Food Chemistry 166 (2015) 231239

Contents lists available at ScienceDirect

Food Chemistry
journal homepage: www.elsevier.com/locate/foodchem

A cell-penetrating peptide analogue, P7, exerts antimicrobial activity

against Escherichia coli ATCC25922 via penetrating cell membrane
and targeting intracellular DNA
Lirong Li a,b,c,1, Yonghui Shi a,c, Xiangrong Cheng a,c, Shufang Xia a,c, Maureen Jepkorir Cheserek a,c,d,
Guowei Le a,c,
a

Institute of Food Nutrition and Safety, School of Food Science and Technology, Jiangnan University, Wuxi, Jiangsu Province, China
Institute of Food Safety, Kunming University of Science and Technology, Kunming, Yunnan Province, China
c
The State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi, Jiangsu Province, China
d
Human Nutrition Department, Egerton University, PO Box 536, Egerton, Kenya
b

a r t i c l e

i n f o

Article history:
Received 21 September 2013
Received in revised form 9 April 2014
Accepted 20 May 2014
Available online 6 June 2014
Keywords:
Escherichia coli
Antimicrobial peptide
Penetrate cell membrane
DNA binding

a b s t r a c t
The antibacterial activities and mechanism of a new P7 were investigated in this study. P7 showed antimicrobial activities against ve harmful microorganisms which contaminate and spoil food (MIC = 4
32 lM). Flow cytometry and scanning electron microscopy analyses demonstrated that P7 induced
pore-formation on the cell surface and led to morphological changes but did not lyse cell. Confocal uorescence microscopic observations and ow cytometry analysis expressed that P7 could penetrate the
Escherichia coli cell membrane and accumulate in the cytoplasm. Moreover, P7 possessed a strong DNA
binding afnity. Further cell cycle analysis and change in gene expression analysis suggested that P7
induced a decreased expression in the genes involved in DNA replication. Up-regulated expression genes
encoding DNA damage repair. This study suggests that P7 could be applied as a candidate for the development of new food preservatives as it exerts its antibacterial activities by penetrating cell membranes
and targets intracellular DNA.
2014 Elsevier Ltd. All rights reserved.

1. Introduction
Food preservation plays an important role in the food industry.
Food preservatives are used to secure food quality and extend their
shelf life. Microorganisms are one of the important factors that
inuence the safety of the food. Great concerns have arisen from
food safety problems caused by harmful microorganisms that
induce food contamination and deterioration. Microorganisms
from polluted foods may cause a number of infections and the
spread of diseases. Minimally processed and safe foods are in high
demand. Such demands call for better, more efcient antimicrobial
sources of biological preservatives that inhibit food contamination.
Due to the limited safety proles of chemical preservatives and
efciency of natural antimicrobial agents, there is a need for them
to be improved.

Corresponding author at: The State Key Laboratory of Food Science and
Technology, Jiangnan University, Wuxi, Jiangsu Province, China. Tel./fax: +86 510
85917789 (G. Le).
E-mail addresses: lirong.lily@gmail.com (L. Li), lgw@jiangnan.edu.cn (G. Le).
1
Tel./fax: +86 0871 65920171 (L. Li)
http://dx.doi.org/10.1016/j.foodchem.2014.05.113
0308-8146/ 2014 Elsevier Ltd. All rights reserved.

Antimicrobial peptides (AMPs) are defensive molecules in higher

organisms that provide innate immunity against invading organisms (Splith & Neundorf, 2011). AMPs show potential antimicrobial
activities against Gram-positive and Gram-negative bacteria, fungi,
protozoa, viruses and tumour cells, but do not bring about cytotoxic
effects in normal cells. Compared with traditional antibiotics, AMPs
have a broad spectrum of activity against pathogenic microorganisms, are interactive with cell membranes without specic receptors, thus they seldom induce antibiotic resistance (Fjell, Hiss,
Hancock, & Schneider, 2011). Their activities and selectivity contribute to their important role in their practical applications. Currently,
Nisin is the only antimicrobial peptide widely applied as a food
preservative against Gram-positive bacteria (Cleveland, Montville,
Nes, & Chikindas, 2001; Delves-Broughton, Blackburn, Evans, &
Hugenholtz, 1996). Due to these potential advantages of AMPs, they
could be promising candidates for the development of new food
preservatives.
In our previous study, we derived a cell-penetrating peptide
(CPP) analogue, P7, by replacing Phe and Trp with the Arg in the
parent peptide, ppTG20, based on the structureactivity relationship of AMP and CPP (Li, Shi, Su, & Le, 2012). It showed potent

232

L. Li et al. / Food Chemistry 166 (2015) 231239

bactericidal activities against pathogenic and spoilage microorganisms pertinent to food and possessed good selectivity. This study
was aimed to investigate the antimicrobial mechanism of P7
against Escherichia coli. Insights into the mechanism employed by
P7 will facilitate new approaches to discover and guide the
development of efcient food preservatives.

2. Materials and methods

2.1. Materials
Propidium iodide (PI) and uorescein isothiocyanate (FITC)
were purchased from Sigma (St. Louis, MO, USA). Gram-negative
(E. coli ATCC25922, Shigella dysenteriae CMCC51302 and Salmonella
typhimurium CMCC50013) and Gram-positive (Listeria monocytogenes CMCC54002 and Staphylococcus aureus ATCC25923) were
obtained from the Centre for Disease Control and Prevention
(Wuxi, China). Peptides were chemically synthesized on a solidphase synthesizer and puried (>98% homogeneity) by reversedphase high-performance liquid chromatography (RP-HPLC) on a
C18 column. Peptides were characterized by mass spectroscopy
and amino acid analysis.

2.2. Antimicrobial activity

The antimicrobial activities of the peptides were determined by
a microdilution assay (Yang, Shin, Hahm, & Kim, 2006). Bacterial
cells were collected in the mid-logarithmic growth phase,
washed three times with physiological saline and suspended at
2  106 CFU/ml in fresh LuriaBertani (LB) culture medium.
Aliquots of 100 ll of a set of twofold serial dilutions of peptides
(concentrations range from 640.031 lM) in 1% peptone was added
to 100 ll of bacteria together in 96-well plates. After incubation at
37 C for 18 h, the inhibition of bacterial growth in each well
was determined by measuring absorbance at 630 nm with a microplate reader (Multiskan MK3, Thermo China). The minimal
inhibitory concentration (MIC) of the peptide was dened as the
lowest peptide concentration that completely inhibited bacterial
growth.

2.3. Cell membrane integrity analysis

The experiment was performed according to Joshi et al. with
some modications (Joshi et al., 2010). The peptide was added to
the E. coli cells suspension (1  106 CFU/ml) to give a nal concentration of 8 lM, and the mixtures were incubated at 37 C for 0.5 h.
Then the cells were xed with PI (nal concentration 10 lg/ml) for
15 min at 4 C in the dark. A FACS Calibur ow cytometer (Becton
Dickinson, USA) was used for analysis. Data were analysed using
WinMDI 2.9 software.

2.4. Scanning electron microscopy

The Escherichia coli cell suspension (1  106 CFU/ml) was incubated with P7 (nal concentration 8 lM) at 37 C for 0.5 h. A control was incubated in 10 mM sodium phosphate (pH 7.4). The cells
were collected by centrifugation (2000 rpm for 5 min), washed
three times with 10 mM sodium phosphate (pH7.4) and xed with
2.5% glutaraldehyde in sodium phosphate buffer at 4 C overnight.
Thereafter, the cells were dehydrated with a graded series of ethanol and dried. Cells were coated with gold and observed under a
scanning electron microscope (S-3000 N, Hitachi Japan).

2.5. Confocal laser-scanning microscopy

Localization of the peptide onto the E. coli cells was determined
with the FITC-labelled peptide by employing a Zeiss LSM-710 confocal microscope with 40X lens. The experiment was performed
according to Park et al. with slight modications (Park, Kim, &
Kim, 1998). The Escherichia coli cell suspension (1  106 CFU/ml)
was incubated in the absence and presence of the FITC-labelled
peptide (nal concentration 8 lM) at 37 C for 0.5 h. After incubation, the cells were centrifuged with 10 mM sodium phosphate
(pH7.4). The cells were then immobilized on a glass slide and analysed by the confocal laser-scanning microscopy. The uorescent
images were obtained with a 488 nm bandpass lter for excitation
of FITC.

2.6. Cell-penetrating efciency analysis

The inux of the FITC-labelled peptides into the bacterial cells
was investigated using a FACS Calibur ow cytometer (Becton Dickinson, USA). The cell penetrating efciency was analysed according
to previously reported methods by Park et al. and Richard et al. with
some minor modications (Park, Yi, Matsuzaki, Kim, & Kim, 2000;
Richard et al., 2003). 1 ml of the E. coli cell suspension
(1  106 CFU/ml) was incubated with the FITC-labelled peptide (at
a nal concentration of 8 lM) at 37 C for 0.5 h. The cells were
collected, washed three times with phosphate buffer saline and
incubated with trypsin (1 mg/ml) for 15 min at 37 C to remove
extracellular, surface-bound peptide. The cells were collected,
washed and resuspended in 1 ml buffer before analysis.

2.7. Electrophoretic mobility shift assay

E. coli genomic DNA was extracted using the CTAB extraction
method. The purity of the extracted genomic DNA was evaluated
by the optical density ratio at 260 nm and 280 nm (OD260/
OD280 = 1.92). The concentration of genomic DNA was determined
by measuring the absorbance at 260 nm (One Drop Spectrophotometer, China) at room temperature.
The assay was described by Imura et al. with some modications (Imura, Nishida, & Matsuzaki, 2007). DNA (250 ng, in
10 mM Tris, 1 mM EDTA buffer, pH 8.0) was mixed with increasing
amounts of peptides in 12 ll at room temperature for 10 min. After
adding 2 ll of loading buffer, the migration of DNA was assessed
by electrophoresis using 0.8% agarose gel in 1 TAE buffer and
detected by the uorescence of EB. Gel retardation was visualized
under UV illumination using a Gel imaging system (Bio-Rad, USA).

2.8. Cell cycle analysis

The cell cycle assays were carried out as described by Steen and
Boye (1980), with some modications. The peptide (nal concentration 8 lM) was added to the E. coli cell (1  108 CFU/ml) suspension and incubated at 37 C for 0.5 h. The cells were centrifuged
(2000 rpm for 5 min) and washed three times with phosphate buffered saline and xed in 1.5 ml 70% ice cold ethanol for 3 h. Cells
were collected and washed three times again. The pellet was resuspended in PI solution (containing Rnase) and incubated at 4 C for
15 min in the dark. The cell cycle was tested using a FACS calibur
ow cytometer (Becton Dickinson, San Jose, CA, USA) and the data
was analysed by ModFit LT 3.0 software (Verity Software House,
ME, USA).

233

L. Li et al. / Food Chemistry 166 (2015) 231239

2.9. Gene expression of the response of E. coli to peptides

2.9.1. RNA isolation
E. coli cells were incubated with 8 lM peptide at 37 C for 30 min
and then collected by centrifugation for 5 min at 5000 rpm. Cells
were lysed in the presence of 10 mg/ml lysozyme at 37 C for
30 min. After incubation, 1 ml of Trizol reagent was added, the
tubes shaken for 15 s and then incubated on ice for 5 min. Chloroform (200 ll) was added to each tube, shaken for 15 s and then
incubated on ice for 5 min. Separation of the aqueous and organic
phase was done by centrifugation at 10,000 rpm for 10 min at
4 C. The supernatant (400 ll) was transferred to a new tube and
mixed with aliquots isopropanol. The RNA was collected by centrifugation 10,000 rpm at 4 C for 10 min. The RNA pellets were
washed twice in 70% ethanol (in DEPC-treated water). The supernatant was discarded, and then the RNA pellets were air-dried on ice
for approximately 10 min and resuspended in 30 ll DEPC-treated
water. The purity of the RNA was evaluated by the optical density
ratio of 260 nm and 280 nm.

2.9.2. Synthesis of cDNA

First-strand cDNAs were synthesized in a reverse transcription
system containing RNA (2 lg), dNTP (10 mM), random hexamer
primer (100 lM), reverse transcription buffer, Rnase inhibitor
(50 U/ll) and M-MLV reverse transcriptase (200 U/ll).

2.9.3. RT-PCR
Quantitative real-time PCRs were performed using the same
cDNA for both the gene of interest and 16S rRNA, using the Greenstar qPCR Master Mix (Bioneer, Korea). Each reaction contained
0.5 ll cDNA, 5 ll SYBR Green PCR Master Mix, 0.4 ll of forward
and reverse primers and 3.7 ll nuclease-free water was used to produce a nal volume of 10 ll. The sequences of the primers were
used as follows: dnaA (chromosomal replication initiator protein)
forward AGCAGTCCATTGATATTATTAAGG, reverse GATGAGTTACCA
GCCACAG; dnaB (replicative DNA helicase) forward CAACAAACAGC
AGGCTGAACC, reverse CTACATCATCCCAGCGTTCGT; dnaG (DNA
primase) forward CGGTCGGGTGATTGGTTTTG, reverse CACAAGCAG
ACGATTGGGTTCA; ssb (single-stranded DNA-binding protein) forward CCAGCAGAGGCGTAAACAAGGT, reverse GATTCGGAAGTAGCC
AGCGTAA; 16s rRNA (16S ribosomal RNA) forward CGGACGGGTGA
GTAATGTCTG, reverse AGGTCCCCCTCTTTGGTCTTG.
The PCR conditions consisted of activation at 95 C for 5 min,
followed by 45 cycles of denaturation at 95 C for 20 s, annealing
at 62 C for 30 s and extension of 72 C for 20 s. A melting curve
step of 95 C for 15 s, 60 C for 15 s and 95 C for 15 s was also
included to verify the specicity of the PCR amplied products
using the software provided with the 7900 real time PCR system
(Applied Biosystems, Foster City, CA, USA). The relative expression
levels of the interest genes were calculated as the ratio to the
housekeeping 16S rRNA gene.

3. Results
3.1. Antibacterial activities of peptides
Compared to ppTG20, P7 exhibited higher antibacterial activity
against all the tested bacterial strains with MIC values between 4
and 32 lM (Table 1). The antibacterial activity against the Gramnegative bacteria was better than the Gram-positive bacteria.
Except for S. aureus, the antibacterial activity of P7 was better than
Nisin, which was active against the Gram-positive bacteria but not
against Gram-positive bacteria.

Table 1
The minimal inhibitory concentrations of peptides against different pathogenic
microorganisms.
Microorganism

MIC (lM)
ppTG20

P7

Nisin

Buforin II (521)

Gram-negative bacteria
E. coli
S. dysenteriae
S. typhimurium

>64
>64
64

8
8
4

>64
>64
>64

1
2
0.5

Gram-positive bacteria
L. monocytogenes
S. aureus

>64
>64

16
32

32
16

1
1

3.2. Peptide induced membrane damage

The increase in the uorescent signal for the cells stained with PI
reects the membrane damage. As showed in Table 2 and Supplementary Fig. S2A, in the absence of the peptide, 99.9% of the
untreated control E. coli cells showed no uorescence signal.
Treatment with ppTG20 caused only a minimal increase in the
uorescence signal (1.67% cells stained with PI, Table 2 and
Supplementary Fig. S2B). Compared to the control group, there
was a signicant increase (9.60%, Table 2 and Supplementary
Fig. S2C) (p < 0.05) in the uorescence when the cells were treated
with P7. The results indicated that P7 damaged rather than removed
the E. coli cell membrane.
3.3. Effect of P7 on morphology of E. coli cells
The morphologic effect of P7 was investigated by SEM. The
E. coli cells were treated with 8 lM P7 for 0.5 h, 1 h and 2 h, respectively. The P7 cells exposed to the peptide for 0.5 h (Fig. 1B) had a
more wrinkled surface than the smooth surface of the untreated
cells (Fig. 1A), and formed pores on the cell surface. Moreover,
the cells treated with P7 for 1 h appeared in an irregular manner,
became lamentous, elongated and formed more pores, depressions or scars on the cell surface (Fig. 1C). However, as the incubation time increased it was accompanied by a corresponding
decrease in the viable bacterial population (Supplementary
Fig. S1) and both the number and degree of damaged cells
increased (Fig. 1D), but the structure of the E. coli cells remained
intact after treatment with P7 for 2 h. This demonstrated that P7
induced pore-formation on the cell surface and led to a morphological change but did not lyse the cell.
3.4. Localization of peptide in E. coli cells
The cellular localization of the peptide in the E. coli cells was
measured using confocal laser-scanning microscopy. The FITClabelled ppTG20 (Fig. 2A) and FITC-labelled P7 (Fig. 2B) were found
to penetrate the cell membrane and accumulated in the cytoplasm
of the E. coli cells after 30 min of incubation at 37 C. This was similar to what occurred in the positive control buforin II (521)
(Fig. 2C), a truncated N-terminal region of buforin II with 5 to 21
residues, which exhibits cell-penetrating properties and kills bacteria by binding to DNA (Park et al., 2000). This result demonstrated that the cytoplasm was the major site of action in the
E. coli by P7.
3.5. Cell-penetrating efciency
Table 2 and Supplementary Fig. S4 showed the results of the
cell-penetrating efciency analysis of E. coli cells incubated with
FITC-labelled peptides. When E. coli cells were treated with the
FITC-labelled P7 for 0.5 h, the uorescence intensity of the treated

234

L. Li et al. / Food Chemistry 166 (2015) 231239

Table 2
Peptide induced membranes damage of E. coli cells and the cell-penetrating efciency of E. coli cells treated with FITC-labelled peptides.
Experimental conditions

Membrane damage (%)

Cell-penetrating efciency (%)

Control
ppTG20
P7
Buforin II (521)

0.06 0.03
1.67 0.82
9.60 2.97*
NT

0.34 0.10#
9.17 0.36*,#
87.9 2.57*
94.2 3.02*

Each value of cell-penetrating efciency is expressed as the mean SD of three independent experiments.
NT, Not test.
*
Signicant difference with control group (P < 0.05).
#
Signicant difference with buforin II (521) group (P < 0.05).

Fig. 1. E. coli cells treated with phosphate buffered saline (A), 8 mM P7 for 0.5 h (B), 1 h (C) and 2 h (D) visualized by scanning electron microscopy.

cells increased to 87.9%, approaching the increase of uorescence

intensity of buforin II (521) (94.2%) but was much higher than
parent peptide (9.17%). There was no signicant difference
between the P7-treated groups and the control groups (P > 0.05).
3.6. DNA binding by electrophoretic mobility shift assay
To evaluate the DNA binding activity of the peptide, a electrophoretic mobility shift assay was performed. The results showed
that P7 could interact with E. coli genomic DNA, the same as the parent peptide. The distance migrated by the peptide-incubated DNA
was different from that migrated by the DNA itself. For ppTG20,

the electrophoretic mobility of the DNA was completely inhibited

by the peptide: DNA weight ratio of 30:1 (Fig. 3A). whereas, P7 completely inhibited the migration of DNA at a weight ratio of 6
(Fig. 3B). BuforinII (521) completely suppressed the migration of
E. coli genomic DNA above a weight ratio of 15 (Fig. 3C). The results
suggested that P7 possessed a stronger DNA binding afnity.
3.7. Effect on cell cycle
The cell cycle of bacteria consists of three stages. Phase I, the time
from cell division to the initiation of chromosome replication, equivalent to phase G1 in the eukaryocyte. While phase R was similar to

235

L. Li et al. / Food Chemistry 166 (2015) 231239

ppTG20 Fluorescence image

P7 Fluorescence image

ppTG20 DIC image

P7 DIC image

ppTG20 Merge image

P7 Merge image

Fig. 2. Confocal uorescence microscopic images of E. coli cells. E. coli cells were treated with 8 lM of FITC-labelled ppTG20 (A), P7 (B) and Buforin II (521) (C) at 37 C for
30 min. FITC-labelled peptides penetrated the cell membrane and accumulated in the cytoplasm. For each of the peptide treatments, uorescence, differential interference
contrast (DIC) and merge images of each cell type are shown.

phase S, which is the phase to replicate the chromosome. Once phase

R was completed, the prokaryote entered phase D directly without
entering phase G2, the time from termination of replication to cell
division (Pan, Na, Xing, Fang, & Wang, 2007; Steen & Boye, 1980).
The cell cycle of normal E. coli cell is shown in Fig. 4A. After treatment
with ppTG20, the percentage of E. coli cells in phase S increased,
while those in phase G1 decreased (Fig. 4B). P7 exhibited a stronger
effect on the cell cycle compared to ppTG20 (Fig. 4C) but the effect
was similar to what was observed in the positive control buforin II

(521) (Fig. 4D). These results indicated that P7 caused most cells
to remain in phase S, affecting the DNA replication of bacteria intracellularly rather than targeting the membrane.
3.8. Change in gene expression in E. coli cells
The quantitative reverse transcriptionpolymerase chain reaction was carried out to analyse whether the expression of the
DNA replication and DNA damage repairing related genes were

236

L. Li et al. / Food Chemistry 166 (2015) 231239

Fig. 3. Gel retardation analysis of the binding of peptide to E. coli genomic DNA. Various amounts of peptides were incubated with 250 ng of E. coli genomic DNA at room
temperature for 10 min and the reaction mixtures were applied to a 0.8% agarose gel electrophoresis. The weight ratio (peptide: DNA) was indicated above each lane.

affected after treatment with the peptide. In Fig. 4E, there was a
signicant decrease in the expression of dnaG mRNA (P < 0.05).
No signicant difference in the expression of the other ve interested genes was observed between the ppTG20 treated and the
control groups (P > 0.05). In contrast, a total of six interest genes
were found to be responsive to P7. P7 included signicantly
decreased expression of genes encoding DNA replication compared
with the control group (P < 0.05). These genes included dnaA, dnaB,
dnaG and ssb. Exposure to P7 resulted in the up-regulation of recA
and recN genes, which are involved in the SOS response to DNA
damage repair. Similar, but more pronounced, expression proles
of recA and recN genes were seen in buforin II (521) treated
groups. The results demonstrated that P7 binded to DNA and it

induced damage in the DNA state, which may signicantly

down-regulate the expression of genes related to DNA replication.

4. Discussion
Natural preservatives are always being developed to satisfy
consumer demand with regard to nutritional, preservative-free
and minimally processed aspects of foods (Tiwari et al., 2009).
Unfortunately, they show a narrow range of antibacterial spectrum
and low antimicrobial activities. Meanwhile, multi-resistant pathogenic bacteria are emerging and pathophoresis caused by foodborne pathogens have created an urgent need for the development

L. Li et al. / Food Chemistry 166 (2015) 231239

237

Fig. 4. Effect of peptide on cell cycle and verication of the expression changes of dnaA, dnaB, dnaG, ssb ,recA and recN of E. coli. cells analysis by ow cytometry. (A) The cell
cycle of normal E. coli cells, (B) cells treated with ppTG20 for 0.5 h, (C) cells treated with P7 for 0.5 h, cells treated with buforin II (521) for 0.5 h (D), (E) The relative
expression level of samples were calibrated by the comparative threshold cycle method, using 16s rRNA as an endogenous control. Data are expressed as fold changes,
normalized to 16s rRNA mRNA expression, where the values for the control group were set at 1.0. Results are showed as means SD. P < 0.05 compared with the control
group. Statistical different versus control as determined by ANOVA post hoc Tukeys test.

of new kinds of preservatives (Rydlo, Miltz, & Mor, 2006). Safe and
efcient preservatives can be used alone or in combination with
other natural preservatives to replace traditional chemical preservatives. Antimicrobial peptides are small peptides with a wide
range of antimicrobial activity (including bacteria, yeasts, and
fungi), effective and safe therapeutics without antibiotic resistance
(Brandenburg, Merres, Albrecht, Varoga, & Pufe, 2012). Their enzymatic hydrolysis products are also safe for changing into small
peptides. There they show prospective applications in the food
industry. The antimicrobial peptides Nisin, which was initially
evaluated as a clinical antibiotic, has been used as a food preservative in dairy products and canned goods (Delves-Broughton et al.,

1996). In a previous study, we derived a cell-penetrating peptide

analogue, P7, and found it possessed higher antimicrobial activities
than the parent peptide and displayed low haemolysis. In this
study, we demonstrated that P7 possessed antimicrobial activities
against ve spoilage and pathogenic microorganisms pertinent to
food. P7, the new peptide with efcient and safe features, could
be a good possible candidate for food preservation.ppTG20
contains 65% hydrophobic amino acids and shows classic amphipathic characteristics. Hydrophobicity is an essential feature for
antibacterial peptidemembrane interactions. If it is too hydrophobic, the peptide may become stuck in the membrane rather than
internalize, thus preventing its transport to the intercellular target

238

L. Li et al. / Food Chemistry 166 (2015) 231239

(Dathe & Wieprecht, 1999). A high percentage of net charge

content plays an essential role in the antibacterial activity of AMPs
(Fjell et al., 2011). In CPPs, a high percentage of hydrophobic residues does not cause more membrane perturbation (Hugonina,
Vukojevc, Bakalkinb, & Grslund, 2006), but the positive charge
and a-helicity are thought to be pivotal factors that mediate CPPs
binding to negatively charged glycosaminoglycans on the plasma
membrane (Rittner et al., 2005). The weak antibacterial activity
of ppTG20 is due to its high ratio of hydrophobic residues and its
low positive charge. Therefore, P7 was derived by replacing
Phe(3) and Trp(14) with Arg to reduce the hydrophobicity
(containing 55% hydrophobic amino acids) but an increase in the
overall positive charge in order to enhance the peptide-membrane
interaction. Decreased hydrophobicity and increase net charge of
ppTG20 did improve its antimicrobial afnity.
Most of the antimicrobial peptides target the cell membranes of
pathogenic microorganisms, lyse the cell membranes and lead to
death. It was not clear whether the antimicrobial mechanism of
P7 that derived from cell-penetrating peptide was same or different. Did P7 act like membrane-active antimicrobial peptide or as
a intracellular-active cell penetrating peptide or other mechanism?
Membrane damage measured in intact bacterial cells was monitoring the increase of PI uorescence after the addition of the peptide.
At a concentration of 8 lM, P7 induced a minor damage effect
(9.60% damage) on the E. coli cell membranes. But bactericidal
kinetics analysis showed that exposure of E. coli to P7 for 0.5 h
did result in an immediate decrease in the number of bacterial cells
(Supplementary Fig. S1). These results further conrmed that P7
kills E. coli in some other way rather than by a membrane damage
mechanism. The observation of morphological changes provided
more of an insight into the membrane effects by P7. Scanning electron microscopy revealed that the untreated E. coli cells exhibited
smooth surface morphology (Fig. 1A). Treatment with P7 for
30 min resulted in wrinkled, elongated and pore formation on
the cell surface (Fig. 1B). Although P7 induced damage to the cell
membranes and surface morphology change of E. coli cells with
the time increased, it didnt lyse the bacterial cell membrane
(Fig. 1C and Fig. 1D). CD spectroscopy has been used to assess
the structural properties of ppTG20 and P7 (Supplementary
Fig. S3A). Their structure is random in PBS, but they both displayed
much higher a-helicities in TFE/PBS. The a-helical content of
ppTG20 and P7 was 79.8% and 81.2%, respectively (Supplementary
Fig. S3B). The conformational transition of each peptide was necessary for the peptide attached to and insertion into the bacterial
membrane, that maybe support their varying abilities to translocate through bacterial membranes. Thus it was conceivable that
the previously described ndings were the results for P7 entering
the cytoplasm to exert its antibacterial activity by targeting other
targets. We further conrmed that the killing mechanism of P7 is
in another way other than membrane-lysing mode. For determination of the site of action of P7, FITC-labelled P7 was incubated with
E. coli cells. The confocal laser-scanning microscopy images (Fig. 2B
and Fig. 2C) revealed that P7 penetrated the cell membrane and
accumulated inside the cytoplasm of E. coli cells, which is similar
to buforin II (521) that kills bacterium by penetrating the cell
membranes and inhibiting cellular function. Table 2 showed the
results of the cell-penetrating efciency of P7 and buforin II
(521). The uorescence intensity of the E. coli cells treated with
P7 increased to 87.9%. The positive control buforin II (521)
penetrated more efciently (94.2%). That is, P7 possessed a high
cell-penetrating efciency. Results of confocal laser-scanning
microscopy images and FACS analysis indicated that P7 could
penetrate E. coli cells membranes without lysing them and the
eventual molecular target of P7 was intracellular.
The initial interaction between P7 and the E. coli cells membrane would allow it to penetrate into the cell to bind to the intra-

cellular targets. The electrophoretic mobility shift assay showed

that P7 could interact with E. coli genomic DNA and completely
inhibited the migration of E. coli genomic DNA above a weight ratio
of 6 (Fig. 3B). The DNA-binding afnity was 5 and 2.5 times stronger than that of parents peptide and buforin II (521), respectively
(Fig. 3A and Fig. 3C). During the DNA-binding process P7 intercalated into the E. coli genomic DNA base pairs, which was further
supported by the competition with EB (ethidium bromide) in binding to the E. coli genomic DNA uorescence experiments (data not
showed). Thus, we conrmed that DNA was the major intracellular
target of P7 after entering the cells. The improved antimicrobial
activity of P7 was concerned with its cell-penetrating efciency
and DNA-binding afnity. Penetrating the cells more efciently
and possessing good DNA-binding afnity contributed to the
strong antimicrobial activity of buforin II (521) (Table 1,
MIC = 0.52 lM). The DNA stores and transmits the genetic information of life. Peptide interaction with DNA can hamper or inhibit
macromolecular synthesis, related gene expression, or disrupts
materials needed for the life cycle of bacteria. It has been reported
that certain antimicrobial peptides bind DNA or inhibit intracellular processes after penetration into bacterial cells, such as buforin II
(Park et al., 1998), tachyplesin (Yonezawa, Kuwahara, Fujii, &
Sugiura, 1992), PR-39 (Boman, Agerberth, & Boman, 1993) and indolicidin (Subbalakshmi & Sitaram, 1998). After 30 min of P7 treatment, the E. coli cells remained in phase R where DNA replication
occurs, without completing the cell cycle (Fig. 4C). P7 bound with
DNA results in the inhibition of DNA replication, which disturbs
the normal cell cycle. This also demonstrated that P7 induced lamentation in E. coli cells (Fig. 1B) as a result of inhibition of DNA
synthesis (Lutkenhaus, 1990; Subbalakshmi & Sitaram, 1998) or a
bacterial SOS-response (Ulvatne, Samuelsen, Haukland, Krmer, &
Vorland, 2004). Furthermore, a quantitative reverse transcriptionpolymerase chain reaction was carried out to analyse the
changes in expression of DNA replication and DNA damage
repair-related genes (Fig. 4E). The expression of four down-regulated genes reected a response to perturbation of the E. coli
DNA replication by P7. The gene expression results could be consistent with the cell cycle analysis that P7 affected DNA replication
during cell cycle. Such genes may represent potential active targets
for the antimicrobial activity of P7 against E. coli. Treatment with
P7 induced the increased expression of recA and recN genes which
play an important role in the SOS response to survival when DNA
damage occurs. Altered expression of these genes reected a
protective response to DNA damage by P7. We propose that P7
interacted with E. coli genomic DNA and intercalated into the
DNA base pairs to cause DNA damage, disturbing DNA replication
and resulting in bacterial death. BuforinII (521) kills E. coli by
binding to DNA and interfering intercellular functions, but the
change in expression proles of DNA replication and DNA damage
repair genes in E. coli cells was some different from P7. This may
involve in their different DNA-binding sites and DNA-binding
capabilities.

5. Conclusion
More studies of the molecular mechanisms are needed. However, our results clearly demonstrated that P7, derived from the
cell-penetrating peptide ppTG20, has strong antibacterial activities
against food-borne pathogenic microorganisms. This peptide
might be an attractive and valuable candidate as an effective food
biological preservative. Moreover, antimicrobial mechanism analysis revealed that unlike most membrane-active peptides, P7 had a
minor damaging effect on the cytoplasmic membrane of E. coli.
However P7 could penetrate the E. coli cell membranes and accumulate in the cytoplasm but did not lyse the cells. After uptake into

L. Li et al. / Food Chemistry 166 (2015) 231239

the cytoplasm, P7 interacted with intracellular DNA and affected

DNA replication, and eventually leading to cell death. All these
results indicated that P7 exerted its antimicrobial activity against
E. coli by penetrating the cell membrane and targeting intracellular
DNA.
Acknowledgments
This research was funded by National Natural Science Foundation of China (Grant No. 31172214 and 31201805) and Fundamental Research Funds for the Central Universities (JUSRP1052).
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.foodchem.2014.
05.113.
References
Boman, H. G., Agerberth, B., & Boman, A. (1993). Mechanisms of action on
Escherichia coli of cecropin P1 and PR-39, two antibacterial peptides from pig
intestine. Infection and Immunity, 61, 29782984.
Brandenburg, L. O., Merres, J., Albrecht, L. J., Varoga, D., & Pufe, T. (2012).
Antimicrobial peptides: Multifunctional drugs for different applications.
Polymers, 4, 539560.
Cleveland, J., Montville, T. J., Nes, I. F., & Chikindas, M. L. (2001). Bacteriocins: Safe,
natural antimicrobials for food preservation. International Journal of Food
Microbiology, 71, 120.
Dathe, M., & Wieprecht, T. (1999). Structural features of helical antimicrobial
peptides: Their potential to modulate activity on model membranes and
biological cells. Biochim Biophys Acta, 1462, 7187.
Delves-Broughton, J., Blackburn, P., Evans, R., & Hugenholtz, J. (1996). Applications
of the bacteriocin, nisin. Antonie van Leeuwenhoek, 69, 193202.
Fjell, C. D., Hiss, J. A., Hancock, R. E. W., & Schneider, G. (2011). Designing
antimicrobial peptides: Form follows function. Nature Reviews Drug Discovery,
11, 3751.
Hugonina, L., Vukojevc, V., Bakalkinb, G., & Grslund, A. (2006). Membrane leakage
induced by dynorphins. FEBS Letters, 580, 32013205.
Imura, Y., Nishida, M., & Matsuzaki, K. (2007). Action mechanism of PEGylated
magainin 2 analogue peptide. Biochimica et Biophysica Acta (BBA)
Biomembranes, 1768, 25782585.

239

Joshi, S., Bisht, G. S., Rawat, D. S., Kumar, A., Kumar, R., Maiti, S., et al. (2010).
Interaction studies of novel cell selective antimicrobial peptides with model
membranes and E. coli ATCC 11775. Biochimica et Biophysica Acta (BBA)
Biomembranes, 1798, 18641875.
Li, L. R., Shi, Y. H., Su, G. F., & Le, G. W. (2012). Selectivity for and destruction of
Salmonella typhimurium via a membrane damage mechanism of a cellpenetrating peptide ppTG20 analogue. International Journal of Antimicrobial
Agents, 40, 337343.
Lutkenhaus, J. (1990). Regulation of cell division in E. coli. Trends in Genetics, 6,
2225.
Pan, L. Z., Na, J., Xing, Z., Fang, H. J., & Wang, G. L. (2007). Inhibiting effect of melittin
on pathogens of crops. Chinese Science Bulletin, 52, 639644.
Park, C. B., Kim, H. S., & Kim, S. C. (1998). Mechanism of action of the antimicrobial
peptide buforin II: Buforin II kills microorganisms by penetrating the cell
membrane and inhibiting cellular functions. Biochemical and Biophysical
Research Communications, 244, 253257.
Park, C. B., Yi, K. S., Matsuzaki, K., Kim, M. S., & Kim, S. C. (2000). Structureactivity
analysis of buforin II, a histone H2A-derived antimicrobial peptide: The proline
hinge is responsible for the cell-penetrating ability of buforin II. Proceedings of
the National Academy of Sciences, 97, 82458250.
Richard, J. P., Melikov, K., Vives, E., Ramos, C., Verbeure, B., Gait, M. J., et al. (2003).
Cell-penetrating peptides a reevaluation of the mechanism of cellular uptake.
Journal of Biological Chemistry, 278, 585590.
Rittner, K., Benavente, A., Bompard-Sorlet, A., Heitz, F., Divita, G., Brasseur, R., et al.
(2005). New basic membrane-destabilizing peptides for plasmid-based gene
delivery in vitro and in vivo. Molecular Therapy, 5(2), 104114.
Rydlo, T., Miltz, J., & Mor, A. (2006). Eukaryotic antimicrobial peptides: Promises
and premises in food safety. Journal of Food Science, 71, R125R135.
Splith, K., & Neundorf, I. (2011). Antimicrobial peptides with cell-penetrating
peptide properties and vice versa. European Biophysics Journal, 40, 387397.
Steen, H. B., & Boye, E. (1980). Bacterial growth studied by ow cytometry.
Cytometry, 1, 3236.
Subbalakshmi, C., & Sitaram, N. (1998). Mechanism of antimicrobial action of
indolicidin. FEMS Microbiology Letters, 160, 9196.
Tiwari, B. K., Valdramidis, V. P., ODonnell, C. P., Muthukumarappan, K., Bourke, P., &
Cullen, P. (2009). Application of natural antimicrobials for food preservation.
Journal of Agricultural and Food Chemistry, 57, 59876000.
Ulvatne, H., Samuelsen, ., Haukland, H. H., Krmer, M., & Vorland, L. H. (2004).
Lactoferricin B inhibits bacterial macromolecular synthesis in Escherichia coli
and Bacillus subtilis. FEMS Microbiology Letters, 237, 377384.
Yang, S. T., Shin, S. Y., Hahm, K. S., & Kim, J. I. (2006). Design of perfectly symmetric
Trp-rich peptides with potent and broad-spectrum antimicrobial activities.
International Journal of Antimicrobial Agents, 27, 325330.
Yonezawa, A., Kuwahara, J., Fujii, N., & Sugiura, Y. (1992). Binding of tachyplesin I to
DNA revealed by footprinting analysis: Signicant contribution of secondary
structure to DNA binding and implication for biological action. Biochemistry, 31,
29983004.