You are on page 1of 3

Computational Biology and Chemistry 31 (2007) 124126

Brief communication

HBV-encoded microRNA candidate and its target


Wei-Bo Jin a,b , Fang-Li Wu a , Dong Kong a , Ai-Guang Guo a,b,
a

College of Life Science, Northwest A&F University, Yangling, Shaanxi 712100, China
Key Laboratory of Agriculture Molecular Biology in Shaanxi, Yangling, Shaanxi 712100, China

Received 24 October 2006; received in revised form 18 January 2007; accepted 21 January 2007

Abstract
MicroRNAs (miRNAs) are a group of short (22 nt) noncoding RNAs that specifically regulate cellular gene expression at the post-transcriptional
level. miRNA precursors (pre-miRNAs), which are imperfect stem loop structures of 70 nt, are processed into mature miRNAs by cellular RNases
III. To date, hundreds of miRNAs and their corresponding targets have been reported in kinds of species. Although only a few of these miRNA/target
pairs have been functionally verified, some do play important roles in regulating normal development and physiology. Several viruses (e.g. the
Epstein-Barr virus and human herpesvirus Kaposis sarcoma-associated herpesvirus) has been reported to encode miRNAs. Here, we extend the
analysis of miRNA-encoding potential to the Hepatitis B virus (HBV). Using computational approaches, we found that HBV putatively encodes
only one candidate pre-miRNA. We then matched deduced mature miRNA sequence from this pre-miRNA against a database of 3 untranslated
sequences (UTR) from the human genome. Surprisingly, none of cellular transcripts could potentially be targeted by the viral miRNA (vmiRNA)
sequence. However, one viral mRNA was found to be targeted by the vmiRNA when we searched the target from viral mRNAs. We propose that
HBV has evolved to use vmiRNAs as a means to regulate its own gene expression for its benefit.
2007 Elsevier Ltd. All rights reserved.
Keywords: HBV; MicroRNA; Identification; Target

The first miRNA to be discovered was the Caenorhabditis


elegans heterochronic gene lin-4, which inhibits translation by
pairing with partially homologous sequences lin-14 in the 3
untranslated region (UTR) (Lee et al., 1993; Fire et al., 1998;
Hunter and Poethig, 2003). To date, thousands of miRNAs have
been found in animals, plants and virus (Griffiths-Jones, 2004).
Structurally, microRNAs (miRNAs) are 1925 nucleotide
RNAs processed from short stem-loop precursors that can be
encoded in genomes of plants, animals and viruses. According
to the current understanding, miRNA is firstly transcribed as
long primary miRNA, which is processed into 6070 nt miRNA
precursor (pre-miRNA) by nuclear RNase III Drosha (Lee et al.,
2002, 2003). Then the pre-miRNA is transported from nucleus
to cytoplasm by Exportin-5 (Kim, 2004; Zeng and Cullen, 2004)
and further cleaved into 22 nt duplexes (Bartel, 2004).
Although the exact mechanism by which miRNA regulates
gene expression is not completely understood, several experi-

Corresponding author at: College of Life Science, Northwest A&F University, Yangling, Shaanxi 712100, China. Tel.: +86 29 8702 6171;
fax: +86 29 8709 2262.
E-mail address: guoaiguang@yahoo.com.cn (A.-G. Guo).

1476-9271/$ see front matter 2007 Elsevier Ltd. All rights reserved.
doi:10.1016/j.compbiolchem.2007.01.005

mental observations have been made to generalize the rules of


miRNA-target binding. The most important one among them
is the base 28 of the 5 end of the miRNA (named as seed
sequence) must perfectly complement with the 3 UTR of target mRNA. Other general features like optimum minimum free
energy (MFE) of the miRNA:mRNA complex also benefit the
function of miRNAs.
Recently, researchers are more and more interested in the
interaction of miRNA and virus mRNA. Pfeffer et al. (2004)
identified virus-encoded miRNA sequences in Epstein-Barr
virus (EBV) infected cells. They reported that EBV encodes
five miRNAs which are capable of regulating the expression
of viral genes involved in latency and modulating the expression of host cell genes. Thus, it seems that EBV has evolved to
use the miRNA pathway for its replicative benefit. From then
on, virus-encoded miRNA sequences are reported successively
(Griffiths-Jones, 2004). To query whether this strategy is also
employed by Hepatitis B virus (HBV) or not, we have analyzed
putative miRNA-encoding capacity of HBV.
We wondered if HBV maintains RNA structures that
resemble pre-miRNAs. As a proof-of-principle, we examined
pre-miRNA structures in the genome of HBV. The HBV genome
sequence was downloaded from NCBI (accession number:

W.-B. Jin et al. / Computational Biology and Chemistry 31 (2007) 124126

125

Fig. 1. Potential hairpin structures on HBV genome. Red ringed sequence is miRNA candidate. (For interpretation of the references to colour in this figure legend,
the reader is referred to the web version of the article.)

NC 00397). The hairpins were predicted as follows: (1) extract


sequences from HBV genome with the window of 700 nt and
the step of 350 nt; (2) compute secondary structure of these
segments using RNAfold (Hofacker et al., 1994); (3) cut the
sequences containing hairpin structure from 700 nt fragments;
(4) select segments whose stems are at least 18 base pairings
(including the GU wobble pairs) in length, and the free energy
of the secondary structure is no more than 15 kcal/mol (the
thresholds 18 and 15 are the lowest number of base pairings
and the highest free energy among all the genuine human premiRNAs, respectively); (5) validate whether those fragments are
hairpin or not using Mfold (Zuker, 2003). Only two thermodynamically reasonable candidates (#1 and #2) were uncovered
and the secondary structures of each candidate are presented in
Fig. 1.
Then the RP-SVM classifier, which was developed by Jin
Wei-bo et al. to classify real and pseudo-pre-miRNA and is free
to all users (http://geneweb.icpcn.com/rp svm/), was applied to
further distinguish the two candidates, and only #2 was identified as pre-miRNA candidate. As shown in Fig. 2, the #2
is in the precore/core gene. Using FS-SVM classifier (http://

Fig. 2. Locations for predicted pre-miRNAs candidates (#2) in the HBV


genome.

Table 1
Sequence and location of miRNA
Virus miRNA
miRNA sequence
Localization on HBV genome

#2
CAUGUCCUACUGUUCAAGCCUC
18501871

Potential target location


(according to Fig. 4)

18861907 (4a)
25492570 (4b)
30813012 (4c)

geneweb.icpcn.com/fs svm/) for predicting functional strand,


the corresponding deduced mature virus-encoded miRNA
(vmiRNA) sequence is presented in Table 1.
We asked if HBV-encoded vmiRNA is present in HBVinfected patients. By using blood cells infected with HBV, we
first isolated, based on size selection, only those RNAs smaller
than 80 nt. The size-selected RNAs were electrophoresed in

Fig. 3. RNA enriched for small RNAs (<80 nt) was extracted from blood cells
with mock-infected (lane 1) or HBV-infected (lanes 2 and 3) and was separated in
15% polyacrylamide8 M urea gel and hybridized to vmiRNA#2-specific probe
(top) or to control 5S rRNA probe (bottom). The strong hybridization signal on
lane 2 indicated high expression of the vmiRNA in latency cells, and the faint
signal on lane 3 showed very low-abundance of vmiRNA in activity cells.

126

W.-B. Jin et al. / Computational Biology and Chemistry 31 (2007) 124126

Fig. 4. Potential region targets in mRNA by miRNA (red ring). (For interpretation of the references to colour in this figure legend, the reader is referred to the web
version of the article.)

polyacrylamide gel and transferred to nylon membrane. We then


hybridized the membrane with a vmiRNA-specific 32 P-labeled
probe and detected a 21 nt signal (Fig. 3, lanes 2 and 3) not
seen in mock-infected cells (Fig. 3, lane 1).
We wonder whether the putative vmiRNA could be used by
HBV to modulate host cell gene expression profiles. We searched
3 UTR database for human genes that could engage in WatsonCrick base pairing with nucleotides 28, the seed sequence
of vmiRNA (Lewis et al., 2003, 2005), Surprisingly, none of
cellular targets were found, which suggests that vmiRNAs could
not affect the expression pattern of cellular genes.
What is the function of the vmiRNA? In order to know
whether the vmiRNA could modulate its own gene expression,
we checked the viral mRNAs that could perfectly complement
with the seed sequence of vmiRNA, and three genes were
found. Mfold (Zuker, 2003) was applied to predict the secondary
structures of these three genes of large S protein, polymerease
and X protein, respectively, and the target binding site are shown
in Fig. 4ac. The binding sites in Fig. 4a and c were found to
locate in the duplex, while the binding site in Fig. 4b located
in the loop structure. Fig. 4b shows that the binding site in the
variable region can benefit the interaction with vmiRNA, suggesting that it is the most believable miRNA-target binding site
(Lewis et al., 2005), so we suppose that the polymerase gene
could potentially be targeted if this vmiRNA were processed
in host cell. Why does the vmiRNA suppress the expression
of polymerase gene? We speculated that the polymerase was
repressed by vmiRNA to reduce HBV replication for evading
the immunity system of its host in latent period. But there are
still many problems, such as when does vmiRNA begin expressing, and how does vmiRNA stop expressing when HBV need
replicating largely, and so on?
Here, we introduce a concept that the HBV genome could
reasonably encode one candidate pre-miRNA. Studies are in
progress to examine how vmiRNAs might evade the immunity
system of host cell during HBV infection.

Acknowledgement
The authors thank Dr. Ning Gao, Second Affiliated Hospital, Xian Jiaotong University, for providing necessary RNA
samples.
References
Bartel, D.P., 2004. MicroRNAs, genomics, biogenesis, mechanism, and function. Cell 116, 281297.
Fire, A., Xu, S., Montgomery, M.K., et al., 1998. Potent and specific genetic
interference by double-stranded RNA in Caenorhabditis elegans. Nature
391, 806811.
Griffiths-Jones, S., 2004. The microRNA registry. Nucl. Acids Res. 32 database
issue, D109D111.
Hofacker, I.L., Fontana, W., Stadler, P.F., Bonhoeffer, S., Tacker, M., Schuster, P., 1994. Fast folding and comparison of RNA secondary structures.
Monatshefte f Chemie 125, 167188.
Hunter, C., Poethig, S.R., 2003. Missing links, miRNAs and plant development.
Curr. Opin. Genet. Dev. 13, 372378.
Kim, V.N., 2004. MicroRNA precursors in motion: exportin-5 mediates their
nuclear export. Trends Cell Biol. 14, 156159.
Lee, R.C., Feinbaum, R.L., Ambros, V., 1993. The C. elegans heterochronic
gene lin-4 encodes small RNAs with antisense complementarity to lin-14.
Cell 75, 843854.
Lee, Y., Jeon, K., Lee, J.T., Kim, S., Kim, V.N., 2002. MicroRNA maturation,
stepwise processing and subcellular localization. EMBO J. 21, 46634670.
Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., Radmark, O., Kim, S., Kim, V.N., 2003. The nuclear RNase III Drosha initiates
microRNA processing. Nature 425, 415419.
Lewis, B.P., Shih, I.H., Jones-Rhoades, M.W., Bartel, D.P., Burge, C.B., 2003.
Prediction of mammalian microRNA targets. Cell 115, 787798.
Lewis, B.P., Burge, C.B., Bartel, D.P., 2005. Conserved seed pairing, often
flanked by adenosines, indicates that thousands of human genes are
microRNA targets. Cell 120, 1520.
Pfeffer, S., Zavolan, M., Grasser, F.A., Chien, M., Russo, J.J., Ju, J., John,
B., Enright, A.J., Marks, D., Sander, C., Tuschl, T., 2004. Identification
of virusencoded microRNAs. Science 304, 734736.
Zeng, Y., Cullen, B.R., 2004. Structural requirements for pre-microRNA binding
and nuclear export by Exportin 5. Nucl. Acids Res. 32, 47764785.
Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization
prediction. Nucl. Acids Res., 34063415.