Sie sind auf Seite 1von 28

Organismo Internacional Regional de Sanidad Agropecuaria

Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Manual de procedimiento para la colecta, envo y procesamiento de muestras para el diagnstico


del HLB (Candidatus Liberibacter spp) en hojas y la presencia de la bacteria asociada en el insecto
vector.

Abril 2013.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Contenido.
A. Informacin general.
B. Objetivos del manual.
C.

Referencias

D. Aspectos a considerar antes del muestreo.


E.

Mtodos de Diagnstico de HLB

F.

Muestreo del Pslido Asitico de los Ctricos para la deteccin de HLB.

G. Procesamiento de muestras de Pslidos.


H. Muestreo de material Vegetal
Distribucin irregular de la bacteria.
Toma de muestras vegetales.
Muestreo en unidad de produccin de ctricos.
Envo de muestras.
Recepcin de muestras.
I.

Metodologa de diagnstico para la deteccin de HLB.

J.

Referencias

K.

Anexos.
1.

Aspirador Manual.

2.

Formato de solicitud de Diagnstico.

3.

Extraccin de ADN de Pslidos y plantas.

4.

PCR convencional y PCR tiempo Real.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

INFORMACIN GENERAL.
El Huanglongbing (HLB) es una enfermedad destructiva que afecta a los ctricos y que representa una gran
amenaza a la industria citrcola en el mundo porque est invadiendo rpidamente las reas de produccin. Causa la muerte
de las plantas infectadas y todava no existe un mtodo efectivo de control.
La presencia de HLB fue reportada por primera vez en Asia y posteriormente en frica. En el continente Americano,
la primera deteccin fue en el 2004 y a partir de esa fecha se ha expandido rpidamente. Actualmente, el HLB est
presente en algunas reas de Mxico1, Brasil, EEUU2, Belice, Costa Rica, Cuba, Guatemala, Puerto Rico, Honduras, Jamaica,
Nicaragua y Repblica Dominicana. Refirindonos a los pases que integran la regin OIRSA, hasta esta fecha (abril 2013)
slo El Salvador y Panam no tienen registros de la presencia de la enfermedad.
Candidatus Liberibacter asiaticus y Ca. L. americanus son los patgenos consistentemente asociados a la
enfermedad del HLB de los ctricos, reportados en el continente americano. Se tienen registros de Candidatus Liberibacter
africanus slo en el continente Africano. Estos patgenos colonizan el floema y son diseminados en el campo por el pslido
asitico de los ctricos, Diaphorina citri, presente en todos los pases de la Regin del OIRSA3. El HLB afecta a todos los
cultivares de ctricos, independientemente de los patrones y la edad de la planta. El patgeno tambin se ha detectado en
rboles de Murraya paniculata (naranja jazmn, limonaria o mirto) en reas urbanas y rurales.
El HLB es considerado una de las enfermedades ms importantes en los ctricos, porque una vez presente en la
regin es necesario implementar medidas de control regional. Los esfuerzos individuales encaminados al control del
insecto vector y a la reduccin del inoculo no son exitosos y slo representan un incremento considerable en los costos de
produccin. Las regiones que se encuentran an libres de HLB, centran sus esfuerzos en conocer las razones de tal
dispersin, en identificar las formas ms probables de su ingreso en las distintas reas y en tomar medidas eficaces para
evitar su introduccin. Estas acciones se generan frente al hecho constatado de que vastas reas citrcolas del mundo no
han podido evitar el ingreso de esta enfermedad en los ltimos aos, como es el caso de Sao Pablo en Brasil, de Florida en
EEUU y en general, en la citricultura centroamericana (Mara y Reyrou, 2010).
Considerando los mecanismos de dispersin de la enfermedad, en las regiones citrcolas donde no se tienen
registros de la presencia de HLB se realizan inspecciones constantes encaminadas a la bsqueda de sntomas en material
vegetal y a la colecta del Pslido Asitico de los Ctricos (PAC) para conocer si es portador de la bacteria. Por otro lado, en
las regiones citrcolas con presencia de HLB, se ha establecido como una estrategia de manejo de la enfermedad, eliminar
los rboles de ctricos infectados para reducir la cantidad de inoculo y evitar as la dispersin de la enfermedad a otras
reas. Estas estrategias requieren mtodos de diagnstico sensibles y confiables para poder justificar las acciones de
eliminacin de plantas y/o control del insecto vector.
Actualmente la combinacin de PCR convencional y PCR cuantitativa (qPCR) son las tcnicas ms empleadas para la
deteccin de HLB. Los mtodos de muestreo y el adecuado envo de las muestras vegetales y del insecto vector, son
esenciales para la deteccin y cuantificacin de las variantes de Candidatus Liberibacter.

1 En Mxico, HLB est presente en 13 de los 23 estados productores de ctricos. http://www.senasica.gob.mx/?id=3265


2 Florida (2005), Louisiana (2008), South Carolina (2009), Texas (2012) y California (2012).
3http://www.cabi.org/isc/DatasheetDetailsReports.aspx?&iSectionId=128*0&iDatasheetID=18615&sSystem=Product&iPageID=481&iCompendiumId=5

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

OBJETIVOS DEL MANUAL.


Considerando que la deteccin temprana de rboles infectados o de poblaciones del vector portando a la bacteria, es
de vital importancia para reducir las fuentes de inoculo y mitigar la dispersin de HLB a travs del pslido vector, se ha
elaborado este documento con los siguientes objetivos:
a.
b.
c.
d.

Proporcionar informacin relevante a considerar antes del muestreo de pslidos y material vegetal.
Describir el procedimiento de toma y envo de muestras de pslidos y material vegetal.
Describir el procedimiento de Diagnstico para la deteccin de HLB en muestras vegetales y en muestras de pslidos.
Realizar recomendaciones generales para el trabajo dentro del laboratorio de diagnstico.

REFERENCIAS
Para mayor entendimiento del tema, se sugiere conocer los siguientes documentos publicados por el OIRSA:
Manual de la campaa contra el HLB y su vector.
Protocolo de monitoreo del Pslido Asitico de los Ctricos.
Guia de sntomas de Huanglongbing.
Protocolo del Sistema de Informacin Geogrfica para HLB y su vector.
Norma Regional de Sanidad Vegetal Lineamientos de Armonizacin Normativa de Certificacin Fitosanitaria de
Material Propagativo de Ctricos
Asimismo, segn el pas de que se trate, deber conocerse el programa de certificacin y la normativa relacionada con
el HLB y su vector.

ASPECTOS A CONSIDERAR ANTES DEL MUESTREO.


Para determinar la presencia de HLB en una regin citrcola, se han establecido dos actividades fundamentales:
Bsqueda de sntomas caractersticos en plantas y/o la colecta del insecto vector. Vase del Manual de la campaa contra
el HLB y su vector, publicado por el OIRSA.
Cuando no se tiene registros de la presencia del insecto vector ni de la enfermedad, es importante realizar
monitoreo continuo e intensivo para detectar adultos del PAC. El empleo de trampas pegajosas, puede ser til para la
deteccin de adultos del PAC. Si el PAC es identificado, debern colectarse insectos para analizarlos y determinar si son
portadores de Candidatus Liberibacter spp, as como tejido de la o las plantas donde stos se colecten.
MTODOS DE DIAGNSTICO DE HLB.
La baja concentracin y distribucin irregular de la bacteria en plantas infectadas con HLB dificultan la deteccin de
forma consistente. Diversos mtodos de deteccin se han desarrollado, incluyendo el indexado biolgico, microscopa
electrnica, PCR (Reaccin en Cadena de la Polimerasa) convencional y PCR cuantitativa (qPCR). No obstante, para la
aplicacin de estrategias de manejo es necesario desarrollar metodologas de diagnstico ms sensibles que permitan la
deteccin de la bacteria en tejidos asintomticos. La eliminacin temprana de las plantas infectadas en el campo y en los
viveros protegidos, adems de impactar en el control de la enfermedad, reducir el riesgo de diseminacin de sta.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

La tcnica de PCR emplea iniciadores especficos que amplifican secuencias de la regin 16S del ADN ribosomal de
la bacteria e iniciadores basados en genes protenicos (operon-) (Jagoueix et al., 1996; Tian et al., 1996; Hocquellet et al.,
1999, Teixeira et al., 2005, Li et al., 2006) que permiten detectar a las tres variantes de Ca. Liberibacter. La distribucin
irregular del patgeno y los ttulos bajos en las plantas hospederas, as como los inhibidores de la PCR presentes en los
extractos de ctricos, han dificultado la deteccin consistente del patgeno. La PCR tiempo real o qPCR es mucho ms
sensible que la PCR convencional. La qPCR, basada en la amplificacin de la regin del gen 16S ribosomal de Ca.
Liberibacter spp, es el mtodo aceptado por las entidades regulatorias y no regulatorias para detectar la presencia del
patgeno tanto en muestras vegetales de ctricos y muestras de pslidos (Hall et al., 2011). Li et al., (2006) desarrollaron el
ensayo de qPCR para la deteccin de HLB y lo validaron utilizando ADN de tejidos diferentes de distintas especies de
ctricos, procedentes de diversas regiones geogrficas. La combinacin de PCR convencional y la qPCR son los mtodos
empleados por los laboratorios oficiales para la deteccin y confirmacin del HLB.
En el proceso de Diagnstico, la toma de la muestra, la conservacin de sta y el envo de la misma, son de gran
importancia para obtener resultados confiables, todo ello encaminado a toma de decisiones sobre el manejo de la
enfermedad y del insecto vector.
MUESTREO DEL PSLIDO ASIATICO DE LOS CITRICOS PARA LA DETECCIN DE HLB.
El anlisis de pslidos colectados en huertas comerciales, viveros, zonas residenciales urbanas y rurales, es una
estrategia que se ha planteado para anticipar la llegada de Ca. Liberibacter spp., o bien para delimitar la presencia de HLB
en la zona (vase el Manual de la campana contra el HLB y el Protocolo de monitoreo del pslido asitico de los ctricos,
ambos publicados por el OIRSA).
En ese sentido, el resultado positivo de un anlisis de pslidos es til para llevar a cabo decisiones adecuadas de
manejo. Las ninfas de pslidos, que no se mueven de una planta a otra, pueden adquirir a Ca. Liberibacter spp, slo del rbol
en el que viven. Una muestra de ninfas positiva, indicara que la planta de origen est infectada, mientras que un adulto con
HLB puede indicar la presencia rboles infectados en la zona (Manjunath et al., 2008). Si bien es cierto, esta estrategia es
costosa, por la presencia de altas poblaciones de Diaphorina citri en algunas regiones y la consecuente necesidad de
analizar un nmero importante de muestras de pslidos4, la investigacin muestra que los pslidos positivos aparecen en
lugares inesperados.5 Ca. Liberibacter asiaticus se ha detectado en muestras de rboles visualmente sanos en sitios sin
registro de la presencia de HLB. Esta informacin es de gran utilidad porque generalmente nos gua hacia las plantas
enfermas que son la fuente de inoculo.
En Mxico por ejemplo, se realizan muestreos peridicos en las huertas comerciales para determinar si los pslidos
son portadores de la bacteria, de igual forma, se han establecido rutas urbanas que abarcan diferentes poblaciones o
localidades, que se recorren mensualmente para colectar pslidos, ya sea en ctricos o bien en limonaria (M. paniculata). En
California, a raz de la reciente deteccin de HLB en ctricos residenciales en Los ngeles, se estableci un sistema de
monitoreo intensivo por medio de trampas para detectar la presencia del insecto en los condados6 con registros previos de
la presencia del pslido.

Mxico proces ms de 2500 muestras de pslidos antes de detectar una muestra positiva a Ca. Liberibacter asiaticus.
Technical Working Group (TWG) Report: HLB in Texas
6
San Diego, Imperial, Orange, Los ngeles, Riverside, San Bernardino y Ventura
5

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Manjunath et al., (2008) publicaron un estudio en el que reportan la deteccin de Ca. Liberibacter asiaticus en una
muestra de pslidos colectada en un huerto de ctricos de 3 aos de edad. Ningn sntoma de HLB fue observado durante
todo el periodo de coleccin (junio a septiembre), 9 meses despus de la deteccin de HLB en los pslidos encontraron
arboles sintomticos y confirmaron la presencia de Ca. Liberibacter por PCR. Estos resultados sugieren que esos rboles, de
tres aos de edad, pudieron permanecer asintomticos por ms de 9 meses.
Por otro lado, existe evidencia que altas temperaturas en el verano puede suprimir la bacteria en el PAC, pero no
se tienen registros consistentes sobre este comportamiento. En Florida, se han observado porcentajes altos de PAC
positivos detectados en otoo y al inicio del invierno. En Mxico tampoco no se tienen registros consistentes sobre la tasa
de pslidos positivos detectados en los muestreos realizados durante todo el ao, sin embargo existe un reporte que seala
un incremento en la deteccin de pslidos positivos a partir del mes de noviembre hasta marzo, cuando la temperatura
promedio mensual es de 20-22 C con un porcentaje de humedad relativa de 70-75% (Flix et al., 2011).
Recientemente Yulu et al., (2011) reportaron en China la presencia de otro pslido potencialmente vector de HLB,
Cacopsylla (Psylla) citricola (pendiente de confirmacin taxonmica definitiva), ya que al colectar los ninfas de esta especie
de pslidos de rboles sintomticos a HLB, resultaron positivos a Ca. Liberibacter asiaticus.
PROCESAMIENTO DE MUESTRAS DE PSLIDOS
De acuerdo a lo establecido en el Manual de la campaa contra el HLB y su vector, as como el Protocolo de
monitoreo del Pslido Asitico de los Ctricos, la colecta de pslidos se puede realizar en huertos comerciales, zonas
residenciales y en zonas de alto riesgo que se determinen en cada regin. Es muy importante registrar los datos sobre la
ubicacin (anexo 2) de la huerta o bien de las zonas residenciales, de acuerdo a lo establecido en el Protocolo del Sistema
de Informacin Geogrfica para HLB y su vector. La finalidad es poder localizar el sitio especfico de coleta, ya que en caso
de tener un resultado positivo a HLB ser necesario realizar un segundo muestreo ms exhaustivo para localizar o detectar
material vegetal sintomtico.
Para realizar la toma de muestras de pslidos se deber tomar en cuenta lo siguiente:
A. Los pslidos pueden colectarse con un aspirador manual (anexo 1) y se colocarn de inmediato para su conservacin en
frascos viales con alcohol etlico al 95% o al 75%.
B. No recolectar todos los pslidos de una misma planta.
C. Etiquetar los frascos que contengan los pslidos. Es recomendable asignar un nmero consecutivo a las muestras para
simplificar el manejo y rastreabilidad a las muestras. Para etiquetar las muestras se recomienda utilizar lpiz y evitar
as que la etiqueta se borre (figura 1). Una muestra sin etiqueta carece de valor para el laboratorio porque no podr
determinar la procedencia.
D. Asegurar que los frascos que contienen las muestras no presenten fugas de alcohol y de preferencia no emplear frascos
de vidrio, que pueden sufrir rupturas si se utiliza servicios de mensajera.
E. Es importante registrar la informacin de cada una de las muestras en un formato (anexo 2) que contenga los datos
necesarios para identificar sin problema la procedencia de la muestra. ste se deber anexar al realizar el envo de las
muestras o bien deber remitirlo al laboratorio de forma electrnica.
F. Las muestras debern enviarse al laboratorio lo antes posible, a fin de lograr la deteccin oportuna del HLB.
NOTA: Para deteccin de la bacteria no deben utilizarse pslidos colectados en trampas pegajosas.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Los pslidos colectados pueden conservarse en alcohol al 75% o al 95% a temperatura ambiente, sin comprometer la
deteccin de Ca. Liberibacter spp. El ADN se conserva estable en estas condiciones hasta por dos meses (59 das) (Hall, et
al., 2011).

Figura 1. Muestras de Pslidos enviadas para diagnstico de HLB. A y B) Frasco con etiqueta borrada.
C) Muestras etiquetadas con lpiz, sin fugas de alcohol.

MUESTREO DE MATERIAL VEGETAL PARA LA DETECCIN DE HLB.


La observacin de sntomas caractersticos en el campo es una
herramienta til para reconocer las plantas posiblemente infectadas con la
bacteria. El entrenamiento de los tcnicos para llevar a cabo el reconocimiento
eficientemente de la sintomatologa es de gran importancia dentro de las
estrategias de manejo de la enfermedad (Collazo et al., 2008).
Se han descrito diversos sntomas asociados a la presencia de HLB. El
moteado asimtrico de las hojas es el sntoma ms caracterstico de la
enfermedad. Este sntoma se manifiesta en forma diferente dependiendo de la
especies, ejemplo, en los ctricos cidos como el limn persa, las manchas son ms
angulares y de color ms contrastante en comparacin con los sntomas
observados en ctricos dulces (figura 2). Sin embargo, los sntomas comnmente
asociados a HLB (moteado asimtrico, amarillamiento y engrosamiento de
nervadura) son producto de la interferencia que ocasiona el patgeno sobre el
movimiento de nutrientes y distribucin a todas las clulas vivas que se realiza a
travs de los tejidos del floema, propiciando as el desarrollo de la enfermedad en
las partes de la planta que carezcan de esos nutrientes y sustancias (Agrios, 1999).
Esta interferencia no es exclusiva de Ca. Liberibacter spp., por ello la deteccin
confirmatoria de la presencia de HLB en las plantas se realiza por mtodos
moleculares.

Figura 2. Sntomas de HLB en


Limn Persa y Naranja Dulce.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Aunado a esto, recientemente se ha reportado la presencia de dos fitoplasmas asociados a los sntomas del HLB
(Texeira et al., 2008; Chen et al., 2009). El fitoplasma reportado en Brasil (Pigeon pea witches'-broom phytoplasma),
asociados a plantas con sntomas muy similares a los que ocasiona la presencia de Ca. Liberibacter asiaticus (figura 3),
reitera la necesidad de realizar la deteccin confirmatoria por mtodos moleculares.

Figura 3. Sntomas del fitoplasma reportado en Brasil en Naranja Dulce.

Para mayor referencia, se recomienda contar con la Gua de sntomas del Huanglongbing, elaborada por el OIRSA.
DISTRIBUCIN IRREGULAR DE LA BACTERIA.
En los rboles afectados los sntomas de HLB se presentan solo en algunas ramas. Esto sugiere una distribucin
irregular o desigual de la bacteria. Texeira et al., (2008) analizaron 822 muestras de hojas de diferentes ramas de un rbol
de naranja dulce con sntomas de HLB. Emplearon la tcnica de PCR convencional, PCR nested y qPCR, los resultados que
obtuvieron son los siguientes:
De las 822 muestras de hojas, 111 presentaban moteado caracterstico, 77 con sntomas de deficiencias de Zinc y
634 asintomticas. Al analizarlas con PCR convencional, 263 resultaron positivas, es decir slo 31% de las muestras. Las
muestras positivas corresponde a las 111 muestras con moteado, 81 asintomticas y 61 con deficiencias de zinc. Las 569
muestras negativas restantes se analizaron por PCR nested, resultando 34 muestras positivas (el 6%), que corresponde a 30
asintomticas y 4 con deficiencias de Zinc. Las 535 negativas restantes, eligieron 97 muestras al azar y las analizaron por
qPCR resultando 5 positivas que corresponden a muestras asintomticas. Los resultados demuestran que incluso en un
rbol sintomtico, algunas ramas todava poden estar libres de infeccin o tienen un contenido muy bajo de Ca.
Liberibacter (figura 4).

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Figura 4. Representacin de resultados obtenidos de hojas de una rama de un rbol de naranja dulce afectado por HLB.
Tringulos rojos: hojas con moteado positivas por PCR convencional. Crculos rojos: hojas con deficiencia de zinc u
hojas asintomticas positivas por PCR convencional. Crculos azules: hojas con deficiencia de zinc u hojas asintomticas
negativos por PCR convencional y PCR nested. Crculos verdes: Hoja positiva por qPCR, (negativa por PCR convencional
y PCR nested). Crculos blancos: Hoja negativa por PCR convencional y PCR nested, no evaluadas por qPCR. Anillos
verdes: Hojas negativas por PCR convencional, PCR nested y qPCR. Tomado de Texeira et al., (2008).

El resultado de las pruebas de qPCR no slo depende de la sensibilidad de la tcnica de PCR, tambin depende
del tipo de hojas que se estn seleccionando. Para la deteccin de HLB de los rboles infectados pero asintomticos, la
qPCR es sin duda ms sensible que la PCR convencional, pero el muestreo de las hojas sigue siendo un aspecto clave.
TOMA DE MUESTRAS VEGETALES
Los mtodos de muestreo son esenciales para la deteccin, identificacin y cuantificacin de las variantes de Ca.
Liberibacter, ya que su distribucin en las plantas hospederas puede ser irregular o con un ttulo muy bajo (Li and Levy,
2009).
Algunos reportes sealan que en Florida y Brasil los sntomas en plantas son mucho ms evidentes durante el
otoo, cuando la temperatura no es tan extrema, por ello se recomienda intensificar las inspecciones y realizar la toma de
muestras vegetales desde finales de julio hasta marzo.
En rboles con sntomas, se colectan de 1 a 4 ramas (de 10 a 15 cm de largo) con hojas o frutos sintomticos. Se
recomienda utilizar la Gua de sntomas de Huanglongbing, elaborada por el OIRSA.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

En caso de optar por analizar rboles que no presentan sntomas, lo cual no es recomendable en un programa de
vigilancia, pero si en un programa de certificacin de material propagativo, se colectan 4 ramas con hojas (de 10 a 15 cm de
largo). Las ramas no deben ser viejas, pero tampoco deben ser de los brotes recin formados o nuevos (figura 5), es decir,
la rama debe ser de color verde oscuro y la corteza debe estar endurecida7 (figura 6). Las ramas deben tomarse de cuatro
puntos diferentes del rbol.

Figura 5. A) Hojas de brote nuevo, no maduras. B) Hojas de brotes


maduros, hojas bien formadas.

Figura 6. A) Ramas viejas con corteza caf no apta para toma de muestra
vegetal. B) Ramas con hojas bien formadas, corteza color verde oscuro.

Sampling Protocol for Submission of Huanglongbing (syn= Greening or HLB) Samples to the Southern Gardens Diagnostic Laboratory.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Si no hay ramas disponibles, como en el caso de los rboles pequeos de vivero (figura 7), se colectan 4 a 12 hojas
completamente expandidas y endurecidas de cada planta. En el caso extremo de no contar con ningn tipo de hojas, se
puede utilizar corteza del tallo o raz.

Figura 7. Plantas de vivero con hojas


endurecidas o bien formadas.

MUESTREO EN UNIDADES DE PRODUCCIN DE CTRICOS.


La exploracin peridica y el muestreo de las diferentes unidades de produccin de material propagativo son
fundamentales para detectar oportunamente al HLB8. Se ha demostrado que yemas procedentes de ramas asintomticas
pero portadoras de la bacteria son capaces de producir la enfermedad en las nuevas plantas injertadas con tasas de
transmisin que van desde 10 a 60% (Coletta et al., 2010). Por ello, se recomienda realizar actividades de revisin visual y
diagnstico molecular a las diferentes unidades de produccin, para garantizar la produccin de material propagativo de
ctricos completamente sano.
La cantidad de muestras a colectar por unidad de produccin depender del Programa de Certificacin de cada
pas. Para mayor referencia, se recomienda conocer la Norma Regional de Sanidad Vegetal Lineamientos de Armonizacin
Normativa de Certificacin Fitosanitaria de Material Propagativo de Ctricos, as como el programa de certificacin del pas
de que se trate.
ENVO DE MUESTRAS VEGETALES.
Una vez realizada la toma de muestra, deber realizar lo siguiente:
1.
2.
3.
4.
5.
6.

Colocar las muestras de ramas con hojas (u hojas solamente) en toallas de papel o bien en bolsa de papel (figura 8).
Introducir cada muestra en una bolsa de plstico.
Colocar sobre la bolsa el nmero de identificacin de la muestra (se sugiere asignar un nmero consecutivo y
garantizar que la etiqueta no se borre) (figura 8).
Sacar el aire de la bolsa y cerrarla.
Colocar las muestras en hielera (unicel) con refrigerantes para protegerlas de la temperatura y evitar la oxidacin de las
hojas.
Las muestras debern enviarse preferentemente el mismo da de su colecta, si esto no es posible, es necesario
mantenerlas en refrigeracin (4C) para enviarlas el da siguiente.

Protocolo de Diagnstico NAPPO.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

7.

El envo de las muestras deber acompaarse de una solicitud de diagnstico (anexo 2) que contenga la siguiente
informacin:
Datos del interesado (nombre, domicilio, telfono, e-mail).
Nmero total de muestras, fecha de muestreo y fecha de envo
Identificacin de las muestras (Datos de procedencia como Ciudad, Distrito, Provincia, Comunidad y Datos de la
muestra como variedad y clave de stas).
Ubicacin de la huerta (croquis detallado y/o datos de georeferenciacin, segn lo establece el Protocolo del
Sistema de Informacin Geogrfica para el HLB y su vector del OIRSA )
8. Notificar el envo de muestras al laboratorio y considerar los das laborales.

Figura 8. A) Muestra sintomticas. B) Muestra sin sntomas caractersticos. C) Etiquetado de muestra vegetal, en
bolsa de papel.

Es importante que el envo de las muestras se realice en corto tiempo y sobre todo, es necesario proteger las
muestras de la temperatura, de lo contrario las hojas comenzarn a oxidarse (figura 9), imposibilitando la eleccin de las
hojas sintomticas por parte del personal del laboratorio. Si las hojas llegan oxidadas no es recomendable procesar ese
tejido para hacer el diagnstico, por ello se recomienda que se enven ramas con hojas (sintomticas o asintomticas). De
esa forma, si las hojas presentan oxidacin es posible utilizar la corteza de las ramas.

Figura 9. Muestras vegetales con hojas oxidadas.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

RECEPCION DE MUESTRAS
Al ingresar las muestras al laboratorio, stas debern registrarse en una Bitcora de Diagnstico (se sugiere
asignar un folio consecutivo interno). La Bitcora de Diagnstico se registrar la clave de las muestras y posteriormente los
resultados obtenidos. El laboratorio deber dar prioridad a las muestras vegetales, para evitar que stas se oxiden. Una
vez registradas las muestras, se proceder a realizar la extraccin de ADN y la PCR o qPCR para la deteccin de HLB.
METDOS DE EXTRACCIN DE ADN.
Existen diferentes metodologas que nos permiten extraer el ADN de muestras vegetales y/o de insectos. En las
publicaciones y/o protocolos de deteccin de HLB, los mtodos de extraccin comnmente usados son: el mtodo de
CETAB utilizado para plantas y pslidos (Murray y Thompson 1989). El mtodo reportado por De Barro et al., (1995) para
extraccin de ADN de pslidos y los mtodos basados en kits comerciales como Kit Qiagen DNeasy para Sangre y Tejido y
Mini Kit para Plantas Qiagen DNeasy Qiagen.
Existe tambin una gran diversidad de kits comerciales9 basados en el uso de membranas (columnas) de silicato
para purificar rpidamente ADN celular total sin usar extracciones orgnicas ni precipitacin con etanol. La eleccin del
mtodo de extraccin depende bsicamente de los costos y tambin del tiempo que se destina a esta actividad. Los kits
comerciales, ofrecen adems de simplificar el procedimiento y obtener ADN con menos inhibidores, un ahorro de tiempo
considerable y la reduccin del riesgo de contaminacin cruzada.

EXTRACCIN DE ADN TOTAL A PARTIR DE PSLIDOS


Previo a la extraccin de ADN, se debe eliminar el residuo de alcohol. La muestra de pslidos se coloca en una
toalla de papel (sanita) (figura 10) durante 10 a 15 minutos a temperatura ambiente. Se recomienda que el rea est
cerrada y alejada de corrientes de aire para evitar contaminacin cruzada entre las muestras.

Figura 10. Muestras de Pslidos sobre papel para


eliminar el alcohol.

AXYPREP MULTISOURCE GENOMIC ADN MINIPREP KIT, AXYPREP BLOOD GENOMIC ADN MINIPREP KIT, SPEEDTOOLS PLANT ADN EXTRACTION KIT,
KIT WIZARD. GENOMIC ADN (Promega).

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Para la extraccin de ADN de pslidos se recomienda utilizar los siguientes mtodos:


Mtodo de extraccin empleando Kit Qiagen DNeasy para Sangre y Tejido (Qiagen #69504 ).
Mtodo de extraccin empleando Kit Axygen para sangre y tejido (AxyPrep Blood Genomic ADN Miniprep Kit) (anexo
3: Procedimiento de Extraccin de ADN)

EXTRACCIN DE ADN TOTAL A PARTIR DE PLANTAS


Para la extraccin de ADN de plantas se desprenden de 10 a 12 hojas con sntomas caractersticos de HLB o bien las
hojas que presenten algn sntoma. En caso de no presentar sntomas, entonces se toman las hojas de diferentes partes de
la rama (figura 11). Si la muestra comprende varias ramas, tomar hojas de todas las ramas.

Figura 11. Seleccin de hojas, tomadas de diferentes puntos de de la rama. Tomar hojas de las diferentes
ramas procurando cubrir la longitud de sta.

Una vez seleccionadas las hojas, se deprende la nervadura central y peciolos, se cortan en trozos pequeos (figura
12). El resto del tejido se puede almacenar a 4 C o bien a -20 C. Si se requiere corroborar el resultado de una muestra, se
puede hacer una nueva extraccin de ADN del tejido ya picado (ya que son las hojas ms representativas). Se recomienda
usar una navaja por cada muestra a fin de evitar contaminacin entre las muestras. 200 mg de tejido se colocan en un tubo
de 1.5 ml, para realizar la extraccin de ADN.

Figura 12. Hojas seleccionadas para la extraccin de ADN. Nervadura y peciolo


picado de las hojas seleccionadas.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Para la extraccin de ADN de plantas se recomienda utilizar los siguientes mtodos:


Mtodo de Extraccin de ADN empleando Mini Kit para Plantas Qiagen DNeasy ( Qiagen DNeasy #69104).
Mtodo de Extraccin de ADN empleando el AxyPrep Multisource Genomic ADN Miniprep Kit (Cat. AP-MN-MS-GADN50) (anexo 3: Procedimiento de Extraccin de ADN)
PCR CONVENCIONAL y qPCR PARA LA DETECCIN DE HLB
Como ya se mencion, la combinacin de PCR convencional y PCR cuantitativa (qPCR) son las tcnicas ms
empleadas para el diagnstico de HLB. La tcnica de PCR emplea iniciadores (oligos) especficos que amplifican secuencias
de la regin 16S del ADN ribosomal de la bacteria e iniciadores basados en genes protenicos (operon-) (Jagoueix et al.,
1996; Tian et al., 1996; Hocquellet et al., 1999, Teixeira et al., 2005, Li et al., 2006) que permiten detectar a las tres
variantes de Ca. Liberibacter.
Los iniciadores comnmente utilizados en PCR convencional son los denominados OI1/OI2c/OA y rplA2/rplJ5
desarrollado por Jagoueix et al., (1996) y Hocquellet et al., (1999) respectivamente. Los iniciadores OI1/OI2c/OA amplifican
un fragmento de 1160 pares de bases (pb) de las variantes asitica y africana de Ca. Liberibacter. Para diferenciarlas, se
requiere realizar la digestin del producto de amplificacin con la enzima Xba I. El patrn de restriccin para la variante
africana es de tres fragmentos (520 pb, 506 pb y 130 pb) y para la variante asitica se obtienen dos fragmentos (640 pb y
520 pb). El par de iniciadores rplA2/rplJ5 permiten distinguir ambas variantes, ya que amplifican un fragmento de 703 pb
para Ca. Liberibacter asiaticus y 669 pb para Ca. Liberibacter africanus.
Se han desarrollado otros ensayos de PCR convencional empleando distintos pares de iniciadores (cuadro 1). Hung
et al., 1999 reportaron un ensayo sensible y rpido usando iniciadores desarrollados a partir de secuencias de fragmentos
clonados de Ca. Liberibacter asiaticus. Este set de iniciadores fue evaluado en varios cultivares colectados de diversos
pases de Asia para detectar a la bacteria. Otro set de iniciadores fue publicado por Tatineni et al., (2008). Los iniciadores
estn dirigidos a la secuencia del gen de la ADN polimerasa de Ca. Liberibacter asiaticus. La especificad del ensayo con los
nuevos iniciadores denominados HLB 65/HLB-66 se evalu analizando ADN de naranja dulce infectadas con Ca. Liberibacter
asiaticus, ADN de naranja dulce sanas de diferentes plantaciones que contienen endfitos mltiples, Virus Tristeza de los
Ctricos (CTV), Xanthomonas axonopodis pv. citri, cepas diferentes de bacterias de Ctricos, Phytophthora spp. y
Mycosphaerella citri. Los iniciadores HLB-65/HLB-66 generan resultados positivos slo en muestras infectadas con Ca.
Liberibacter asiaticus.
Cuadro 1. Iniciadores empleados en PCR convencional para detectar HLB.
Iniciador
OI1
OI2c
rplA2
rplJ5
GB1
GB3
Primer 226
Primer 226
HLB-65
HLB- 66

Secuencia
GCG CGT ATG CAA TAC GAC CGG CA
GCC TCG CGA CTT CGC AAC CCA T
TAT AAA GGT TGA CCT TTG GAG TTT
ACA AAA GCA GAA ATA GCA CGA ACA A
AAG TCG ACG GAG TAC GCA AGT ACT
CTA TAT TTG CCA TCA TTA AGT TGG
CAC CGA AGA TATGGA CAACA
GAG GTT CTT GTGGTT TTT CTG
TCCTGAGAATTACACACAAAC
TCTAAGTCTATCCTGTAACCC

Fragmento

Fuente/autor

1,160 LAS/LAF

Jagoueix, et al., (1996)

703 para LAS


699 para LAF
1, 027
LAM
226
LAS
1000
LAS

Hocquellet et al., (1999)


Teixeira et al., 2005
Hung et al., 1999.
Tatineni et al., 2008

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Actualmente, la qPCR se ha convertido en el mtodo rutinario para la deteccin de las variantes de Ca.
Liberibacter. En comparacin con PCR convencional, qPCR ofrece la deteccin sensible y rpida de las bacterias. La qPCR
aumenta la sensibilidad para la deteccin de Ca. Liberibacter 10 veces ms en relacin con la PCR anidada y 100 a 1000
veces ms con respecto a la PCR convencional (Morgan et al., 2012), por ello es el mtodo aceptado por las entidades
regulatorias y no regulatorias para detectar la presencia del patgeno tanto en muestras de ctricos y muestras de pslidos
(Hall et al., 2011). El ensayo de qPCR que comnmente se utiliza emplea los iniciadores y sonda desarrollados por Li et al.,
(2006), que estn dirigidos a la secuencia de la regin 16S del ADN ribosomal.
Tambin se han reportado otros ensayos de PCR cuantitativa o qPCR (Cuadro 2). Teixeira et al., (2008)
desarrollaron otro ensayo de qPCR usando SYBR Green para determinar la distribucin de Ca. Liberibacter americanus en
hojas de naranja dulce afectadas por HLB. Sealan que la sensibilidad del ensayo en muestras de campo es al menos tan
alta como la de tcnicas similares publicadas anteriormente para la deteccin de Ca. Liberibacter Africana, Asitica y /o
Americana.
Un ensayo ms de qPCR fue publicado por Coletta et al., (2010) para monitorear y cuantificar la multiplicacin de
Ca. Liberibacter en plantas jvenes de naranja dulce con injertos infectados con CaLas. Con el trabajo que realizaron
demostraron que CaLas puede propagarse fcilmente por yemas tomadas de ramas no sintomticas pero infectadas. Brotes
tomados de ramas infectadas, pero asintomticas fueron injertados sobre lima Rangpur (C. limonia) (limn cravo). El
resultado fue la transmisin de la bacteria con una tasa del 10 a 60%. Tambin observaron una relacin directa entre la
concentracin del agente patgeno y la expresin de sntomas. Hojas amarillentas o brotes, son comnmente el primer
sntoma observado de HLB, estos sntomas estuvieron presentes en los rboles con una baja cantidad de bacterias. La tasa
de infeccin por injerto alcanz el 100% a los 120 das despus de la inoculacin, lo que demuestra la diseminacin de la
bacteria por injerto.
Sin embargo, todos estos ensayos de qPCR estn dirigidos a genes con un bajo nmero de copias. Recientemente
Morgan et al., (2012) publicaron un nuevo ensayo de qPCR para la deteccin de HLB. Sealan que con la reciente
secuenciacin del genoma de Ca. Liberibacter se han identificado dos genes nicos hipotticos situados en una regin del
genoma de un profago10 que se designaron como hyvI (YP_003084345) y hyvII (HQ263703). Estos genes contienen
mltiples secuencias repetidas en tndem11 de 132 pb para cada repeticin de longitud completa. Estas secuencias son
ideales para el desarrollo de un mtodo de qPCR en tiempo real. Los genes hyvI/hyvII puede contener hasta un total
combinado de quince repeticiones casi idnticas. Esto mejora la sensibilidad del ensayo para la deteccin de CaLas en las
plantas hospederas como en los insectos vectores. Al comparar los nuevos iniciadores y sonda diseada (designados como
LJ900) con el ensayo de qPCR basado en el 16S rDNA, se redujo el umbral de deteccin y se detect a Ca. Liberibacter en
muestras que otros mtodos no detectaron.

10

Fago integrado en el cromosoma de la bacteria parasitada, sin provocar, salvo tras induccin, la reproduccin de las partculas vricas, se reproduce a la par con el cromosoma
de la clula parasitada.
11
Dos o ms secuencias idnticas de ADN contiguas.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Cuadro 2. Iniciadores y sondas diseados para la deteccin por qPCR de Ca. Liberibacter
Iniciador/
Sonda
HLB as

Gen
TCG AGC GCG TAT GCA ATA CG

HLBr

GCG TTA TCC CGT AGA AAA AGG TAG

HLBp
HLBam

56 FAM/AGA CGG GTG AGT AAC GCG/3BHQ 1


GAG CGA GTA CGC AAG TAC TAG

HLBr

GCG TTA TCC CGT AGA AAA AGG TAG

HLBp
f-rplJAmf
r-rplJAmr
f-rplLAsf
r-rplLAsr
AS84F
As180R
As111T
LJ900f
LJ900r
LJ900p

56 FAM/AGA CGG GTG AGT AAC GCG/3BHQ 1


GGACAAGGGGATATTGGATAATGATG
ATTAAGAGTTCTAAGCAACCTGACAG
CGCCCGTTTCCGTTGT
AGCCTCTTTAAGCCCTAAATCAG
TCACCGGCAGTCCCTATAAAAGT
GGTTAAGTCCCGCAACGA
ACATCTAGGTAAAAACC
GCCGTTTTAACACAAAAGATGAATATC
ATAAATCAATTTGTTCTAGTTTACGAC
ACATCTTTCGTTTGAGTAGCTAGATCATTGA

ADN
ribosomal
16s

Candidatus
liberibacter
Asiaticus

Fuente/autor
Li et al., 2006

ADN
ribosomal
16s

Americanus

b-operon

Americanus

b-operon

Asiaticus

16S rADN

Asiaticus

Coletta et al., 2010.

hyvI / hyvII

Asiaticus/Americanus

Morgan et al., 2012.

Teixeira et al., 2008

El ensayo de qPCR que comnmente se utiliza para la deteccin de HLB emplea los iniciadores y sonda
desarrollados por Li et al., (2006) (anexo 4). Sin embargo, es importante disponer de otros ensayos tanto de PCR
convencional como de PCR tiempo real, y evaluar la sensibilidad de estos ensayos en las muestras que el laboratorio
comnmente analiza.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Anexos

Anexo 1. Aspirador Manual para la colecta de Pslidos


La colecta de pslidos puede realizarse con ayuda de un aspirador manual que es sencillo de fabricar. Hay dos
tipos comunes de aspiradores para colectar insectos (figura 1). Uno de stos consiste de un frasco pequeo y un tapn de
corcho o goma en la parte superior. El tapn tiene dos perforaciones, una para el tubo para aspirar y la otra para el tubo
por donde los insectos sern aspirados. El otro sistema es similar pero un poco ms simple. Consiste en un cilindro o tubo
grueso de cristal o plstico, abierto de manos extremos con un tapn de corcho o goma en cada abertura. Ambos tapones
estn perforados en el centro. En un extremo est el tubo aspirador y en el otro extremo el tubo recogedor por el que
pasaran los insectos al aspirar12.

En ambos sistemas el tubo aspirador, tiene una malla o red delgada, en el extremo dentro del frasco, para que al
momento de aspirar el insecto caiga dentro del recipiente e impedir que los insectos pasen a la boca.
Se puede fabricar con materiales simples, se requieren botes o frascos de 50 ml, dos tubos flexibles, malla o red
delgada. Se hacen dos perforaciones en la tapa del bote, conviene dejar suficiente separacin entre ellos para evitar que la
tapa se agriete. En uno de los tubos, deber pegar la malla. Despus se inserte los tubos en los orificios de la tapa y selle
perfectamente, para que no haya fugas de aire.
El funcionamiento es simple, por uno de los tubos (que se recomienda sea ms grueso que el tubo al que se
adicion la malla) se aspira con la boca mientras que con el extremo del otro, se acerca y apunta al insecto que queremos
capturar, ste ser absorbido con facilidad y con un poco de prctica, graduando la distancia y la presin con la que
aspiramos, no ha absorberse demasiada tierra o polvo.

12

Medina G. S. 1977. Manual de procedimientos para colectar, preservar y montar insectos y otros artrpodos. Universidad de Puerto Rico.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Anexo 2. FORMATO DE SOLICITUD DE DIAGNSTICO


DATOS DE LA(S) MUESTRA(S)
TOTAL MUESTRAS DE PSILIDOS: 4
NUMERACIN O CLAVE ASIGNADA: 3-6
PROCEDENCIA:

TOTAL DE MUESTRAS VEGETALES: 2


NUMERACIN O CLAVE ASIGNADA: 1-2
FECHA DE ENVIO:
FECHA DE RECEPCION:

INTERESADO O TCNICO QUE ENVA


NOMBRE:

TELEFONO

DIRECCION:

E-MAIL:

Clave o
FOLIO
Muestra

ESTADO/
PROVINCIA

CIUDAD/
LOCALIDAD

PLANTACION

ESPECIE

EDAD DE LA
PLANTACIN

SINTOMAS
OBSERVADOS

VEGETAL

comercial

Naranja

Moteado

traspatio

Limn
Persa

Sin
sntomas

PSILIDOS

PRODUCTOR

LATITUD/
LONGITUD

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Anexo 3. Procedimiento de Extraccin de ADN


Extraccin de ADN de Psilidos.
Mtodo de extraccin empleando Kit Qiagen DNeasy para Sangre y Tejido (Qiagen #69504 )
1. Precalentar el bao seco a 56C para usarse posteriormente.
2.

Agregar 360 l de PBS 1X pH 7.2, (Fosfato de Potasio 50mM, NaCl 150 mM).

3.

Transferir los psilidos a un tubo de 1.5 mL (mximo 50 psilidos).

4.

Cerrar perfectamente el tubo y homogenizar las muestras usando un disruptor de tejidos.13 Transferir 180 l de
sobrenadante a un tubo nuevo de 1.5 ml, debidamente etiquetado. Se recomienda usar puntas con filtro.

5.

Agregue 20 l de proteinasa K a cada tubo. Agregar 200 l del amortiguador AL (sin etanol extra) a cada tubo.

6.

Agitar por 5-10 segundos con vortex. Centrifugar brevemente de 10-15 segundos.

7.

Incubar a 56C durante 10 minutos. Retirar las muestras de la incubadora.

8.

Agregar 200 l de Etanol (96-100%) a cada tubo, agitar 5-10 segundos en vortex.

9.

Transferir la mezcla, incluyendo cualquier precipitado que se forme, a la columna DNeasy Mini colocada en un tubo de
recoleccin de 2ml. Etiquetar las columnas con las claves respectivas.

10. Centrifugar a 8,000 rpm durante 1 min. Conservar la columna y desechar el precipitado.
11. Colocar la columna en un tubo nuevo de recoleccin y agregar 500 l de amortiguador AW1.
12. Centrifugar durante 1 min. a 8,000 rpm. Conservar la columna DNeasy y desechar el precipitado.
13. Colocar la columna en un nuevo tubo de recoleccin y agregar 500 l de amortiguador AW2.
14. Centrifugar durante 1 min. a 13,000 rpm. Conservar la columna y desechar el precipitado.
15. Centrifugar 2 min. 13,000 rpm para remover completamente el exceso de amortiguador de lavado. Desechar el
precipitado y el tubo de recoleccin.
16. Retirar cuidadosamente la columna para evitar que sta entre en contacto con el precipitado y colocar la columna en
un nuevo tubo etiquetado de 1.5 ml. Agregar 30-50 l de amortiguador AE directamente en la membrana del DNeasy.
Incubar a temperatura ambiente durante 1 minuto.
17. Centrifugar durante 1 minuto a > 8,000 rpm para recolectar la elusin de ADN.
18. Repetir la elusin, usando el mismo tubo de recoleccin que contiene 30-50 l de la primera elusin.
19. Almacenar el ADN en hielo y/o a 4 C para su uso inmediato en PCR-RT o almacenar a -20 C para su uso posterior.

13

Existen varios modelos de disruptores, como el Mini-BeadBeater de Biospec Products, MagNa Lyser de Roche. Si no cuenta con un disruptor, puede
macerar la muestra de psilidos con morteros pequeos, pero debe trabajar con sumo cuidado para evitar contaminacin cruzada. La ventaja del disruptor
de tejido es, adems del ahorro de tiempo, que se minimizan los riesgos de contaminacin, ya que cada muestra permanece en el tubo cerrado.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Mtodo de extraccin empleando Kit Axygen para sangre y tejido (AxyPrep Blood Genomic DNA Miniprep Kit)
1. Precalentar el Buffer TE a 65C para usarse posteriormente.
2.

Transferir los psilidos en un tubo de 1.5 ml estril, agregar 350 de PBS 1X pH 7.2, (fosfato de potasio 50mM, NaCl 150
mM), 500 ul de la solucin AP1 y 100ul de la solucin AP2. Macerar los psilidos en un disruptor de tejidos.

3.

Centrifugar 8 min a 14 000 rpm.

4.

Preparar la columna y etiquetar tubos de recoleccin.

5.

Pasar el sobrenadante a la columna (alrededor de 700 ul)

6.

Centrifugar 1 min a 8000 rpm. Desechar el sobrenadante.

7.

Agregar 700 ul de la solucin AW1. Centrifugar 1 min a 8000 rpm. Desechar el sobrenadante.

8.

Agregar 700 ul de la solucin AW2. Centrifugar 1 min a 8000 rpm. Desechar el sobrenadante.

9.

Agregar 300 ul de la solucin Aw2. Centrifugar 2 min a 14000 rpm. Retirar cuidadosamente la columna para evitar
que sta entre en contacto con el precipitado. Pasarla a un tubo nuevo etiquetado.

10. Agregar 35 ul de TE precalentado a 65C, incubar 5 min a temperatura ambiente y centrifugar 1 min a 8000 rpm.
11. Repetir el paso 10.
12. Desechar la columna y almacenar el ADN en hielo y/o a 4 C para su uso inmediato en PCR o bien almacenar a -20 C
para su uso posterior.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Extraccin de ADN total de muestras vegetales


Extraccin de ADN empleando Mini Kit para Plantas Qiagen DNeasy* Qiagen DNeasy #69104 .
1. Desprender las nervaduras centrales y peciolos de las hojas con sntomas o sospechosas, cortarlos en pedacitos, pesar
200 mg de tejido y colocarlo dentro de un tubo de 1.5 ml etiquetado. Utilice una navaja por cada muestra a fin de
evitar contaminacin entre las muestras.

2.
3.

4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.

15.
16.

Precalentar la solucin AE a 65C que ser utilizado posteriormente.


Agregar 800 l de solucin AP1 a cada tubo. Homogenizar el tejido de la planta en disruptor de tejidos.
Si no cuenta con un disruptor de tejidos, colocar el tejido en mortero, congelar a -70C y macer o bien emplee
nitrgeno lquido para congelar y macerar. Pasar el tejido macerado a un tubo de 1.5 ml que contenga la solucin de
extraccin AP1.
Incubar el tejido macerado a 65C durante 10 minutos.
Centrifugar la muestra durante 10 segundos 10,000 rpm para retirar el tejido de la capa superior.
Agregar 260 l de la solucin amortiguadora AP2 al lisado, agitar brevemente e incubar en hielo por 5 minutos.
Centrifugar a 14,000 rpm durante 10 minutos. Transferir el lisado a una columna mini spin de DNeasy QIAshredder
(columna de color lila) y centrifugar durante 2 minutos a 14,000 rpm.
Agregar a un tubo de 1.5 ml etiquetado 700 l de la solucin amortiguadora AP3.
Transferir el sobrenadante al tubo que contiene la solucin AP3 y mezclar por inversin. Centrifugar por unos
segundos.
Transferir 700 l de la mezcla, a la columna mini spin DNeasy (blanca). Centrifugar a 8000 rpm durante 1 minuto.
Desechar el precipitado.
Repetir el Paso 11 con el resto de la mezcla. Desechar el precipitado.
Agregar 500 l de la solucin amortiguadora AW y centrifugar 8000 rpm durante 1 minuto. Desechar el precipitado.
Realizar un segundo lavado, agregar 300 l de la solucin AW a la columna y centrifugar durante 2 minutos a 14,000
rpm. Retirar cuidadosamente la columna para evitar que sta entre en contacto con el precipitado.
Transferir la columna a un tubo nuevo de 1.5 ml y agregar 85 l de la solucin AE precalentada a 65C sobre la
membrana de la columna. Incubar por 5 minutos a temperatura ambiente, centrifugar durante 1 minuto a 8000 rpm
para recolectar la elusin del ADN.
Repetir el paso 15.
El ADN genmico pueden almacenarse a 4C slo para un uso inmediato o a -20C para utilizarse en el futuro.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Mtodo de Extraccin de DNA empleando el AxyPrep Multisource Genomic DNA Miniprep Kit (Cat. AP-MN-MS-GDNA-50)
1.

Desprender las nervaduras centrales y peciolos de las hojas con sntomas o sospechosas, cortarlos en pedacitos, pesar
200 mg de tejido y colocarlo dentro de un tubo de 1.5 ml.

2.

Adicione 550l de PBS y 150ul de Buffer C-L. Homogenizar el tejido en un disruptor de tejidos.
Alternativamente, colocar el tejido en mortero, congelar a -70C y macerar o bien, emplee nitrgeno lquido para
congelar y macerar. Pasar el tejido macerado a un tubo de 1.5 ml que contenga 550l de PBS y 150ul de Buffer C-L y
mezclar vigorosamente.

3.

Adicione 20l de Proteinasa K y d vortex para mezclar

4.

Centrifugue brevemente e incube 10 min a 56C. Retire las muestras de la incubadora y centrifugue brevemente.

5.

Adicione 350l de buffer P-D y d vortex a mxima velocidad durante 30 segundos.

6.

Centrifugue a 13,300 rpm durante 10 minutus.

7.

Coloque la columna miniprep en un tubo de 2 ml (incluido en el kit) y transfiera el sobrenadante del paso anterior a la
columna. Centrifugue por 1 minuto a 13,300 rpm.

8.

Deseche el eluido y adicione 500l de buffer W1 a la columna. Centrifugue por 1 min a 13,300 rpm.

9.

Deseche el eluido y adicione 700l de buffer W2 a la columna. Centrifugue por 1 min a 13,300 rpm. Deseche el eluido y
repita.

10. Deseche el eluido, regrese la columna al tubo de 2 ml y centrifugue 1 min a 13,300 rpm.
11. Transfiera la columna al tubo colector de 1.5ml (incluido en el kit) adicione 100l del eluyente en el centro de la
columna, incube a temperatura ambiente por unos minutos y centrifugue a 8000 rpm por 1 min. Repetir el paso.
12. Retire la columna y almacene el DNA a 4C para uso prximo o a -20C para uso a largo plazo.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

ANEXO 4. PCR convencional y PCR en tiempo real para la deteccin de HLB


Los iniciadores comnmente utilizados en PCR convencional son los denominados OI1/OI2c/OA, y rplA2/rplJ5
desarrollado por Jagoueix, et al., (1996) y Hocquellet et al., (1999) respectivamente. Los iniciadores OI1/OI2c/OA
amplifican un fragmento de 1160 pares de bases (pb) de las variantes asitica y africana de Ca. Liberibacter. Para
diferenciarlas, se requiere realizar la digestin del producto de amplificacin con la enzima Xba I. El patrn de restriccin
para la variante africana es de tres fragmentos (520 pb, 506 pb y 130 pb) y para la variante asitica se obtienen dos
fragmentos (640 pb y 520 pb). El par de iniciadores rplA2/rplJ5 permiten distinguir ambas variantes, ya que amplifican un
fragmento de 703 pb para Ca. L. asiaticus y 669 pb para Ca. L. africanus.

Iniciador
OI1
OI2c
rplA2
rplJ5
GB1
GB3

Secuencia
GCG CGT ATG CAA TAC GAC CGG CA
GCC TCG CGA CTT CGC AAC CCA T
TAT AAA GGT TGA CCT TTG GAG TTT
ACA AAA GCA GAA ATA GCA CGA ACA A
AAG TCG ACG GAG TAC GCA AGT ACT
CTA TAT TTG CCA TCA TTA AGT TGG

Fragmento

Fuente/autor

1,160 LAS/LAF

Jagoueix, et al., (1996)

703 para LAS


699 para LAF
1, 027
LAM

Hocquellet et al., (1999)


Teixeira et al., 2005

El ensayo de PCR tiempo real o qPCR que comnmente se utiliza para la deteccin de HLB emplea los iniciadores y
sonda desarrollados por Li et al., (2006). Para muestras de plantas, este ensayo utiliza un par de iniciadores y sonda,
basado en la enzima citocromo-oxidasa (COX) como control interno positivo. Para muestras de Pslidos, tambin se emplea
una sonda y primers especficos basados en genes de la glicoprotena (WG). Las metodologas empleadas se basan en el
protocolo de diagnstico desarrollado y validado por USDA-APHIS (USDA et al., 2012b).
PRIMERS Y SONDAS PARA MUESTRAS DE PLANTAS
Nombre del primer

1.
2.

Secuencia 5-3

Primer HLB as

TCG AGC GCG TAT GCA ATA CG

Primer HBr

GCG TTA TCC CGT AGA AAA AGG TAG

Sonda HLBp

FAM/AGA CGG GTG AGT AAC GCG/BHQ 1

Primer HLB am

GAG CGA GTA CGC AAG TAC TAG

Primer HLBr

GCG TTA TCC CGT AGA AAA AGG TAG

Sonda HLBp

FAM/AGA CGG GTG AGT AAC GCG/BHQ 1

Primer COX

GTA TGC CAC GTC GCA TTC CAG A

Primer COXr

GCC AAA ACT GCT AAG GGC ATT C

Sonda COX

TET/ATC CAG ATG CTT ACG CTG G/BHQ 2

Las mezclas de primers HLBas y HLBam comparten un primer comn, HLBr.


COX se refiere al gen citocromo oxidasa de las plantas.

Gen
objetivo

Especifico para

Genes 16s de rRNA

Las

Genes 16s de rRNA

Lam

COX

COX

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

PRIMERS Y SONDAS PARA MUESTRAS DE PSILIDOS


Nombre del primer

1.

Secuencia 5-3

Primer HLB as

TCG AGC GCG TAT GCA ATA CG

Primer HLBr

GCG TTA TCC CGT AGA AAA AGG TAG

Gen
objetivo

Sonda HLBp

FAM/AGA CGG GTG AGT AAC GCG/BHQ 1

Primer HLB am

GAG CGA GTA CGC AAG TAC TAG

Primer HLBr

GCG TTA TCC CGT AGA AAA AGG TAG

Sonda HLBp

FAM/AGA CGG GTG AGT AAC GCG/BHQ 1

Primer WG

GCT CTC AAA GAT CGG TTT GAC GG

Primer WGr

GCT GCC ACG AAC GTT ACC TTC

Sonda WG

TET/TTA CTG ACC ATC ACT CTG GAC GC/BHQ 2

Especifico
para

ADN ribosomal 16s

Las

ADN ribosomal 16s

Lam

Gen WG*

pslidos

WG se refiere a la glicoprotena
REACTIVOS

1 REACCIN

Agua de grado molecular

4.7l

CONCENTRACIN FINAL

10x buffer

2.5 l

1x

MgCl2 (50 mM)

3.0 l

6.0 mM

dNTPs (10 mM cada uno, invitrogen)

0.6 l

0.24mM

Taq platino (5U/l, invitrogen)

0.2 l

1 unidad

Mezcla primer HLB* (2M cada uno)

3.0 l

240nM

Sonda HLB (1M)

3.0 l

120nM

Mezcla primer COX (2M cada uno) o


Mezcla primer WG

3.0 l

240nM

Sonda COX (1M)


Sonda WG

3.0 l

120nM

total

23.0 l

N/D no disponible

NOTA: mezcla de primers de HLB en la tabla se refiere a cualquiera de las mezclas, ya sea HLBas/HLBr o HLBam/HLBr.
Mezcla de primers COX se refiere a COX/COXr o mezcla de primer WG, dependiendo del tipo de muestras (psilidos o vegetales)

RECOMENDACIONES DE TRABAJO
1. Los tubos con iniciadores y sondas liofilizadas deben centrifugarse brevemente antes de abrirlos para garantizar que el material
liofilizado est en el fondo del tubo.
2. Soluciones Stock (100 M) de las sondas y primers
Las sondas y los primers se deben disolver dentro de una estacin de trabajo de PCR limpia. Se recomienda disolver las sondas y primers
en amortiguador TE 1x, ajustando la concentracin a 100M. Conservar estas soluciones stocks a 20 C. Las sondas deben almacenarse
en tubos mbar, para protegerlas de la luz.
3. Mezclas de primers
Agregue 20 l de la solucin stock 100M de cada uno de los primers, formando las mezclas siguientes: HLBas/HLBr, HLBam/HLBr y
WG/WGr, COX/COXr. A cada mezcla de primers agregue 960 l de amortiguador TE 1x (la concentracin final es 2 M) para las muestras
de Psilidos y plantas.
4. Sondas
Prepare soluciones 1M de cada sonda en agua ultrapura o en amortiguador TE 1x diluyendo la solucin stock de la sonda de 100 M
(agregue 10 l de solucin de reserva a 990 l de amortiguador TE 1x, la concentracin final es de 1 M). Almacene alcuotas pequeas
(20 l) de las sondas a -20C en tubos oscuros o mbar de 1.5 ml para protegerla de degradacin debida a la exposicin de luz. Se
recomienda preparar alcuotas pequeas, ya que las sondas son sensibles a los ciclos frecuentes de congelado / descongelado.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

La preparacin de la mezcla de reaccin se debe realizar en una estacin de trabajo de PCR limpia.
1. Prepare dos mezclas para PCR-RT para el nmero de muestras y muestras adicionales (1 por cada 10), ms los 2 controles (positivo y
negativo). Las mezclas deben conservarse en hielo durante su preparacin y antes de hacer las alcuotas para las reacciones
individuales. Descongele el amortiguador PCR 10x, MgCl2 50mM, las mezclas de primers, las sondas y dNTPs. Centrifugue por 2-4
segundos. Coloque en hielo.
2. Prepare dos mezclas de PCR en Tiempo real (Tabla 4): una mezcla deber contener los primers HLBas/HLBr y la segunda los primers
HLBam/HLBr.
3. Mezcle perfectamente los reactivos, transfiera 23.0 l de la mezcla en cada tubo.
B
ADICION DE LAS MUESTRAS Y CONTROLES
El ADN extrado el mismo da puede mantenerse en hielo y est listo para su uso. Si el ADN fue extrado previamente y
almacenado a 20C, descongele, mezcle y centrifugue por algunos segundos. Coloque los tubos de muestra en hielo. EL DNA de las
muestras debe depositarse fuera de la estacin de trabajo de PCR a fin de evitar posibles contaminaciones.
1. Agregue 2 l de ADN de pslido o muestra vegetal al tubo de PCR correspondiente. El volumen de la reaccin total es de 25 l.
2. Cada corrida PCR debe incluir 2 controles. Use 2 l de agua o amortiguador TE como control negativo. De igual forma, deposite 2 l de
ADN de pslido o muestra vegetal positivo a LAS. El volumen de la reaccin total es de 25 l.
PROGRAMA DE TERMOCICLAJE
Se usa el mismo programa para los ensayos de deteccin PCR de HLB del LAS y del LAM.
Etapa 1: Mantenga a 95C durante 20 segundos con los pticos desconectados.
Etapa 2: repita 40 veces y Ciclo de 2 temperaturas.
- primer ciclo de temperatura: 95C durante 1 segundo con los pticos desconectados
- segundo ciclo de temperatura: 58C durante 40 segundos con los pticos conectados.
D.
VALORACIN DE LA PCR-RT
1. Controles: Si los valores Ct requeridos no son los adecuados, la corrida no es vlida y todas las muestras deben ser probadas
nuevamente.
a) El control negativo debe tener un TET Ct = 0.00 y el FAM Ct = 0.00
b) Para el ADN positivo (Psilido o Vegetal) a LAS y LAM:
El control interno debe mostrar 0.00 < TET Ct < 38.
El control positivo de HLB debe mostrar 0.00 < FAM Ct < 32.
2. Muestras a diagnosticar: no evale muestras hasta que determine que sus controles positivos son aceptables.
a) TET Ct
Si una muestra tiene un control interno de 0.00 = TET Ct o > 38, la muestra especfica debe ser probada de nuevo. Si la muestra presenta
resultados similares, entonces la muestra no presenta una calidad adecuada, aun cuando el FAM Ct es aceptable.
b) FAM Ct
Muestras positivas a LAS o LAM: Si una muestra de genera un valor FAM Ct en el rango de 0.00 < FAM Ct < 32 la muestra probada es
positiva para LAS o LAM. (Nota: El control interno de la muestra para el PCR en tiempo real tambin debe ser aceptable.)
Las muestras que den positivo a HLB por LAS o LAM deben analizadas nuevamente con los primers correspondientes para confirmar
los primeros resultados de la corrida. Si los resultados son similares, entonces la muestra queda determinada como positiva a HLB por
LAS o LAM.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

REFERENCIAS
Agrios, G.N. 1999. Fitopatologa. Edit. Limusa, S.A. de C.V. Mxico, D.F.
Collazo C. C., Pantoja, M. L,. Llauger, R. R. 2008. Tcnicas empleadas para el diagnstico del Huanglongbing de los ctricos
Revista CitriFrut, Vol. 25, No. 2, 2008
Hall, D. G., Irey M., LeVesque, C., Madishetty, K. and Polek M. 2011. Comparative analysis of various short-term storage
methods for preserving Candidatus liberibacter asiaticus in its vector Diaphorina citri 2nd Annual Citrus Health Research Forum October
4-6, 2011 Abstracts
De Barro, P. J., Sherratt, T. N., Brookes, C. P., David, O., and Maclean, N. 1995. Spatial and temporal variation in British field
populations of the grain aphid Sitobion avenae (F.) (Hemiptera: Aphididae) studied using RAPD-PCR. Proc. R. Soc. Lon. Ser-B. 262:321-327.
Duan Y., Zhou L., Gabriel D, Weathersbee A, Gottwald T.R. A unique disease phenotype -yellow shoot without blotchy mottle
was associated with a low titer of Candidatus Liberibacter asiaticus in Florida. APS Centennial Meeting. Minneapolis, MN2008. p. Poster
Session Phytopathology 98:S48.
El-Desouky Ammar, Abigail J. Walter and David G. Hall. 2011. A new detached leaf assay method to test the inoculativity of
psyllids with Candidadus Liberibacter asiaticus associated with citrus Huanglongbing disease
Flix, P.M., Martnez, Q. J., Arredondo, B. H. 2011. Estacionalidad de la infectividad de HLB en Colima. 2 Simposio Nacional
sobre investigacin para el manejo del Pslido Asitico de los Ctricos y el Huanglongbing en Mxico.
Coletta-Filho,H. D., E. F. Carlos, K. C. S. Alves, M. A. R. Pereira, R. L. Boscariol-Camargo, A. A. de Souza, M. A. Machado. 2010. In
planta multiplication and graft transmission of Candidatus Liberibacter asiaticus revealed by Real-Time PCR. Eur J Plant Pathol (2010)
126:5360
Huanglongbing de los ctricos. Protocolos de diagnstico de la NAPPO.
http://www.nappo.org/es/data/files/download/Draft%20documents/NAPPO%20HLB%20PD%202%202012-05-30-S.pdf
Hung TH, Wu ML, Su HJ, 1999. Development of a rapid method for the diagnosis of citrus greening disease using the polymerase
chain reaction. Journal of Phytopathology 147, 599604.
Irey, M. Sampling Protocol for Submission of Huanglongbing (syn= Greening or HLB) Samples to the Southern Gardens
Diagnostic Laboratory http://www.crec.ifas.ufl.edu/extension/greening/Diagnostics.shtml
Li W. and Levy L. 2009. Citrus huanglongbing diagnosis based on molecular detection of associated Liberibacter species.
http://www.calcitrusquality.org/wp-content/uploads/2009/05/manuscript.pdf
Li, W., Hartung, J. S., and Levy, L. 2007. Evaluation of DNA amplification methods for improved detection of Candidatus
Liberibacter species associated with citrus huanglongbing. Plant Dis. 91:51-58.
Li, W.B., J.S. Hartung y L. Levy. 2006. Quantitative real-time PCR for detection and identification of Candidatus Liberibacter
species associated with citrus huanglongbing. J. Microbiol. Methods 66:104-115.
Manjunath, K. L., Halbert, S. E., Ramadugu, C., Webb, S., & Lee, R. F. (2008). Detection of Candidatus Liberibacter asiaticus in
Diaphorina citri and its importance in the management of citrus huanglongbing in Florida. Phytopathology, 98, 387396
Mara, H. y Peyrou, M. 2010. La citricultura de Argentina y Uruguay puede escapar a la amenaza del HLB. Instituto de
Investigaciones Biolgicas Clemente Estable
Morgan J.K, Zhou L, Li W, Shatters R.G, Keremane M, Duan Y.P. 2012. Improved real-time PCR detection of 'Candidatus
Liberibacter asiaticus' from citrus and psyllid hosts by targeting the intragenic tandem-repeats of its prophage genes. Mol Cell Probes.
2012 Apr;26(2):90-8.
Murray M.G and Thompson W.F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980; 239:48791.

Organismo Internacional Regional de Sanidad Agropecuaria


Mxico, Belice, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Repblica Dominicana y Panam

Organizacin de las Naciones Unidas para la Agricultura y la Alimentacin

Technical Working Group (TWG) Report: HLB in Texas. 5 April 2012. United States Department of Agriculture (USDA). Animal
Plant Health Inspection Service (APHIS), Plant Protection and Quarantine (PPQ), Center for Plant Health Science and Technology (CPHST).
Teixeira D.C, Saillard C., Couture C., Martins E.C., Wulff, N.A., Eveillard-Jagoueix S, 2008. Distribution and quantification of
Candidatus Liberibacter americanus, agent of huanglongbing disease of citrus in Sao Paulo State, Brazil, in leaves of an affected sweet
orange tree as determined by PCR. Mol Cell Probes 2008; 22:139-150.
United States Department of Agriculture (USDA), Animal Plant Health Inspection Service (APHIS), Plant Protection and
Quarantine (PPQ), Center for Plant Health Science and Technology (CPHST), 2012a. Technical Working Group (TWG) Report: HLB in Texas.
United States Department of Agriculture (USDA), Animal and Plant Health Inspection Service (APHIS), Plant Protection and
Quarantine (PPQ). 2012b. DNA extraction and PCR detection in citrus in New Pest Response Guidelines Citrus Greening Disease.
http://www.aphis.usda.gov/plant_health/plant_pest_info/citrus_greening/downloads/pdf_files/cg-nprg.pdf).
Yulu Xia, Yijing Cen, Xiaoling Deng, and Ronald Sequeira. 2011. Report of a new potential psyllid vector of Huanglongbing. In 2nd
Annual Citrus Health Research Forum October 4-6, 2011 Abstracts