_______________________________________________________________

_______________________________________________________________

Report Information from ProQuest

14 November 2014 22:13
_______________________________________________________________

14 November 2014

Page 1 of 15

ProQuest

Daftar isi
PLEASE RIGHT CLICK HERE AND SELECT "Update Field" TO UPDATE TABLE OF CONTENTS.

14 November 2014

Page 2 of 15

ProQuest

Dokumen 1 dari 1

Postnatal Prebiotic Fiber Intake in Offspring Exposed to Gestational Protein

Restriction Has Sex-Specific Effects on Insulin Resistance and Intestinal
Permeability in Rats1-3
Link dokumen ProQuest
Abstrak: Maternal protein restriction (PR) during pregnancy is known to have numerous adverse
effects on offspring, including increased adiposity and impaired glucose tolerance later in life. A
few studies have shown that this adverse programming can be reversed by dietary or hormonal
therapies early in postnatal life. The objective of this study was to determine if a weaning diet
high in prebiotic fiber could mitigate some of the negative effects of maternal PR, such as
increased adiposity and impaired glucose tolerance. Wistar rats were fed a low- (8%) or normal(20%) protein diet during pregnancy. Male and female pups were weaned onto control (C; 5%
fiber, 20% protein) or high (prebiotic) fiber (HF; 21% wt:wt, 1:1 ratio oligofructose and inulin at 410 wk; 10% wt:wt, 1:1 ratio oligofructose and inulin at 10-24 wk; 17.3% protein) diets. At 24 wk of
age, glucose tolerance, body composition, satiety hormones, gut microbiota, and markers of
intestinal permeability were measured in the offspring. Maternal PR reduced offspring birth weight
by 5% and lean mass by 9%compared with the C offspring (P <0.007). HF-fed offspring had lower
body weights and percentage body fat (~23% in males, ~19% in females) at 24 wk than did C
offspring (P <0.02). Compared with C pups, pups fed the HF diet had greater cecal
Bifidobacterium spp. (>5-fold) and plasma concentrations of the gut trophic hormone glucagonlike peptide 2 (GLP- 2) (P <0.05). In male PR offspring fed the HF diet, insulin resistance measured
by the homeostasis model assessment of insulin resistance was reduced by 81% compared with
those fed the C diet (P = 0.02). In female PR offspring fed the HF diet, plasma endotoxin was
greater and colonic tight junction protein 1 (Tjp1) expression was lower than in those fed the C
diet. A high prebiotic fiber weaning diet mitigated increased adiposity and insulin resistance
associated with maternal PR, which could improve health and decrease risk of chronic disease in
offspring born to malnourished dams. However, the functional importance of sex-specific changes
in markers of intestinal barrier function warrants further investigation.

Teks lengkap: Headnote

Abstract
Maternal protein restriction (PR) during pregnancy is known to have numerous adverse effects on
offspring, including increased adiposity and impaired glucose tolerance later in life. A few studies
have shown that this adverse programming can be reversed by dietary or hormonal therapies
early in postnatal life. The objective of this study was to determine if a weaning diet high in
prebiotic fiber could mitigate some of the negative effects of maternal PR, such as increased
adiposity and impaired glucose tolerance. Wistar rats were fed a low- (8%) or normal- (20%)
protein diet during pregnancy. Male and female pups were weaned onto control (C; 5% fiber, 20%
protein) or high (prebiotic) fiber (HF; 21% wt:wt, 1:1 ratio oligofructose and inulin at 4-10 wk; 10%
wt:wt, 1:1 ratio oligofructose and inulin at 10-24 wk; 17.3% protein) diets. At 24 wk of age,
glucose tolerance, body composition, satiety hormones, gut microbiota, and markers of intestinal
permeability were measured in the offspring. Maternal PR reduced offspring birth weight by 5%
and lean mass by 9%compared with the C offspring (P <0.007). HF-fed offspring had lower body
14 November 2014

Page 3 of 15

ProQuest

weights and percentage body fat (~23% in males, ~19% in females) at 24 wk than did C offspring
(P <0.02). Compared with C pups, pups fed the HF diet had greater cecal Bifidobacterium spp.
(>5-fold) and plasma concentrations of the gut trophic hormone glucagon-like peptide 2 (GLP- 2)
(P <0.05). In male PR offspring fed the HF diet, insulin resistance measured by the homeostasis
model assessment of insulin resistance was reduced by 81% compared with those fed the C diet
(P = 0.02). In female PR offspring fed the HF diet, plasma endotoxin was greater and colonic tight
junction protein 1 (Tjp1) expression was lower than in those fed the C diet. A high prebiotic fiber
weaning diet mitigated increased adiposity and insulin resistance associated with maternal PR,
which could improve health and decrease risk of chronic disease in offspring born to malnourished
dams. However, the functional importance of sex-specific changes in markers of intestinal barrier
function warrants further investigation. J. Nutr. 144: 1556-1563, 2014.
Introduction
The influence of maternal dietary, metabolic, and environmental factors on offspring health has
been well documented in animal models and increasingly so in humans (1). Although the maternal
stressors that lead to aberrant offspring health are numerous, 1 stressor, intrauterine growth
restriction (IUGR),6 was shown to lead to early detriments such as perinatal mortality (2) and
necrotizing enterocolitis (3). The effects of IUGR can also persist and increase susceptibility to
metabolic syndrome, cardiovascular disease, and irritable bowel syndrome later in life (4-7). IUGR
is frequently modeled in animals by using protein restriction (PR) during pregnancy or lactation or
both. Offspring exposed to gestational PR display changes in the development of the insulin axis
(8), hypothalamic nuclei (9), and numerous organs (10), as well as changes in body composition,
activity levels and food intake (11), and gut microbiota (12). One organ that is remarkably
affected by maternal PR is the intestinal tract. Both the colon and small intestine display deficits
in intestinal length, DNA content, and number and height of intestinal villi and decreased
migration of enterocytes along the intestinal villi in response to in utero PR (12,13).
Thus far, there is limited but important evidence suggesting that the effects of a maternal PR diet
can be reversed in the offspring. In the prenatal period, supplementing a gestational PR diet with
folic acid or taurine can prevent some of the adverse metabolic effects in offspring (14-16). In the
postnatal period, Vickers et al. (17) showed that leptin injections could normalize high-fat-dietinduced weight gain, adiposity, food intake, plasma insulin, and locomotor activity in female pups
of undernourished dams to that of pups from adequately nourished dams. Dietary interventions in
the postnatal period also hold promise given that plasticity, or the ability to respond to the
environment, has been demonstrated in response to folic acid supplementation at 4 wk of age
(18) and a weaning diet supplemented with probiotics, prebiotics, and long-chain PUFAs
decreased small intestinal permeability to LPS and improved growth after maternal separationinduced stress in rats (19).
Prebiotic fibers, including oligofructose and inulin, are nondigestible carbohydrates that are
preferentially fermented by specific bacteria generally considered beneficial for the host (20).
Prebiotic fiber was shown to have positive effects on numerous aspects of metabolic health
including lower body weight and fat mass, improved glucose control, reduced inflammation, and
increased bifidobacteria abundance in the gut (21). Given its ability to target multiple metabolic
endpoints, prebiotic fiber has the potential to improve a number of adverse programming
outcomes found in offspring of dams fed a PR diet during pregnancy. As such, our objective was to
determine if a weaning diet high in prebiotic fiber would improve body composition, glucose and
14 November 2014

Page 4 of 15

ProQuest

satiety hormone response, and gut microbiota composition in offspring exposed to maternal PR
during pregnancy.
Materials and Methods
Ethical approval. The University of Calgary Animal Care Committee approved the experimental
protocol, which was conducted in accordance with the Guide for the Care and Use of Laboratory
Animals.
Rats and diets. Twenty-seven virgin female Wistar rats were obtained from Charles River and
housed in a temperature- and humiditycontrolled facility with a 12-h light/dark cycle. After 7 d of
acclimatization, rats were randomly assigned to a PR diet (8% protein, wt:wt) or a control (C) diet
(AIN-93G; 20% protein, wt:wt) purchased from Dyets (Supplemental Table 1) (22). Rat dams
consumed the diets for 1 wk before being bred with male Wistar rats in wire-bottomed cages.
After the identification of a copulation plug, dams were housed individually and continued to
consume their assigned experimental diet (PR or C) ad libitum until parturition. During lactation
all dams consumed AIN-93G. Dams were weighed weekly, and food intake was measured
throughout week 2 of pregnancy, as well as during the first week postpartum
Body composition, glucose tolerance, and tissue sampling. On the day after birth, pups were
weighed and litters culled to 10 pups, 5 males and 5 females where possible. Offspring were
weighed weekly for the remainder of the study, and food intake was measured for 5 consecutive
days at weeks 5, 9, 15, and 19. At 21 d of age, 2 male and 2 female pups were randomly selected
from each litter and weaned onto either a C diet (AIN-93G; 20% protein, wt:wt; 5% fiber, wt:wt; n
= 1 male and n = 1 female) or a high (prebiotic) fiber (HF) diet (21% wt:wt, 1:1 ratio oligofructose
and inulin; 17.3% protein, wt:wt; n = 1 male and n = 1 female). At 10 wk of age, all offspring were
switched to the maintenance formulas of their diets (14% protein, wt:wt; 5%fiber, wt:wt), andHF
rats were switched to a 10%(wt:wt) prebiotic fiber diet (14% protein, wt:wt). Pups not selected for
inclusion in the study underwent a DXA scan (Hologic QDR 4500) while lightly anesthetized with
isoflurane at 1 wk postweaning. Hologic QDR software for small animals was used to determine
lean and fat mass. At 23 wk of age, rats underwent an oral glucose tolerance test (OGTT). After
overnight feed deprivation, blood was sampled from the tip of the tail in conscious rats followed
by an oralglucose gavage (2 g/kg). At 15, 30, 60, and 90 min post-glucose gavage, additional
blood samples were collected for satiety hormone analysis according to our previous work (23).
Blood glucose concentrations were determined immediately at each time point with a blood
glucose meter (Accu-Chek Blood Glucose Meter; Roche Diagnostics). Blood was collected in chilled
Vacutainer tubes containing diprotinin-A (0.034 g/L blood; MP Biomedicals), Sigma protease
inhibitor (1 g/L blood; Sigma Aldrich), and Roche Pefabloc (1 mg/mL of blood). Plasma was stored
at 280C. One week after the OGTT and 1 d before study termination, rats underwent aDXA scan to
determine body composition. At study termination, rats were feed-deprived overnight and then
anesthetized with the use of isoflurane. A blood sample was collected from the hepatic portal vein
for analysis of glucagon-like peptide (GLP) 2 and LPS. Rats were killed via overanesthetization and
aortic cut. The entire intestine was excised, flushed, and weighed. Samples from the liver,
stomach, small intestine, cecum, and colon were snap-frozen and stored at 280C.
Plasma analysis. A Milliplex Rat Gut Hormone kit (Millipore) was used to measure ghrelin (active),
insulin, amylin (active), leptin, glucosedependent insulinotropic polypeptide (GIP; total), GLP-1
(active), and peptide YY (PYY; total). HOMA-IR was calculated from insulin and glucose
concentrations in plasma obtained from feed-deprived rats. An ELISA was used to measure portal
14 November 2014

Page 5 of 15

ProQuest

vein concentrations of GLP-2 (Millipore). Plasma LPS was measured by using a PyroGene
Recombinant Factor C Endotoxin Endpoint Fluorescent Detection assay (Lonza Group) according to
the manufacturers directions.
Tissue RNA extraction and real-time PCR. Extraction of total colonic RNA and reverse transcription
was performed as previously reported (24). Primer sequences used for RT-PCR were as follows:
sodium-glucose transporter 1 (Sglt1; F: CTACATCCAGTCCATCACCAGTTAC; R:
CCAATCAGGAAGCCGAGAATCAG); tight junction protein 1 (Tjp1; F: CCATGCCTCCTCCTCCTC; R:
ACGGAATTGCCTTCACTCTG), mucin 2 (Muc2; F: CACCATTACCACCACCTCAG; R:
CGATCACCACCATTGCCATTG), and trefoil factor 3 (Tff3; F: GTCCTGGTTGCTGGGTCCTC; R:
CCACGGTTGTTACACTGCTCTG). Gapdh was verified as a suitable housekeeping gene for the
tissues of interest and Gapdh primers included as an internal control in the reactions. The 22CT
method was used for the data analysis (25).
Fecal DNA extraction and qPCR. Fecal pellets were collected from the dams at parturition, and
offspring cecal contents were collected at study termination. Gut microbiota were assessed by
using qPCR as per our previous work (26).
Statistical analysis. All data are presented as means 6 SEMs. Data collected from the dams were
analyzed by using 1-factor ANOVA. For offspring data, 3-factor ANOVAwas performed with factors
of maternal diet and offspring diet and sex, and a Bonferroni correction was applied. When a
significant interaction effect was identified, all 8 groups were compared by using 1-factor ANOVA
with Tukeys post hoc analysis. A repeated-measures ANOVAwas used to examine changes in body
weight and energy intake over time and blood variables during the OGTT. If unequal variance was
detected, data were log transformed before analysis. P # 0.05 was considered significant.
Statistical analysis was performed by using SPSS version 19.0 software (IBM).
Results
Dams and litters. There was no difference in weight gain between dams during the first 2 wk of
pregnancy, but PR dams gained significantly less weight than C dams during the third week of
pregnancy (P = 0.001) (Table 1). Energy intake, measured during the second week of pregnancy,
was 18% higher in PR dams than in C dams (P = 0.032). No differences in energy intake were
found during the first 2 wk of lactation (data not shown). There was a trend for an increased
number of still births from PR compared with C dams (C: 0 still births; PR: 0.44 6 0.19 still births; P
= 0.06) but no difference in the number of live births or number of males or females born to PR
and C dams (Table 1). Hereafter, offspring of PR dams are designated as PRC or PRF according to
postnatal C or HF diet, respectively, whereas offspring of C dams are designated CC or CF for
postnatal C or HF diet, respectively.
Offspring growth and food intake. Birth weight was lower in offspring of PR than in those of C
dams (P = 0.004; Table 1). During the remainder of the suckling period there were no significant
differences in pup weight. At 4 wk of age, offspring from PR dams had lower lean mass (P =
0.036) and higher body fat than those from C offspring (P = 0.007; Table 1). From 3 to 24 wk,
body weight was affected by the interaction of time, sex, and postnatal diet (P = 0.002; Fig. 1A).
Males fed the HF diet had lower body weight from weeks 5-22 and at week 24, whereas females
fed the HF diet had lower body weight at week 4 than did the C pups.
Energy intake in offspring was affected by the interaction of time, postnatal diet, sex, and
maternal diet (P = 0.013; Fig. 1B). Energy intake increased with age, although to varying degrees
14 November 2014

Page 6 of 15

ProQuest

on the basis of sex and postnatal diet. Male CF consumed less energy than male CC at 5 and 9
wk. PRF also consumed less energy than PRC for males at 19 wk and for females at 9 wk (P
<0.05).
At study termination, the interaction between postnatal diet and sex affected final body weight (P
= 0.02), with males weighing more than females, and male offspring fed the HF diet having lower
body weight than offspring fed the C diet (Fig. 2A). The interaction between postnatal diet and sex
also affected body fat, lean mass, and naso-anal length. Percentage body fat was lower in male
offspring fed the HF diet than in offspring fed the C diet (Fig. 2B; P = 0.046). Lean mass was
higher in female offspring fed the HF diet than in offspring fed the C diet (Fig. 2C; P = 0.048), and
naso-anal length was greater in male offspring fed the C diet (28.1 6 0.30 cm) than in offspring
fed the HF diet (26.8 6 0.26 cm; P = 0.007). The interaction of maternal diet and sex affected liver
weight, with males born to C dams having higher liver weight than males born to PR dams (Fig.
2D; P = 0.034). The interaction between postnatal diet, sex, and maternal diet influenced colon
weight in offspring (P <0.01; Fig. 2E). Colon weight was lower in male PRF than in male CF,
whereas female PRF had higher colon weight than female CF.
Gut microbiota. Maternal diet had an effect on the gut microbiota profile in the dams at
parturition. Both Clostridium leptum (C: 4.69 3 104 6 1.15 3 104; PR: 8.15 3 104 6 1.21 3 104 16S
ribosomal RNA (rRNA) gene copies/20 ngDNA; P = 0.05) and Roseburia spp. (C: 6.96 3 105 6 2.14
3 105; PR: 8.32 3 106 6 2.05 3 104 16S rRNA gene copies/20 ng DNA; P = 0.003) were greater in
PR vs. C dams.
In the offspring, Roseburia spp. was significantly affected by the interaction of maternal diet,
postnatal diet, and sex (P = 0.036), with higher abundance in male offspring fed the HF diet than
offspring fed the C diet and lower abundance in female PR offspring than female C offspring (Table
2). The interaction between postnatal diet and sex influenced Lactobacillus spp.,
Enterobacteriaceae, and Clostridium cluster I (P <0.05). Lactobacillus spp. was higher in male
offspring fed the C diet vs. those fed the HF diet. Enterobacteriaceae was greater in females fed
the HF vs. those fed the C diet, whereas Clostridium cluster I was greater in offspring fed the C
diet vs. those fed the HF diet and greater in females than in males born to C dams. The
interaction between maternal diet and postnatal diet affected C. leptum (P = 0.034), wherein
offspring fed the HF diet had lower abundance than offspring fed the C diet and male CC had
higher abundance than did female CC. Bifidobacterium spp. was higher in offspring fed the HF vs.
the C diet and higher in female PRF than in female CF (Fig. 3A).
Independently, maternal diet, postnatal diet, and sex all influenced Clostridium coccoides,
wherein PR offspring had higher abundance than C offspring; offspring fed the C diet had higher
abundance than offspring fed the HF diet and females had higher abundance than males.
Postnatal diet also independently affected Bacteroides spp., wherein offspring fed the HF diet had
greater abundance than offspring fed the C diet, whereas for Clostridium cluster XI the reverse
was true. Independently, sex affected Methanobrevibacter spp. with the abundance in females
(34,000 6 4010 16S rRNA copies/20 ng DNA) being greater than in males (5890 6 864 16S rRNA
copies/20 ng DNA) (P <0.001).
Plasma satiety hormones and blood glucose. The interaction between time, postnatal diet, and
maternal diet affected insulin concentrations (P = 0.05; Supplemental Fig. 1). Throughout the
OGTT, PRF had lower insulin concentrations than PRC except at 15 min. PRF also had reduced
insulin than did CF throughout the OGTTexcept at 15 min. The interaction of time and postnatal
14 November 2014

Page 7 of 15

ProQuest

diet affected PYY concentrations, with offspring fed the HF diet having higher PYY than offspring
fed the C diet at all time points (P = 0.001). All glucose and hormone time courses are presented
in Supplemental Figure 1 and Supplemental Figure 2.
The interaction between postnatal diet, sex, and maternal diet influenced AUC for insulin (P =
0.001; Fig. 4B), HOMA-IR (P = 0.015; Fig. 2F), and plasma LPS (P = 0.046; Fig. 3B). Insulin AUC was
lower in male PRF than in PRC. Male PRC had higher insulin AUC than CC and male CF had higher
insulin concentrations than PRF. Female CC had higher insulin AUC than PRC. HOMA-IR scores were
lower in male PRF and CC than in PRC (P <0.05). Plasma LPS was lower in female CF than in CC
but higher in female PRF than in female PRC.
The interaction of postnatal diet and maternal diet affected amylin AUC (P = 0.027; Fig. 4C), with
PRF having greater amylin AUC than CF. Maternal diet and sex had a significant effect on AUC for
GIP and ghrelin (Fig. 4D, F). Ghrelin was higher in females than in males fed the C diet. GIP AUC
was higher in male offspring born to PR dams than C dams. Independently, postnatal diet
influenced PYY AUC (P <0.001; Fig. 4E) and GLP-2 concentrations in plasma derived from
feeddeprived rats (P = 0.014; Fig. 3C), wherein these variables were greater in rat pups fed the HF
diet than in those fed the C diet (P <0.05).
Gene expression. The interaction between postnatal diet, sex, and maternal diet affected Tjp1
mRNA levels in the colon (P = 0.032; Fig. 3D). Tjp1 expression was greater in male PRC than in
PRF. In females, HF diet was associated with lower Tjp1 in both PR and C offspring. Muc2 gene
expression was affected by the interaction of maternal diet and sex (P = 0.015), with females
born to PR dams having lower mRNA levels than females born to C dams (males: C, 13.6 6 2.31;
PR, 17.2 6 1.39 arbitrary units; females: C, 15.2 6 3.13; PR, 11.1 6 1.30 arbitrary units). Maternal
diet affected Tff3 expression (P = 0.017), with offspring born to PR dams having lower mRNA
levels than offspring born to C dams (C: 6.4 6 0.4; PR: 5.0 6 0.3 arbitrary units).
Discussion
Evidence from experimental and epidemiologic studies demonstrates that exposure to an
aberrant nutritional environment during the periconceptional, fetal, or early postnatal period
programs susceptibility to chronic diseases later in life (27). The results we observed with
maternal PR during pregnancy are largely in keeping with those previously reported (13,28). As
expected, gestational PR resulted in lower offspring birth weight; however, it was not low enough
to be considered IUGR, usually defined as lower than the 10th percentile of normal pups (12).
Body composition was also affected, with pups born to PR dams exhibiting reduced lean mass and
higher percentage body fat at 4 wk of age. At 24 wk of age, additional differences were observed,
with more adverse outcomes noted in male vs. female offspring, which included decreased lean
mass and naso-anal length and higher GIPAUC than in offspring born to C dams. Both male and
female offspring born to PR dams had decreased liver weight and increased C. coccoides, the
latter of which has been previously reported (12). Although not measured in this study, other
metabolic defects of gestational PR have been documented, including renal disease and
hypertension (29). Given the detrimental effects associated with maternal undernourishment, our
objective was to determine if prebiotic fiber intake could mitigate some of the documented
negative metabolic effects of gestational PR.
Offspring born to C dams exhibited many of the known benefits of consuming prebiotic fiber. Male
offspring had reduced body weight similar to that shown in a variety of rodent models
14 November 2014

Page 8 of 15

ProQuest

(23,24,26,30,31) and in humans (32). Female offspring had greater lean mass and colon length
and a reduction in plasma LPS, a factor associated with metabolic endotoxemia and the low-grade
inflammatory tone of obesity (30,31). In both sexes, the prebiotic was associated with a lower
percentage body fat and greater colon weight, PYY AUC, and plasma GLP-2. Greater
concentrations of the anorexigenic peptide PYY after prebiotic fiber intake has been shown in both
rodents (33) and humans (32) and may explain in part the reduced energy intake seen with
prebiotic supplementation (33,34). Finally, the prebiotic fiber diet also modulated the gut
microbiota with characteristic elevated amounts of Bifidobacterium spp. and Bacteroides spp. and
decreased Clostridiales (30,31,35).
The novel question, however, was whether or not consuming the prebiotic fiber from weaning
onward would mitigate any of the detrimental metabolic effects of gestational PR, which in fact it
did. Insulin resistance is typically greater in rats exposed to fetal malnutrition (36). By using
HOMA-IR as a surrogate marker, we showed that male PRF had dramatically lower insulin
resistance than did PRC. Although HOMA-IR scores have been shown to improve with a moderate
intake of the prebiotic fiber inulin in healthy subjects (37), the improvement in insulin resistance
after gestational PR is a novel finding. Improvements in insulin resistance could in part be due to
the lower fat mass seen in PRF or greater production of the short-chain FA propionate. As a
fermentation by-product of prebiotics, propionate has been shown to lower blood glucose after
feed deprivation and inhibit gluconeogenesis in hepatocytes in feed-deprived rats (38).
Mounting evidence suggests that certain diseases are associated with specific gut microbiota
signatures (39,40). In many diseases, such as in obesity, amounts of bifidobacteria are typically
reduced (41,42). Confirming previous work, we demonstrated that the HF diet resulted in greater
amounts of Bifidobacterium spp. in the cecal contents, a result that is of particular importance for
the PR offspring given previous reports of bifidobacteria amounts that were lower in IUGR
offspring than in controls (12). These greater amounts of bifidobacteria may also be linked to the
observed improvement in HOMA-IR scores on the basis of work showing an association between
greater bifidobacteria and normalized insulin in feed-deprived rats fed a prebioticsupplemented
HF diet (30). The magnitude of increase in Bifidobacterium spp. was greater in male offspring fed
the HF diet vs. female offspring fed the HF diet, which may explain why the same improvements
in HOMA-IR were not evident in female offspring. Beyond bifidobacteria, the microbiota profiles of
CC and PRC were fairly similar except for Roseburia spp. and Lactobacillus spp., wherein the
female PRC had 87% lower Roseburia spp. than did female CC, whereas male CC had 87% lower
Lactobacillus spp. than didmale PRC. Ingestion of the prebiotic fiber by the PRF group partially
restored the CF profiles.
It is well known that maternal malnutrition compromises organ growth in offspring (10). With
regard to the intestinal tract, IUGR offspring have a thinner intestine and smaller surface area for
nutrient absorption, resulting in reduced growth and compromised health (43). In our model,
offspring born to C dams that consumed the HF diet had greater small intestine length and female
offspring also had greater colon length. In PR offspring, colon length was greater in those fed the
HF diet. Although greater colon length and/or mass is a common feature of prebiotic fiber
consumption observed in animals (35), the correction of the typical IUGR-associated short colon
phenotype (12) suggests that the fiber may have aided overcoming this developmental deficit.
Although the prebiotic fiber diet had beneficial effects on metabolic markers related to obesity
and type 2 diabetes (i.e., adiposity and insulin resistance), the finding related to greater LPS in
14 November 2014

Page 9 of 15

ProQuest

female PR offspring fed the HF diet warrants further examination given the links established
between circulating LPS, compromised gut barrier function, and metabolic endotoxemia (30,31).
Although we did not measure intestinal permeability directly, Cani et al. (31) showed that plasma
LPS and Tjp1 mRNA correlate with direct measures of gut barrier function. In PR but not C female
offspring, the HF diet was associated with higher plasma LPS and lower expression of Tjp1 in the
colon than the C diet. This is interesting in light of 1 study showing that bacterial translocation
was increased at postnatal day 18 in artificially reared rat pups supplemented with
galactooligosaccharides and inulin, although this was no longer present at day 40 (44). Other
factors involved in the integrity of the gut barrier are the trefoil peptides, specifically Tff3 and the
related Muc2, which are present in the colon and play a role in protecting the epithelium and
restoring mucosal barrier integrity after injury (45). In infants with necrotizing enterocolitis, which
is more frequently found in preterm and small-for-gestational-age infants, Tff3 is found to be
downregulated (45), as it was in our offspring born to PR dams. Similarly, Muc2 was shown to be
downregulated in PR offspring at weaning (12), which is consistent with our female PR offspring.
Treatment with MUC2 protein reduced bacterial translocation (46). On the other hand, Garc'a- R'
odenas et al. (19) showed improvement in the intestinal barrier in maternally stressed pups when
weaned onto a 4% fructooligosaccharide diet; however, galacto-oligosaccharides, probiotics, and
long-chain PUFAs were also included in the diet and may have exerted a synergistic effect.
Despite the consistency of our findings with regard to markers of intestinal permeability (plasma
LPS, gene expression), a direct in vivo measure of permeability, such as the fluorescein
isothiocyanate dextran or sucrose/lactulose/mannitol protocol, should be performed to confirm the
functional significance of these findings.
On the basis of findings that GLP-2, a gut trophic factor, reduces translocation of LPS (31), we
would have expected that the greater portal GLP-2 we observed in CF and PRF would reduce LPS
translocation. In male and female offspring, GLP-2 concentrations were greater in rats fed the HF
diet in both C and PR offspring, although the magnitude of increase was greater in male PR vs.
female PR offspring, potentially explaining the sexspecific effect on plasma LPS. If there were
differences in GLP-2 at earlier time points, it is possible that the adult measures of GLP-2 were not
a good indicator for early GLP-2 response in the offspring. In pigs that underwent small bowel
resection, GLP-2 concentrations increased over the first 2 wk postoperatively, stayed
approximately the same for another 2 wk, and then declined over the following 4 wk (47).
In conclusion, an HF weaning diet after maternal PR had differential effects on correcting adverse
in utero programming. Beneficial effects related to metabolic disease included a reduction in fat
mass and greater abundance of bifidobacteria in both sexes and an improvement inHOMA-IR
scores in males.Markers of intestinal barrier function, however, as measured by Tjp mRNA and
plasma LPS,were impaired in the female but not male offspring born to PR dams after prebiotic
consumption. The ability of postnatal prebiotic fiber intake to mitigate some of the detrimental
metabolic effects of a PR maternal diet is promising; however, further work is warranted to
understand the functional importance of the changes in markers of intestinal permeability
observed in this study.
Acknowledgments
R.A.R. and M.C.H. designed the research; M.C.H. conducted the research and analyzed data; and
M.C.H. and R.A.R. wrote the manuscript. Both authors read and approved the final manuscript.
Footnote
14 November 2014

Page 10 of 15

ProQuest

1 Supported by a research grant fromthe Natural Sciences and Engineering Research Council
(RGPIN 238382-2011). M.C. Hallam was supported by a Natural Sciences and Engineering
Research Council Postgraduate Scholarship, a Frederick Banting and Charles Best Canada
Graduate Scholarship, and a Canadian Institutes of Health Research Training Award in Genetics,
Child Development, and Health.
2 Author disclosures:M. C. Hallam, no conflicts of interest. R. A. Reimer previously held a research
grant from Beneo-Orafti, Inc., manufacturer of Raftilose P95 and Raftiline HP, for a project
unrelated to the current work.
3 Supplemental Table 1 and Supplemental Figures 1 and 2 are available from the ''Online
Supporting Material'' link in the online posting of the article and from the same link in the online
table of contents at http://jn.nutrition.org.
6 Abbreviations used: C, control (group/diet); CC, offspring of control rat dams fed the control diet;
CF, offspring of control rat dams fed the high-fiber diet; GIP, glucose-dependent insulinotropic
polypeptide; GLP, glucagon-like peptide; HF, high (prebiotic) fiber; IUGR, intrauterine growth
restriction; Muc2, mucin 2; OGTT, oral glucose tolerance test; PR, protein-restricted/protein
restriction; PRC, offspring of protein-restricted rat dams fed the control diet; PRF, offspring of
protein-restricted rat dams fed the high-fiber diet; PYY, peptide YY; rRNA, ribosomal RNA; Sglt1,
sodium-glucose transporter 1; Tff3, trefoil factor 3; Tjp1, tight junction protein 1.
References
References
1. Patti ME. Intergenerational programming of metabolic disease: evidence from human
populations and experimental animal models. Cell Mol Life Sci 2013;70:1597-608.
2. Bernstein IM, Horbar JD, Badger GJ, Ohlsson A, Golan A. Morbidity and mortality among verylow-birth-weight neonates with intrauterine growth restriction. The Vermont Oxford Network. Am J
Obstet Gynecol 2000;182:198-206.
3. Garite TJ, Clark R, Thorp JA. Intrauterine growth restriction increases morbidity and mortality
among premature neonates. Am J Obstet Gynecol 2004;191:481-7.
4. Barker DJP. Fetal origin of coronary heart disease. BMJ 1995;311:171-4.
5. Jaquet D, Gaboriau A, Czernichow P, Levy-Marchal C. Insulin resistance early in adulthood in
subjects born with intrauterine growth retardation. J Clin Endocrinol Metab 2000;85:1401-6.
6. Nilsson PM, Ostergren PO, Nyberg P, Soderstrom M, Allebeck P. Low birth weight is associated
with elevated systolic blood pressure in adolescence: a prospective study of a birth cohort of
149,378 Swedish boys. J Hypertens 1997;15:1627-31.
7. Bengtson MB, Ronning T, Vatn MH, Harris JR. Irritable bowel syndrome in twins: genes and
environment. Gut 2006;55:1754-9.
8. Rees WD, Hay SM, Cruickshank M, Reusens B, Remacle C, Antipatis C, Grant G.Maternal protein
intake in the pregnant rat programs the insulin axis and body composition in the offspring.
Metabolism 2006;55:642-9.
9. Plagemann A, Harder T, Rake A, Melchior K, Rohde W, Dorner G. Hypothalamic nuclei are
malformed in weanling offspring of low protein malnourished rat dams. J Nutr 2000;130:2582-9.
14 November 2014

Page 11 of 15

ProQuest

10. Desai M, Crowther NJ, Lucas A, Hales CN. Organ-selective growth in the offspring of proteinrestricted mothers. Br J Nutr 1996;76:591-603.
11. Fagundes AT, Moura EG, Passos MC, Santos-Silva AP, de Oliveira E, Trevenzoli IH, CasimiroLopes G, Noquiera-Neto JF, Lisboa PC. Temporal evaluation of body composition, glucose
homeostasis and lipid profile of male rats programmed by maternal protein restriction during
lactation. Horm Metab Res 2009;41:866-73.
12. Fana-Berthon P, Hoebler C, Mouzet E, David A, Michel C. Intrauterine growth restriction not
only modifies the cecocolonic microbiota in neonatal rats but also affects its activity in young
adult rats. J Pediatr Gastroenterol Nutr 2010;51:402-13.
13. Mickiewicz M, Zabielski R, Grenier B, Le Normand L, Savary G, Holst JJ, Oswald IP, Metges CC.
Structural and functional development of small intestine in intrauterine growth retarded porcine
offspring born to gilts fed diets with differing protein ratios throughout pregnancy. J Physiol
Pharmacol 2012;63:225-39.
14. Jackson AA, Dunn RL, Marchand MC, Langley-Evans SC. Increased systolic blood pressure in
rats induced by maternal low-protein diet is reversed by dietary supplementation with glycine.
Clin Sci (Lond) 2002;103:633-9.
15. Torrens C, Brawley L, Anthony FW, Dance CS, Dunn R, Jackson AA, Poston L, Hanson MA. Folate
supplementation during pregnancy improves offspring cardiovascular dysfunction induced by
protein restriction. Hypertension 2006;47:982-7.
16. Boujendar S, Reusens B, Merezak S, Ahn MT, Arany E, Hill D, Remacle C. Taurine
supplementation to a low protein diet during foetal and early postnatal life restores a normal
proliferation and apoptosis of rat pancreatic islets. Diabetologia 2002;45:856-66.
17. Vickers MH, Gluckman PD, Coveny AH, Hofman PL, Cutfield WS, Gertler A, Breier BH, Harris M.
Neonatal leptin treatment reverses developmental programming. Endocrinology 2005;146:42116.
18. Burdge GC, Lillycrop KA, Phillips ES, Slater-Jefferies JL, Jackson AA, Hanson MA. Folic acid
supplementation during the juvenile-pubertal period in rats modifies the phenotype and
epigenotype induced by prenatal nutrition. J Nutr 2009;139:1054-60.
19. Garca-Rdenas CL, Bergonzelli GE, Nutten S, Schumann A, Cherbut C, Turini M, Ornstein K,
Rochat F, Corthesy-Theulaz I. Nutritional approach to restore impaired intestinal barrier function
and growth after neonatal stress in rats. J Pediatr Gastroenterol Nutr 2006;43:16-24.
20. Roberfroid M, Gibson GR, Hoyles L, McCartney AL, Rastall RA, Rowland L, Wolvers D, Watzl B,
Szajewska H, Stahl B, et al. Prebiotic effects: metabolic and health benefits. Br J Nutr 2010;104:S163.
21. Delzenne NM, Neyrinck AM, Cani PD. Gut microbiota and metabolic disorders: how prebiotic
can work? Br J Nutr 2013;109:S81-5.
22. Reeves PG, Nielsen FH, Fahey GC Jr. AIN-93 purified diets for laboratory rodents: final report of
the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A
rodent diet. J Nutr 1993;123:1939-51.

14 November 2014

Page 12 of 15

ProQuest

23. Pyra KA, Saha DC, Reimer RA. Prebiotic fiber increases hepatic acetyl CoA carboxylase
phosphorylation and suppresses glucose-dependent insulinotropic polypeptide secretion more
effectively when used with metformin in obese rats. J Nutr 2012;142:213-20.
24. Maurer AD, Chen Q, McPherson C, Reimer RA. Changes in satiety hormones and expression of
genes involved in glucose and lipid metabolism in rats weaned onto diets high in fiber or protein
reflect susceptibility to increased fat mass in adulthood. J Physiol 2009;587:679-91.
25. Silver N, Best S, Jiang J, Thein SL. Selection of housekeeping genes for gene expression studies
in human reticulocytes using real-time PCR. BMC Mol Biol 2006;7:33.
26. Bomhof MR, Saha DC, Reid DT, Paul HA, Reimer RA. Combined effects of oligofructose and
Bifidobacterium animalis on gut microbiota and glycemia in obese rats. Obesity (Silver Spring)
2014;22:763-71.
27. Ganu RS, Harris RA, Collins K, Aagaard KM. Early origins of adult disease: approaches for
investigating the programmable epigenome in humans, nonhuman primates, and rodents. ILAR J
2012;53:306-21.
28. Pinheiro DF, Pinheiro PF, Buratini J Jr., Castilho AC, Lima PF, Trinca LA, Vicentini-Paulino ML.
Maternal protein restriction during pregnancy affects gene expression and immunolocalization of
intestinal nutrient transporters in rats. Clin Sci (Lond) 2013;125:281-9.
29. Zandi-Nejad K, Luyckx VA, Brenner BM. Adult hypertension and kidney disease: the role of
fetal programming. Hypertension 2006;47:502-8.
30. Cani PD, Neyrinck AM, Fava F, Knauf C, Burcelin RG, Tuohy KM, Gibson GR, Delzenne NM.
Selective increases of bifidobacteria in gut microflora improve high-fat-diet-induced diabetes in
mice through a mechanism associated with endotoxaemia. Diabetologia 2007;50:2374-83.
31. Cani PD, Possemiers S, Van de Wiele T, Guiot Y, Everard A, Rottier O, Geurts L, Naslain D,
Neyrinck A, Lambert DM, et al. Changes in gut microbiota control inflammation in obese mice
through a mechanism involving GLP-2- driven improvement in gut permeability. Gut
2009;58:1091-103.
32. Parnell JA, Reimer RA. Weight loss during oligofructose supplementation is associated with
decreased ghrelin and increased peptide YY in overweight and obese adults. Am J Clin Nutr
2009;89:1751-9.
33. Reimer RA, Maurer AD, Eller LK, Hallam MC, Shaykhutdinov R, Vogel HJ, Weljie AM. Satiety
hormone and metabolomic response to an intermittent high energy diet differs in rats consuming
long-term diets high in protein or prebiotic fiber. J Proteome Res 2012;11:4065-74.
34. Cani PD, Lecourt E, Dewulf EM, Sohet FM, Pachikian BD, Naslain D, De Backer F, Neyrinck AM,
Delzenne NM. Gut microbiota fermentation of prebiotics increases satietogenic and incretin gut
peptide production with consequences for appetite sensation and glucose response after a meal.
Am J Clin Nutr 2009;90:1236-43.
35. Parnell JA, Reimer RA. Prebiotic fibres dose-dependently increase satiety hormones and alter
Bacteroidetes and Firmicutes in lean and obese JCR:LA cp rats. Br J Nutr 2012;107:601-13.
36. Desai M, Byrne CD, Meeran K, Martenz ND, Bloom SR, Hales CN. Regulation of hepatic
enzymes and insulin levels in offspring of rat dams fed a reduced-protein diet. Am J Physiol
1997;273:G899-904.
14 November 2014

Page 13 of 15

ProQuest

37. Russo F, Riezzo G, Chiloiro M, De Michele G, Chimienti G, Marconi E, D'Attoma B, Linsalata M,

Clemente C. Metabolic effects of a diet with inulin-enriched pasta in healthy young volunteers.
Curr Pharm Des 2010;16:825-31.
38. Kaur N, Gupta AK. Applications of inulin and oligofructose in health and nutrition. J Biosci
2002;27:703-14.
39. Arumugam M, Raes J, Pelletier E, Le Paslier D, Yamada T, Mende DR, Fernandes GR, Tap J, Bruls
T, Batto JM, et al. Enterotypes of the human gut microbiome. Nature 2011;473:174-80.
40. Wu GD, Bushmanc FD, Lewis JD. Diet, the human gut microbiota, and IBD. Anaerobe
2013;24:117-20.
41. Schwiertz A, Taras D, Schafer K, Beijer S, Bos NA, Donus C, Hardt PD. Microbiota and SCFA in
lean and overweight healthy subjects. Obesity (Silver Spring) 2010;18:190-5.
42. Million M, Maraninchi M, Henry M, Armougom F, Richet H, Carrieri P, Valero R, Raccah D,
Vialettes B, Raoult D. Obesity-associated gut microbiota is enriched in Lactobacillus reuteri and
depleted in Bifidobacterium animalis and Methanobrevibacter smithii. Int J Obes (Lond)
2012;36:817-25.
43. Simmonds A, LaGamma EF. Towards improving mucosal barrier defenses: rhG-CSF plus IgG
antibody. Indian J Pediatr 2006;73: 1019-26.
44. Barrat E, Michel C, Poupeau G, David-Sochard A, Rival M, Pagniez A, Champ M, Darmaun D.
Supplementation with galactooligosaccharides and inulin increases bacterial translocation in
artificially reared newborn rats. Pediatr Res 2008;64:34-9.
45. Vieten D, Corfield A, Carroll D, Ramani P, Spicer R. Impaired mucosal regeneration in neonatal
necrotising enterocolitis. Pediatr Surg Int 2005;21:153-60.
46. Mattar AF, Coran A, Teitelbaum DH. MUC-2 mucin production in Hirschsprung's disease:
possible association with entercolotis development. J Pediatr Surg 2003;38:417-21.
47. Paris MC, Fuller PJ, Carstensen B, Nagy E, Taylor RG, Sourial M, Holst JJ, Hartmann B, Binesm JE.
Plasma GLP-2 levels and intestinal markers in the juvenile pig during intestinal adaptation: effects
of different diet regimens. Dig Dis Sci 2004;49:1688-95.
AuthorAffiliation
Megan C. Hallam4 and Raylene A. Reimer4,5*
4Faculty of Kinesiology and 5Department of Biochemistry and Molecular Biology, University of
Calgary, Calgary, AB, Canada
* To whom correspondence should be addressed. E-mail: reimer@ucalgary.ca.

Subjek: Metabolic disorders; Rodents; Insulin; Glucose; Small intestine; Pregnancy; Proteins; Age;
Laboratory animals; Food; Diet; Permeability; Plasma; Gene expression; Probiotics; Females;
Judul: Postnatal Prebiotic Fiber Intake in Offspring Exposed to Gestational Protein Restriction Has
Sex-Specific Effects on Insulin Resistance and Intestinal Permeability in Rats1-3
Pengarang: Hallam, Megan C; Reimer, Raylene A
Judul publikasi: The Journal of Nutrition
14 November 2014

Page 14 of 15

ProQuest

Volume: 144
Edisi: 10
Halaman: 1556-63
Jumlah halaman: 8
Tahun publikasi: 2014
Tanggal publikasi: Oct 2014
Tahun: 2014
Penerbit: American Institute of Nutrition
Tempat publikasi: Bethesda
Negara publikasi: United States
Subjek publikasi: Nutrition And Dietetics
ISSN: 00223166
CODEN: JONUAI
Jenis sumber: Scholarly Journals
Bahasa publikasi: English
Jenis dokumen: Feature, Journal Article
Fitur dokumen: References Tables Graphs
Nomor aksesi: 25080539
ID dokumen ProQuest: 1566913313
URL Dokumen: http://search.proquest.com/docview/1566913313?accountid=50268
Hak cipta: Copyright American Institute of Nutrition Oct 2014
Terakhir diperbarui: 2014-11-04
Basis data: ProQuest Agriculture Journals
ProQuest Nursing & Allied Health Source

_______________________________________________________________
Hubungi ProQuest

Hak cipta

2014 ProQuest LLC. Semua hak cipta dilindungi. - Syarat dan Ketentuan

14 November 2014

Page 15 of 15

ProQuest