Molecular Microbiology (1990) 4(9), 1585-1593

The pYV plasmid of Yersinia encodes a lipoprotein,

YlpA, related to TraT
B. China, T. Michiels and G. R. ComelJs*
Unite de f>/licrobioiogie. Universite Catholique de
Louvain. U.C.L 54-90. 54 Avenue Hippocrate, B-1200
Brussels, Belgium.
Summary
A series of lipoproteins was detected in the membrane
fraction of Yersinia enterocolitica W227, a typical
strain from serotype 0:9. At least two of them, YlpA
and YIpB, are encoded by the pYV plasmid. The
sequence of ylpA reveals the presence of a typical
lipoprotein signal peptide. The mature YtpA protein
would be 223 residues long with a calculated molecular weight of 23798 for the proteic moiety of the
molecule. YlpA shares 88% identical residues with the
TraT protein encoded by plasmid pED208, 80%
identity with TraT proteins encoded by plasmids R100
and F, and 77% identity with the TraT protein encoded
by the virulence plasmid of Salmonella typhimurium.
The ylpA gene hybridized with the pYV plasmid of
Yersinia pseudotubercutosis, suggesting that this
gene is conserved among Yersinia spp. The production of YlpA is controlled by virF and only occurs at
37 C in the absence of Ca^' ions. This co-regulation
with the yop genes suggests that ylpA is a virulence
determinant. However, mutations in ylpA clearly affect
neither the resistance to human serum nor the
virulence for intravenously inoculated mice.

Introduction
Pathogenic strains of Yersinia harbour closely related
70kb plasnnids involved in virulence designated pYV
{Gemski ef ai. 1980; Zink et ai, 1980; Biot and Cornelis,
1988). The pYV plasmids specify several temperaturedependent properties. These include a Ca^ * requirement
for growth at 37C, the secretion of large amounts of
plasmid-encoded proteins called Yops and the production of an outer membrane protein called PI (Bolin et
ai, 1982; for review see Straley, 1988; Cornelis et ai,
1989a).

Received 3 January, 1990; revised 17 ApnI. 1990. 'For correspondence.

Tel. (2) 7645488; Fax (2) 7645481; Earn/Bitnet CORNELIS at BUCLLN11.

The secretion of Yops occurs in growth-restriction

conditions, i.e. at 37C in the absence of Ca^* ions. Both
phenomena are controlled by a 20kb region of the PYV
plasmid called the 'calcium region'. This region contains
several transcription units designated virA. virB. wrCand
virF in Yersinia enterocolitica and IcrA. B. C and F in
Versin/a pesf/s (Goguen et al., 1984; Cornelis etai, 1986;
Yother et al., 1986). The virF/lcrF locus of the calcium
region encodes a DNA-binding protein responsible for the
transcriptional activation of yop genes at 37^C (Yother et
ai, 1986; Cornelis etai. 1987; 1989b). Vop proteins are
thought to be involved in the resistance of yersiniae
towards host immune defences but little is known about
their individual role. Yop2b from Yersinia pseudotubercu/os/s(thecounterpartofYop51 from Y. enterocolitica) has
been reported to be involved in phagocytosis inhibition
(Rosqvist et ai, 1988) while YopM from V. pestis (the
counterpart of Yop48 from Y. enterocolitioa) was found to
share homology vi/ith the a-chain of the human platelet
membrane glycoprotein Ib, which suggests that this
protein might interfere with blood coagulation (Leung and
Straley, 1989).
In contrast to Yops, the membrane protein P l , encoded
by gene yopA. is produced at 37''C irrespective of the Ca^""
concentration and independently of the presence of VirF
(Bolin ef ai, 1982; Bolin and Wolf-Watz, 1984; Skurnik,
1985; Cornelis etai. 1986), This protein has been reported
to be involved in autoagglutination(Skumik efa/.. 1984), in
the intestinal colonization of mice (Kapperud et ai, 1987),
in the binding of collagen fibres (Emody ef ai. 1989) and in
resistance to the bactericidal activity of human serum
(serum resistance) (Balligand et ai, 1985). A cloned yopA
gene can restore the serum resistance of a yopA mutant ot
y. enterocolitica but not that of a pYV strain, suggesting
that serum resistance in Y. enterocolitica is multi-factorial
(Balligand ef al., 1985). In contrast, Martinez showed
recently (1989) that Escherichia co//strain MM294 producing PI from a cloned y. enterocolitica gene became
serunn-resistant.
In this work, we report that the pYV plasmid directs the
production of at least two lipoproteins. One of them, YlpA,
is related to TraT, a protein known to be involved in surface
exclusion during conjugation (Achtman et ai. 1977) but
also in serum resistance (Moll ef ai, 1980) and in the
inhibition of phagocytosis by macrophages (Aguero ef ai,
1984).

1586

S, China, T. Michiels and G. R. Cornelis

YlpA

1985). This plasmid did not direct the production of YlpA.

Thus we inferred that, in this mutant, Tn3 inserted within
the ylpA gene or upstream of that gene if it was contained
in an operon. Insertion of Tn3 in pYL4 occurred between
the SamHI site at co-ordinate 6.7 kb and the fcoRI site at
co-ordinate 9,6kb of the pYV plasmid (co-ordinates are as
in Biot and Cornelis, 1988) (see Fig, 2).

30-

YIpB

Construction of mobilizable cloning vectors

20-

14-

LPS

LPP

Since the transformation of Yersinia by conventional

methods is rather inefficient, we constructed mobilizable
derivatives of plasmids pTZ18R and pT219R (see the
Experimental procedures). These plasmids, designated
pBC18R and pBC19R, were used to sequence the ytpA
gene as well as to analyse the expression of cloned genes
111 Yersinia.
Nucleotide sequence of gene ylpA

Fig, 1.1 den 11 fi cat ion of lipoproteins encoded by Yersinia W22703 or

W22708 (serotype 0:9) pH)-palmittc acid-labelled membranes extracted
trom Y. enterocolitica W227 strains were analysed by SDS-PAGE and
fluorography. Lane 1, W22703(pWe227) (pBC5) incubated at 37'C In
BHIo., lane 2. W22708(pYL4) incubated at 37C in BHb.; lane 3.
W22703(pYVe227) incubated at 37 C in BHIr,.; lane 4, W22703
incubaled at 37-C in BHIo.; lane 5, W22703(pYVe227) incubated at 25' C
in BHIo., lane 6, W22703(pYVe227) incubated at 3 7 X in BHica; lane 7,
W22703(pYVe2?7) incubated at 37''C in BHIo.. Two proteins, YlpA and
YIpB, produced by the wild-type strain incubated at 3 r C in BHIo< (lanes
3 and 7) were not detected when the strain was grown at 25 C (lane 5) or
in the presence of Ca^ ions (lane 6). The broad band labelled LPS
probably corresponds to the lipopolysaccharide since it did not
disappear upon 1 h incubation at 37 C with up lo 1 mg rnl ' pronase or
proteinase K (data not shown). Lpp identities an abundant, low
molecular-weight lipoprotein inferred to correspond to the ma|Or E. coli
fipoprotein. 30. 20 and 14 are molecular mass markers (kD).

Results
identification of ptasmid-encoded tipoproteins
The lipoproteins of Y. enterocolitica W22703 were labelled
in vivo with [^H]-palmitic acid and analysed by SDS-PAGE
and fluorography (Fig. 1). This typical O:9 strain produced
several lipoproteins, two of which appeared in higher
amounts on the gels. These were a 19 kD protein and a low
molecular-weight (<1G000) protein probably corresponding to the major E. coli lipoprotein. Two lipoproteins were
only produced by the plasmid-bearing strain, suggesting
that they are plasmid-encoded. These proteins, with
apparent molecular weights of 29000 and 27000, were
called YlpA and YIpB, respectively (for Yersinia lipoprotein). They were only detected when the strain was
incubated at 37''C in the absence of Ca^' ions.
Plasmid pYL4 is a Tn3 insertion mutant of the pYVe227
plasmid obtained earlier in ourlaboratory (Balligand efa/.,

Fragment fcoRI 4 (E4) from pYVe439-80, the plasmid

fronn another typical 0:9 strain, was subcloned from a
pACYC184-E4 derivative (Laroche ef ai. 1984) into the
pBC19R, giving pBC5 (Fig. 2). Yersinia strains carrying
both the pYV plasmid and pBC5 overproduced YlpA (Fig.
1), confirming that a functional ylpA gene was present in
fragment E4. Subfragments corresponding to the ylpA
region were ctoned into pBCI 8R and pBCI 9R and used to
sequence an 875bp region extending from co-ordinates
7.1 to 6.2 kb of the pYVe439-80 plasmid (Fig. 3).
This sequence contains a 249-codon open reading
frame (ORF). In view of its lipoproteinaceous nature, YlpA
is expected to be synthesized as a precursor with a signal
sequence typical for signal peptidase SPII, thus containing a cysteine as the first residue of the mature protein
(Tokunaga ef ai, 1982). The first three residues following
the initial methionine are negatively charged, which does
not fit the /V-terminus of a signal sequence. By contrast,
translation starting at the second ATG codon (codon 5 of
the ORF) would yield a typical signal sequence with
positively charged residues at the /V-terminal end. A
cysteine is encoded by codon 27 of the longer ORF,
suggesting that the actual signal cleaved by signal peptidase II is 22 residues long, A potential ribosome-binding
site (GGAAGA) occurs 4bp upstream ot the second start
codon.
Southern blot hybridizations confirmed that the insertion site of Tn3 in plasmid pYL4 is within the sequenced
ORF (Fig. 4). The ylpA probe from Y. enterocolitca also
hybridized with plasmid pIBI, the pYV plasmid from Y.
pseudotubercutosis YPIII. Hybridization occurred with
fragment Bl of PIBI, suggesting that the ylpA gene is
conserved in Y. enterocolitica and Y. pseudotubercutosis
and that it maps similarly with respect to the calcium

YlpA. a pYV-encoded lipoprotein of Yersinia

as

a
I
He

E4
I
Me

1587

(9.4 kbi

pQCS

DBC4

Rg. 2. Genetic map of pYVe227 and cloned fragments.

A. Ganetic map ot pYVe227 integrating previous data (see Mulder e(a(.. 1989): yop are the genes of the released proteins; yopfl encodes protein P I : vir
are the genes of the calcium region. repBA-oriR is the replication region and incD is the stabilization region (Vanooteghem and Cornelis, 1990). Arrows
indicate the onentation of the genes. Flags show the orientation of transposons fTnflf^, mini-Mu diac or Jr\2S07) inserted into pYV. M. operon fusion
leading to the expression ot ihe probe gene {cat or lacZ) at 3 7 X , I, lack of transcription, ^. weak transcription.
B. pBCISRor pBC19R den vat ives carrying subfragments of fragment EcoRI 4 cf pYV439 80 and used to sequence the/IpA gene; restriction sites are B,
SamHI; E, EcoRI; He, HincW and H, H/ndlll. Only the Hindi and the Hindlll sites used for cloning are shown.

region. No copy of ylpA was detected on the chromosome

of y. enferoco//fica W22703 by Southern blot hybridization
(data not shown).

Regulation of ylpA
YlpA was only produced at 37''C in absence of Ca^* (see
Fig. 1), which suggests that it is regulated by virF like the
yop genes (Cornelis efa/., 1989b). In order to confirm this
hypothesis, we monitored the expression of ylpA in a pair
of virF'^ and virF~ strains. The wrf mutant was constructed
by homologous recombination between pYVe227 and
pGCS904, a 'suicide plasmid' (Miller and Mekalanos,
1988) containing an internal fragment of virF {C. Lambert
de Rouvroit ef at., in preparation). As shown in Fig. 5, both
lipoproteins YlpA and YIpB disappeared in the virF~ strain.
Thus genes ylpA and yIpB are members of the yop
regulon.
In order to check whether ylpA is transcribed from its
own WrF-regulated promoter or from the promoter of the
yop20 neighbouring gene, we tested its expression in
pBM33, a yop20 insertion mutant of pYVe227 (Mulder et
ai, 1989). As shown in Fig. 5, YlpA was still produced by
W22703(pBM33), indicating that yop20 and ylpA do not
form an operon.

Searching for homologies

Four genes were found to share significant homology with
gene yIpA. These were the frafgenes of plasmid pED208
from Satmonella fyp/j/(Finlay and Paranehych, 1986), of
plasmids RIOO (Ogata et ai. 1982) and F (Jalajakumari ef
ai, 1987) and of the virulence-associated plasmid of S,
typhimurium (Sukupolvi ef ai. 1990). The homology to
ylpA was 76% for fraffrom pED208 (fra7"pED208) and 68%
for traTf, traTp^oo and traTs. typhimunum- The similarity was

even more pronounced when the amino acid sequences of

mature proteins were compared (Fig. 6). The five TraT
proteins aligned without gaps. Only 26 out of 223 amino
acids differed between YlpA and TraTpEopoa (88%
identity). The number of divergent residues was higher for
the other TraT proteins: 44/223 for TraTpioo (80% identity),
45/223 for TraTp (80% identity) and 51/223 for
TraJs.,ypt,,mtjr.ijm (77% identity).

Role of YlpA in pathogenicity

We monitored the virulence for the mouse of Y. enterocolitica W22703(pYVe227) and of the ylpA mutant W22708(pYL4). The mice were inoculated intravenously (i.v.), as
was done previously, to assess the virulence of yop20 and
yop48 mutants (Mulder ef ai. 1989). As shown in Fig, 7,
the bacterial counts in the spleen and the liver did not differ

1588

e. China. T Michiels and G. R. Cornelis

HetGluAspAspMetLysLys
CTGGATCCCATTTTGGTCAACCGTGGCTATGGGAGGTGCCATGCCCTGTTTTAAATGGAAGATGATAreAAGAAA
1960
Hindi
,
.
2000
AsnMetLysLeul leAlal lfThrAUValLeuS>rS(TValLeuValLeuSerGlyCysr.l>AIaMetScrThr
AACATCAAGTTAATAGCAATAACTGCCGTACTGTCCTCAGTGTTAGTCCTCTCCGGCTGTGGTGCGATGAGCACA

ZIOO
AlalleLysLysArgAsnLeuGluValLysThrGlnMetSerGluThrlleTrpLeuGluCroSerSerGlnlys
GCAATCAAAAAACGTAATCTGGAAGTGAAAACGCAGATGAGTGAAACGATTTGGTTAGAGCCGTCTTCACAGAAA

ThrValTyrLeuGlnllrLysAsnThrSerAspLysAsnMetLeuGlyLeuAlaProLyslleThrLysAlaVal
ACCGTTTATCTACAGATAAAAAATACCTCAGATAAAAATATGCTTGGCTTAGCCCCCAAAATCACAAAAGCTGTG
2200
,
,
.
.
,
GlnAapLysGlyTyrThrValThrScrSerProGluAspAlaHisTyrTrpl icIilnAlaAsnValLpuLjsAla
CAGGATAAGGGGTATAtCGTGACATCGTCCCCAGAAGATGCACATTACTGGATCCAGGCTAATGTCCTGAAAGCC
2300 BaMl
AspLyaMetAspLeuArgGluAlaGluGlyPheLeuSerGlnGlyTyrGlnGlyAiaAULeuGlyAlaAiaLeu
GATAAAATGGATTTGCGTGAAGtTGAAGGATTTCTGAGTCAGGGGTATCAGGGGGCTGCGCTGGGGGCCGCATTA
2400
GlyAlnGIyl leThrGlyTyrAsnScrAKiiScrAlaGlyAiaSprl.ciitilyVulrilyLcuAlnAlaGiyl.PuVal
GGGGCTGGTATTACAGGCTACAACTCTAACTCAGCGGGAGCrTCGTTAGGAGTTGGATTGGfGGrTGGTCTTGTT

GlyHetValAUAspAlaMetValGluAspIleAsnTyrThrMetValThrAspValGlnl leSerGluLysThr
GGGATGGTCGCGGATGCGATGGTCGAGGACATCAATTATACTATGCTGACGGATGTCCAGATTTCCGAGAAAACG
2500
.
.
.
.
.
AspThrProLeuGlnThrAspAsnValAIaAlaLeuLyaGlnGlyThrSerGlyTyrLysValGlnThrSerThr
GACACCCCCCTACAGACTGACAATGTGGCGGCGCTGAAGCAAGGCACCTCTGGCTATAAAGTTCAGACCAGCACA
2600
GlnThrGlyAsnLysHisGlnTyrGlnThrArgValValSerSerAlaAsnl.ysValAsnLeuLysPheGluGlu
CAGACGGGtAACAAACATCAATACCAGACTCGCGTGGTTTCTTCGGCTAACAAGQTtAACCTGAAATTTGAAGAA
.Hindi
.
2700
AlaGlnProValLeuGluAspGlnLeuAlaLyBSerlleAlaAsnlleLeu
GCCCAGCCGCTTCTGGAAGACCAGCTAGCGAAGTCTATCGCCAATATCCTGTAAGTCATAAGCATCCTGGTATGA
. 277fi

significantly between both strains. It is noteworthy that

only one mouse out of 13 inoculated with the ylpA strain
exhibited abcesses on the liver 96 hours after inoculation,
whereas these abcesses occurred in 13/13 mice inoculated with the ylpA * strain.

Discussion
Plasmid pYV from Y. enterocolitica 0:9 encodes at least
two lipoproteins designated YlpA (29kD) and YIpB (27 kD).
As in the case of most pYV-encoded functions, these
proteins were found to be produced at 37''C only in the
absence ot Ca^* ions.
According to the nucleotide sequence analysis, the
YlpA lipoprotein of Y. enterocolitica is closely related to
the TraT proteins encoded by the conjugative plasmids
pED208, RIOO and F as well as by the virulenceassociated plasmid of S. typhimurium (Finlay and Paranehych, 1986; Ogata ef ai, 1982; Jalajakukumari ef ai.

Fig. 3, Sequence of the ylpA gene from pYVe43980 and of (fs gene product. The 875 bp
sequenced fragment corresponds to co-ordinates
7.1 to 6.2kb of the pYV plasmid (see Fig. 2).
This sequence was numbered from nucleofide
1952 to nucleotide 2776 to allow an easy
connection with the immediately preceding
sequence containing gene /op 20 and presented
elsewhere (T Michiels et al.. submitted for
publication). ylpA starts about 500bp
downstream of the end of yop20 and is
transcribed in the same onentation. The largest
open reading frame (249 codons) starts at
nucleotide 2006 and ends at nucleotide 2752 of
the sequence. The actual ylpA gene presumably
starts at the second ATG (underlined twice).
Cleavage by signal peptidase II would occur in
the Leu-Ser-Gly v Cys sequence (underlined),
typical of TraT proteins. BamHI and Hincll
restriction sites are indicated. These sequence
data will appear in the EMBL'GenBank/DDBJ
Nucleotide Sequence Data Libranes under the
accession number X52753 (ylpA).

1987; Sui<upolvi et ai, 1990). Although the five TraT

proteins clearly derive from a common ancestor, they
appear to form two clusters: one comprises TraTpED^os
and YlpA, and the other comprises TraTr, TraTpioo arid
TraTs typhimunum- It is somewhat puzzling that the two
proteins encoded by virulence plasmids (YlpA and TraTs
rvphimu'ium) appear to be the most distant ones (see Fig. 6).
The sequence of YlpA reveals the presence of a
potential signal sequence for the exportation of lipoproteins (Tokunaga ef ai, 1982). This putative signal
sequence would start at the second initiation codon within
the ORF. Cleavage by signal peptidase SPII would occur
22 residues further in the Leu-Ser-Gly v Cys sequence
typical of TraT lipoproteins (Perumal and Minckley, 1984):
YlpA is 223 residues long. The calculated molecular
weight of the proteic moiety of the mature protein is
23 798. whereas the size of YlpA estimated by SDS-PAGE
analysis was 29000.
Several TraT proteins have been reported to be involved
in resistance to the bactericidal activity of human serum.

YlpA, a pYV-encoded lipoprotein of yersinia 1589

y/p/i
B2( 13.6 kb)

4.9 kb
14.9 kb

3.6 kb

B
^
CD

a.

^
-i

Q)
>

a.

a.

14.9
13.6

3.6

Fig. 4. Mapping of the In3 insertion in pYL4 and detection of ylpA in

plB1 (rom Y pseudotubercutosis.
A. Schematic representation and size of SamHI fragments of (ij fragment
BamHI no. 2 |82) of pYVe227, (ii) transposon Tn3, and {IIMV) the two
BamHI fragments generated by the insertion ot Tn3.
B. Southem blot hybridization, DNA from pYVe227, pYL4 and pIBI was
digested by BaniHI and hybridized with the Hinc\\-BamH\ 300bp
fragment corresponding to the 5' moiety of the ylpA gene. The probe
was isolated from pBC4 (Fig. 2) by electroelution and labelied with
["P]-dATP by nick translation. Since Tn3 contains a BamHI site,
insertion of this transposon in the fragment of pVL4 corresponding to the
probe would give nse to two SamHI fragments of pVL4. hybridizing with
the probe. Indeed, the probe hybndized with two fragments ot 3,6 and
14.9kb, confirming that insertion of this element occurred within the ylpA
gene.

-^ igkD

This is the case for TraT proteins from plasmids Rl 00 (also

known as NR1) (Reynard and Beck, 1976; Taylor and
Hughes, 1978), R6-5 (Moll ef ai, 1980), and from the
virulence plasmid of S. typhimurium LT2 (Rhen and
Sukupolvi, 1988: Sukupolvi et ai, 1990). However, the
deletion of the region encoding TraT in plP135G, the
virulence plasmid of S. typhimurium C52, did not have a
significant effect on the virulence for orally infected mice
as estimated by bacterial growth in the spleen (Michiels ef
ai, 1987),
Plasmid pYV-encoded components are known to be
involved in the resistance of Yersinia to human serum at
37X (Heesemann et ai, 1983; Pai and DeStephano,
1982). Protein PI has been shown to participate in that
activity since mutants lacking PI were rapidly killed upon
incubation in 5% human serum, irrespective of the growth
temperature (Balligand et al., 1985). Furthermore, E. coli
MM294 expressing protein PI was reported to resist
human serum (Martinez, 1989). However, the production
of protein PI from a cloned gene restored the serum
resistance of a pYV* yers/n/a strain mutated in PI but did
not confer serum resistance to a pYV strain (Balligand ef
ai, 1985). This suggests that at least one additional
plasmid-encoded factor is involved in serum resistance.
The YlpA protein is a likely candidate in view of its high
homology with TraT, However, Balligand et al. (1985) did
not detect any difference between Y. enterocolitica
W22708 strains carrying either the wild-type plasmid
pYVe227 or the ylpA mutant plasmid pYL4 with respect to
their ability to resist human serum. This suggests that YlpA
is not essential for resistance to human serum, at least in
the experimental conditions used by these authors.
Production of YlpA appeared to be regulated by virF.

-YIpB

19kD

Fig. 5. Expression of YlpA and YIpB in virF and

yop20 mutants. Lipcprcteins were analysed by
SOS-PAGE and fluorography after incorporation
ot pH|-palmitic acid during incubation at 3 7 X in
BHIo,. Unes 1-3, 16% SDS-PAGE analysis of
total cell proteins from Y. enterocolitica:
W22708(pYL4}. the ylpA mutant {lane 1);
W22703(pBC6), the virF mutant (lane 2):
W22703(pYVe227), the wild-type strain (lane 31.
Both YlpA and YIpB disappear in the virF
mutant, while the strain containing pYL4 only
lacks YlpA Lanes 4-7. i d % SDS-PAGE analysis
of pHlpalmitic acid-labelled outer-membrane
proteins extracted from W22703, the plasm id less
derivative (lane 4); W22703(pYVe227), the wildtype strain (lane 5}; W22708(pYL4), the ylpA
mutant (lane 6); and U'22703(pBM33), the yop20
mutant (lane 7). YlpA was not detected in the
ylpA mutant pYL4 (lane 6), but was detected in
the yop20 mutant, pBM33 (lane 7), indicating that
yop20 and ylpA are net part ot a single operon.
Note that a chromosome-encoded protein
migrates nearly to the same position as YlpA on
this 14% acrylamide gel, while this protein was
separated from YlpA on the 16% acrylamide gel.

1590

S. China, T. Michiels and G. R. Cornells

-20

pVV*.439-B0
pK[)2U8

Riao

.S . ( 1 phimuri UBl

10

20

-M-M
MMlii- Kl.HMV-LV- - T - A - - HK-- KLMM\-LV- -T-A
MK-- KLMMVTLV- -T-A

- - -

pYVp439-80
ptD20fl

30

10

50

rGAHSTAIKKRNLb:\KT9MSETIWLEPSS(JhTVVLalKNTSDKNMLGLAPKITKAV8DKG
A-tN--F

RIOO

D-S--wr.--AI)--KA--

W-^-HD-\-fB--*>--\

70
pVVe4 39-H0
pEDZOB
F
RiOO

-10

MKKNMKLIAITAVLSSVLVLSG

KO

30

I)-SD-WSL-A-DI-A--

100

110

120

VTVTSSi'EDAHVl. IWANVLKADKMllLKKAFCFLSQGYWCAAl.CAAl GAGITGVNMNSAGA

--1
DS
T-tt
F--IA
S
--VT--DK->
Sg'W-NR--E:---\
-G
--\T--DK-V
S-li-NH--t
V

S. t.vptiimurium

VT--DK-V

Sg-y>-NH--E--LS

1.10

no

150

160

A-

170

--

180

S. (ip/ji

SLGVGLAAGLVGHVADAMVEDI WTHVTIlVal St:KTDTPLWTDM\ ,VALKGTSGYKVgTS

T
A
--[
TASV---T
A
V
I
A-H-KATVT
R
A-1
T
A
--\
[
A-R-KATVT
R
A-1
T
A
1
R-KAT\T
R
A-I

pED20B

lyd
ZOO
210
22a
TeTGNKliaY8TRV\ SSANKVNl,KFFEAF'Vl.EDyLAKSl ANI L
9-K
1
K
\

pED208
F
RIOO

IDENTITY

RIOO
5 . t yph I mtir I

'E---a-K
-K---a-K
-K

y-h

-J
S
--N

K
K
K

---

K-

like the production of the Yops. This co-regulation suggests that, like Yops, YlpA could be involved in pathogenicity. However, our observations with i.v.-inoculated mica
did not support this hypothesis. The i.v,-inoculated mouse
model was selected because tt allowed us to demonstrate
the role of yop20 and yop48 in virulence (Mulder ef al..
1989). This model may not be the best one to piri-point the
influence of a component involved in complement neutralization because normal mouse serum has been shown to
have a poor bactericidal effect against E. coli (Vaara ef ai.
1984), Thus our result suggesting that YlpA is not a clear
virulence factor must be interpreted cautiously.
Alternatively, the presence of YlpA on the pYV plasmid
could simply be an evolutionary vestige of this plasmid.
Indeed, the replication function of pYV is related to that of
plasmid RIOO (Vannooteghem and Cornells, 1990) while
the partition and stabilization function of pYV is homologous to that of F (Bakour ef ai. 1983; Biot and Cornells,
1988), both plasmids containing a frafgene. However,
one argument contradicts this hypothesis: ylpA is not part
of a transfer operon in pYV (Bakour ef at.. 1983) while in
both RIOO and F traTis included in thefraoperon.

197/223
178/223
I 79/223
172/223

Fig. 6. Similarities between TraT proleins. The

amtno acid sequence of Yip A trom PYVe439-80
js aligned with those of TraT from p6D20e IFinlay
and Pafanchych, 1986], F (Jalaiakuman et ai..
J986),R100 (Ogata e(aA, 1982). and S,
typhimurium (Sukupoivi el ai.. 1990). The amino
adds are numbered from ifie cysteine that
conslitLrtes the first residue of the mature protein.
Dashes symbolize residues identical to those of
YipA. Divergent residues are indicated.

Experimental procedures
Bacteriat strains and plasmids
Y. enterocolitica W22703 (nalidixic acid-resistant) and Y. enterocolitica W22708 (slreptomycin-resistant) are derivatives of the
same Res Mod ' mutant of Y. enterocolitcaVJ227 (serotyoe 0:9)
(Cornells and Colson, 1975). Y. enterocotitica 439-80 is a
wild-type 0:9 strain. The pYV plasmids of all these strains are
indistinguishable by SamHI, EcoRI or Ssfll restriction analysis
(Larocheefa/., 1984).
E. coliJM^01 (Yanisch-Perron etal.. 1985)and LK111 (received
from M. Zabeau) are F ' . /acZ delta M15 strains. Strain S17.1.
containing a copy of RP4 integrated into its chromosome (Simon
etal., 1983). was used to mobilize onT-containing plasmids.
Phasmids pTZi8R and pTZ19R are from Pharmacia, pTJS82
(similar to pTJS81) is a pUC derivative containing the transfer
origin (oriT) from piasmid RK2 (Schmidhauser and Helinski,
1985).

Construction of mobilizable derivatives ofpTZtSR and

pTZ19R
In order to facilitate the introduction of recombinant plasmids in
yersiniae, we constructed mobilizable denvatives of the versatile
cloning vectors pTZ18R and PTZ19R. A 760bp Hinc\\-Sma\

YlpA, a pYV-encoded tipoprotein of \ersm\a

o

1 A

pH]-patmitic acid tabelling of tipoproteins

6
5

^
i"

1591

^ ^ ^

O pYV*
D pVL4

3
1

0 6 12 18 24 30 36 42 48 54 60 66 7? 78 84 90 96

Yersinia strains were inoculated to an optical density ot 0.1 ODsoo

in 5-10ml of brain heart infusion broth fBHI, Difco) supplemented
with 0,4% (w/v) glucose as well as either 5mM OaCtz (BHIca) or
200mM Na oxalate and 200mM MgClp (BHIoJ. After 2h incubation at room temperature with shaking, 250-500[iCi of [9.10^H]-palmitic acid (30Ci mmol ', from Dupont-NEN) was added to
the culture and bacteria were further incubated at either 37"C or
25C for 4h. Membrane proteins were prepared according to
Achtman ef al. (1978). Proteins were analysed by SDS-PAGE, on
gels containing 14% or 16% of 29/1 (w/w) acrylamide/bisacrylamide (Serva). The gel was treated with En^Hance (Dupont-NEN)
for fluorography as recommended by the manufacturer. Autoradiography was performed over 2-10 days at -70C using FUJI
NIF X-ray films.

Infection of mice

0 6 12 18 24 30 364248546066 72 78849096
Hours
Fig. 7. Growth of strains K enterocolitica Vi/22703(pYVe227) and
W22708(pYL4). the yipA derivative, in the spleen (A) and the liver (B) of
the mouse. Mice were inoculaled i v. with 5 x 10' baderia (arrow).
Bacterial growth was followed in the liver and in the spleen over a 4-day
period. Each point was the mean value of a group of four mice; XUe
standard deviation was less Ihan 0.7 log.o bactena (not shown). All mice
inoculated with both the pYVe227- and pYL4-containing strains died at
day 5. This expenment was repeated twice with similar results. Symbols:
O . pYVe227 ' bacteria; L], pYL4' bacteria.

Specific pathogen-free BAL8/c female mice (bred at the University of Louvain) 6 weeks old were given (intraperitoneally)
0.5ml of saline (NaCI 0.15M) containing 20mg ml ' desferrioxamine (Desteral, Ciba-Geigy). Twenty-four hours later, mice were
inoculated intravenously (i.v.) with 0.5ml of a V. enterocolotica
suspension in saline. Bacterial challenges were prepared from
overnight cultures at room temperature in tryptic soy broth,
washed once and then suspended in saline. Grovt^h of bacteria in
the spleen and liver of animals was followed in relation to time
after the i.v. injection. Groups of four mice were sacrificed by ether
anaesthesia and the organs were removed aseptically and
hon^iogenized separately in saline: 0.1-nnl volumes of serial
10-fold dilutions in saline were spread on McConkey agar and
colonies were counted after incubation for 48h at 28C. Minimal
detectable limits were 50 bacteria per organ. Results were
expressed as the log,o of bacterial counts.

Proteinase treatment of membrane fractions

fragment from plasmid pTJS82, containing the transfer origin of
plasmid RK2 {oriT) was cloned into pTZ19R linearized by partial
Dra I digestion. The recombinants carrying the o/'/7"fragment were
identified by their ability to be mobilized by E. coli S17.1 as
follows: (i) the iigation mixture was transformed into E. co//SI 7.1:
(ii) all thelranstormants, selected on ampiciflin, were collected m a
single broth and mated with the naiidixic acid-resistant strain Y.
enterocolitica W22703; (iii) the transfer of mobilizable derivatives
was selected with nalidixic acid and ampicillin. Two transconjugants were analysed by restriction. Both were found to contain
the onTfragment inserted in the Dral site at co-ordinate 1372 of
pTZ19R. One of these phasmids was designated pBC19R. In
order to construct a similar pTZ18R derivative, we simply
replaced the 346bp PvuU fragment containing the multicloning
site of pBOl 9R with that of pTZI 8R. The constructed mobilizable
derivative of pTZ18R was designated pBC18R. According to
restriction analysis, pBCI 8R lost the Dral site at co-ordinate 1353
of pTZ18R during its construction. Both pB018R and pBC19R
were checked for their ability to be packaged as single-stranded
DNA in phage particles upon infection by the helper phage
M13KO7, to complement the /acZ delta Ml5 mutation or to be
mobilized by E. coli S17.1.

In order to discriminate between lipoproteins and other lipid-containing components, membrane tractions were incubated with
increasing quantities (10fi.g ml ' to 1 mg ml ')of either pronase
(Serva) or proteinase K (Serva). After 30 min incubation at 37X,
membranes were either pelleted by a 60 min centrifugation at
15000 r.p.m. or were precipitated by the addition of 4 vol. acetone
and subsequently harvested by centrifugation.

Southern blot analysis

DNA was digested, electrophoresed on a 1% agarose gel,
denatured and transferred into a nylon membrane (Hybond-N,
Amersham) by standard methods (Maniatis er al.. 1982). The
probe was electroeluted from a polyacryiamide gel and labelled
with p^Pj-dATP (Dupont-NEN, lOOOCi mmol ') by nick translation (Maniatis et a(., 1982).

Nucieotide sequence and sequence analysis

The nucleotide sequence was determined by the method of
Sanger ef al. (1977), using T7 DNA polymerase for eiongation
(Sequenase, from USB). Single-stranded DNA was obtained from

1592

a China, T. Michiets and G. R. Cornetis

strains LK111 or JM101 overinfected with the M13K07 helper

phage.
DNA and protein sequences were analysed on a Micro Vax
Computer (Digital Equipment Corp.) with the program package of
Claverie (1984) and the FASTN, FASTP (Lipman and Pearson.
1985), ALIGN, and NAQ software from the Protein Identification
Resource program package.

Acknowledgements
We acknowledge L. Houdmont for skilful help in testing the
virulence in mice. We thank H. Wolf-Watz for the gift of V.
pseudotuberculosis VPIII. and H. Makela for discussion. This
work was supported by the Belgian Ministry for Sciences (Action
Concertee 86/91686) and by the Belgian Fund for Medical
Research (FRSM convention 3.4514.83). B.O. is a fellow of the
Belgian Institute for Scientific Research applied to Industry and
Agriculture (IRSIA). T.M, is Senior Research Assistant of the
Belgian National Fund for Scientific Research (FNRS).

References
Achtman. M., Kennedy, N., and Skurray, R. (1977) Cell-oell
interactions in conjugating Escherichia coli: role of fraTprotein
in surface exclusion. Proc Natl Acad Sci USA 74: 5104-5108.
Achtman, M., Schwuchow, S., Helmuth, R., Morelli, G.. and
Manning, P.A. (1978) Cell-cell interactions in conjugating
Escherichia coli: Con mutants and stabilization of mating
aggregates. Mo/Gen Genef 164: 171-183.
Aguero, M.E., Aron, L., DeLuca, A.G., Timmis, K.N., and Cabello,
F.C. (1984) A plasmid-encoded outer membrane protein, TraT,
enhances resistance of Escherichia coliio phagocytosis. Infect
Immun 46: 740-746.
Bakour, R., Laroche, Y., and Cornelis, G. (1983) Study of the
incompatibility and replication of the 70-kb virulence piasmid ot
Yersinia. Ptasniid \Q: 279-289.
Baliigand, G., Laroche, Y., and Cornelis, G. (1985) Genetic
analysis of virulence plasmid from a serogroup 9 Yersinia
enterocolitica strain: role of outer membrane protein PI in
resistance to fiuman serum and autoagglutination. Infect
tmmun 48: 782-786.
Biot, T., and Cornelis, G. (1988) The replication, partition and yop
regulation of the pYV plasmids are highly conserved in Yersinia
enterocolitica and Y. pseudotuberculosis. J Gen Microbioi ^34.
1525-1534.
Bolin, I., and Wolf-Watz, H. (1984) Molecular cloning of the
temperature-inducible outer membrane protein 1 of Yersinia
pseudotuberculosis. Infect Immun 43: 72-78.
Bolin, I., Norlander, L., and Wolf-Watz, H, (1982) Temperatureinducible outer membrane protein of Yersinia pseudotuberculosis and Yersinia enterocolitica is associated with the virulence
plasmid. Intect Immun 37: 506-512.
Claverie, J.M. (1984) A common philosophy and FORTRAN 77
software package lor implementing and searching sequence
data base. NucI Acids Res 12: 397-407.
Cornelis, G.R., and Colson C. (1975) Restnction ot DNA in
Yersinia enterocolitica detected by recipient ability for a
derepressed R tactor from E. coli. J Gen Microbiol87:285-291.
Cornells. G.. Sory, M.P., Laroche, Y., and Derclaye, I. (1986)
Genetic analysis of the plasmid region controlling virulence in
Yersinia enterocolitica 0:9 by mini-Mu insertions and lac gene
fusions. Microb Pathogen 1: 349-359.

Cornelis, G.. Vanooteghem, J.C., and Sluiters, C. (1987) Transcription of the yop regulon from Y. enterocolitica requires
Irans-acting pYV and chromosomal genes. Microb Pathogen2:
367-379.
Cornelis, G.R., Biot, T., Lambert de Rouvroit, C , Michiels, T ,
Mulder. B,. Sluiters, C , Sory, M.-P., Van Bouchaute, M., and
Vanooteghem, J.-C. (1989a) The Yersinia yop regulon. Mol
Microbioi 3: 1455-1459.
Cornelis, G., Sluiters, C , Lambert de Rouvroit, C , and Micbiels, T.
(1989b) Homology between VirF, the transcriptional activator of
the Yersinia virulence reguion, and AraC, the Escherichia coli
arabinose operon regulator. J Bacteriol 171: 254-262.
Embdy, L., Heesemann, J., Wolf-Watz, H., Skurnik, M., Kapperud. G.. O'Joole. P., and Wadstrom, T (1989) Binding to
collagen by Yersinia enterocolitica and Yersinia pseudotuberculosis: evidence for yop<A-mediated and chromosomally
encoded mechanisms. J Bacteriol ^7A: 6674-6679.
Finlay, B.B., and Paranchych, W. (1986) Nucleotide sequence of
the surface exclusion genes traS and fraffrom the IncFJac
plasmid pED208. JBacfer/oM66: 713-721.
Gemski, P., Lazere, J.R., and Casey, T. (1980) Plasmid associated
with pathogenicity and calcium dependency of Yersinia enterocolitica. Intect Immun 27: 682-685.
Goguen, J.D,, Yother, J., and Straley, S.C. (1984) Genetic analysis
of the low calcium response m Yersinia pestis Mu d1(Ap lac)
insertion mutants. J Bacterioi 160: 842-848.
Heesemann, J., Keller, C , Morawa, R., Schmidt, N., Siemens,
H.J.,and Laufs, R, (1983) Plasmidsof human strains of Yersinia
enterocolitica: molecular i elatedness and possible importance
for pathogenesis. J Inf Dis 147: 107-115.
Jalajakumari, M.B., Guidolin, A., Buhk, H.J.. and Manning, P.A.
(1987) Surface exclusion genes trsS and traToi the sex factor
of Escherichia coli K-12. Determination of the nucleotide
sequence and promoter and terminator activities. J Mol Biot
198: 1-11.
Kapperud, G., Namork, E., Skurnik, M., and Nesbakken, T, (1987)
Plasmid-mediated surface fibrillae of Yersinia pseudotuberculosis and Yersinia enterocolitica. relationship to the outer
membrane protein Y0P1 and possible importance for pathogenesis. Infect Immun 55: 2247-2254.
Laroche, Y., van Bouchaute, M., and Cornelis, G. (1984) A
restnction map of virulence plasmid pYVe439-80 from a
serogroup 9 Yersinia enterocolitica strain. Plasmid^2: 67-70.
Leung, K.Y., and Straley, S.C. (1989). The yopMgene of Yersinia
pestis encodes a released protein having homology with the
human platelet surface protein GPtalpha. J Bacteriol 171:
4623-4632.
Lipman, P.J., and Pearson, W.R, (1985) Rapid and sensitive
protein similarity searches. Science227: 1435-1441.
Maniatis, T., Fritsch, E.F., and Sambrook, J. [1982) Molecular
Cioning. A Laboratory Manual. Cold Spring Harbor, New York:
Cold Spring Harbor Laboratory Press.
Martinez, R.J. |1989) Thermoregulation-dependent expression of
Yersinia enterocolitica protein 1 imparts serum resistance to
Escherichia coii K^2-JBacteriot^7^. 3732-3739.
Michiels, T., Popoff, M.Y., Durviaux, S., Coynault, C , and
Corneiis, G. (1987) A new method for the physical and genetic
mapping of large plasmids: application to the localisation of the
virulence determinants on the 90kb plasmid of Salmonella
typhimurium. Microb Pathogen 3: 109-116.
Miller, V.L., and Mekaianos, J.J. (1988) A novel suicide vector and
its use in construction of insertion mutations: osmoregulation ot
outer membrane proteins and virulence determinants in Vibrio
choierae requires toxR. J Bacterioi ^70: 2575-2583.

YtpA. a pYV-encoded tipoprotein of Yerslnia

Molt, A., Manning, P.A. and Timmis, K.N. (1980) Plasmid-determined reistance to serum bacterial activity: a major outer
membrane protein, the (raTgene product, is responsible for
plasmid-specified serum resistance in Escherichia coli. Infect
/mmun 28: 359-367.
Mulder. B., Michiels, T , Simmonet, M., Sory, M.-P., and Cornelis,
G.R. (1989) Identification of additional virulance determinants
on the pYV plasmid ot Yersinia enterocolitica W227. Intect
Immun 57: 2534-254^.
Ogata, R.T., Winters, C , and Levine, R.P. (1982) Nucleotide
sequence analysis of the complement resistance gene from
plasmid RIOO. J Bacfeno/151: 819-827.
Perumal, N.B., and Minkley, E.G., Jr (1984) The product of the F
sex factor (ra7" surface exclusion gene is a lipoprotein. J Biot
Chem259: 5357-5260.
Pai, CH,, and DeStephano, L. (1982) Serum resistance associated with virulence in Yersinia enterocotitica. tnfect Immun 35:
605-611.
Reynard, A.M., and Beck, M.E. (1976) Plasmid-mediated resistance to the bactericidal effects of normal rabbit serum. Intect
Immun 14: 848-850.
Rhen, M., and Sukupoivi, S. (1988) The role of the frafgene of the
Salmonella typhimurium virulence plasmid for serum resistance and growth within liver macrophages. Microb Pathogen 5:
275-285.
Rosqvist, R., Bolin, I., and Wolf-Watz, H. (1988) Inhibition of
phagocytosis in Yersinia pseudotuberculosis: a virulence plasmid-encoded ability involving the Yop2b protein. Intect immun
56:2139-2134.
Sanger, F., Nicklen, S., and Coulson, A.R. (1977) DNA sequencing
with chain temiinating inhibitors. Proc Natl Acad Sci USA 74:
5463-5467.
Schmidhauser, T.J., and Helinski, D.R. (1985) Regions of broadhost-range plasmid RK2 involved in replication and stable
maintenance in nine species of gram-negative bacteria. J
Sacteno/164: 446-455.
Simon, R., Priefer, U., and Puhier, A. (1983) A broad host range
mobilization system for in vivo genetic engineering: transposon

1593

mutagenesis in Gram negative bacteria. Biotechnology 1:

784-791.
Skurnik, M. (1985) Expression ot antigens encoded by the
virulence plasmid of Yersinia enterocolitica under different
growth conditions, intect immun 47: 183-190.
Skurnik, M., Bolm, I,, Heikkinen, H., Piha, S., and Wolf-Watz, H.
(1984) Virulence piasmid-associated autoagglutination in Yersinia spp. J Bacteriol 158: 1033-1036.
Straley, S.C. (1988) The plasmid-encoded outer-membrane
proteins of Yersinia pestis. Rev Infect Dis 10: S323-S326.
Sukupoivi, S., Vuorio, R., Oi, S.Y., O'Connor, 0., and Rhen, M.
(1990) Characterization of the traT gene and mutants that
increase outer membrane permeability from the Salmonella
typhimurium virulence plasmid. Mol Microbiol4: 49-57.
Taylor, P.W., and Hughes, C (1978) Plasmid carriage and the
serum sensitivity of enterobacteria. Infect Immun 22: 10-17.
Tokunaga, M., Tokunaga, H. and Wu, H.C. (1982) Post-translational modification and processing of Escherichia coli prolipoprotein in vitro. Proc Natt Acad Sci USA 79: 2255-2259.
Vaara, M., Vitjanen, P., Vaara, T., and Makela H. (1984) An outer
membrane-disorganizing peptide PMBN sensitizes E. coli
strains to serum bactericidal action. J Immunol 132: 25822589.
Vanooteghem. J.C. and Cornelis, G.R. (1990) Structural and
functional similarities between the replication region of the
Yersinia virulence plasmid and the RepFIIA replicons. J

Bacterion72: 3600-3608.
Yanisch-Perron, C , Vieira, J., and Messing, J. (1985) Improved
M13 phage cloning vectors and host strains: nucleotide
sequences of the M13mp18 and pUC19 vectors. Gene 33:
103-119.
Yother, J., Chamness. T.W., and Goguen, J.D, (1986) Temperature-controlled plasmid regulon associated with low calcium
response in Yersinia pestis. J Bacteriol 165: 443-447,
Zink, D.L., Feeley, J.C, Wells, J.G., Vanderzant, V., Vickery, C ,
Roof, W,D., and O'Donovan, G,A. (1980) Plasmid-mediated
tissue invasiveness in Yersinia enterocolitica. Nature 283:

224-226.