You are on page 1of 58

Molecular Epidemiology of infectious diseases

Gilman K.H. Siu

Assistant Professor, The Hong Kong Polytechnic University

Ph.D, BSc, MSB, MB(ASCP i )

YOUR YOUR LOGO LOGO
YOUR YOUR LOGO LOGO

Principle and Approach

YOUR YOUR LOGO LOGO

General Concept

Molecular Biology Epidemiology Microbiology
Molecular
Biology
Epidemiology
Microbiology

Molecular epidemiology of

infectious diseases

Integrates practices and principle of molecular

biology and

microbiology

with those of epidemiology

YOUR LOGO

Definition

Epidemiology:

The study of the distribution and determinants of diseases and injures in human populations

Molecular Epidemiology of Infectious Diseases:

The study of the distribution and determinants of infectious diseases that utilizes molecular biology methods

Page 4

YOUR LOGO

Purpose

  • To identify the microorganisms responsible for infectious disease

─ Determinants

  • To determine their physical sources

  • To identify the genetic factors that determine and regulate an organism’s specific pattern of transmission

  • To identify the genes responsible for their virulence, vaccine-relevant antigens and drug resistance

Distribution

YOUR LOGO

Epidemiology? Taxonomy? Phylogeny?

Epidemiology? Taxonomy? Phylogeny?  One third of them deal with infectious disease topic  More than
  • One third of them deal with infectious disease topic

  • More than half only focus on laboratory method, no discussion on the use of these techniques to characterize disease occurrence, distribution, or determinants of disease distribution.

  • NOT molecular epidemiology, but Molecular Taxonomy or Molecular Phylogeny

YOUR LOGO

Epidemiology? Taxonomy? Phylogeny?

Molecular Taxonomy:

  • Science of classification of organisms into naturally related groups based on genetic factors common to each

  • Taxonomy uses strain-typing techniques to describe properties and characteristics of organisms

    • e.g. M. tuberculosis can be subdivided into East Asia (Beijing) lineage, Africa lineage etc.

  • Epidemiology targets on organism itself AND its interactions with the host and the environment in which it resides.

    • e.g. M. tuberculosis Beijing lineage is more virulent and associated with drug resistance

YOUR LOGO
YOUR LOGO
Epidemiology? Taxonomy? Phylogeny? Molecular Taxonomy:  Science of classification of organisms into naturally related groups based

Epidemiology? Taxonomy? Phylogeny?

Molecular Phylogeny:

Epidemiology? Taxonomy? Phylogeny? Molecular Phylogeny: YOUR LOGO Determine the association of the genetic attributes with disease

YOUR LOGO

Determine the association of the genetic

attributes with disease severity

  • Study of lines descent or evolutionary development of an organism

  • Both epidemiology and phylogeny describe the distribution of particular genetic attributes of a pathogen in a population over time

Inferred evolution history of H3N2 by genetic attributes

  • Phylogenetic analysis seeks to infer past evolution event cannot be empirically confirmed

  • Epidemiology focuses on events of the present, uses analytical study designs to predict or validate the relationship of these attributes to disease distribution, transmission and manifestation

Application of Strain- Typing Techniques in Epidemiology

YOUR YOUR LOGO LOGO

Epidemiological problems addressed by strain-typing

techniques

Determining dynamics of disease transmission in geographically widespread disease

  • Study how an organism or a strain introduce and spread into a community

  • Identify reasons for changes in prevalence of infections or syndromes

  • Study the factors (host, environment, organism) that contribute to transmission

Epidemiological problems addressed by strain-typing techniques Determining dynamics of disease transmission in geographically widespread disease 
  • E.g. Strain typing techniques

changes our concept in transmission dynamics of diarrheal disease

YOUR LOGO

Page 10

Epidemiological problems addressed by strain-typing techniques

  • Without the strain-typing

information, the cases of diarrheal

diseases may appear endemic (no major fluctuation in occurrence of disease over time)

  • The ability to better discriminate between cases according to strain types reveal outbreaks that

had not been previously detected.

Page 11

Epidemiological problems addressed by strain-typing techniques  Without the strain-typing information, the cases of diarrheal diseases
YOUR LOGO
YOUR LOGO

Epidemiological problems addressed by strain-typing techniques

Identifying risk of infectious diseases

  • A strain characterized by a typing method that has previously been shown to be linked to a particular vehicle or reservoir may provide a clue about the sources of infection

    • E.g. H9N2 is associated with poultry

  • Information can be used to generate a

hypothesis and to design cross- sectional or prospective studies to determine the proportion of infections caused by such a strain.

Epidemiological problems addressed by strain-typing techniques Identifying risk of infectious diseases  A strain characterized by

YOUR LOGO

Epidemiological problems addressed by strain-typing techniques

Stratifying data and refining epidemiologic study designs

  • Molecular strain typing methods can group data related to infectious agents by subtypes a new discrete units.

  • Patients infected with these organisms can be reclassified according to these isolates’ new groupings a new case definition.

  • E.g Patients from whom M. tuberculosis is isolated would all be grouped as TB patient.

    • But if those M. tuberculosis strains were typed for drug resistance

    • Patients can be reclassified according to the drug resistance of

their isolates.

  • Redefine the cases (patients with DR-TB) and control (patients with nonDR-TB) to identify risk factors for the infection (e.g risk factors for drug resistant TB)

Page 13

YOUR LOGO

Epidemiological problems addressed by strain-typing

techniques

Distinguishing pathovars from nonpathvars

  • A pathogenic variant of an organism is referred as a pathovar

  • E.g. E. coli was harboured in every healthy human host. Yet some strains can cause hemolytic-uremic syndrome and kill 53 people in Europe in 2011.

  • Distinguishing between E. coli strains associated with a particular type of disease, and separating them from non-pathogenic variants is an important activity in epidemiological investigation

Page 14

Epidemiological problems addressed by strain-typing techniques Distinguishing pathovars from nonpathvars  A pathogenic variant of an
YOUR LOGO
YOUR LOGO

Epidemiological problems addressed by strain-typing techniques

Distinguishing hospital and community infectious disease problems

  • Issues related to infectious disease problem in hospital settings are often distinct from those related to field or community settings.

  • Strain-typing helps to identify the genetic determinants which are specific to the strains circulating in hospital and community respectively

 

CA-MRSA

HA-MRSA

 

At-risk groups/conditions

Children, athletes

Long-term care facility residents

SCCmec type

IV, V

I, II,and III

Antimicrobial resistance

Usually β-lactam resistance alone

Multidrug resistance

Panton Valentine leukocidin

Frequent

rare

Associated clinical syndromes

Skin and soft tissue

Sepsis, pneumonia, UTI

infection

 

YOUR LOGO

 

Epidemiological problems addressed by strain-typing techniques

Identifying genetic determinants of disease transmission

  • Infectious disease transmission is an interaction of

characteristic of the pathogen, the host, and the

environment

  • Molecular typing technique can help to identify:

Epidemiological problems addressed by strain-typing techniques Identifying genetic determinants of disease transmission  Infectious disease transmission
  • Genetic determinants of human susceptibility to certain infectious diseases

    • - People with single copy of sickle cell anaemia mutation are naturally resistant to malaria.

  • Genetic determinants of microorganisms that facilitate their transmission

    • - usually structural genes and regulatory genes

    • - Some strains of Clostridium difficile showed overexpression of sporulation genes hyperproduction of spore facilitate their transmission

Page 16

Epidemiological problems addressed by strain-typing techniques Identifying genetic determinants of disease transmission  Infectious disease transmission

YOUR LOGO

Examples of Strain-typing methods

YOUR YOUR LOGO LOGO

Conventional epidemiological typing methods

  • Antibiogram

    • Typing based on the susceptibility patterns of the strains against different antibiotics

  • Serotyping

    • Identifying the distinct variations among the strains based on the interactions between antibodies and cell surface antigens

  • Phage typing

    • Differentiating bacterial strains based on the specificities of different bacteriophages to infect particular bacterial strains

Limitation

  • Low discrimination power outbreak strains may share the same antiobiogram with sporadic strains

  • Fastidious bacteria / viruses cannot be grown in culture media

Conventional epidemiological typing methods  Antibiogram  Typing based on the susceptibility patterns of the strains
Conventional epidemiological typing methods  Antibiogram  Typing based on the susceptibility patterns of the strains
YOUR LOGO
YOUR LOGO

Molecular typing methods

Non-amplified typing methods

  • Involve analysis of the whole genome high discriminative power

    • Restriction fragment length polymorphism (RFLP) - with / without probe hybridization

    • Pulsed field gel electrophoresis (PFGE)

Amplification-based typing methods

  • Involve analysis of single or multiple genetic regions variable discriminative power

    • PCR-ribotyping

    • spa typing

    • Variable number of tandem repeat (VNTR)

    • Multiocus sequencing typing (MLST)

YOUR LOGO

Restriction fragment length polymorphism (RFLP)

Principle

  • Fragmentation of genomic DNA by restriction enzymes

  • No. and size of fragments rely on the

frequency and distribution of the cutting sites

  • Fragments pattern can be simply visualized by gel electrophoresis

  • Two clonally related strains contain almost identical DNA sequences cutting site should be conserved identical electrophoresis

  • Can be theoretically applied on all bacterial species.

  • But some restriction sites may be commonly

found throughout bacterial genome large

number of DNA fragments or even smears

Restriction fragment length polymorphism (RFLP) Principle  Fragmentation of genomic DNA by restriction enzymes  No.
Restriction fragment length polymorphism (RFLP) Principle  Fragmentation of genomic DNA by restriction enzymes  No.

YOUR LOGO

Restriction fragment length polymorphism (RFLP)

RFLP with DNA probe

  • The DNA fragments produced by RE is separated by gel electrophoresis and transferred to a membrane filter.

  • The filter is incubated with a probe that hybridizes to a specific genes

  • Simplify the restriction fragments pattern by selecting only those containing the specific genes

  • Sequence differences in the regions flanking the gene of interest lead to variability in fragment patterns discriminate between related strains

Restriction fragment length polymorphism (RFLP) RFLP with DNA probe  The DNA fragments produced by RE
  • Insertion Sequence 6110 (IS6110) RFLP

    • High discriminative power

    • Still considered as gold standard for M. tuberculosis typing

YOUR LOGO

Restriction fragment length polymorphism (RFLP)

Application

  • IS6110-RFLP- Gold standard method for epidemiological investigation of M. tuberculosis transmission

YOUR LOGO

Restriction fragment length polymorphism (RFLP)

Limitations

  • Involves tedious and time consuming experimental procedure

    • Gel electrophoresis > 24 hours

  • Not amplification steps require very heavy bacterial inocula for DNA extraction

    • particularly dangerous for MTB

  • Require intact DNA extract (no DNA shearing is allowed )

  • Low throughput

  • Poor interlaboratory portability

    • getting improved by image capturing

software which converts analog band pattern into digital pattern

Restriction fragment length polymorphism (RFLP) Limitations  Involves tedious and time consuming experimental procedure  Gel

YOUR LOGO

Pulsed field gel electrophoresis

Principle

  • Bacterial chromosome is digested with rare cutting enzyme (6-8 bases)

  • Protect chromosomal DNA from mechanical damage by immobilizing the bacteria into agarose block during lysis

  • Fragments are separated by gel electrophoresis subjected to an alternating voltage gradient in which the orientation of electric field switches direction periodically

  • Can resolve DNA fragment up to 800kb

  • Point mutations, deletions/ insertion, lost or gain of plasmids difference in profile among epidemiologically related strains

  • Very high discriminative power good for outbreak investigation

YOUR LOGO
YOUR LOGO

Pulsed field gel electrophoresis

  • PFGE protocol and rare cutting enzymes have been standardized for various bacterial pathogen

Pulsed field gel electrophoresis  PFGE protocol and rare cutting enzymes have been standardized for various

YOUR LOGO

Pulsed field gel electrophoresis

Application

  • Investigation of MRSA outbreak in Neonatal ICU

Incubator 1

MRSA

Pulsed field gel electrophoresis Application  Investigation of MRSA outbreak in Neonatal ICU Incubator 1 MRSA

MRSA

Pulsed field gel electrophoresis Application  Investigation of MRSA outbreak in Neonatal ICU Incubator 1 MRSA
Pulsed field gel electrophoresis Application  Investigation of MRSA outbreak in Neonatal ICU Incubator 1 MRSA
Pulsed field gel electrophoresis Application  Investigation of MRSA outbreak in Neonatal ICU Incubator 1 MRSA
Pulsed field gel electrophoresis Application  Investigation of MRSA outbreak in Neonatal ICU Incubator 1 MRSA
Pulsed field gel electrophoresis Application  Investigation of MRSA outbreak in Neonatal ICU Incubator 1 MRSA
Pulsed field gel electrophoresis Application  Investigation of MRSA outbreak in Neonatal ICU Incubator 1 MRSA

Incubator 2

Pulsed field gel electrophoresis Application  Investigation of MRSA outbreak in Neonatal ICU Incubator 1 MRSA
MRSA MRSA YOUR LOGO
MRSA
MRSA
YOUR LOGO

Pulsed field gel electrophoresis

Application

  • MRSA isolated from neonates who lived in incubator 1 had the same antibiogram Cli-S/R; Ery-R; Fus-S/R; Gen-S/R; Mth-R; Rif-S/R; Van-S

  • PFGE after SmaI digestion were performed for the following samples

    • 14 MRSA from new born

    • 1 MRSA from air sample

    • 2 MRSA from baby with no contact to the incubator (internal control group)

    • 12 MRSA from a small epidemic in another hospitals (external control group)

Page 27

YOUR LOGO

Pulsed field gel electrophoresis

Internal air External control 14 MRSA in neonates sample control
Internal
air
External
control
14 MRSA in neonates
sample control

Standardized

interpretation rule

  • Closely related

    • Difference in 2-3 fragments

    • Possibly related

      • Difference in 4-6 fragments

    • Unrelated

      • Difference in ≥ 7

fragments

YOUR LOGO

Pulsed field gel electrophoresis

Limitations

  • Labour intensive, requiring multiple days to perform experimental work

  • Poor portability

  • Low intra- or inter-laboratory reproducibility - The intensity of banding patterns can

be affected by many factors, e.g.

i. Cell concentration ii. Incomplete digestion of DNA iii. Faulty electrodes iv. Uneven gel thickness

v. Buffer height due to uneven

surfaces used for electrophoresis

  • Some bacterial species, such as Streptococci spp. and Pseudomonas, are difficult to be typed due to DNA degradation by their DNAse production

Pulsed field gel electrophoresis Limitations  Labour intensive, requiring multiple days to perform experimental work 

YOUR LOGO

Repetitive Sequence-Based PCR (Rep-PCR)

Principle

  • PCR amplification of spacer fragments lying between repeat motifs of the using primers that bind to the repeat motifs.

  • Amplicons are separated by electrophoresis to generate banding patterns

  • Banding patterns differ as a result of the number of repetitive elements and their relative position within the bacterial genome.

  • Moderate discriminatory power - depends on the method used and the number of repetitive sequences present in strains

  • Also affect by PCR reagents, thermal cycling and gel electrophoresis

YOUR LOGO

Repetitive Sequence-Based PCR (Rep-PCR)

Application

  • PCR-ribotyping for Clostridium difficile

    • Uses specific primers complementary to the 3’ end of the 16S rRNA gene and

to the 5’ end of the 23S

rRNA gene to amplify the variable-length intergenic spacer region.

  • The most common method for C. difficile typing

  • Ribotype 027 considered as hypervirulent strain highly associated with severe form of infection (Pseudomembranous colitis)

Repetitive Sequence-Based PCR (Rep-PCR) Application  PCR-ribotyping for Clostridium difficile  Uses specific primers complementary to
YOUR LOGO
YOUR LOGO

Repetitive Sequence-Based PCR (Rep-PCR)

Repetitive Sequence-Based PCR (Rep-PCR)  In Hong Kong, The most predominant C. difficile strains is PCR
  • In Hong Kong, The most predominant C. difficile strains is PCR ribotype 002

  • Significantly higher sporulation frequency (20.2% [002] vs 3.7% [other ribo])

  • Warning on potential outbreak in

Hong Kong hospitals

YOUR LOGO

Variable number of tandam repeat (VNTR) analysis

Principle

  • Repetitive sequence DNA motifs ranging from a few bases to > 100 bp

  • Tandem: copies of repeat motifs clustered together and oriented in the same direction

  • No. of repeats in a tandem highly

variable due to DNA strand slippage during replication

Variable number of tandam repeat (VNTR) analysis Principle  Repetitive sequence DNA motifs ranging from a
  • Primers anneal non-repetitive sequences

just outside the repeat region amplicon size determines no. of repeat

Variable number of tandam repeat (VNTR) analysis Principle  Repetitive sequence DNA motifs ranging from a

YOUR LOGO

Variable number of tandam repeat (VNTR) analysis

Application

  • Mycobacterial Interspersed repeat units VNTR (MIRU-VNTR)

    • Short sequence repeats in M. tuberculosis genome

    • Tandemly repeated sequences of 40-100 bp

    • Location and number of repeats varies in different M. tuberculosis strains

    • Based on 15 to 24 loci

    • Better predictive value than IS6110-RFLP

Variable number of tandam repeat (VNTR) analysis Application  Mycobacterial Interspersed repeat units – VNTR (MIRU-VNTR)
Variable number of tandam repeat (VNTR) analysis Application  Mycobacterial Interspersed repeat units – VNTR (MIRU-VNTR)

YOUR LOGO

Variable number of tandam repeat (VNTR) analysis

A web-based database for MIRU-VNTR typing - www.miru-vntrplus.org/

Variable number of tandam repeat (VNTR) analysis A web-based database for MIRU-VNTR typing - www. miru
Variable number of tandam repeat (VNTR) analysis A web-based database for MIRU-VNTR typing - www. miru

YOUR LOGO

Variable number of tandam repeat (VNTR) analysis

Application

  • Typing for C.difficile outbreak investigation

    • Mini-outbreak in elderly home of Kowloon Hospital

    • Collected 13 C.difficile isolates from patients with severe diarrhoeae

    • PCR-ribotyping reveals all belong to R-002 (cannot differentiate from sporadic cases)

    • Investigate 7-loci VNTR

YOUR LOGO

Variable number of tandam repeat (VNTR) analysis

Very High discriminative power !!

Variable number of tandam repeat (VNTR) analysis Very High discriminative power !! 13 suspected outbreak isolates

13 suspected outbreak isolates from Kowloon Hospital

3 isolates from other wards

in Kowloon Hospital

Sporadic R002 isolates from other hospitals

Isolates with a summed tandem repeat difference

of ≤2 are genetically

YOUR LOGO

related

Staphylococcus protein A gene (spa) typing

  • The emergence of MRSA has become a major concern, especially in the hospital environment, because of the high mortality of the infections caused by these strains

  • There is evidence for recombination in S. aureus

  • Single locus DNA-sequencing of repeat regions of the Staphylococcus protein A gene (spa) could be used for reliable and accurate typing of MRSA

  • Identify the number and the sequence of repeat unit (24-bp) in the spa gene

Page 38

Staphylococcus protein A gene ( spa ) typing  The emergence of MRSA has become a

YOUR LOGO

Staphylococcus protein A gene (spa) typing

Step 1:

Obtain a sequence of spa using the PCR-sequencing protocol described by Harmsen D et

al. Harmsen D., Claus H., Witte W., Rothgänger J., Claus H., Turnwald D., & Vogel U. (2003). Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting using a novel software for spa-repeat determination and database management. J. Clin. Microbiol.

41:5442-5448

TAAAAGCTAAAAGCTAAACGATGCTCAAGCACCAAAAGAGGAAGACAATAACAAGCCTGGTAAAGAAGACAACAA

CAAACCTGGCAAAGAAGACGGCAACAAGCCTGGCAAAGAAGACGGCAACAAGCCTGGTAAAGAAGATGGCAACAA

ACCTGGTAAAGAAGACAACAAAAAACCTGGTAAAGAAGACGGCAACGGAGTACATGTCGTTAAACCTGGTGATAC

AGTAAATGACATTGCAAAAGCAAACGGCACTACTGCTGA

Step 2:

Identify the ends of the hypervariable region of the spa gene

Staphylococcus protein A gene ( spa ) typing Step 1: Obtain a sequence of spa using

TAAAAGCTAAAAGCTAAACGATGCTCAAGCACCAAAAGAGGAAGACAATAACAAGCCTGGTAAAGAAGACAACA

ACAAACCTGGCAAAGAAGACGGCAACAAGCCTGGCAAAGAAGACGGCAACAAGCCTGGTAAAGAAGATGGCAAC

AAACCTGGTAAAGAAGACAACAAAAAACCTGGTAAAGAAGACGGCAACGGAGTACATGTCGTTAAACCTGGTGA

TACAGTAAATGACATTGCAAAAGCAAACGGCACTACTGCTGA

YOUR LOGO

Staphylococcus protein A gene (spa) typing

Step 3:

Find out the 24-bp repeating units

Staphylococcus protein A gene ( spa ) typing Step 3: Find out the 24-bp repeating units

TAAAAGCTAAAAGCTAAACGATGCTCAAGCACCAAAA

GAGGAAGACAATAACAAGCCTGGT

AAAGAAGACAACAACAAACCTGGC

AAAGAAGACGGCAACAAGCCTGGC

AAAGAAGACGGCAACAAGCCTGGT

AAAGAAGATGGCAACAAACCTGGT

6 x 24-bp repeating units

AAAGAAGACAACAAAAAACCTGGT

AAAGAAGACGGCAACGGAG

TACATGTCGTTAAACCTGGTGATACAGTAAATGACATT

GCAAAAGCAAACGGCACTACTGCTGA

Step 4:

Staphylococcus protein A gene ( spa ) typing Step 3: Find out the 24-bp repeating units

Type the repeating units by input the sequence one-by-one to the online database - Ridom SpaServer (http://spa.ridom.de/index.shtml)

GAGGAAGACAATAACAAGCCTGGT

AAAGAAGACAACAACAAACCTGGC

AAAGAAGACGGCAACAAGCCTGGC

AAAGAAGACGGCAACAAGCCTGGT

AAAGAAGATGGCAACAAACCTGGT

AAAGAAGACAACAAAAAACCTGGT

Staphylococcus protein A gene ( spa ) typing Step 3: Find out the 24-bp repeating units

YOUR LOGO

Staphylococcus protein A gene (spa) typing

Step 5:

Identify the spa type of the strain by input the

repeat succession to the Ridom SpaServer (http://spa.ridom.de/index.shtml)

GAGGAAGACAATAACAAGCCTGGT

r04

AAAGAAGACAACAACAAACCTGGC

r20

AAAGAAGACGGCAACAAGCCTGGC

r22

AAAGAAGACGGCAACAAGCCTGGT

r17

AAAGAAGATGGCAACAAACCTGGT

r25

AAAGAAGACAACAAAAAACCTGGT

r34

Staphylococcus protein A gene ( spa ) typing Step 5: Identify the spa type of the

04-20-22-17-25-34 (repeat succession)

Spa type: t4673

YOUR LOGO
YOUR LOGO
Staphylococcus protein A gene ( spa ) typing Step 5: Identify the spa type of the

Multilocus sequence typing (MLST)

  • Characterize isolates of microbial species using the DNA sequences of internal fragments of multiple housekeeping genes (present in all isolates)

  • Approximately 450-500 bp internal fragments of each gene

  • For each housekeeping gene, Sequences that differ at even a single nucleotide are assigned as different alleles

  • About seven to eight house-keeping genes are commonly used in the laboratories

  • For each isolate, the alleles at each of the loci define sequence type (ST).

Page 42

YOUR LOGO

Multilocus sequence typing (MLST)

MLST databases contain the reference allele sequences and sequence types for various organisms - http://www.mlst.net/

YOUR LOGO

Multilocus sequence typing (MLST)

Application

  • Identification of a sequence type of S. aureus that are failed to be detected by a commercial real time PCR assay

    • A commercial CE-IVD MRSA real time PCR diagnostic assay showed >95% sensitivities and

Multilocus sequence typing (MLST) Application  Identification of a sequence type of S. aureus that are

specificities in US and Europe

  • But more than 50% MRSA samples in Hong Kong yield negative results

  • Characterize these strains with MLST

Multilocus sequence typing (MLST) Application  Identification of a sequence type of S. aureus that are

YOUR LOGO

Multilocus sequence typing (MLST)

  • Seven housekeeping genes were sequenced

carbamate kinase (arcC), shikimate dehydrogenase (aroE), glycerol kinase (glpF), guanylate kinase (gmk), phosphate acetyltransferase (pta), triosephosphate isomerase (tpi) and acetyl coenzyme A acetyltransferase (yqiL)

  • Most of these strains belong to ST45 highly prevalent MRSA strains in Hong Kong

Multilocus sequence typing (MLST)  Seven housekeeping genes were sequenced carbamate kinase ( arcC ), shikimate
C AGC
C
AGC
C ACC
C
ACC

Other MLST type

ST45

Fluorescent signal produced

No fluorescent signal produced

YOUR LOGO

How to choose appropriate molecular typing method ???

Convenience-related features of the methods

  • Simplicityability of the method to be handled in non- specialized and non research laboratories. Molecular tests require less previous training time than culture- based tests do.

  • Turnaround time may be important if the investigation involves clinical management of patients infected with a pathogen under study, or if the etiologic agent in an outbreak is unknown, e.g. SARS

  • High throughout ability to process a large number of strains in a reasonable interval of time. In epidemiology, this may affect the power (due to sample size) of a statistical test to assess risk and association.

  • Cost and affordability

YOUR LOGO

How to choose appropriate molecular typing method ???

Performance-related features of the methods

  • Typeability ability of the technique to generate an unambiguous result for an isolate tested. i.e. how many strains are untypeable? E.g. <1% M. tuberculosis strains do not harbour IS6110 cannot be typed by IS6110 RFLP.

  • Discriminatory power ability to generate distinct units of information from epidemiologically unrelated isolates

  • Reproducibility - ability to generate identical results when a strain is tested repeatedly. It depends on the natural stability of

a test strain’s genetic marker used as the basis for typing.

Page 47

  • Portability ability to share interpretable format of the results among laboratories

YOUR LOGO

Molecular strain typing methods for outbreak investigation

  • An outbreak is defined as the acute appearance of a cluster of disease caused by a single pathogen that occurs in numbers in excess of what is expected for that time and place.

  • Strain typing technique must have the ability to distinguish strains that are epidemiologically related from those that are not by minimizing misclassification and confounding variables

Molecular strain typing methods for outbreak investigation  An outbreak is defined as the acute appearance
Molecular strain typing methods for outbreak investigation  An outbreak is defined as the acute appearance

YOUR LOGO

Molecular strain typing methods for outbreak investigation

How do we validate the performance of molecular strain typing methods for outbreak investigation?

  • No gold standard method

  • Most of the time, in an outbreak setting, the study

subjects are already recognized to have characteristics that define them as being related, e.g. infected with the same pathogens in a setting or period of time where

such cluster of the disease is not expected.

  • No strain typing information is needed to define the disease cluster as an outbreak.

  • But it provides a good opportunity to validate a

Page 49

molecular typing technique for epidemiological

application.

YOUR LOGO

Molecular strain typing methods for outbreak investigation

Demonstrating that a pathogen is clonal in a recognized outbreak setting

  • Which of the following typing methods have the higher discriminatory power?

  • What of the following typing methods satisfies the criterion for outbreak investigation given that FF, F, G, C, CC, J and JJ were isolated from an outbreak?

Molecular strain typing methods for outbreak investigation Demonstrating that a pathogen is clonal in a recognized

YOUR LOGO

Molecular strain typing methods for outbreak investigation

Demonstrating that a pathogen is clonal in a recognized outbreak setting

  • The higher the no. of discrete units of typing information generated by a typing method from a set of isolates, the higher the discriminatory power of that test.

  • Method A generate discrete units of information for almost every isolates.

  • It may be a mistake to abandon the conclusion that an outbreak had occurred based on information generated by Method A

  • But Method A is quite useful for taxonomic purpose many subtypes identified.

  • Method B is epidemiologically suitable since the relatedness of the strains according to this method matches with the previous knowledge of outbreak

  • The utility of a new typing method for epidemiologic purposes does not

YOUR LOGO

necessarily correlate with high discriminatory power of that technique.

Molecular strain typing methods for outbreak investigation

Selecting appropriate comparison isolates

  • The validity of a typing method should NOT be evaluated a collection of isolates from only one outbreak.

  • The test should be simultaneously applied to appropriate comparison isolates

  • The comparison isolates can be :

    • collected from geographic sources distinct from the setting of outbreak,

    • a collection of isolates obtained during some period before or well after the outbreak

  • If the method is able to classify the comparison isolates into many

  • distinct taxonomic units satisfies another criterion for its epidemiological tool.

    utility as an

    YOUR LOGO

    Molecular strain typing methods for outbreak investigation

    Ascertaining fidelity of the typing information

    • In response to changing selective pressure, bacteria undergo mutations during replications or acquire external genetic materials by transduction or conjugations

    • Strain typing method must take into account the intrinsic “ biological clock” and evolutionary relationships of the genetic markers.

    Molecular strain typing methods for outbreak investigation Ascertaining fidelity of the typing information  In response
    • Some pathogens predominantly propagate clonally (like TB) whereas some undergo frequent genetic recombination (like E.coli)

    YOUR LOGO

    Molecular strain typing methods for outbreak investigation

    Ascertaining fidelity of the typing information

    • Even within a single organism, there are differences in the type, number, and the rate at which specific genes undergo mutations.

    • Gene encode outer membrane proteins show greater sequence diversity than those that encode “housekeeping” genes ( probably because outer membrane proteins are under selective pressure to undergo more frequent changes)

    • E.g. the “clock speed” of a single spa gene is equal to, or even greater than the combination of 7 housekeeping genes used in MLST.

    Molecular strain typing methods for outbreak investigation Ascertaining fidelity of the typing information  Even within

    Even the strains have the same MLST, their spa types are always different

    YOUR LOGO

    Molecular strain typing methods for outbreak investigation

    Ascertaining fidelity of the typing information

    • Typing method needs to be validated epidemiologically or experimentally to assess the temporal stability of the typing information generated by such a method.

    • Subject an organism to multiple passages in vitro and analyze the passaged strain by the typing method.

    • If stable typing information obtained after 6 month to a year of multiple passage may be suitable for future outbreak investigations or short-term investigation

    • If the typing information remains unchanged for more than 2 years, the method is useful for surveillance purpose or for multiregional comparison of strains.

    Page 55

    YOUR LOGO

    Concluding remark

    • Molecular epidemiology is not just a technique or a tool

    • All the laboratory-based information have to be associated with epidemiological analysis, either analytical or descriptive studies

    • The ultimate goal of the strain typing method is to reveal a particular subtype to be associated with a specific risk factor.

      • E.g Clostridium difficile ribotype 002 has significantly higher sporulation rate

    • The reliability of a typing test must be assessed in multiple systemically designed epidemiological studies.

    • The validity of the typing method is ultimately affirmed by demonstration of the effectiveness of an intervention based on the epidemiological observations made possible by the use of the typing method.

      • E.g. Using more effective disinfectants to eliminate the spores of C. difficile in

    the environment.

    YOUR LOGO

    Page 56

    Whole Genome Sequencing (WGS) for microbial typing

    • Potential

    Take all genetic information into account highest discriminatory power Replace all other sequencing-based method for outbreak investigation Lower economic costs and turnaround time (US$100 in one day’s time)

    • Questions?

      • Any good bioinformatics tools for translation of results into a format that can be understood by health professional

      • Too discriminative overestimate the amount of recent transmission of the disease.

      • Expensive for large-scale investigation

    Whole Genome Sequencing (WGS) for microbial typing  Potential  Take all genetic information into account

    YOUR LOGO

    Do You Have Any Questions? Placeholder, enter your own text here YOUR LOGO

    Do You Have Any Questions?

    Placeholder, enter your

    own text here

    YOUR LOGO