Experimental Gerontology 60 (2014) 215219

Contents lists available at ScienceDirect

Experimental Gerontology
journal homepage: www.elsevier.com/locate/expgero

Increased intestinal production of -defensins in aged rats with acute

pancreatic injury
Dbora Maria Gomes Cunha, Marcia Kiyomi Koike, Denise Frediani Barbeiro, Hermes Vieira Barbeiro,
Mike Yoshio Hamasaki, Guilherme Tude Coelho Neto,
Marcel Cerqueira Csar Machado, Fabiano Pinheiro da Silva
Emergency Medicine Department, University of Sao Paulo, Sao Paulo, Brazil

a r t i c l e

i n f o

Article history:
Received 23 July 2014
Received in revised form 9 November 2014
Accepted 12 November 2014
Available online 14 November 2014
Section Editor: B. Grubeck-Loebenstein
Keywords:
-Defensins
Pancreatitis
Rats
Elderly
Antimicrobial peptides
Intestine

a b s t r a c t
Acute pancreatitis is a life-threatening situation, frequently associated with uncontrolled local and systemic
inammation, and aging is associated with a worst prognosis. Antimicrobial peptides are ancient molecules
that belong to innate immunity, produced by epithelial and immune cells, and are able to trigger a myriad of
effector responses. We have hypothesized that antimicrobial peptides could play an important role during serious pancreatic injury. To investigate our hypothesis, -defensin-5, -defensin-7 and CRAMP gene expression
levels were measured in the intestinal tissue of old and young rats submitted to chemical pancreatic damage.
We found signicantly higher levels of -defensin-5 and -defensin-7, but not CRAMP, in the samples from
old mice. This increase was not associated with a worse systemic inammatory response. We conclude that defensins may have a pivotal role during acute pancreatitis and that the elderly develops a more severe local,
but not systemic inammatory process.
2014 Elsevier Inc. All rights reserved.

1. Introduction
Antimicrobial peptides (AMPs) are evolutionary conserved molecules produced by vertebrates, insects, and plants. They are considered
natural antibiotics because they directly kill invading pathogens by
creating pores to disrupt their cell membranes. In addition to these antimicrobial properties against Gram-positive and Gram-negative bacteria, protozoa, fungi, and viruses, many other functions were recently
described (Guani-Guerra et al., 2010; Lai and Gallo, 2009; Pinheiro da
Silva and Machado, 2012; Zasloff, 2002).
AMPs are produced mainly by epithelial cells and certain leukocytes,
probably because these cells are in constant or critical contact with potential pathogens and are called upon to defend against bacterial attack
(Beger et al., 1997; Cappell, 2008). Susceptible sites that produce AMPs
include the intestinal mucosa, skin, and respiratory and reproductive
tracts.

Abbreviations: AMPs, antimicrobial peptides; IL, interleukin; TNF, tumor necrosis factor;
DEFA, -defensin; IFN, interferon; TLR, Toll-like receptors.
Corresponding author at: Faculdade de Medicina da Universidade de So Paulo,
Laboratrio de Emergncias Clnicas (LIM-51), Av. Dr. Arnaldo, 455 sala 3189, CEP
01246-000 So Paulo, SP, Brazil.
E-mail address: pinheirofabiano@hotmail.com (F. Pinheiro da Silva).

http://dx.doi.org/10.1016/j.exger.2014.11.008
0531-5565/ 2014 Elsevier Inc. All rights reserved.

Integrity of the intestinal barrier is of critical importance for maintaining health. Diseases that alter intestinal permeability, such as sepsis
or acute pancreatitis, are associated with high morbidity and mortality
rates. Acute pancreatitis is a common disease in critical care and is
caused by alcoholism or gallstones (Cappell, 2008). The prognosis of
acute pancreatitis is directly related to the intensity of inammation. Elevated serum levels of interleukin-6 (IL-6) and tumor necrosis factor-
(TNF) are associated with higher mortality rates and are used in the
clinic to measure the severity of inammatory responses. A counterregulatory anti-inammatory response characterized by the production
of mediators such as IL-10 (Bhatia et al., 2000, 2001; Coelho et al., 1997;
Sakorafas and Tsiotou, 2000) is concomitantly triggered to prevent tissue damage caused by excessive inammation.
There has been an increase in life expectancy in economically developed countries and, more recently, in less developed countries. Many
studies have investigated the inammatory prole of the elderly during
inammatory catastrophes (Pinheiro da Silva et al., 2013), but it remains
inconclusive whether older patients can mount an effective immune response. Patients with advanced age have increased susceptibility to postoperative infections (Franceschi et al., 2000) and show an increase in
overall hospital mortality. Although these events might be related to depletion of the immune system, our group observed a similar inammatory prole when older septic patients were compared with young septic
patients (Pinheiro da Silva et al., 2013).

216

D.M.G. Cunha et al. / Experimental Gerontology 60 (2014) 215219

The aim of this study was to verify the local levels of intestinal antimicrobial peptides and the systemic inammatory prole of young and
old rats with acute pancreatitis.

2.3. Miliplex analysis

2. Material and methods

TNF, IL-1, IL-6, IL-10, interferon- (IFN), IP-10, and IL-18 serum
levels were measured by Miliplex Technology (Millipore, USA) and analyzed using the MAGPIX Xponent software. -defensin-5 (DEFA5)
serum levels were measured by ELISA.

2.1. Animals and model of acute pancreatitis

2.4. Statistical analysis

All experiments were performed at the Laboratory of Emergency

Medicine (LIM-51), University of So Paulo Faculty of Medicine, Brazil.
The protocol was approved by the University of Sao Paulo Faculty of
Medicine Animal Research and Ethics Committee (protocol # 156/13).
Wistar male rats, 280350 g, were anesthetized by intraperitoneal
injection of ketamine (75 mg/kg of body weight, Parke-Davis, So
Paulo, Brazil) and xylazine (10 mg/kg of animal body weight, Bayer
HealthCare, Toronto, Canada).
The animals were then divided into the following groups: Young
Pancreatitis (n = 10), Young Control (n = 17), Old Pancreatitis (n =
8), and Old Controls (n = 10). Young animals were 8 weeks old and
aged animals were 18 months old.
Acute pancreatitis was induced by injecting 2.5% taurocholic acid directly into the pancreatic duct (Sigma Chemical Company TM, St. Louis,
MO, USA) at a dose of 0.1 mL/100 g body weight (Penido et al., 2012).
After 12 h, the terminal ileum of the intestine was collected for molecular analysis by RT-PCR. Blood was collected from the cava vein and
serum was separated for Miliplex and DEFA5 analyses.

The results were compared by ANOVA or the KruskalWallis test, as

appropriate. A p-value of b0.05 was considered statistically signicant
and the results were reported as mean and standard deviation (SD). Statistical analysis was performed using Graphpad Prism 5.0 for Windows.

2.2. Gene expression by RT-PCR analysis

-defensin-5 (DEFA5), -defensin-7 (DEFA7), CRAMP, and TNF
mRNA levels were determined by quantitative PCR (qPCR), using
GAPDH as a housekeeping gene (Barbeiro et al., 2013). Total RNA was
isolated from terminal ileum extracts according to a standard Trizol
RNA protocol (Invitrogen, Carlsbad, USA). Samples of total RNA were
quantied by measuring the optical density at 260 nm (Nano Vue
Plus-spectrophotometer GE, New Jersey, USA). All qPCR reaction mixtures were prepared using Superscript Platinum III one step kits with
incorporated SYBR Green (Invitrogen, # 11736-051). One step cDNA
production and DNA amplication were performed on a Step One (Applied Biosystems Carlsbad, CA, USA) thermocycler and products were
conrmed on a 1.5% agarose gel. The sequences of primers used in this
study are described in Table 1. Reverse transcription was carried out
at 45 C for 30 min, 95 C for 5 min, and 5 C for 5 min. After reverse transcription, quantitative PCR was done using the following conditions:
95 C for 30 s, 60 C for 30 s, and 72 C for 1 min for 35 cycles. Resulting
levels of uorescence were submitted to relative quantication by normalization against a housekeeping gene and expressed as arbitrary
units (Wong and Medrano, 2005).

3. Results
At the macroscopic level, we could not identify obvious differences
in the appearance of the pancreatic tissue from young rats submitted
to chemical injury compared to aged rats in the same conditions. We
found, however, that at the terminal ileum, -defensin levels were
higher in aged animals with pancreatitis compared with all other
groups (p b 0.001) (Fig. 1A and B). The levels of CRAMP were similar
in the aged and young groups (p N 0.05) (Fig. 1C). TNF gene expression
levels, a well-known marker of inammation, were higher in the terminal ileum of aged rats with acute pancreatitis than in all other groups
(p b 0.001) (Fig. 1D).
Interestingly, serum TNF and DEFA5 levels of aged and young rats
were similar during the pancreatic insult (Fig. 2A and B), indicating that
differences in inammatory status are only observed at the local level.
Furthermore, systemic serum IL-1, IL-6, IL-10 and IL-18 levels (Fig. 3)
were similar in all study groups. Aged and young animals, moreover,
exhibited similar serum levels of IFN (Fig. 4A) and IP-10 (Fig. 4B).
Figures show the differences between young and aged animals during
the pancreatic insult. Controls were served only to show that the animals were previously healthy, and the differences between the control
and the pancreatitis group were disregarded, since they are already
well described (Machado et al., 2012).
4. Discussion
The molecular investigation of aging has attracted increased attention from the scientic community, because it is associated with
diseases such as atherosclerosis, Alzheimer's disease, type 2 diabetes
mellitus, and other major causes of death worldwide. Senescence, characterized by chronically elevated serum levels of inammatory markers
such as TNF, IL-1, IL-6, and C-reactive protein (Baylis et al., 2013;
Bruunsgaard et al., 2001), might inuence various components of the
immune system. Profound changes in the function of T cells, especially
T regulatory and Th17 cells, were described in the elderly (Haynes and
Maue, 2009; Maue and Haynes, 2009). Regarding innate immunity,

Table 1
Sequence of primers used in this study.
Gen

Primers

Annealing (C)

Cycles

DEFA7

Sense: ATGAGGACGCTCACTCTG CT
Anti-sense: ATCCCCTCCAAAGGATATGG
Sense: GGACGCTCACTCTGCTTA CC
Anti-sense: TCTTGGAGAGCAGTGCCTTT
Sense: AAGTATGTGAGGTTCCGAGTG AA
Anti-sense: ArCCAAACTTCTCTCCACCTTTTC
Sense: ACTCCCAGAAAAGCAAGC AA
Anti-sense: CGAGCAGGAATGAGAAGAGG
Sense: GAATTCCCTGGGAGAGAAGC
Anti-sense: CGGGTGGTTCAATTTTT AT
Sense: ATGATT CTA CCCACGGCA AG
Anti-sense: CTGGAAGATGGTGATGGGTT

60 C

40

60 C

40

60 C

38

60 C

40

60 C

40

60 C

40

DEFA5
CRAMP
TNF
IL-10
Housekeeping GAPDH

D.M.G. Cunha et al. / Experimental Gerontology 60 (2014) 215219

B
p < 0.001

20

p < 0.001
DEFA7 gene expression
(arbitrary units)

DEFA5 gene expression

(arbitrary units)

A
15
10
5

20
15

control group
pancreas group

10
5
0

OLD

OLD

YOUNG

YOUNG

p = 0.129

p < 0.001

TNF gene expression

(arbitrary units)

CRAMP gene expression

(arbitrary units)

217

500
400
300
200
100
0

OLD

YOUNG

OLD

YOUNG

Fig. 1. Gene expression of -defensin-5 (A), -defensin-7 (B), CRAMP (C), and TNF- (D) in the distal ileum of rats.

changes caused by aging have been described in macrophages, polymorphonuclear cells, and natural killer cells (Pawelec et al., 1998;
Shaw et al., 2010). However, discrepant results have been reported
and the inammatory status of the elderly during critical illness is
under intense investigation (Panda et al., 2009). While some studies reported increased proinammatory activity in the elderly during acute
stress compared with the young (Han et al., 1995), others have described opposite results (Effros et al., 1991).
Acute pancreatitis has mild and severe forms and the latter is notoriously associated with high mortality rates. Severe acute pancreatitis
is characterized by pancreatic necrosis and peri-pancreatic necrosis
and systemic complications, often leading to multiple organ failure
(Fan et al., 1988). Why older adults exhibit a higher mortality rate
than the young remains unclear.
The intestinal barrier plays a key role in acute pancreatitis (Fu et al.,
2012), because increased gut permeability can lead to bacterial

B
p = 0.51
DEFA5 (pg/ml)

100

TNF (pg/ml)

translocation and exacerbated inammatory responses (Ammori et al.,

1999; Beger et al., 1986). Aging impacts many branches of the intestinal
immune system (Man et al., 2014). AMPs, especially defensins and
cathelicidin LL-37, produced by the gut epithelial barrier, might be
also affected, since they contribute to the maintenance of intestinal integrity (Yasuda et al., 2006).
Tiszlavicz et al. (2010) demonstrated that variations in the copy
number of the -defensin gene were associated with increased severity
of acute pancreatitis. In their study, a high number of copies of the defensin gene predicted a worse outcome and a study by Gallo et al.
(1997) showed a reduction in the expression levels of CRAMP in the intestine of young mice compared with neonatal mice, suggesting CRAMP
might have a protective role in neonatal mice.
Several studies reported a reduction of -defensin production in the
terminal ileum of patients with Crohn's disease (Perminow et al., 2010;
Simms et al., 2008; Wehkamp et al., 2005; Wehkamp and Stange, 2010).

80
60
40

p = 0.09
10
8
6
4

20

OLD

YOUNG

OLD

YOUNG

Fig. 2. Determination of TNF- (A) and -defensin-5 (B) serum levels.

control group
pancreas group

218

D.M.G. Cunha et al. / Experimental Gerontology 60 (2014) 215219

250

p = 0.28
IL-6 (pg/ml)

IL-1 (pg/ml)

200
150
100
50

3000
2000
1000
0

OLD

YOUNG
p = 0.40

100

OLD

80
60
40

YOUNG

1000

IL-18 (pg/ml)

IL-10 (pg/ml)

control group
pancreas group

4000

p = 0.95

5000

p = 0.76

800
600
400
200

20

OLD

YOUNG

OLD

YOUNG

Fig. 3. Determination of IL-1 (A), IL-6 (B), IL-10 (C) and IL-18 (D) serum levels.

Overall, these studies suggest that a decrease in intestinal -defensin

production facilitates bloodstream infection through the gut.
In the current study, we found that -defensin-5 and -7 were considerably increased in the elderly rat group compared with the young
group, during acute pancreatitis. Recent experiments from our group
demonstrated that bacterial translocation was increased in aged rats
compared with young rats (manuscript in preparation), and that acute
pancreatitis was more severe in elderly than in young animals.
Previous studies demonstrated that Toll-like receptors (TLRs) play a
crucial role in the production of defensins in the gastrointestinal system.
A recent study by Ayala-Sumuano et al. (2013) demonstrated that Entamoeba histolytica activated TLRs 2 and 4, inducing potent production
of -defensin-2. Rizzo et al. also showed that Chlamydia pneumoniae induced TLR4 activation and subsequent -defensin-2 production (Rizzo
et al., 2008). Scarpa and colleagues studied patients with ulcerative colitis and showed increased -defensin 5 and 6 gene expression after
surgical procedures (Scarpa et al., 2012). Chalifour et al. demonstrated
that natural killer cells activated by TLR agonists produced excessive
levels of -defensin-5 and IFN (Chalifour et al., 2004).
We propose that older rats have defective intestinal integrity and that
during acute pancreatitis there is an enhanced bacterial translocation,

p = 0.29

5. Conclusion
The mechanisms underlying the increased severity of acute pancreatitis in the elderly are complex. Here, we showed that aged rats exhibited increased intestinal production of -defensins compared with
young rats. We hypothesize that this was associated with exacerbated
bacterial translocation that might affect the elderly. Antimicrobial peptide release, moreover, might further increase inammatory processes,

150

p = 0.27

800

IP-10 (pg/ml)

IFN- (pg/ml)

which triggers a greater production of -defensins by Paneth cells, the

major source of intestinal AMPs. Indeed, TLR receptors activated by danger signals and bacteria can stimulate antimicrobial peptide synthesis
and release.
The signicant increase in TNF, DEFA5 and DEFA7 gene expression
in aged animals conrmed that aged rats developed more severe local
inammation compared with young rats. We propose that a more severe local inammation may affect prognosis, even when the systemic
inammatory response is similar between the study groups. The impact
of local inammatory processes that occur even at distant sites, during
systemic inammatory syndromes, is poorly characterized and merits
deeper attention, especially in the aged patient.

100

50

600
400
200

OLD

YOUNG

OLD

YOUNG

Fig. 4. Determination of IFN (A) and IP-10 (B) serum levels.

control group
pancreas group

D.M.G. Cunha et al. / Experimental Gerontology 60 (2014) 215219

because they activate many immune pathways, potentially creating a

vicious deleterious circle. Although antimicrobial peptides are very
effective alarmins, they might also aggravate local injury. Therefore, further studies are warranted to investigate the multiple effects that antimicrobial peptides might exert on the inammatory course of acute
pancreatitis.
Conicts of interest
The authors declare that they have no nancial or ethical conicts of
interest.
Acknowledgments
FPS is supported by the FAPESP, Sao Paulo Research Foundation
(grant no. 2009/17731-2) and the CNPq, The National Council for Scientic and Technological Development (grant no. 470539/2013-15).
References
Ammori, B.J., Leeder, P.C., King, R.F., Barclay, G.R., Martin, I.G., Larvin, M., McMahon, M.J.,
1999. Early increase in intestinal permeability in patients with severe acute pancreatitis: correlation with endotoxemia, organ failure, and mortality. J. Gastrointest. Surg.
3, 252262.
Ayala-Sumuano, J.T., Tellez-Lopez, V.M., Dominguez-Robles Mdel, C., Shibayama-Salas, M.,
Meza, I., 2013. Toll-like receptor signaling activation by Entamoeba histolytica induces
beta defensin 2 in human colonic epithelial cells: its possible role as an element of the
innate immune response. PLoS Negl. Trop. Dis. 7, e2083.
Barbeiro, D.F., Barbeiro, H.V., Zampieri, F.G., Cesar Machado, M.C., Torggler Filho, F.,
Gomes Cunha, D.M., Goulart, A.C., Velasco, I.T., Monteiro da Cruz Neto, L., Possolo
de Souza, H., Pinheiro da Silva, F., 2013. Cathelicidin LL-37 bloodstream surveillance
is down regulated during septic shock. Microbes Infect. 15, 342346.
Baylis, D., Bartlett, D.B., Patel, H.P., Roberts, H.C., 2013. Understanding how we age: insights into inammaging. Longev. Healthspan 2, 8.
Beger, H.G., Bittner, R., Block, S., Buchler, M., 1986. Bacterial contamination of pancreatic
necrosis. A prospective clinical study. Gastroenterology 91, 433438.
Beger, H.G., Rau, B., Mayer, J., Pralle, U., 1997. Natural course of acute pancreatitis. World J.
Surg. 21, 130135.
Bhatia, M., Brady, M., Shokuhi, S., Christmas, S., Neoptolemos, J.P., Slavin, J., 2000. Inammatory mediators in acute pancreatitis. J. Pathol. 190, 117125.
Bhatia, M., Neoptolemos, J.P., Slavin, J., 2001. Inammatory mediators as therapeutic targets in acute pancreatitis. Curr. Opin. Investig. Drugs 2, 496501.
Bruunsgaard, H., Pedersen, M., Pedersen, B.K., 2001. Aging and proinammatory cytokines. Curr. Opin. Hematol. 8, 131136.
Cappell, M.S., 2008. Acute pancreatitis: etiology, clinical presentation, diagnosis, and therapy. Med. Clin. North Am. 92, 889923 (ix-x).
Chalifour, A., Jeannin, P., Gauchat, J.F., Blaecke, A., Malissard, M., N'Guyen, T., Thieblemont,
N., Delneste, Y., 2004. Direct bacterial protein PAMP recognition by human NK cells
involves TLRs and triggers alpha-defensin production. Blood 104, 17781783.
Coelho, A.M., Machado, M.C., Sampietre, S.N., Leite, K.R., Oliveira, V.L., Pinotti, H.W., 1997. Hepatic damage during acute pancreatitis in the rat. Braz. J. Med. Biol. Res. 30, 947953.
Effros, R.B., Svoboda, K., Walford, R.L., 1991. Inuence of age and caloric restriction on
macrophage IL-6 and TNF production. Lymphokine Cytokine Res. 10, 347351.
Fan, S.T., Choi, T.K., Lai, C.S., Wong, J., 1988. Inuence of age on the mortality from acute
pancreatitis. Br. J. Surg. 75, 463466.
Franceschi, C., Bonafe, M., Valensin, S., Olivieri, F., De Luca, M., Ottaviani, E., De Benedictis, G.,
2000. Inamm-aging. An evolutionary perspective on immunosenescence. Ann. N. Y.
Acad. Sci. 908, 244254.
Fu, S., Stanek, A., Mueller, C.M., Brown, N.A., Huan, C., Bluth, M.H., Zenilman, M.E., 2012.
Acute pancreatitis in aging animals: loss of pancreatitis-associated protein protection? World J. Gastroenterol. 18, 33793388.

219

Gallo, R.L., Kim, K.J., Berneld, M., Kozak, C.A., Zanetti, M., Merluzzi, L., Gennaro, R., 1997.
Identication of CRAMP, a cathelin-related antimicrobial peptide expressed in the
embryonic and adult mouse. J. Biol. Chem. 272, 1308813093.
Guani-Guerra, E., Santos-Mendoza, T., Lugo-Reyes, S.O., Teran, L.M., 2010. Antimicrobial
peptides: general overview and clinical implications in human health and disease.
Clin. Immunol. 135, 111.
Han, D., Hosokawa, T., Aoike, A., Kawai, K., 1995. Age-related enhancement of tumor necrosis factor (TNF) production in mice. Mech. Ageing Dev. 84, 3954.
Haynes, L., Maue, A.C., 2009. Effects of aging on T cell function. Curr. Opin. Immunol. 21,
414417.
Lai, Y., Gallo, R.L., 2009. AMPed up immunity: how antimicrobial peptides have multiple
roles in immune defense. Trends Immunol. 30, 131141.
Machado, M.C., Coelho, A.M., Carneiro D'Albuquerque, L.A., Jancar, S., 2012. Effect of ageing
on systemic inammatory response in acute pancreatitis. Int. J. Inamm. 270319, 2012.
Man, A.L., Gicheva, N., Nicoletti, C., 2014. The impact of ageing on the intestinal epithelial
barrier and immune system. Cell. Immunol. 289, 112118.
Maue, A.C., Haynes, L., 2009. CD4+ T cells and immunosenescence a mini-review. Gerontology 55, 491495.
Panda, A., Arjona, A., Sapey, E., Bai, F., Fikrig, E., Montgomery, R.R., Lord, J.M., Shaw, A.C.,
2009. Human innate immunosenescence: causes and consequences for immunity
in old age. Trends Immunol. 30, 325333.
Pawelec, G., Solana, R., Remarque, E., Mariani, E., 1998. Impact of aging on innate immunity. J. Leukoc. Biol. 64, 703712.
Penido, A., Coelho, A.M., Molan, N.T., Silva, F.P., D'Albuquerque, L.A., Machado, M.C., 2012.
Do opioid receptors play a role in the pathogenesis of the inammatory response in
acute pancreatitis? Acta Cir. Bras. 27, 600605.
Perminow, G., Beisner, J., Koslowski, M., Lyckander, L.G., Stange, E., Vatn, M.H., Wehkamp,
J., 2010. Defective paneth cell-mediated host defense in pediatric ileal Crohn's disease. Am. J. Gastroenterol. 105, 452459.
Pinheiro da Silva, F., Machado, M.C., 2012. Antimicrobial peptides: clinical relevance and
therapeutic implications. Peptides 36, 308314.
Pinheiro da Silva, F., Zampieri, F.G., Barbeiro, D.F., Barbeiro, H.V., Goulart, A.C., Torggler
Filho, F., Velasco, I.T., da Cruz Neto, L.M., de Souza, H.P., Machado, M.C., 2013. Septic
shock in older people: a prospective cohort study. Immun. Ageing 10, 21.
Rizzo, A., Paolillo, R., Buommino, E., Lanza, A.G., Guida, L., Annunziata, M., Carratelli, C.R.,
2008. Modulation of cytokine and beta-defensin 2 expressions in human gingival broblasts infected with Chlamydia pneumoniae. Int. Immunopharmacol. 8, 12391247.
Sakorafas, G.H., Tsiotou, A.G., 2000. Etiology and pathogenesis of acute pancreatitis: current concepts. J. Clin. Gastroenterol. 30, 343356.
Scarpa, M., Grillo, A., Scarpa, M., Brun, P., Castoro, C., Pozza, A., Cavallo, D., Faggian, D.,
Ruffolo, C., D'Inca, R., Bardini, R., Castagliuolo, I., Angriman, I., 2012. Innate immune
environment in ileal pouch mucosa: alpha5 defensin up-regulation as predictor of
chronic/relapsing pouchitis. J. Gastrointest. Surg. 16, 188201 (discussion 201-182).
Shaw, A.C., Joshi, S., Greenwood, H., Panda, A., Lord, J.M., 2010. Aging of the innate immune system. Curr. Opin. Immunol. 22, 507513.
Simms, L.A., Doecke, J.D., Walsh, M.D., Huang, N., Fowler, E.V., Radford-Smith, G.L., 2008.
Reduced alpha-defensin expression is associated with inammation and not NOD2
mutation status in ileal Crohn's disease. Gut 57, 903910.
Tiszlavicz, Z., Szabolcs, A., Takacs, T., Farkas, G., Kovacs-Nagy, R., Szantai, E., SasvariSzekely, M., Mandi, Y., 2010. Polymorphisms of beta defensins are associated with
the risk of severe acute pancreatitis. Pancreatology 10, 483490.
Wehkamp, J., Stange, E.F., 2010. Paneth's disease. J. Crohn's Colitis 4, 523531.
Wehkamp, J., Salzman, N.H., Porter, E., Nuding, S., Weichenthal, M., Petras, R.E., Shen, B.,
Schaeffeler, E., Schwab, M., Linzmeier, R., Feathers, R.W., Chu, H., Lima Jr., H.,
Fellermann, K., Ganz, T., Stange, E.F., Bevins, C.L., 2005. Reduced Paneth cell alphadefensins in ileal Crohn's disease. Proc. Natl. Acad. Sci. U. S. A. 102, 1812918134.
Wong, M.L., Medrano, J.F., 2005. Real-time PCR for mRNA quantitation. BioTechniques 39,
7585.
Yasuda, T., Takeyama, Y., Ueda, T., Shinzeki, M., Sawa, H., Nakajima, T., Kuroda, Y., 2006.
Breakdown of intestinal mucosa via accelerated apoptosis increases intestinal permeability in experimental severe acute pancreatitis. J. Surg. Res. 135, 1826.
Zasloff, M., 2002. Antimicrobial peptides of multicellular organisms. Nature 415, 389395.