons. The two
other techniques are more affected by non-specific
amplification especially when the amount of target DNA
was low. In these conditions, the peak corresponding to
the specific amplicon was difficult to identify. More fine
tuning is probably required to increase the specificity of
the amplification. Therefore, the Taqman approach was
selected for the detection of N. caninum in organs of
naturally infected dogs.

Fig. 2. PCR systems on N. caninum DNA mixed with foreign DNA. PCR have been performed from 107 (7), 106 (6), 105 (5), 104 (4), 103 (3), 102 (2),
101 (1), 100 (0) equivalent genomes of NC-1 N. caninum DNA. (A) Dissociation curve (dF/dT) in function of the temperature (8C) for sybrgreen
amplification. The melting temperature of the amplicons was 86.2 8C. Primer dimers were predominant for 100 equivalent genome (0). Standard
curve for Sybrgreen (B), Plexor (D) and Taqman (F) amplification, respectively. Ct values in function of the logarithm of DNA copies number
(log N). The curve equation is indicated with the determination coefficient (R2) and the PCR efficiency (E). (C) Dissociation curve (dF/dT) in
function of the temperature (8C) for Plexor amplification. The melting temperature of the amplicons was 80.0 8C. Primers dimers were present from
102 to 100 equivalent genomes and the primers dimers curve was predominant for 100 equivalent genome amplification. (E) Taqman amplification
curves. The fluorescence in function of the cycle number. The horizontal line corresponds to the fluorescence threshold.

166

F. Ghalmi et al. / Veterinary Parasitology 155 (2008) 161167

Since DNA isolated from organ can contain PCR

inhibitors, the construction of an internal PCR control
(IPC) was performed. The addition of a competitor
molecule in the PCR mix could lower the detection limit
of the system. In order to check this, the previous
experiments were reproduced including the IPC. The
detection limit was not modified but the measured Ct
values were significantly increased (46.29  0.3;
p < 0.01).

attempted. The Ct value from organs ranged from

34.70 to 43.40 corresponding a range of 1 to 102.6
genome equivalents by PCR reaction or from 800 to
4  105 parasites per gram of organ. The results
indicated that the level of contamination varied
widely between dogs. But it was just an estimation
based on the principle that the parasites were
randomly distributed in the organ.
3.4. PCR versus IFAT

3.2. Dog organs

A prevalence study was performed on 87 dogs of the
central pound of Algiers. The liver and the spleen was
analysed on each animal using the Taqman real time
PCR system. Out of the 87 dogs, 59 (68%) were
negative and 28 (32%) were positive in at least one
organ. Among the 59 positive, 14 (50%) were positive
in both organs, 11 (12.4%) were positive only for the
spleen sample and 3 (3.4%) were positive for the liver
sample. It is probably due to the sampling since the
DNA extraction was only performed on 50 mg of organ.
Moreover, liver is a bigger organ than spleen therefore
the sample represented a larger proportion of the whole
spleen than of the whole liver. It is maybe possible to
increase the sensitivity of the method by increasing the
size of the sample and by decreasing the elution volume
of the DNA. Nevertheless, the PCR can only be
performed on a small volume (here 5 ml) that is also a
limitation in the sensitivity of the method. But, some
dogs (14/87, 16%) were positive for both organs
indicating a big colonisation of the organs by N.
caninum. Another point that can decrease the efficiency
of the PCR was the presence of PCR inhibitors. Out of
87 tested samples, 10 showed inhibition. The inhibition
was solved by DNA dilution, but this lead to a decrease
of the sensitivity. After the dilution, 2 samples became
positive and 8 became negative. The DNA extraction
method could be improved to eliminate the inhibitors.
Finally, the two selected organs were liver and spleen
even thought the major site of N. caninum is the brain
(Barber and Trees, 1996). Therefore, it is probable that
this study underestimated the prevalence of N. caninum
due to the organ choice.

A blood sample was taken before euthanasia of the

dogs and the serum was isolated. Specific N. caninum
antibodies were detected using IFAT. Out of 87 dogs, 28
(32.2%) were positive. The real time PCR and the IFAT
results were compared. The relative accuracy was 69%
(60/87). When the IFAT was considered as the reference
method, the relative sensitivity was 53% (9/17) and the
relative specificity was 73% (51/70). The kappa value
was 0.21 considered as bad agreement (Winepiscope
2.0; http://infecepi.unizar.es/ratio/soft_sp.htm). Dogs
positive for PCR and negative for IFAT were probably
due to the fact that in chronic infection the parasite
forms cysts in the organs that stimulate slightly the
immune system. More surprisingly, 8 dogs were
positive by IFAT and negative by PCR indicating that
PCR was less sensitive than IFAT. Among these dogs
were 4 dogs showed a PCR inhibition. These four dogs
showed an IFAT titre of 1/800. The 4 other dogs were
only slightly positive by IFAT with a titre of 1/200. It
indicated either than the PCR sensitivity was too low
mostly when dilution was performed due to the
inhibition or that the dog was seropositive but that
the parasite was not present in tested organs. Nevertheless, the major advantage of PCR on serology is to
directly detect the presence of the parasite. The major
disadvantage is the incapacity to perform the test on
living dogs. The positive PCR results obtained on cattle
blood opened an interesting way for PCR testing on
living animals (Okeoma et al., 2004). Even if the
sensitivity of the method must be increased, real time
PCR offers an interesting alternative to the histological
methods for the detection of N. caninum in dogs
organs.

3.3. Quantification

Acknowledgements

Since real time PCR is a quantitative method the

number of parasite per gram of organ can be
estimated. Using NC1 DNA dilution, a standard
curve was constructed and a quantification of the
number of parasite present in the organ was

FG thanks the Algerian Ministry of Higher Teaching

to contribute to her PhD formation. FG was financially
supported by the Belgian Technical Cooperation fro this
work. The authors thank Dr E. Kissling for her critical
reading of the manuscript.

F. Ghalmi et al. / Veterinary Parasitology 155 (2008) 161167

References
Barber, J.S., Trees, A., 1996. Clinical aspects of 27 cases of neosporosis in dogs. Vet. Rec. 139, 439443.
Baszler, T.V., Gay, L.J., Long, M.T., Mathison, B.A., 1999. Detection
by PCR of Neospora caninum in fetal tissues from spontaneous
bovine abortions. J. Clin. Microbiol. 37, 40594064.
Buxton, D., Maley, S.W., Wright, S., Thomson, K.M., Rae, A.G.,
Innes, E.A., 1998. The pathogenesis of experimental neosporosis
in pregnant sheep. J. Comp. Pathol. 118, 267279.
Collantes-Fernandez, E., Zaballos, A., Alvarez-Garcia, G., OrtegaMora, L.M., 2002. Quantitative detection of Neospora caninum in
bovine aborted fetuses and experimentally infected mice by realtime PCR. J. Clin. Microbiol. 40, 11941198.
Dubey, J.P., Schares, G., 2006. Diagnosis of bovine neosporosis. Vet.
Parasitol. 140, 134.
Dubey, J.P., Carpenter, J.L., Speer, C.A., Topper, M.J., Uggla, A.,
1988. Newly recognized fatal protozoan disease of dogs. J. Am.
Vet. Med. Assoc. 192, 12691285.
Dubey, J.P., Buxton, D., Wouda, W., 2006. Pathogenesis of bovine
neosporosis. J. Comp. Pathol. 134, 267289.
Georgieva, D.A., Prelezov, P.N., Koinarski, T.S., 2006. Neospora
caninum and neosporosis in animals-a review. Bulg. J. Vet.
Med. 9, 126.
Gondim, L.F., McAllister, M.M., Pitt, W.C., Zemlicka, D.E., 2004.
Coyotes (Canis latrans) are definitive hosts of Neospora caninum.
Int. J. Parasitol. 34, 159161.
Holland, P.M., Abramson, R.D., Watson, R., Gelfand, D.H., 1991.
Detection of specific polymerase chain reaction product by utilizing the 50 !30 exonuclease activity of Thermus aquaticus DNA
polymerase. Proc. Natl. Acad. Sci. U.S.A. 88, 72767280.
Jonhson, S.C., Sherill, C.B., Marshall, D.J., Moser, M.J., Prudent, J.R.,
2004. A third base pair for the polymerase chain reaction: insertion
isoC and isoG. Nucleic Acids Res. 32, 19371941.

167

Muller, N., Vonlaufen, N., Gianinazzi, C., Leib, S.L., Hemphill, A.,
2002. Application of real-time fluorescent PCR for quantitative
assessment of Neospora caninum infections in organotypic slice
cultures of rat central nervous system tissue. J. Clin. Microbiol. 40,
252255.
Okeoma, C.M., Williamson, N.B., Pomroy, W.E., Stowell, K.M.,
Gillepsie, L., 2004. The use of PCR to detect Neospora caninum
DNA in the blood of naturally infected cows. Vet. Parasitol. 122,
307315.
Packham, A.E., Sverlow, K.W., Conrad, P.A., Loomis, E.F., Rowe,
J.D., Anderson, M.L., Marsh, A.E., Cray, C., Barr, B.C., 1998. A
modified agglutination test for Neospora caninum: development,
optimization, and comparison to the indirect fluorescent-antibody
test and enzyme-linked immunosorbent assay. Clin. Diagn. Lab.
Immunol. 5, 467473.
Payne, S., Ellis, J., 1996. Detection of Neospora caninum DNA by the
polymerase chain reaction. Int. J. Parasitol. 26, 347351.
Peters, M., Wagner, F., Schares, G., 2000. Canine neosporosis: clinical
and pathological findings and first isolation of Neospora caninum
in Germany. Parasitol. Res. 86, 17.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular CloningA
Laboratory Manual, 2nd Edition. Cold Spring Harbour Laboratory Press, New York.
Schneeberger, C., Speiser, P., Kury, F., Zeillinger, R., 1995. Quantitative detection of reverse transcriptase-PCR products by means of
a novel and sensitive DNA stain. PCR Methods Appl. 4, 234238.
Sismour, A.M., Lutz, S., Park, J.H., Lutz, M.J., Boyer, P.L., Hughes,
S.H., Benner, S.A., 2004. PCR amplification of DNA containing
non-standard base pairs by variants of reverse transcriptase from
human immunodeficiency virus-1. Nucleic Acids Res. 32, 728735.
Yamage, M., Flechtner, O., Gottstein, B., 1996. Neospora caninum:
specific oligonucleotide primers for the detection of brain cyst
DNA of experimentally infected nude mice by the polymerase
chain reaction (PCR). J. Parasitol. 82, 272279.