The Plant Journal (2010) 62, 124134

doi: 10.1111/j.1365-313X.2010.04132.x

Methyl salicylate production in tomato affects biotic

interactions
Kai Ament1, Vladimir Krasikov2, Silke Allmann3, Martijn Rep2, Frank L.W. Takken2 and Robert C. Schuurink1,*
Department of Plant Physiology, Swammerdam Institute for Life Sciences, Science Park 904, 1098 XH, Amsterdam,
NL, USA,
2
Department of Plant Pathology, Swammerdam Institute for Life Sciences, Science Park 904, 1098 XH, Amsterdam,
NL, USA, and
3
Department of Molecular Ecology, Max Planck Institute for Chemical Ecology, D07745 Jena, Germany

Received 2 November 2009; revised 14 December 2009; accepted 23 December 2009; published online 9 February 2010.
*
For correspondence (fax +31 20 5257934; e-mail r.c.schuurink@uva.nl).

SUMMARY
The role of methyl salicylate (MeSA) production was studied in indirect and direct defence responses of tomato
(Solanum lycopersicum) to the spider mite Tetranychus urticae and the root-invading fungus Fusarium
oxysporum f. sp. lycopersici, respectively. To this end, we silenced the tomato gene encoding salicylic acid
methyl transferase (SAMT). Silencing of SAMT led to a major reduction in SAMT expression and MeSA
emission upon herbivory by spider mites, without affecting the induced emission of other volatiles
(terpenoids). The predatory mite Phytoseiulus persimilis, which preys on T. urticae, could not discriminate
between infested and non-infested SAMT-silenced lines, as it could for wild-type tomato plants. Moreover,
when given the choice between infested SAMT-silenced and infested wild-type plants, they preferred the
latter. These findings are supportive of a major role for MeSA in this indirect defence response of tomato.
SAMT-silenced tomato plants were less susceptible to a virulent strain of F. oxysporum f. sp. lycopersici,
indicating that the direct defense responses in the roots are also affected in these plants. Our studies show that
the conversion of SA to MeSA can affect both direct and indirect plant defence responses.
Keywords: methyl salicylate, Fusarium, tomato, spider mite, predatory mite.

INTRODUCTION
Plants often respond to damage inflicted by herbivorous
arthropods, microbial pathogens or virus infection by producing a bouquet of volatiles. These volatiles can have a
direct effect on the attacker or can serve as signals within
and perhaps between plants (Farmer, 2001). Another function of induced volatiles lies in the attraction of predators of
herbivores. At this third trophic level, the information
encoded by the blend of volatile molecules released by a
herbivore-attacked plant is used by a predator to locate its
prey. Such an effect of a herbivore species on a predator is
called indirect, because it can only arise via the plant as an
intermediate organism (Wootton, 1994).
The blind predatory mite Phytoseiulus persimilis preys
preferentially on the two-spotted spider mite Tetranychus
urticae and its eggs. P. persimilis is specifically attracted to
plants infested with spider mites (Sabelis and Vandebaan,
1983) by relying on the emitted odours from the plants
(Sabelis et al., 1984). Spider mites are generalists and feed
124

on many host plants, thereby inducing different bouquets of

volatiles from various species (van den Boom et al., 2004).
They produce extensive webbing to protect their eggs,
requiring highly specialized predators such as P. persimilis
that can deal with this.
We used tomato (Solanum lycopersicum) plants to study
both direct and indirect defence responses to spider-mite
herbivory. Spider mites induce both jasmonate (JA)- and
salicylic acid (SA)-related responses in tomato plants (Kant
et al., 2004). Both JA and SA are necessary for the direct and
indirect defence responses (Ament et al., 2004, 2006). Spider
mites also induce the expression of salicylic acid
methyl transferase (SAMT), which leads to the production
of methyl salicylate (MeSA) from SA. The induction of
SAMT is JA-dependent (Ament et al., 2004), suggesting
crosstalk between JA and SA signalling pathways that
control the indirect defence response. JA and SA are both
necessary to induce the production of the volatile
2010 The Authors
Journal compilation 2010 Blackwell Publishing Ltd

Role of methyl salicylate in tomato defence 125

homoterpene (E,E)-4,8,12-trimethyltrideca-1,3,7,11-tetraene
(TMTT) (Ament et al., 2006), which is emitted in large
quantities by spider mite-infested tomato plants (Kant et al.,
2004).
Previously, a screen for the most important volatile
compounds in attracting predatory mites using pure synthetic compounds led to the identification of MeSA as a key
component (De Boer and Dicke, 2004b; van Wijk et al., 2008).
Moreover, the addition of MeSA to a MeSA-free, weakly
attractive blend of plant volatiles significantly increased the
attractiveness for predatory mites (De Boer and Dicke,
2004a,b). These data all point to an important role for MeSA
in indirect host defence, especially for the attraction of
predatory mites. However, it has not been directly demonstrated that the MeSA emitted by spider mite-infested
tomato plants is in fact required for this attraction. To
address this issue, here we have specifically silenced SAMT
in tomato plants.
Methyl salicylate might not only function in indirect
plant defence, because, together with its precursor salicylate, it has also been implied as an important signal in
direct defence. An increase in SA level accompanies the
induction of both local and systemic induction of host
defences, and the accumulation of SA in local and
systemic tissues is required for systemic acquired resistance (SAR) (Gaffney et al., 1993; Wildermuth et al., 2001).
Exogenous application of SA to tomato plants triggers the
accumulation of endogenous SA, resulting in the induction of both local and systemic host defence responses
(Mandal et al., 2009). Reduction of endogenous SA levels
by conversion to MeSA might therefore weaken host
defence to microbial pathogens. Support for this hypothesis comes from the observation that in a compatible
interaction between Pseudomonas syringae and Arabidopsis, MeSA production is stimulated by the bacterial
virulence factor coronatine (Attaran et al., 2009). Attaran
and co-workers propose that volatization of SA into MeSA
could be a strategy employed by some phytopathogens to
attenuate the SA-based defence pathway. Additional support for such a mechanism is the increased susceptibility
to the bacterial pathogen P. syringae and the fungal
pathogen Golovinomyces orontii observed after SAMT
overexpression in Arabidopsis (Koo et al., 2007; Song
et al., 2008). These plants failed to accumulate SA and its
glucoside (SAG). Furthermore, MeSA has recently been
identified as a mobile signal for SAR in tobacco mosaic
virus (TMV)-infected tobacco (Nicotiana tabacum) (Park
et al., 2007; Vlot et al., 2008b). Conversion of SA to MeSA
by SAMT might therefore also affect interactions of the
host with microbial pathogens. Our silencing approach
provided the opportunity to address this issue by challenging plant lines silenced for SAMT with the rootinvading fungus Fusarium oxysporum f. sp. lycopersici.
Our results demonstrate that SA to MeSA conversion

indeed affects both direct and indirect defence to different

biotic interactors in tomato.
RESULTS
Identification of S. lycopersicum salicylic acid carboxyl
methyl transferase (SlSAMT)
Previously, we demonstrated that spider-mite herbivory on
tomato plants induces the emission of MeSA (Kant et al.,
2004). Transcriptome analysis of spider mite-infested
tomato leaves revealed the JA-dependent induction of a
putative SAMT gene (Ament et al., 2004). To investigate the
organ-specific expression of SAMT, we dissected mature
tomato plants and isolated RNA for qRT-PCR analysis. SAMT
transcripts were predominantly present in green fruits, but
were also present in stems, roots and leaves, in which
transcript levels decreased with age (Figure S1). To determine if the product of this gene encodes SAMT (i.e. is
capable of methylating SA), we expressed the full-length
cDNA in Escherichia coli. After feeding SA to E. coli cells
expressing the cDNA, MeSA was detected in the culture
medium. As MeSA was not detectable in non-transformed
control cells, this result shows that the product of SlSAMT
indeed has SAMT activity (Figure S2).
BLASTN and TBLASTX searches with SlSAMT against
public databases revealed highest homology with SAMT
from Datura wrightii (90% similarity on nucleotide level; 94%
similarity on amino acid level). The deduced amino acid
sequence of SlSAMT, aligned with other members of the
family of SABATH O-methyl transferases (Figure S3), suggests that SlSAMT preferentially methylates SA rather than
the structurally similar substrate benzoic acid (BA). SlSAMT
has a Met on position 156 instead of a His, and this Met is
present on this position in all members of the SABATH
family that prefer SA over BA as a substrate (Effmert et al.,
2005). The specificity conferred by this residue for a specific
substrate has been confirmed by site-directed mutagenesis
(Barkman et al., 2007). Another substrate binding site
distinction is the Phe residue on position 351 in SlSAMT,
which is conserved throughout SAMT-type SABATH family
members (Effmert et al., 2005). The high specificity of
recombinant SlSAMT for SA was experimentally proven by
Tieman et al. (2010) (this issue). They showed that the
relative activity with benzoic acid as substrate was only 2%
of that with SA, with Km values for SA of 52 lM and for
S-adenosyl-L-methionine, the methyl donor, of 15 lM. These
Km values are within the range of other characterized
SAMTs.
Selection of hpSAMT plant lines
To investigate the involvement of MeSA in attracting predatory mites to tomato plants infested with spider mites, we
set out to create transgenic lines in which expression of
SAMT was knocked-down using post-transcriptional gene

2010 The Authors

Journal compilation 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 62, 124134

126 Kai Ament et al.

silencing (PTGS). We transformed tomato cv. GCR161 using
chimaeric gene constructs designed to simultaneously
silence SAMT and the GUS reporter gene via the production
of interfering hairpin RNA (hpRNA). The 3 end of the SAMT
coding sequence was fused to a part of the coding region of
the GUS gene so as to create an inverted repeat separated by
a linker fragment. This strategy was effectively used earlier
for the silencing of NBS-LRR-encoding genes in lettuce
(Wroblewski et al., 2007), and for the investigation of transspecific gene silencing between host and parasitic plants
(Tomilov et al., 2008).
Ten primary hpSAMT transformants (T0) were screened
for the presence of the NPTII transgene and assayed for the
number of T-DNA inserts by Southern hybridization (data
not shown). T1 progeny were screened for the silencing of
the GUS reporter gene in Agrobacterium-mediated transient
assays (Figure S4). Homozygous T1 hpSAMT lines were then
selected by planting T2 offspring on kanamycin selective
medium. T1 plants yielding 100% surviving offspring were
scored as homozygous. Finally, three homozygous hpSAMT
lines, each bearing a single T-DNA insert and exhibiting
silencing of the GUS reporter gene, were used for further
study (S1, S5 and S8).
Expression of SlSAMT in hpSAMT plants after induction
by spider-mite herbivory is suppressed

Reduced expression of SAMT in hpSAMT lines results

in lower MeSA emission
We next set out to measure the emission of MeSA in wildtype and hpSAMT tomato lines. Non-infested tomato plants
emit around 40 lg of MeSA per plant in 5 days, and emission is increased by spider-mite herbivory to 140 lg in
5 days, with the largest increase occurring on day 4 (Kant
et al., 2004). Here, we sampled volatile release on day 4 of
spider-mite feeding. Despite the fact that we did not measure a significant reduction in the expression levels of SAMT
in hpSAMT lines, compared with the unchallenged wild
type, emission of MeSA from non-infested hpSAMT plants
was significantly reduced (P = 0.034 for S1; P = 0.002 for S5;
P = 0.021 for S8) (Figure 2). Upon spider-mite feeding, the
emission of MeSA in wild-type plants was induced sevenfold compared with non-infested control plants (P = 0.01).
MeSA emission by hpSAMT lines challenged with spider
mites was severely reduced compared with spider mitechallenged control plants. No significant induction of MeSA
emission was detected for the hpSAMT plants, except for
line S5 (P = 0.019), which of the three silenced lines had the
lowest silencing levels and hence the highest residual SAMT
expression levels (Figure 2).
Silencing of SAMT does not affect terpenoid volatile
emission
Total headspace analysis of spider-mite infested and
non-infested hpSAMT and wild-type plants revealed that the
MeSA level is the only observable difference between
the emitted volatile spectra. Figure 3(a) shows GC-MS
chromatograms of the headspace from hpSAMT S1 plants

1.2
1
0.8
0.6
0.4
0.2
0

+
Control

+
Line S1

+
Line S5

+
Line S8

Figure 1. SAMT expression is induced by spider mites in control plants, but

not in hpSAMT plants.
Transcript levels were determined by real-time qRT-PCR relative to RCE1.
Lines S1, S5 and S8 contain the hpSAMT construct. Three leaflets per plant
were each infested with 15 spider mites for 5 days (open bars), after which the
infested leaflets of three plants were pooled for RNA isolation. Similar leaflets
of non-infested control plants were harvested for RNA isolation on the same
day (solid bars). Bars represent the mean, relative to RCE1, of five independent experiments, except for line S5, without spider mites, which was
replicated four times. The standard error is indicated.

MeSAemission
Per plant/24 hrs in g

Relative SAMT expression

To analyze whether SlSAMT was also effectively silenced,

we measured the expression levels of SlSAMT in noninfested and spider mite-infested leaves from the three
independent hpSAMT lines and a non-transgenic control
(Figure 1). Expression of SAMT was not significantly
reduced in hpSAMT lines compared with control plants in
the absence of spider mites. In agreement with previous
reports, spider-mite herbivory induced the expression of

SAMT by about sevenfold in wild-type plants (Ament et al.,

2006). SAMT expression was slightly induced in hpSAMT
lines upon spider-mite infestation; however, this induction
was severely reduced compared with the controls.

60
50
40
30
20
10
0

+
Control

+
Line S1

+
Line S5

+
Line S8

Figure 2. Spider mite-induced emission of methyl salicylate (MeSA) is

strongly reduced in hpSAMT lines.
Three leaflets per plant were infested with 15 spider mites for four days (open
bars), after which three plants were enclosed in a glass desiccator. The head
spaces of these, and non-infested plants (solid bars), were sampled for the
following 24 h. Emission of MeSA was determined and quantified by means
of GC-MS-TOF. Bars represent the average of four independent experiments,
except for line S5, without spider mites, which was replicated three times. The
standard error is indicated.

2010 The Authors

Journal compilation 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 62, 124134

Role of methyl salicylate in tomato defence 127

and wild-type plants after 4 days of spider-mite herbivory.
Emission of TMTT, the most abundant spider mite-induced
volatile from tomato, was strongly induced in both wild-type
and hpSAMT plants (P = 0.001 for wild-type plants;
P = 0.002 for S1 plants; P = 0.012 for S5 plants; P = 0.001 for
S8 plants) compared with their non-infested controls.
Emission of TMTT by wild-type plants was not significantly
different from that of SAMT silenced plants, both before and
after spider-mite herbivory (Figure 3b). Emission of all
monoterpenes and sesquiterpenes in the hpSAMT lines was
equal to that of the wild-type plants, as is shown for the
emission of b-phellandrene (Figure 3c) and a-copaene (Figure 3d). In conclusion, silencing of SAMT specifically affects
the emission of MeSA and does not alter terpenoid volatile
emission.
Silencing of SAMT prevents olfactory preference of
predatory mites for infested plants
In a Y-tube olfactometer assay, predatory mites prefer the
odour of spider mite-infested tomato plants above that of
non-infested tomato plants. This preference is only present
after 4 days of spider-mite herbivory, the time it takes for the

(b)
30000
20000
10000

5
60000
50000
40000

30000

20000
10000

6
4

Time (seconds)

(c)

TMTT emission/plant/24 hrs in g

Detector response (ion count)

(a)

plants to significantly induce the emission of MeSA and four

terpenoid volatiles (Kant et al., 2004). Def-1 tomato plants,
deficient in JA accumulation upon wounding (Howe et al.,
1996), do not induce the emission of volatiles after spidermite feeding. Hence, predatory mites do not prefer spider
mite-infested def-1 plants over non-infested plants (Ament
et al., 2004). To investigate the role of MeSA in the attraction
of predatory mites, we performed olfactory choice assays
with hpSAMT plants. When predatory mites were offered
the choice between the odours of non-infested plants and
spider mite-infested plants, they strongly preferred the
odour of the latter (P < 0.001) (Figure 4a). However, the
predatory mites did not show a significant preference when
they were offered the choice between the odour of infested
hpSAMT plants and non-infested hpSAMT plants. There was
a tendency for predatory mites to prefer the odour of
hpSAMT S5 plants infested with spider mites over the odour
from non-infested hpSAMT S5 plants (P = 0.06). This may be
explained by the weakly induced emission of MeSA by S5
hpSAMT plants after spider-mite feeding (Figure 2). However, this emission is still 10-fold lower than that from spider
mite-infested wild-type plants. When predatory mites were

60
50
40
30
20
10
0

+
Control

+
Line S1

+
Line S5

+
Line S8

+
Control

+
Line S1

+
Line S5

+
Line S8

(d)
1.0
copaene emission/
Per plant/24 hrs in g

phellandrene emission
Per plant/24 hrs in g

0.9
5.5
5.0
4.5
4.0
3.0
2.5
2.0
1.5
1.0
0.5
0

0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1

+
Control

+
Line S1

+
Line S5

+
Line S8

Figure 3. The spectra of emitted volatiles of spider mite-infested control and hpSAMT plants are identical, except for methyl salicylate (MeSA).
Three leaflets per plant were infested with 15 spider mites for 4 days (open bars), after which three plants were enclosed in a glass desiccator. The headspace of
these plants and non-infested plants (solid bars) was subsequently sampled for 24 h. Volatiles were analysed by GC-MS-TOF, and compounds were identified and
quantified on the basis of external standards of known concentrations after normalization to the internal standard. Bars represent the relative averages of four
independent experiments, except for line S1, without spider mites, which was replicated three times.
(a) Chromatograms of spider mite-infested control plants (bottom panel) and hpSAMT line S1 (top panel): 1, b-phellandrene; 2, b-ocimene; 3, linalool; 4, benzyl
acetate, internal standard; 5, MeSA; 6, a-copaene; 7, (E,E)-4,8,12-trimethyltrideca-1,3,7,11-tetraene (TMTT).
(b) Emission of TMTT in lg per plant in 24 h.
(c) Emission of b-phellandrene in lg per plant in 24 h.
(d) Emission of a-copaene in lg per plant in 24 h.

2010 The Authors

Journal compilation 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 62, 124134

128 Kai Ament et al.

(a)

P << 0.001
6 Control - (43)

Control + (88)

P = 0.6
Line S1 + (48)

22

Line S1 - (43)
P = 0.06

Line S5 + (50)

11

Line S5 - (33)
P = 0.6

Line S8 + (48)

0%

10% 20%

30%

14

40%

50%

Line S8 - (55)

60% 70%

80%

90% 100%

(b)
P << 0.001
Control + (72)

Line S1 + (27)

P < 0.001
Control + (68)

11

Line S5 + (34)
P << 0.001

Control + (77)

0%

10%

20%

30%

40%

50%

60%

70%

Line S8 + (31)

80%

90%

100%

Figure 4. Olfactorial preference of predatory mites for plants infested with

spider mites is lost upon silencing of salicylic acid methyl transferase (SAMT).
The Y-tube olfactory preference is depicted as the percentage of predatory
mites that choose the odour of infested plants (open bars) or non-infested
plants (solid bars). The percentage of predatory mites that did not make a
choice within 5 min is indicated by grey bars. The absolute number of mites is
given in brackets. All experiments were performed five times, except for those
with line S5, with and without spider mites, which were performed four times.
The results of these experiments were not heterogeneous, and are therefore
pooled and presented as such. Results were analysed using a replicated test for
goodness-of-fit as described in Sokal and Rohlf (1995), with d.f. = 1.
(a) Predatory mites were given the choice between the odour of non-infested
and spider mite-infested plants of the same line.
(b) Predatory mites were given the choice between control plants and hpSAMT
plants infested with spider mites.

(Mandal et al., 2009). Methylation of SA volatilizes this

phytohormone, which could influence in planta concentrations of SA, and lead to an altered susceptibility to pathogens such as F. oxysporum. To investigate this, we
performed disease assays on seedlings as well as 4-weekold plants, comparing wild-type plants with hpSAMT lines.
The S5 line was excluded from these experiments as it
developed symptoms unrelated to infection in older plants
(yellowing and necrosis of leaves). S1 and S8 hpSAMT lines
showed less symptom development, indicated by a significantly higher average weight 3 weeks after inoculation with
Fol007, a virulent strain of F. oxysporum f. sp. lycopersici
(Figure 5a). The percentage of plants with disease index 4
(the highest score) was much higher for the control line in
comparison with the S8 hpSAMT line, and was intermediate
in the S1 hpSAMT line (Figure 5b). Moreover, the percentage of decayed plants was significantly reduced in the
hpSAMT lines as compared with the control (10% for the S1
line, 5% for the S8 line and 45% for the GCR161 control).
Silencing of SAMT did not affect I-mediated resistance of
GCR161 to the race-1 isolate Fol004 (data not shown).
Reduced susceptibility of hpSAMT lines to Fusarium wilt
was confirmed in a separate disease assay using older
(4-week-old) plants: both S1 and S8 lines consistently
showed less disease symptoms (Figure 5c). Measurement of
SA and MeSA levels in roots of 4-week-old plants confirmed
that MeSA levels were indeed much lower (i.e. below the
detection limit) in hpSAMT roots, regardless of Fol007
infection (Figure 6). SA levels were very similar in roots of
wild-type and hpSAMT plants, and increased slightly upon
Fol007 infection, both in the roots of wild-type and hpSAMT
plants (Figure 6), indicating that reduced MeSA levels did
not coincide with a change in overall SA levels.
DISCUSSION
Silencing of SAMT makes spider mites undetectable for
predatory mites

given the choice between the odour of wild-type plants

infested with spider mites and hpSAMT plants infested with
spider mites, they significantly preferred wild-type plants
over hpSAMT silenced plants (Figure 4b) (P < 0.001 for lines
S1 and S8; P < 0.001 for line S5). In conclusion, predatory
mites do not discriminate between non-infested and
infested hpSAMT plants. Moreover, the absence of MeSA in
the headspace of spider mite-infested hpSAMT plants
makes them much less attractive to predatory mites than
spider mite-infested wild-type plants.
SAMT silencing reduces susceptibility of tomato to
Fusarium wilt
Exogenous application of SA to tomato, either through
root feeding or foliar spray, induces resistance against
the hemibiotrophic, root-invading fungus F. oxysporum

We have identified a tomato SAMT cDNA, and have demonstrated the requirement of SAMT for an indirect defence
response by showing that predatory mites do not prefer
spider mite-infested SAMT-silenced plants to non-infested
SAMT-silenced plants. Thus, the absence of a single component, i.e. MeSA, from the otherwise normal induced blend
of headspace volatiles is sufficient to deceive predatory
mites. Although basal transcript levels of SAMT were not
significantly different in the hpSAMT lines, a phenomenon
that has been observed before (Rayapuram and Baldwin,
2007), they were significantly reduced upon spider-mite
herbivory (Figure 1), as compared with wild-type control
plants. This resulted in a dramatic effect on the metabolite
level, with MeSA emission being severely reduced in
hpSAMT lines infested with spider mites compared with
wild-type plants infested with spider mites (Figure 2).

2010 The Authors

Journal compilation 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 62, 124134

Role of methyl salicylate in tomato defence 129

(c)

Mock

Fol007

(b)

S8

S1

Control

(a)

Figure 5. Silencing of salicylic acid methyl transferase (SAMT) decreases disease susceptibility to Fusarium oxysporum f. sp. lycopersici.
Ten-day-old seedlings of control (GCR161) and hpSAMT lines were mock inoculated ()) or infected with Fol007 (+). The plant weight (a) and disease index (b) were
determined at 21 days post inoculation (d.p.i.). hpSAMT lines showed significantly less disease symptoms compared with the Fol007-inoculated CGR161 control.
(c) Four-week-old plants of the control and two hpSAMT lines (S1 and S8) were either mock inoculated or infected with Fol007. Pictures of three representative plants
were taken at 26 d.p.i. The Fol007-inoculated hpSAMT lines show less disease symptoms (wilting, stunting and leaf yellowing) as compared with the control line.

MeSA has already been implicated as a key component

for the attraction of predatory mites in studies with synthetic
MeSA and synthetic blends (De Boer and Dicke, 2004a,b;
de Boer et al., 2004; Dicke et al., 1990; van Wijk et al., 2008),
and by correlation studies (Dicke et al., 1999; van den Boom
et al., 2002). Doseresponse analyses indicated that there is
a narrow range of synthetic MeSA concentrations to which
predatory mites are attracted (De Boer and Dicke, 2004a,b;
van Wijk et al., 2008). High concentrations of synthetic MeSA
are actually repellent (De Boer and Dicke, 2004a,b). Moreover, predatory mites did not discriminate between a spider
mite-induced lima bean (Phaseolus lunatus) volatile blend
(that contains MeSA) and a spider mite-induced volatile
blend to which an extra quantity of synthetic MeSA was
added (De Boer and Dicke, 2004a,b), suggesting that over-

production of MeSA is unlikely to alter the choice behaviour

of the predatory mites. By specifically removing MeSA from
the volatiles emitted upon spider-mite infestation through
the silencing of SAMT, we conclusively demonstrate that
MeSA in the naturally emitted volatile blend of tomato is
absolutely required for predatory mites to be able to
discriminate infested from non-infested plants. Interestingly, stealthy spider mites do not induce MeSA emission
(Kant et al., 2008), and from our data we would predict that
this underlies their undetectability for predatory mites.
In Arabidopsis, overproduction of nerolidol and/or 4,8dimethyl-1,3(E),7-nonatriene (DMNT) leads to a greater
attractiveness to predatory mites (Kappers et al., 2005).
Arabidopsis plants do not emit MeSA, nerolidol or DMNT
after spider-mite herbivory, and predatory mites are

2010 The Authors

Journal compilation 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 62, 124134

130 Kai Ament et al.

(a)

180
160

SA (ng/g FW)

140
120
100
80
60
40
2
0

Wild type

+
hpSAMT

(b)
14.0

MeSA (g/g FW)

12.0
10.0
8.0
6.0
4.0
2.0
0.0

ND

+
Wild type

ND

+
hpSAMT

Figure 6. Levels of salicylic acid (SA) and methyl salicylate (MeSA) in roots.
Ten-day-old seedlings of control (GCR161) and hpSAMT lines were mock
inoculated ()) or infected with Fol007 (+). SA (a) and MeSA levels (b) were
determined at 21 days post inoculation (d.p.i.). Levels of MeSA in roots of
hpSAMT plants were below the levels of detection (not detected, ND). Bars
represent the average of three experiments for wild-type and four for hpSAMT
plants. The standard error is indicated. FW, fresh weight.

(van Wijk et al., 2008). In this regard, it is important to point

out that our predatory mites were raised on lima bean plants
and starved before the experiments. Thus, the predatory
mites used for olfactory choices were unconditioned for the
blend of volatiles emitted by tomato.
Clearly, predatory mites are not capable of choosing
between non-infested hpSAMT and spider mite-infested
hpSAMT plants, and in fact many predatory mites do not
make a choice within 5 min (Figure 4a). This implies that all
induced terpenoid volatiles, such as TMTT, play a negligible
role in attracting predatory mites in a background devoid of
MeSA. When just a fraction of the normal quantity of MeSA
is induced, as in line S5 (Figure 2), some predatory mites
can apparently already detect this, as the hpSAMT line S5
infested with spider mites tends to be preferred (P = 0.06) to
non-infested plants of the same line (Figure 4a).
The question of what role the other spider mite-induced
volatiles play remains. Comparison of Figure 4(a,b) suggests that spider mite-infested hpSAMT plants are slightly
more attractive (on average by 28%) than non-infested
control plants (19%) when the alternative choice is the odour
from spider mite-infested control plants. This suggests that
the induced terpenoids may contain some information for
the predatory mites. However, this information, if any, is
apparently not sufficient for predator mites to differentiate
between non-infested and spider mite-infested hpSAMT
plants (Figure 4a) in the (near) absence of MeSA emission
(Figure 2). It may be that predatory mites can use the
information of the terpenoids only when triggered by MeSA,
but a more extensive set of experiments would be necessary
to demonstrate this. Elucidation of this specific question has
been a long and difficult process that is still incomplete
(de Boer et al., 2008; van den Boom et al., 2002), and we now
have an excellent tool, the hpSAMT lines, to arrive at firm
conclusions.
Silencing of SAMT reduces susceptibility to F. oxysporum

normally not attracted to spider mite-infested Arabidopsis

plants. This situation thus more or less mimics the situation
with synthetic volatiles in a non-attractive background, in
contrast to our experiments where a single component is
missing in the blend of headspace volatiles.
The blind predatory mites sense odours with a peripheral
olfactory system that consists of just five putative olfactory
sensilla that reside in a dorsal field at the tip of their first pair
of legs (van Wijk et al., 2006). Electrophysiological recordings made on the tarsi of the first legs show that MeSA can
indeed be recognized (Debruyne et al., 1991). Predatory
mites have the capacity to learn (De Boer and Dicke, 2004a,b,
2006; Drukker et al., 2000), and there is a slight difference in
the response of starved and satiated predatory mites to
certain odours (De Boer and Dicke, 2004a,b). The short-term
memory of predatory mites is lost after 24 h of starvation

In Arabidopsis, mutants impaired in SA signalling show an

increased susceptibility to F. oxysporum (Berrocal-Lobo and
Molina, 2008), and infection of tomato by F. oxysporum f. sp. lycopersici also appears to depend on the SA
levels in the host, as increased SA levels correlate with
reduced disease symptoms (Mandal et al., 2009). Overexpression of SAMT in Arabidopsis reduces SA levels and
resistance to bacterial and fungal pathogens (Koo et al.,
2007). The generation of hpSAMT tomato lines provided us
with the opportunity to further investigate this. We found
that the hpSAMT tomato plants, both at the 4-week and
seedling stages, are less susceptible to Fol infection, as
shown by reduced disease symptoms and increased average plant weight (Figure 5).
The inability of the hpSAMT plants to volatize SA
(Figure 2) leads to low levels of MeSA in total root extracts
(i.e. below the detection limit), but not to overall higher SA

2010 The Authors

Journal compilation 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 62, 124134

Role of methyl salicylate in tomato defence 131

levels compared with wild-type roots (Figure 6), as previously described in Arabidopsis (Attaran et al., 2009; Song
et al., 2009). Interestingly, in a complementary approach,
Tieman et al., 2010 (this issue) created transgenic tomato
plants that constitutively overexpress SAMT, and thus
overproduce MeSA. These lines were disrupted in the
normal regulation of SA levels, leading to much higher
levels of SA in leaves when challenged with the bacterial
pathogen Xanthomonas campestris. This indicates that the
regulation of SA levels might differ between plant species,
as SA levels are lower in Arabidopsis plants overexpressing
SAMT (Koo et al., 2007; Liu et al., 2010).
Fourteen days after Fol infection, the SA levels were
slightly higher in roots of both wild-type and hpSAMT plants
(Figure 6). This overall slight increase may reflect local high
SA levels at infection foci: we had to extract the entire root
system, whereas the infection of tomato roots by F. oxysporum is localized (Van der Does et al., 2008). The observed
increase of SA in wild-type plants is somewhat different from
the results obtained by Mandal et al. (2009), who showed that
overall SA levels in tomato roots did not increase after 7 days
of Fol infection (Mandal et al., 2009), and nor did the
expression of PR-1, a marker for SA activity in this study
(Aime et al., 2008). These different findings may be attributed
to differences in the duration or extent of Fol infection.
Indeed, PR-1 and other PR proteins were found to accumulate
in tomato after 23 weeks of Fol infection, when they were
readily identified in the xylem sap (Houterman et al., 2007;
Rep et al., 2002). This increase agrees with our observed
increase in SA accumulation 2 weeks after infection. Future
experiments should aim to quantify the free SA levels at
infection foci to resolve the exact mechanisms underlying the
reduced susceptibility of hpSAMT plants to F. oxysporum.
Although the role of SA/MeSA in local defence seems to
be conserved between Arabidopsis and tomato, it is
currently unclear whether this also holds for systemic
responses. In tobacco, the conversion of SA into MeSA is
required for SAR, and the silencing of SAMT leads to the loss
of SAR (Park et al., 2007). MeSA can be reconverted to SA via
an esterase: salicylic acid-binding protein 2 (SABP2) (Forouhar et al., 2005), which is also essential for SAR in tobacco
(Park et al., 2007). Functional orthologs of SABP2 have
recently been identified in Arabidopsis (Vlot et al., 2008a,b)
and poplar (Populus trichocarpa) (Zhao et al., 2009). Interestingly, SAR was also compromised in Arabidopsis
mutants with reduced expression levels of these orthologs,
resulting in higher MeSA levels accumulating systemically
(Vlot et al., 2008a,b). In Arabidopsis, however, MeSA production was not found to be essential for SAR, and, instead,
the mobile metabolite azelaic acid seems to be involved
(Attaran et al., 2009; Jung et al., 2009). The hpSAMT lines
described here provide a valuable tool to investigate the
involvement of MeSA in systemic resistance in tomato, and
to test whether the mechanism resembles that in tobacco or

Arabidopsis. With these lines, this study already revealed

that conversion of SA to MeSA affects both direct and
indirect plant defences.
EXPERIMENTAL PROCEDURES
Plant material and arthropod rearing
Tomato (S. lycopersicum cv. Moneymaker GCR161) seedlings were
grown in a glasshouse with daynight temperatures of 2318C and
a 16-h light/8-h dark regime. Three days prior to the start of each
experiment, plants were transferred to a climate room at 2318C
with a 16-h light/8-h dark regime (300 lE m)2 sec)1 light) and a
relative humidity of 60%. The two-spotted spider mite T. urticae
Koch was originally obtained from tomato plants cultivated in a
glasshouse (Houten, the Netherlands; Gotoh et al., 1993), and has
been maintained on the tomato cultivar Moneymaker ever since.
Three-week-old tomato plants were infested with adult females
randomly selected from this colony using a soft-bristle paintbrush.
Predatory mites (P. persimilis) were kindly provided by Koppert
Biological Systems NV (http://www.koppert.com). These predatory
mites were grown on spider mite-infested lima bean plants and
were thus naive for tomato volatiles.

Construction of the hpRNA construct

The RNA interfering hairpin construct was produced by fusing part
of the SAMT gene with a fragment of the GUS reporter gene
(Tomilov et al., 2008; Wroblewski et al., 2007). Briefly, a 303-bp
fragment of the 3 coding part of the SAMT gene (SGN U317256,
bases 7811084 downstream from the ATG codon) was amplified
with primers in which SfiI restriction enzyme cleavage sites were
introduced: Fsamt-Sfi, ATGGCCATGTAGGCCTATACACCATCACAAGGA; Rsamt-Sfi, ATGGCCAGAGAGGCCTTTTTTCTTGGTCAAGGA (the 15-bp adapters bearing the SfiI cleavage site are set in
bold). The obtained fragment was fused to a 451-bp fragment of the
GUS gene (U12639, bases 26443095) encoding part of the b-glucuronidase protein. This chimaeric fragment was used to create an
inverted-repeat structure in the binary vector pGSA1165 (http://
www.chromdb.org). The two arms of the inverted repeat were
separated by intron 3 (788 bp) of the pdk gene from Flaveria
trinervia. The complete SAMT fragment in this construct, including
its borders, was sequenced using primers pGreenF2 (ACTATCCTTCGCAAGACCC) and OCStermRev (TCATGCGATCATAGGCGTCT), annealing to the CaMV 35S promoter and the OCS
terminator of pGSA1165, respectively. SfiI was obtained from New
England Biolabs (http://www.neb.com). T4 DNA ligase was obtained
from Fermentas (http://www.fermentas.com).

Plant transformation and selection of transgenic plants

For tomato transformation, the hpSAMT construct was introduced
into Agrobacterium tumefaciens strain LBA4404 (Hoekema et al.,
1983). Transgenic plants were produced using explants derived
from cotyledons of sterile seedlings, as previously reported (Cortina
and Culianez-Macia, 2004), with some modifications (Appendix S1).
The presence of the T-DNA insertion in primary transformants
was assessed by the presence of the neomycin phosphotransferase
gene (NPTII) using PCR (data not shown). DNA was isolated from
leaves using a modified cetyltrimethylammonium bromide (CTAB)
procedure (Bernatzky and Tanksley, 1986). Two primers, FNptII
(CCGGTTCTTTTTGTCAAGAC) and RNptII (AGAAGAACTCGTCAAGAAGG), were used to assay for a 661-bp fragment that is diagnostic
for the NPTII gene. The number of T-DNA inserts was analysed by
Southern blotting using the NPTII gene as the probe (data not
shown). Briefly, genomic DNA was digested with the restriction

2010 The Authors

Journal compilation 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 62, 124134

132 Kai Ament et al.

enzyme BglII (Fermentas), blotted on nylon filter (Hybond-N) and
hybridized with the [a-32P]NPTII radioactive probe (DecaLabel DNA
labelling kit; Fermentas). Silencing in T1 progeny and T0 parents was
assayed by screening for reduced GUS expression upon leaf
infiltration with A. tumefaciens strain C58C1 harboring the pTFS40
vector (Jones et al., 1992), which allows GUS expression in planta
(Wroblewski et al., 2005). Leaf infiltrations were performed as
described previously (Schob et al., 1997). Histochemical GUS
staining was performed as described before (Jefferson et al., 1987).

Analysis of volatiles in the headspace

The volatiles in the headspace of control plants and three hpSAMT
lines, either infested with spider mites or clean, were collected and
analyzed. Plants were infested with spider mites for 4 days after
which three plants (clean or infested) were enclosed in 40-L glass
desiccators. Carbon-filtered air was pumped through the system
and volatiles were trapped on 5-mm-wide glass tubes filled with
300 mg of Tenax TA (Grace Davison Discovery Science, http://
www.discoverysciences.com). The airflow was set at 200 ml min)1
(Ament et al., 2004). All connections in the set-up were sealed with
Teflon tape. After 24 h of sampling, the Tenax tubes were eluted
with 2 ml pentane:diethylether (4:1; Sigma-Aldrich, http://
www.sigmaaldrich.com) into amber vials (Fisher Emergo BV, http://
www.emergolab.com). Benzyl acetate (Fluka, now part of SigmaAldrich) was added to the pentane : diethylether mixture as an
internal standard at a concentration of 500 ng ml)1. The eluted
volatiles were concentrated by a stream of carbon-filtered N2 to
100 ll at 4C.
A 1-ll portion of the eluent was injected in an Optic injector port
(ATAS GL, http://www.atasgl.com), set to 50C, which was subsequently heated to 250C at 4C sec)1. The split-flow was set to
0 ml sec)1 for 2 min; thereafter, the split-flow was set to 25 ml sec)1
until the end of the run. Compounds were separated on a capillary
DB-5 column (10 m 180 lm, film thickness 0.18 lm; Hewlett
Packard, http://www.chem.agilent.com), with He as the carrier.
The temperature of the column was set to 40C for 3 min; thereafter,
the temperature was raised to 250C at 30C min)1. The column flow
was 3 ml min)1 for the first 2 min, and was then set to 1.5 ml min)1
for the rest of the run. Mass spectra of the eluting compounds were
collected on a Time-of-Flight MS (Pegasus II; LECO, http://www.
leco.com), with 160-sec solvent delay at )1646 eV (ion source set at
200C), at an acquisition rate of 20 spectra sec)1. Volatiles were
identified and quantified on the basis of external standards of
known concentrations after normalization to the internal standard.
Significance of differences in emission was determined through a
repeated-measure ANOVA using SPSS 16.0, followed by a Tukeys
post-hoc test.

Olfactory choice assays

Directly after the removal of the Tenax sampling tube, the outlet of
the desiccator was connected to a Y-tube olfactometer for predatory
mite olfactory choice assays, as described by Bruin et al. (1992).
Predatory mites were deprived of prey for at least 24 h prior to the
bioassay. Individual predatory mites were placed in the long arm of
the Y-tube olfactometer with a soft-bristle paintbrush. The short
arms of the olfactometer were connected to the odour sources. An
individual predatory mite was allowed to make its choice within
5 min, after which it was removed from the set-up. The predatory
mite was scored as no choice if it failed to reach either end of the
short arms within 5 min. A minimum of 25 predatory mites were
tested per replicate. After 5 min, the odour sources connected to the
short arms of the olfactometer were exchanged to eliminate any
bias in the set-up.

RNA isolation and analysis by real-time RT-PCR

measurements
For determination of the relative expression of SAMT, total RNA was
isolated from the nine leaflets of three spider mite-infested plants,
and similar leaflets from three clean plants, using Trizol (Invitrogen,
http://www.invitrogen.com). For the determination of relative transcript levels of SAMT in different organs and tissues, total RNA was
isolated from flower buds, green, orange and red fruits, stems,
petioles, plant tops, young, mature and senescent leaves, and roots
of mature plants. DNA was removed with DNAse (Ambion, http://
www.ambion.com). cDNA was synthesized from 5 lg of total RNA
using M-MuLV Reverse Transcriptase (Fermentas), as described by
the manufacturer, in a 20-ll reaction that was diluted to 50 ll prior to
using it for PCR. PCRs were performed in an ABI 7500 Real-Time PCR
system (Applied Biosystems, http://www.appliedbiosystems.com),
using the Platinum SYBR Green qPCR SuperMix-UDG kit (Invitrogen). The 20-ll PCR reactions contained 0.25 lM of each primer,
0.1 ll ROX reference dye and 1 ll of cDNA. The cycling program was
set to 5 min at 50C, 5 min at 95C, 40 cycles of 15 sec at 95C and
1 min at 60C, followed by a melting curve analysis. Primer pairs
were tested for specificity (amplified products were sequenced), and
amplification was tested for linearity with a standard cDNA dilution
series. The primers used for SlSAMT amplification were SAMTqF2,
TCAATATACACCATCACAAGGAGAAG, and SAMTqR2, GCTCTCATGCACTTTGACACATTG. Expression levels for SAMT were normalized to the expression of RUB1 conjugating enzyme (RCE1
TC116081). The primers used for RCE1 amplification were RCE1qF,
GAACGTAAATGTGCCACCCATA, and RCE1qR, GATTCTCTCTCATCAATCAATTCG.

Functional expression of SAMT in E. coli

The full-length cDNA of SAMT (SGN U317256) was cloned in frame
with the translation start of the expression vector pET32a(+)
(Novagen, now part of Merck, http://www.merck-chemicals.com).
Briefly, the full-length coding sequence of SAMT was amplified with
primer pairs NcoLong (CATGAAGGTTGTTGAAGTTCTTC) and
XhoShort (TTATTTTTTCTTGGTCAAGGAG), and with NcoShort
(AAGGTTGTTGAAGTTCTTC) with XhoLong (AGCTTTATTTTTTCTTGGTCAAGGAG), respectively. The two PCR products were combined, heated to 96C for 5 min and left to cool to room temperature
(2122C), thus generating NcoI and XhoI overhangs (set in bold in
the primers above) in a subset of the annealing products. Subsequently, these DNA fragments were ligated with pET32a(+) digested
with NcoI plus XhoI, and transformed to E. coli BL21 (DE3). Transformed cells were grown at 37C until they reached an OD600 of 0.8.
Isopropyl-b-D-thiogalactopyranosid (IPTG; Sigma-Aldrich) and salicylic acid (Janssen Chimica, http://www.janssenpharmaceutica.be)
were added to a final concentration of 1 mM. After 3 h at 37C, cells
were pelleted by centrifugation (16 000 g for 5 min), and 3 ml of the
supernatant was extracted with 1.5 ml of hexane. A 1-ll portion of
hexane was injected into the injector port of the GC-MS TOF, as
described above.

Fusarium bioassays
Tomato cultivar Moneymaker GCR161, which contains the I gene
(Kroon and Elgersma, 1993), was inoculated with race-2 isolate of
F. oxysporum f. sp. lycopersici (Fol007; virulent on GCR161) or with
race-1 isolate Fol004 (Rep et al., 2005) (avirulent on GCR161). Inoculation was performed using the root-dip method (Wellman, 1939).
Briefly, conidial spores were collected from 5-day-old cultures
grown in NO3 medium (3% sucrose, 5 mM KNO3, 0.17% Yeast
Nitrogen Base without amino acids and ammonium sulphate;

2010 The Authors

Journal compilation 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 62, 124134

Role of methyl salicylate in tomato defence 133

Duchefa, http://www.duchefa.com). After washing the spores, they
were used for root inoculation at a density of 107 spores ml)1.
Twenty 10-day-old uprooted seedlings were incubated for several
minutes in the spore suspension and potted individually in a random block design (with five seedlings per block). Disease symptoms
were scored 3 weeks after inoculation by measuring plant weight
above the cotyledons, and by determining the extent of browning of
vessels at the height of the cotyledons. The disease index was
scored on a scale of 04: where 0 = no symptoms; 1 = slightly
swollen hypocotyl; 2 = one or two brown vascular bundles in the
hypocotyl; 3 = at least two brown vascular bundles and growth
distortion (strong bending of the stem and asymmetric plant
development); and 4 = all vascular bundles brown, plant either
dead or very small and wilted. Ten seedlings of GCR161 and
hpSAMT lines were used for mock inoculation as a control. A oneway ANOVA with Dunnets post-hoc test, and a pairwise comparison
with the Students t-test for the weight measurements and the nonparametrical MannWhitney U-test for the disease index, was performed using PRISM 5.0 (GraphPad, http://www.graphpad.com). An
infection assay of 4-week-old plants was carried out by incubating
the trimmed root system in a spore suspension (5 106 ml)1) for
several minutes and potting the plants individually in a random
design. Roots were collected, frozen in liquid nitrogen and stored at
)80C for the determination of the SA and MeSA levels.

SA and MeSA determinations

SA measurements were performed as described by Diezel et al.
(2009). MeSA was detected in these extracts in the electrospray
ionization-positive mode by molecular ion [M-H](+) at m/z 121 after
collision-induced fragmentation with Argon under )9.5 V of collision energy. A standard curve of MeSA was made in tomato leaf or
root extract that was extracted in the same way as for quantifying
the MeSA levels in the samples.

ACKNOWLEDGEMENTS
We would like to thank Ludek Tikovski, Harrold Lemereis and Thijs
Hendrix for taking care of our plants; Petra Houterman for helping
with Fusarium bioassays; Marian Vroomen for assisting with the
transformation of tomato; Mario Kallenbach for help in optimizing
the MeSA detection method; Martijn Hedden and Bastiaan Koster
for helping with the olfactometer experiments; and Tadeusz
Wroblewski for guidance and the vector to generate the hpSAMT
silencing constructs. We are also grateful to Tadeusz for providing
the C58C1 strain carrying the pTFS40 plasmid. This work was supported by the University of Amsterdam (KA, VK, FLWT, MR, RCS)
and the Max Planck Society (SA).

SUPPORTING INFORMATION
Additional Supporting Information may be found in the online
version of this article:
Figure S1. Spatial expression of SAMT in tomato.
Figure S2. SAMT is capable of methylating SA.
Figure S3. Sequence alignment of deduced proteins of SlSAMT and
several members of the SABATH family.
Figure S4. Transient GUS expression is silenced in T1 progeny of
hpSAMT lines.
Appendix S1. Supplementary experimental procedures.
Please note: As a service to our authors and readers, this journal
provides supporting information supplied by the authors. Such
materials are peer-reviewed and may be re-organized for online
delivery, but are not copy-edited or typeset. Technical support
issues arising from supporting information (other than missing
files) should be addressed to the authors.

REFERENCES
Aime, S., Cordier, C., Alabouvette, C. and Olivain, C. (2008) Comparative
analysis of PR gene expression in tomato inoculated with virulent Fusarium
oxysporum f. sp. lycopersici and the biocontrol strain F. oxysporum Fo47.
Physiol. Mol. Plant Path. 73, 915.
Ament, K., Kant, M.R., Sabelis, M.W., Haring, M.A. and Schuurink, R.C. (2004)
Jasmonic acid is a key regulator of spider mite-induced volatile terpenoid
and methyl salicylate emission in tomato. Plant Physiol. 135, 20252037.
Ament, K., Van Schie, C.C., Bouwmeester, H.J., Haring, M.A. and Schuurink,
R.C. (2006) Induction of a leaf specific geranylgeranyl pyrophosphate
synthase and emission of (E,E)-4,8,12-trimethyltrideca-1,3,7,11-tetraene in
tomato are dependent on both jasmonic acid and salicylic acid signaling
pathways. Planta, 224, 11971208.
Attaran, E., Zeier, T.E., Griebel, T. and Zeier, J. (2009) Methyl salicylate production and jasmonate signaling are not essential for systemic acquired
resistance in Arabidopsis. Plant Cell, 21, 954971.
Barkman, T.J., Martins, T.R., Sutton, E. and Stout, J.T. (2007) Positive selection for single amino acid change promotes substrate discrimination of a
plant volatile-producing enzyme. Mol. Biol. Evol. 24, 13201329.
Bernatzky, R. and Tanksley, S.D. (1986) Genetics of actin-related sequences in
tomato. Theor. Appl. Genet. 72, 314321.
Berrocal-Lobo, M. and Molina, A. (2008) Arabidopsis defense response
against Fusarium oxysporum. Trends Plant Sci. 13, 145150.
de Boer, J.G. and Dicke, M. (2004a) Experience with methyl salicylate affects
behavioural responses of a predatory mite to blends of herbivore-induced
plant volatiles. Entomol. Exp. Appl. 110, 181189.
de Boer, J.G., Posthumus, M.A. and Dicke, M. (2004) Identification of volatiles
that are used in discrimination between plants infested with prey or nonprey herbivores by a predatory mite. J. Chem. Ecol. 30, 22152230.
de Boer, J.G., Hordijk, C.A., Posthumus, M.A. and Dicke, M. (2008) Prey and
non-prey arthropods sharing a host plant: effects on induced volatile
emission and predator attraction. J. Chem. Ecol. 34, 281290.
van den Boom, C.E., van Beek, T.A. and Dicke, M. (2002) Attraction of Phytoseiulus persimilis (Acari: Phytoseiidae) towards volatiles from various
Tetranychus urticae-infested plant species. Bull. Entomol. Res. 92, 539546.
van den Boom, C.E., van Beek, T.A., Posthumus, M.A., de Groot, A. and Dicke,
M. (2004) Qualitative and quantitative variation among volatile profiles
induced by Tetranychus urticae feeding on plants from various families.
J. Chem. Ecol. 30, 6989.
Bruin, J., Dicke, M. and Sabelis, M.W. (1992) Plants are better protected
against spider mites after exposure to volatiles from infested conspecifics.
Experientia, 48, 525529.
Cortina, C. and Culianez-Macia, F.A. (2004) Tomato transformation and
transgenic plant production. Plant Cell Tissue Organ Cult. 76, 269275.
De Boer, J.G. and Dicke, M. (2004b) The role of methyl salicylate in prey
searching behavior of the predatory mite Phytoseiulus persimilis. J. Chem.
Ecol. 30, 255271.
De Boer, J.G. and Dicke, M. (2006) Olfactory learning by predatory arthropods.
Anim. Biol. 56, 143155.
Debruyne, M., Dicke, M. and Tjallingii, W.F. (1991) Receptor cell responses in
the anterior tarsi of Phytoseiulus persimilis to volatile kairomone components. Exp. Appl. Acarol. 13, 5358.
Dicke, M., Vanbeek, T.A., Posthumus, M.A., Bendom, N., Vanbokhoven, H.
and Degroot, A.E. (1990) Isolation and identification of volatile kairomone
that affects acarine predator-Prey interactions involvement of host plant
in its production. J. Chem. Ecol. 16, 381396.
Dicke, M., Gols, R., Ludeking, D. and Posthumus, M.A. (1999) Jasmonic acid
and herbivory differentially induce carnivore-attracting plant volatiles in
lima bean plants. J. Chem. Ecol. 25, 19071922.
Diezel, C., von Dahl, C.C., Gaquerel, E. and Baldwin, I.T. (2009) Different
Lepidopteran elicitors account for cross-talk in herbivory-induced phytohormone signaling. Plant Physiol. 150, 15761586.
Drukker, B., Bruin, J. and Sabelis, M.W. (2000) Anthocorid predators learn to
associate herbivore-induced plant volatiles with presence or absence of
prey. Physiol. Entomol. 25, 260265.
Effmert, U., Saschenbrecker, S., Ross, J., Negre, F., Fraser, C.M., Noel, J.P.,
Dudareva, N. and Piechulla, B. (2005) Floral benzenoid carboxyl methyltransferases: from in vitro to in planta function. Phytochemistry, 66,
12111230.
Farmer, E.E. (2001) Surface-to-air signals. Nature, 411, 854856.

2010 The Authors

Journal compilation 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 62, 124134

134 Kai Ament et al.

Forouhar, F., Yang, Y., Kumar, D. et al. (2005) Structural and biochemical
studies identify tobacco SABP2 as a methyl salicylate esterase and implicate it in plant innate immunity. Proc. Natl Acad. Sci. USA, 102, 17731778.
Gaffney, T., Friedrich, L., Vernooij, B., Negrotto, D., Nye, G., Uknes, S., Ward,
E., Kessmann, H. and Ryals, J. (1993) Requirement of salicylic acid for the
induction of systemic acquired resistance. Science, 261, 754756.
Gotoh, T., Bruin, J., Sabelis, M.W. and Menken, S.B.J. (1993) Host race formation in Tetranychus urticae: genetic differentiation, host plant preference and mate choice in tomato an cucumber strain. Enomol. Exp. Appl. 68,
171178.
Hoekema, A., Hirsch, P.R., Hooykaas, P.J.J. and Schilperoort, R.A. (1983) A
binary plant vector strategy based on separation of Vir-region and T-region
of the Agrobacterium tumefaciens Ti-plasmid. Nature, 303, 179180.
Houterman, P.M., Speijer, D., Dekker, H., de Koster, C.G., Cornelissen, B.J.C.
and Rep, M. (2007) The mixed xylem sap proteome of Fusarium oxysporum-infected tomato plants. Mol. Plant Pathol. 8, 215221.
Howe, G.A., Lightner, J., Browse, J. and Ryan, C.A. (1996) An octadecanoid
pathway mutant (JL5) of tomato is compromised in signaling for defense
against insect attack. Plant Cell, 8, 20672077.
Jefferson, R.A., Kavanagh, T.A. and Bevan, M.W. (1987) GUS fusions: betaglucuronidase as a sensitive and versatile gene fusion marker in higher
plants. EMBO J. 6, 39013907.
Jones, J.D., Shlumukov, L., Carland, F., English, J., Scofield, S.R., Bishop, G.J.
and Harrison, K. (1992) Effective vectors for transformation, expression of
heterologous genes, and assaying transposon excision in transgenic
plants. Transgenic Res. 1, 285297.
Jung, H.W., Tschaplinski, T.J., Wang, L., Glazebrook, J. and Greenberg, J.T.
(2009) Priming in systemic plant immunity. Science, 324, 8991.
Kant, M.R., Ament, K., Sabelis, M.W., Haring, M.A. and Schuurink, R.C. (2004)
Differential timing of spider mite-induced direct and indirect defenses in
tomato plants. Plant Physiol. 135, 483495.
Kant, M.R., Sabelis, M.W., Haring, M.A. and Schuurink, R.C. (2008) Intraspecific
variation in a generalist herbivore accounts for differential induction
and impact of host plant defences. Proc. R. Soc. Lond. B Biol. Sci. 275,
443452.
Kappers, I.F., Aharoni, A., van Herpen, T.W.J.M., Luckerhoff, L.L.P., Dicke, M.
and Bouwmeester, H.J. (2005) Genetic engineering of terpenoid metabolism attracts, bodyguards to Arabidopsis. Science, 309, 20702072.
Koo, Y.J., Kim, M.A., Kim, E.H. et al. (2007) Overexpression of salicylic acid
carboxyl methyltransferase reduces salicylic acid-mediated pathogen
resistance in Arabidopsis thaliana. Plant Mol. Biol. 64, 115.
Kroon, B.A.M. and Elgersma, D.M. (1993) Interactions between Race-2 of
Fusarium oxysporum f sp lycopersici and near-Isogenic Resistant and
Susceptible Lines of Intact Plants or Callus of Tomato. J. Phytopathol. 137,
19.
Liu, P.-P., Yang, Y., Pichersky, E. and Klessig, D.F. (2010) Altering expression
of Benzoic acid/Salicylic acid carboxyl methyltransferase 1 compromises
systemic acquired resistance and PAMP-triggered immunity in Arabidopsis. Mol. Plant Microbe Interact. 23, 8290.
Mandal, S., Mallick, N. and Mitra, A. (2009) Salicylic acid-induced resistance to
Fusarium oxysporum f. sp. lycopersici in tomato. Plant Physiol. Biochem.
47, 642649.
Park, S.W., Kaimoyo, E., Kumar, D., Mosher, S. and Klessig, D.F. (2007) Methyl
salicylate is a critical mobile signal for plant systemic acquired resistance.
Science, 318, 113116.
Rayapuram, C. and Baldwin, I.T. (2007) Increased SA in NPR1-silenced plants
antagonizes JA and JA-dependent direct and indirect defenses in herbivore-attacked Nicotiana attenuata in nature. Plant J. 52, 700715.
Rep, M., Dekker, H.L., Vossen, J.H., de, B.A.D., Houterman, P.M., Speijer, D.,
Back, J.W., de, K.C.G. and Cornelissen, B.J.C. (2002) Mass spectrometric
identification of isoforms of PR proteins in xylem sap of fungus-infected
tomato. Plant Physiol. 130, 904917.
Rep, M., Meijer, M., Houterman, P.M., van der Does, H.C. and Cornelissen,
B.J.C. (2005) Fusarium oxysporum evades I-3-mediated resistance without

altering the matching avirulence gene. Mol. Plant Microbe Interact. 18,
1523.
Sabelis, M.W. and Vandebaan, H.E. (1983) Location of distant spider-mite
colonies by phytoseiid predators demonstration of specific kairomones
emitted by Tetranychus urticae and Panonychus ulmi. Entomol. Exp. Appl.
33, 303314.
Sabelis, M.W., Vermaat, J.E. and Groeneveld, A. (1984) Arrestment responses
of the predatory mite, Phytoseiulus persimilis, to steep odor gradients of a
kairomone. Physiol. Entomol. 9, 437446.
Schob, H., Kunz, C. and Meins, F. Jr (1997) Silencing of transgenes introduced
into leaves by agroinfiltration: a simple, rapid method for investigating
sequence requirements for gene silencing. Mol. Gen. Genet. 256, 581585.
Sokal, R.R. and Rohlf, F.J. (1995) Replicated test of goodness of fit. In Biometry: the Principles and Practice of Statistics in Biological Research. New
York, USA: W.H. Freeman and Company.
Song, J.T., Koo, Y.J., Seo, H.S., Kim, M.C., Choi, Y.D. and Kim, J.H. (2008)
Overexpression of AtSGT1, an Arabidopsis salicylic acid glucosyltransferase, leads to increased susceptibility to Pseudomonas syringae. Phytochemistry, 69, 11281134.
Song, J.T., Koo, Y.J., Park, L.-B., Seo, Y.J., Cho, Y.-J., Seo, H.S. and Choi, Y.D.
(2009) The expression patterns of AtBSMT1 and AtSAGT1 encoding a salicylic acid (SA) methyltransferase and a SA glucosyltransferase, respectively, in Arabidopsis plants with altered defense responses. Mol. Cells, 28,
105109.
Tieman, D., Zeigler, M., Schmelz, E., Taylor, M.G., Rushing, S., Jones, J.B. and
Klee, H.J. (2010) Functional analysis of a tomato salicylic acid methyl
transferase and its role in synthesis of the flavor volatile methylsalicylate.
Plant J. (this issue).
Tomilov, A.A., Tomilova, N.B., Wroblewski, T., Michelmore, R. and Yoder, J.I.
(2008) Trans-specific gene silencing between host and parasitic plants.
Plant J. 56, 389397.
Van der Does, H.C., Duyvesteijn, R.G.E., Goltsteijn, P.M., van Schie, C.C.N.,
Manders, E.M.M., Cornelissen, B.J.C. and Rep, M. (2008) Expression of
effector gene SIX1 of Fusarium oxysporum requires living plants cells.
Fungal Genet. Biol. 45, 12571264.
Vlot, A.C., Liu, P.P., Cameron, R.K. et al. (2008a) Identification of likely
orthologs of tobacco salicylic acid-binding protein 2 and their role in systemic acquired resistance in Arabidopsis thaliana. Plant J. 56, 445456.
Vlot, A.C., Klessig, D.F. and Park, S.W. (2008b) Systemic acquired resistance:
the elusive signal(s). Curr. Opin. Plant Biol. 11, 436442.
Wellman, F.L. (1939) A technique for studying host resistance and pathogenicity in tomato Fusarium wilt. Phytopathology, 29, 945956.
van Wijk, M., Wadman, W.J. and Sabelis, M.W. (2006) Morphology of the
olfactory system in the predatory mite Phytoseiulus persimilis. Exp. Appl.
Acarol. 40, 217229.
van Wijk, M., De Bruijn, P.J. and Sabelis, M.W. (2008) Predatory mite attraction to herbivore-induced plant odors is not a consequence of attraction to
individual herbivore-induced plant volatiles. J. Chem. Ecol. 34, 791803.
Wildermuth, M.C., Dewdney, J., Wu, G. and Ausubel, F.M. (2001) Isochorismate synthase is required to synthesize salicylic acid for plant defence.
Nature, 414, 562565.
Wootton, J.T. (1994) The nature and consequences of indirect effects in
ecological communities. Annu. Rev. Ecol. Syst. 25, 443466.
Wroblewski, T., Tomczak, A. and Michelmore, R. (2005) Optimization of
Agrobacterium-mediated transient assays of gene expression in lettuce,
tomato and Arabidopsis. Plant Biotechnol. J. 3, 259273.
Wroblewski, T., Piskurewicz, U., Tomczak, A., Ochoa, O. and Michelmore,
R.W. (2007) Silencing of the major family of NBS-LRR-encoding genes in
lettuce results in the loss of multiple resistance specificities. Plant J. 51,
803818.
Zhao, N., Guan, J., Forouhar, F., Tschaplinski, T.J., Cheng, Z.M., Tong, L. and
Chen, F. (2009) Two poplar methyl salicylate esterases display comparable
biochemical properties but divergent expression patterns. Phytochemistry,
70, 3239.

Accession number: SGN-U317256.

2010 The Authors

Journal compilation 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 62, 124134

Copyright of Plant Journal is the property of Wiley-Blackwell and its content may not be copied or emailed to
multiple sites or posted to a listserv without the copyright holder's express written permission. However, users
may print, download, or email articles for individual use.