You are on page 1of 8

REFEREED

ORIGINAL RESEARCH

Clinical and Laboratory Findings in Equine


Piroplasmosis
Rosanna Zobba,a Mauro Ardu,b Serena Niccolini,b Bernardo Chessa,c
Laura Manna,d Raffaella Cocco,e and Maria Luisa Pinna Parpagliae

ABSTRACT
The objective of this study was to evaluate equine piroplasmosis (EP) as a cause of morbidity in horses in Sardinia (Italy), describe the clinical signs and altered
hematologic and biochemical parameters, and illustrate
response to different treatments. Among 44 horses suspected of tick-borne disease, 38 were polymerase chain
reaction (PCR) positive for Theileria equi (n 27) or
Babesia caballi (n 6), whereas five were positive for
both protozoans. Typical clinical features of piroplasmosis were seen in some of the horses, whereas others
had nonspecific mild symptoms. Hematologic findings
revealed involvement of the three blood cell lineages
(anemia, leukopenia or leukocytosis, thrombocytopenia), and biochemical variations were related to increased bilirubin, alteration of serum phosphorus, and
hypoalbuminemia. We suggest that the two protozoans
are the most important causative agents of equine tickborne disease in this geographic area, and we observe
that different clinical features are associated with the disease; in addition to the typical aspects of piroplasmosis,
characterized by fever, pale mucous membranes, and icterus, we can signal other nonspecific mild signs such as
weight loss, weight loss associated with an insignificant
leukopenia, or weight loss associated with depression,
anorexia, and mild hyperbilirubin. The study is intended
as a practical contribution for veterinary practitioners
because it describes different clinical presentations and
laboratory findings of EP, suggests diagnostic and therapeutic approaches to the disease, and shows diffusion
of the disease in a Mediterranean region.

From the sezione di Clinica Medica, Universita` di Sassari, Sassari, Italya; private
practice, Sassari, Italyb; the Dipartimento di Patologia e Clinica Veterinaria, sezione
di Malattie Infettive, Universita` di Sassari, Sassari, Italyc; Dipartimento di Scienze
Cliniche Veterinarie, Universita` di Napoli Federico II, Napoli, Italyd; and
Researcher of Dipartimento di Patologia e Clinica Veterinaria, sezione di Clinica
Medica, Universita` di Sassari, Sassari, Italy.e
Reprint requests: Maria Luisa Pinna Parpaglia, Researcher of Dipartimento di
Patologia e Clinica Veterinaria, sezione di Clinica Medica, Universita` di Sassari, Via
Vienna 2, 07100 Sassari, Italy.
0737-0806/$ - see front matter
2008 Elsevier Inc. All rights reserved.
doi:10.1016/j.jevs.2008.03.005

Journal of Equine Veterinary Science  Vol 28, No 5 (2008)

Keywords: Theileria equi; Babesia caballi; PCR; Hematology; Biochemistry

INTRODUCTION
Equine piroplasmosis (EP) is one of the most important
tick-borne diseases, with an economic worldwide impact
on the horse industry. The disease is caused by Theileria
equi and Babesia caballi, two hemoprotozoan parasites of
red blood cells, which belong to the phylum Apicomplexa,
order Piroplasmida.1 Approximately 14 species of Ixodid
ticks of the genera Dermacentor, Rhipicephalus, and
Hyalomma are able to transmit both parasites.2 Recently
it has been hypothesized that Haemaphysalis longicornis
may play a role in the transmission of T. equi.3
The clinical signs of piroplasmosis are variable and often
nonspecific.4 In rare hyperacute cases, animals may be
found dead or dying. More often, piroplasmosis presents
as an acute infection with fever usually exceeding 408C, depression, inappetence, pale mucous membranes or icterus,
dyspnea, and increased respiratory and heart rates. Additional features that may be seen include sweating, congested mucous membranes, petechial hemorrhages or
ecchymoses on the conjunctiva, colic, edema of the distal
limbs around the head and eyelids, and incoordination.
Massive intravascular destruction of parasitized erythrocytes could result in hemoglobinuria. The subacute symptoms are less severe but may resemble the symptoms of
acute form. Chronic infections typically result in variable
clinical presentations involving mild inappetence with
weight loss, transient fever, poor exercise tolerance, weakness, mild anemia, subicterus, and enlarged spleen.5
The most frequent hematologic alterations are reduction
of the number of red blood cells, platelet counts, and hemoglobin concentration.2,6 Acute infections are also characterized by neutropenia and lymphopenia7; furthermore,
decreased plasma fibrinogen, serum iron, phosphorus, and
elevated bilirubin concentrations have been reported.8
Especially in endemic areas, the infection may assume
a subclinical course and such animals could become carriers
of the protozoans.4 It would seem that horses infected with
B. caballi might spontaneously clear the organism after 12
to 42 months, whereas spontaneous clearance of T. equi organisms does not appear to occur.9 In carrier horses, which

301

302

may act as a reservoir of infection, a delicate equilibrium between the parasite and the immune mechanisms of the host
is present. Parasites are in very low numbers in the blood
and generally may not be detected in Giemsa-stained blood
smears.10 A breakdown in homeostasis resulting in clinical
babesiosis may develop after immunosuppressive events or
after strenuous exercise.11 As a result of the increased
movement of horses worldwide, animals that are low-level
carriers represent a risk of introduction of these parasites
into disease-free areas.
EP is endemic in many parts of Europe, Africa, Asia, and
America where suitable tick vectors are present. In parts of
southern Europe, infections caused by T. equi are more
frequent than infections caused by B. caballi.4 In Italy,
T. equi is the most frequent. Both parasites are widespread
throughout the southern part of the country, from Latium
to Sicily, including Sardinia.12
Piroplasmosis may be the most frequent tick-borne disease of horses in Sardinia: (1) The existing ecosystems are
excellent for the survival of many tick genera and in particular Rhipicephalus, Dermacentor, and Hyalomma, which
are known vectors of piroplasmosis and are well represented in the island, contrary to the genus Ixodes, vector
of Anaplasma phagocytophilum (Ehrlichia equi), which is
found only sporadically.13-15 (2) Recently, Alberti et al16
diagnosed only three cases of A. phagocytophilum among
20 horses with typical symptoms, and the other 17 horses
could well be affected by other pathogens, such as piroplasms. (3) The elevated seroprevalence found by Scala
et al17 and Pinna Parpaglia et al18 and the high number
of polymerase chain reaction (PCR) positives for piroplasms in asymptomatic horses found by Pinna Parpaglia
et al18 are contrary to the low seroprevalence and negative
PCR for A. phagocytophilum found by Pinna Parpaglia
(unpublished data). The last author has described a wide
circulation of T. equi and B. caballi, showing the highest
percentages (82.8%) of seroprevalence (by immunofluorescence assay test [IFAT]) against T. equi among Italian
regions.18 These reports illustrate the presence of piroplasmosis in asymptomatic horses,17,18 whereas studies about
its incidence as a cause of clinical disease in Sardinia are
lacking. Every year, in particular during the warm season,
many veterinarians working in Sardinia find in horses clinical forms compatible with tick-borne diseases that cause
important economic losses.
In the current study, the authors evaluate EP as a cause of
morbidity in Sardinia, describe clinical signs, alteration of
hematologic and biochemical parameters, and illustrate
the response to different treatments as a practical contribution for veterinary practitioners.

MATERIALS AND METHODS


Between June 2003 and February 2007, 44 horses from
various areas of Northern Sardinia (Italy) were examined

R Zobba et al  Vol 28, No 5 (2008)

because of a suspicion of tick-borne disease. There were


17 males and 27 females of various breeds (with a predominance of Thoroughbred and Anglo-Arab), between 1
month and 18 years of age (4 foals and 40 adults). The
animals were raised and lived in various habitats (riding
schools, hippodromes, farms, in box or paddock) and
were racehorses or breeders. A clinical examination, including specific PCR studies for Theileria equi and Babesia caballi, and blood smears were performed on every horse, and
hematologic and biochemical analyses were performed on
some samples. Two different therapeutic protocols were
used.
PCR
For DNA extraction, blood samples were collected into
sterile tubes containing K3 ethylenediaminetetra-acetic
acid (EDTA) and stored at 208C until used. Blood was
washed repeatedly by adding phosphate-buffered saline
and centrifuging at 11,000g for 5 minutes at 48C until
a white pellet was obtained. The pellet was resuspended
in 500 mL DNA extraction buffer (10 mM Tris-HCl pH
8, 2 mM EDTA, 0.1% sodium dodecyl sulfate, 500 mg
proteinase K/mL) and incubated at 408C overnight. After
extraction with phenol and chloroform according to Sambrook et al,19 the DNA was precipitated with 0.1 volume
of absolute ethanol and 2 volumes of 3M CH3COONa
(sodium acetate) then centrifuged at 15,000g for 60 minutes at 48C. The pellet was washed with cold 70% ethanol.
The ethanol was removed by centrifugation and the DNA
was dissolved in 100 ml: Tris-EDTA. The DNA concentration was determined photometrically at 260 nm and stored
at 208C until used.
Two PCRs specific for T. equi and B. caballi were performed as previously described by Bashiruddin et al.4 The
primers specific for T. equi (BEQF, forward primer:
catcgttgcggcttggttgg; BEQR, reverse primer: ccaagtctcacaccctattt) and B. caballi (BCAF, forward primer:
ttcgcttcgctttttgtttttact; BCAR, reverse primer: gtccctctaagaagcaaacccaa), that amplify DNA targets of 664 and
659 bp, were chosen from areas of sequence variability of
16S rRNA, designed not to react with each other or with
the other piroplasms. The final 50-mL PCR mixture contained 150 ng DNA, 1 mM forward primer, 1 mM reverse
primer, 0.2 mM deoxyribonucleotide triphosphate mixture and HotMaster Taq polymerase with its buffer
(Eppendorf) using the manufacturers recommendations.
For T. equi, amplification conditions were: 5 minutes at
948C, 31 cycles each of 948C/30 seconds, 588C/30 seconds, 688C/40 seconds. For B. caballi, the amplification
was altered to 30 cycles each of 948C/30 seconds, 558C/
30 seconds, 688C/40 seconds. The final extension period
was 5 minutes at 688C. Reactions were performed in an
automated DNA thermal cycler and PCR products were
submitted to electrophoresis on 1.5% agarose gels to

R Zobba et al  Vol 28, No 5 (2008)

Figure 1. Icterus in a horse affected by T. equi.

check the size of amplified fragments by comparison with


a DNA molecular weight marker (1 Kb DNA Ladder,
Promega).
Blood Smear
Thin film smears were made from fresh blood collected in
K3EDTA Vacutainer tubes, stained with May GrunwaldGiemsa, and observed at 40 and 100 magnification
with an optical microscope for the evaluation of intracellular parasites.
Hematology and Clinical Biochemistry
Hematology parameters were evaluated using an automatic
counter (MS9, Melet Schloesing Laboratoires), whereas
biochemical analyses (alkaline phosphatase, alanine aminotransferase, amylase, bilirubin, total proteins, albumin,
total globulins, urea, calcium, phosphorus, creatinine, glucose, sodium, and potassium) were performed using an
automatic photometer (VetScan). Serum protein electrophoresis was performed by Zooprophylactic Institute of
Sardinia (Italy).
Treatment
The first group of horses was treated with oxytetracycline
(5.5 mg/kg once a day intravenously for 7 days). We complemented the treatment with one intramuscular injection
of imidocarb dipropionate at a dose of 1.7 mg/kg if any
improvement was seen in 24 to 48 hours. A second group
was treated with imidocarb dipropionate at a dose of 1.7
mg/kg IM given once or twice at an interval of 24 hours
on the basis of clinical evaluation. In acute forms, treatment was begun immediately while waiting for laboratory
diagnostic confirmation.

303

Figure 2. Edema of the distal limbs in a horse affected


by T. equi.

RESULTS
DNA was amplified from 38 (86.4%) of the 44 samples examined. In particular, 27 (61.4%) were positive for T. equi,
6 (13.6%) for B. caballi, 5 (11.4%) were positive for both
protozoans, and 6 (13.6%) samples were negative. All
four foals were positive: one for T. equi, two for B. caballi,
and one for both piroplasms.
Small pyriform intraerythrocytic merozoites or spherical/ovoid stages were detected microscopically in blood
smears from 11 of the 27 PCR-positive samples for T.
equi, whereas large pyriform merozoites were detected
from all of the 11 PCR-positive samples for B. caballi.
The most frequent symptoms found during physical examination of positive horses were fever, which could reach
418C, icterus or subicterus (Fig. 1), anorexia-dysorexia,
and depression. Less frequent clinical findings were weight
loss, congested or pale mucous membranes, edema of
the distal limbs (Fig. 2), enlarged lymph nodes (Fig. 3),
eyelid edema with mucous-purulent discharge (Fig. 4), dehydration, asthenia, myalgia, and backache (Table 1).
Pathologic conditions were observed during the whole
year, with the highest number of cases during the warm
season (Table 2).
Hematologic parameters were evaluated in 33 horses (23
positives for T. equi, 5 for B. caballi, and 5 for both protozoans) (Table 3).
Among horses positive for T. equi, one showed pancytopenia, five showed bicytopenia (anemia and thrombocytopenia), one showed thrombocytopenia with mild
reduction of hemoglobin, one showed leukopenia with
mild reduction of hemoglobin, four showed anemia (two
with only mild reduction of hemoglobin), two showed leukopenia, two showed irrelevant leukocytosis, two showed
thrombocytopenia, and five had normal hematologic parameters.

304

Figure 3. Enlarged submandibular lymph nodes in


a horse affected by T. equi.
Among horses positive for B. caballi, three animals
showed anemia and thrombocytopenia, one showed
thrombocytopenia and leukopenia, and one anemia and
leukopenia. Among horses positive for both parasites,
one showed pancytopenia and four showed anemia and
thrombocytopenia.
Clinical biochemistry of serum was evaluated in 26
horses (18 positive for T. equi, four for B. caballi, and
four for both protozoans) and the only altered noteworthy
parameters were bilirubin, phosphorus, and albumin
(Table 4). Twenty-two horses showed an increased
bilirubin (16 positive for T. equi, two for B. caballi, and
four for both protozoans), 9 horses showed decreased
phosphorus (six positive for T. equi, one for B. caballi,
and two for both protozoans), whereas two horses had increased phosphorus (one positive for B. caballi and one for
both protozoans). Seven horses had hypoalbuminemia
(four positive for T. equi, one positive for B. caballi, and
two positive for both). One horse showed an alteration
of hepatic enzymes.
All 34 positive horses treated with one or two doses of
imidocarb dipropionate recovered, with the exception of
a horse treated with one dose only, that showed a relapse
after 10 days. Among the four horses treated with oxytetracycline, three recovered and one manifested an improvement only with successive administration of imidocarb
dipropionate. In some cases, collateral effects appeared
with the second dose of imidocarb dipropionate (cholinergic effects), but were solved with atropine sulfate.

DISCUSSION
Among 44 suspected horses that we observed over 4 years
in Sardinia, 38 (86.4%) were positive for piroplasmosis. T.
equi was more prevalent (72.7%; 32/44) than B. caballi
(25%; 11/44). This is similar to findings by others in
southern Europe.20

R Zobba et al  Vol 28, No 5 (2008)

Figure 4. Eyelid edema with mucous-purulent


discharge in a horse affected by T. equi.
Our study shows that EP is an important cause of morbidity in Sardinia. This was the first time B. caballi was
detected on the island. We have shown that the two protozoans are the main causative agents of tick-borne disease in
this geographic area.
We found the microscopic examination of blood smears
for T. equi to be a less sensitive diagnostic tool than PCR, as
described in the literature, whereas its sensitivity for diagnosis of B. caballi in our study, but in contrast to the literature, was 100% compared with PCR.10,21
The clinical cases occurred all year round. This could be
ascribed to subclinical or asymptomatic infections, typical
of endemic areas, which could become manifested on occasion of immunosuppressive events21 or after strenuous exercise.11 It also could be caused by the continuous presence
of ticks in Sardinia, where climatic conditions are mild during the winter. Sardinia is an insular region located between 388 510 5200 N and 418 150 4200 N latitude and
between 88 8 E and 98 50 E longitude in the center of Occidental Mediterranean Sea with median annual temperatures of 158C to 208C.
Typical clinical signs and laboratory findings of piroplasmosis, such as fever, pale mucous membranes, and icterus,
were frequently observed; other nonspecific mild signs
such as weight loss, weight loss associated with an insignificant leukopenia, or weight loss associated with depression,
anorexia, and mild hyperbilirubin, were detected and may
be ascribed to subclinical or chronic forms.2
In Mediterranean countries, which are endemic for piroplasmosis,4,22 symptomatic infections can occur year round
with specific or nonspecific signs. For this reason, we suggest that veterinarians consider piroplasmosis among differential diagnoses in horses with specific or unspecific
symptoms throughout the year.
Hematologic alterations caused by T. equi and B. caballi are widely described in the literature: reduction in

R Zobba et al  Vol 28, No 5 (2008)

305

Table 1. Clinical signs found in positive horses


Symptoms

D T. equi
(n 27)

D B. cab
(n 6)

D T.equi and
D B. cab (n 5)

Fever
Icterus or subicterus
Anorexia-dysorexia
Depression
Weight loss
Pale mucous membranes
Congested mucous membranes
Edema of the distal limbs
Myalgia
Enlarged lymph nodes
Sore back
Asthenia
Eyelid edema with mucouspurulent discharge
Dehydration

20
18
9
8
7
5
3
2
1
1
1
1
1
-

6
4
2
1
2
1
1

5
5
2
2
1
1
1
-

the number of red blood cells and platelets, reduction in


hemoglobin concentration and, especially in acute forms,
leukopenia.2 The pathogenesis of anemia is described
only in canine babesiosis, but we can suppose that the
same causes could be ascribed to EP. Three mechanisms
of hemolysis have been described in canine babesiosis:
mechanical by trophozoite intra-erythrocyte binary fission, immunomediated by autoantibodies directed
against components of the membranes of infected and
uninfected erythrocytes, and toxic by hemolytic factor
produced by the parasite.23,24 The frequent involvement
of two or three blood cell lineages, found in our study,
is an interesting finding. The thrombocytopenia, found
in 39.1% of horses infected by T. equi, in 80% of horses
infected by B. caballi, and in 100% of horses with co-infection, has been rarely described in experimental and
natural infections.6,8 The mechanism of platelet decrease
also is poorly understood in canine piroplasmosis. It has
been suggested that it may be caused by local and systemic disseminated intravascular coagulation, immunemediated destruction, and sequestration of platelets in
the spleen.25
Hyperbilirubinemia, the most frequent biochemical
finding, is already widely described in natural infection
and is the consequence of hemolytic anemia. The pathogenesis of phosphorus alterations, reported in experimental infection,8 and hypoalbuminemia, which has not been
described in EP but has been illustrated in canine babesiosis, has not been described.26
Treatment of piroplasmosis varies depending on the
location of the horse and the desired goal of treatment.
In endemic regions, suppressing clinical signs without
eliminating the organism from the body is desirable

Table 2. Number of clinical cases distributed by month


D T. equi D B. cab D T. equi e
(n 27) (n 6)
D B. cab (n 5)
January
February
March
April
May
June
July
August
September
October
November
December

2
2
2
2
6
6
1

2
2

1
1

2
2

because premunition depends on the continued presence


of the parasite at low levels.9 The initial use of oxytetracycline was caused by the assumption that A. phagocytophilum (Ehrlichia equi) could be involved in such clinical
cases, but the frequent persistence of symptoms led to
a decision to substitute it with imidocarb dipropionate
until laboratory confirmation. As a consequence of the
excellent results obtained, we suggest use of imidocarb
dipropionate once or twice, on the basis of clinical
evaluation and attending laboratory confirmation.
Moreover, this drug also is effective against ehrlichiosis,
so that it is possible to avoid the association with
oxytetracycline, which is more toxic and more complex
to administer.

R Zobba et al  Vol 28, No 5 (2008)

306

Table 3. Hematologic findings

Horses
1E
2E
3E
4E
5E
6C
7C
8E
9E
10 E
11 E
12 E
13 N
14 C
15 E/C
16 N
17 N
18 E
19 E
20 E
21 E/C
22 E
23 N
24 N
25 E
26 N
27 C
28 E
29 E
30 E
31 E
32 E
33 E/C
34 C
35 E
36 E
37 E
38 E/C
39 E
40 C
41 E/C
42 E
43 E
44 E

WBC
RBC
Hb
(5L12 / (7L13 / (11L17
103mL)
106mL)
g/dL)
-

6.41
6.22
10.09
6.38
5.40
12.9 [
12.2 [
10.76
7.04
6.67
8.25
5.34
7.27
10.51
7.60
3.08 Y
5.34
4.65 Y
5.50
3.72 Y
8.44
6.30
7.48
7.49
5.70
6.45
8.83
7.39
3.85Y
3.77Y
4.38Y
4.55Y
8.12

8.04
5.17 Y
7.94
10.68
8.25
9.07
7.29
5.32 Y
6.76 Y
5.18 Y
4.54 Y
5.88 Y
8.96
5.71 Y
7.98
8.54
7.09
10.68
7.76
6.73 Y
7.46
4.74 Y
8.85
8.09
5.47 Y
7.54
5.26 Y
4.31 Y
7.52
5.46 Y
9.51
7.42
9.06

11.3
7.7 Y
10.2 Y
10.4 Y
9.0 Y
13.2
11.2
6.5 Y
7.1 Y
8.2 Y
6.6 Y
8.1 Y
8.6 Y
7.3 Y
13.6
11.6
10.5 Y
15.1
11.1
10.7 Y
13.0
6.5 Y
9.9 Y
13.3
9.0 Y
12.1
8.3 Y
7.0 Y
9.4 Y
9.2 Y
13.3
10.1 Y
15.4

HcT
MCV
(32%L52%) (35L60 fl)

MCH
(13L20 pg)

MCHC
(30L42
g/dL)

Platelet
(100L400
/103mL)

37.5
26.7 Y
32.4
39.1
31.5 Y
48.3
37.9
29.6Y
35.1
41.4
19.2 Y
30.2 Y
36.6
31.7 Y
42.0
37.1
33.0
49.2
36.4
36.5
33.3
22.5 Y
34.0
39.5
27.8 Y
39.9
27.4 Y
23.8 Y
38.3
25.9 Y
49.8
36.4
46.5

14.1
15.0
12.8
9.8 Y
10.9 Y
14.6
15.4
12.3 Y
10.6 Y
15.8
14.5
13.7
9.6 Y
12.8 Y
17.0
13.6
14.8
14.1
14.1
15.9
17.4
13.7
11.1Y
16.4
16.4
16.0
15.7
16.3
12.5Y
16.9
14.0
13.7
16.9

30.1
28.9 Y
31.4
26.7 Y
28.6 Y
27.4 Y
29.6 Y
22.1 Y
20.3 Y
19.8Y
34.3
26.8 Y
23.5 Y
23.0 Y
32.3
31.3
31.7
30.7
30.0
29.5Y
39.0
28.8 Y
28.9 Y
33.7
32.2
30.2
30.2
29.5 Y
24.6 Y
35.6
26.7 Y
27.8 Y
33.0

150
35 Y
117
191
49 Y
111
138
89 Y
34 Y
178
76 Y
78 Y
99 Y
154
105
73 Y
75 Y
114
119
92 Y
104
51 Y
99 Y
86 Y
57 Y
82 Y
71 Y
82 Y
295
83 Y
328
146
247

46.7
51.7
40.9
36.6
38.1
53.3
52.0
55.6
51.9
79.8 [
42.4
51.3
40.8
55.5
52.6
43.5
46.6
46.1
46.9
54.1
44.7
47.4
38.5
48.7
50.9
52.9
52.0
55.2
50.9
47.5
52.4
49.1
51.3

NOTE. E, positive for T. equi; C, positive for B. caballi; E/C, positive for both protozoans; N, negative horse. -, undetected parameter.

R Zobba et al  Vol 28, No 5 (2008)

307

Table 4. Biochemical findings

Horses

Tot.
Prot.
(6L8
g/dL)

Alb.
(2.7L4.4
g/dL)

Globulin
(2.7L5.0
g/dL)

Bilirubin
(0.5L2.3
mg/dL)

Direct
Bilirubin
(0.23L0.9
mg/dL)

P
(1.9L4.3
mg/dL)

ALP
(50L250
U/L)

ALT
(5L20
U/L)

1E
2E
3E
4E
5E
6C
7C
8E
9E
10 E
11 E
12 E
13 N
14 C
15 E/C
16 N
17 N
18 E
19 E
20 E
21 E/C
22 E
23 N
24 N
25 E
26 N
27 C
28 E
29 E
30 E
31 E
32 E
33 E/C
34 C
35 E
36 E
37 E
38 E/C
39 E
40 C
41 E/C
42 E
43 E
44 E

6.60
6.10
6.4
6.6
6.00
7.0
6.40
6.80
6.8
6.80
7.00
6.00
6.40
7.10
6.0
6.10
7.00
6.8
7.0
6.6
7.1
6.7
5.5Y
6.3
5.5Y
7.1

3.34
2.91
3.6
2.4Y
2.75
2.7
3.16
2.04Y
2.6
2.96
3.35
3.19
2.80
2.79
3.02
2.03Y
2.48Y
3.38
2.02Y
2.77
3.07
3.20
2.52Y
ICT
2.82
2.79

3.26
3.19
2.8
4.2
3.25
4.4
3.24
4.76
4.2
3.84
3.65
2.81
3.6
4.3
2.98
4.07
4.52
3.42
4.49
3.83
4.03
3.50
2.98
2.68
4.31

10.5 [
7.40 [
10.2 [
8.4 [
8.2 [
4.2 [
11.1 [
1.4
0.7
2.3
8.9 [
2.4 [
3.3 [
6.2 [
4.3 [
4.5 [
1.9
9.7 [
8.5 [
7.0 [
12.3 [
5.9 [
7.5 [
9.9 [
4.7 [
4.1 [

1.05 [
3.75 [
4.5 [
0.29
0.4
0.3
0.63
0.21
0.3
0.36
0.3
0.7
0.6
0.8
0.3
1.0 [
0.67

3.4
4.3
3.6
1.5 Y
3.4
3.9
5.0
3.5
3.5
2.0
2.7
3.8
2.9
2.1
3.5
2.1
5.7 [
1.6 Y
0.4 Y
1.6 Y
0.6 Y
1.1 Y
1.4 Y
0.6 Y
1.3 Y
4.0

123
242
98
143
208
152
214
172
209
125
88
116
165
87
139
308 [
87
122
105
183
138
60
216
129
428 [

18
23
30
24
8
11
20
10
10
25
37
9
8
12
29
16
15
14
34
16
18
14
9
21
9
160 [

NOTE. E, positive for T. equi; C, positive for B. caballi; E/C, positive for both protozoans; N, negative horse. -, undetected parameter. The normal
parameters (amylase, urea, calcium, creatinine, glucose, sodium, and potassium) are omitted.

R Zobba et al  Vol 28, No 5 (2008)

308

REFERENCES
1. Homer MJ, Aguilar-Delfin I, Telford SR III, Krause PJ, Persing DH.
Babesiosis. Clin Microbiol Rev 2000;13:451469.
2. De Waal DT. Equine piroplasmosis: a review. Br Vet J 1992;148:
614.

Sardinia and Basilicata regions. Parassitologia 1999;41(suppl. 1):


3940.
15. Fois F, Piras P, Addis G, Cabras P, Patta C, Satta G. Identification of
ticks collected in two areas of Sardinia. Parassitologia 2006;48:349.
16. Alberti A, Zobba R, Chessa B, Addis MF, Sparagano O, Pinna

3. Ikadai H, Sasaki M, Ishida H, Matsuu A, Igarashi I, Fujisaki K, et al.

Parpaglia ML, et al. Equine and canine Anaplasma phagocytophilum

Molecular evidence of Babesia equi transmission in Haemaphysalis

strains isolated on the island of Sardinia (Italy) are phylogenetically

longicornis. Am J Trop Med Hyg 2007;76:694697.


4. Bashiruddin JB, Camma` C, Rebelo E. Molecular detection of Babesia
equi and Babesia caballi in horse blood by PCR amplification of part

related to pathogenic strains from the United States. Appl Environ

of the 16S rRNA gene. Vet Parasitol 1999;84:7583.


5. Franceschi A, Guzzonato M. La babesiosi equina. Riv Ippiat Ippol
2000;7:17.

Microbiol 2005;71:64186422.
17. Scala A, Polinas S, Marras A, Nieddu MS, Varcasia A, Garippa G. Le
babesiosi equine in Sardegna: rilievi sieroepidemiologici. Atti del LX
Convegno Nazionale SISVet 2006;127128.
18. Pinna Parpaglia ML, Zobba R, Ardu M, Di Mauro C, Scimeca S,

6. Camacho AT, Guitian FJ, Pallas E, Gestal JJ, Olmeda AS, Habela MA,

Aloni A, et al. Serologic and molecular detection of Theileria (Babe-

et al. Theileria (Babesia) equi and Babesia caballi infections in horses

sia) equi and Babesia caballi in horses of Northern Sardinia. Parassito-

in Galicia, Spain. Trop Anim Health Pro 2005;37:293302.


7. Ristic M. Equine babesiosis and trypanosomiasis. Proceedings International Symposium on Equine Haematology; 1985.
8. De Waal DT, van Heerden J, Potgieter FT. An investigation into the

logia 2007;49(suppl. 1):101.


19. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory
manual, 1989. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.

clinical pathological changes and serological response in horses ex-

20. Schein E. Equine babesiosis. In: Ristic M, ed. Babesiosis of domestic

perimentally infected with Babesia equi and Babesia caballi. Onder9. Sellon DC. Disorders of the hematopoietic system. In: Reed M,

animals and man. Florida: CRC Press; 1998:198208.


21. Soule C. Le babesiosi equine. Summa 1997;3:6367.
22. Friedhoff KT, Tenter AM, Muller I. Haemoparasites of equines: im-

Bayly WM, Sellon DC, eds. Equine internal medicine. Philadelphia:

pact on international trade of horses. Rev Sci Tech lOIE 1990;9:

Elsevier; 2004:735.
10. Bose R, Jorgensen WK, Dalgliesh RJ, Friedhoff KT, De Vos AJ. Cur-

23. De Gopegui RR, Penalba B, Goicoa A, Espada Y, Fidalgo LE,

rent state and future trends in the diagnosis of babesiosis. Vet Parasi-

Espino L. Clinico-pathological findings and coagulation disorders

stepoort J Vet 1987;54:561568.

tol 1995;57:6174.

11871194.

in 45 cases of canine babesiosis in Spain. Vet J 2007;174:129132.

11. Hailat NQ, Lafi SQ, Al-Darraji AM, Al-Ani FK. Equine babesiosis as-

24. Zygner W, Gojska O, Rapacka G, Jaros D, Wedrychowicz H. Hema-

sociated with strenuous exercise: clinical and pathological studies in

tological changes during the course of canine babesiosis caused by

Jordan. Vet Parasitol 1997;69:18.

large Babesia in domestic dogs in Warsaw (Poland). Vet Parasitol

12. Torina A, Caracappa S. Babesiosis in Italy: an overview. Parassitologia

2007;145:146151.

2007;49(suppl. 1):2523.
13. Garippa G, Piazza C, Biddau M, Seu W, Arru E. Diffusion and distri-

25. Boozer AL, Macintire DK. Canine babesiosis. Vet Clin North Am:

bution of ticks (Ixodidae) in the provinces of Sassari and Nuoro (Sar-

26. Furlanello T, Fiorio F, Caldin M, Lubas G, Solano-Gallego L. Clin-

dinia). Parassitologia 1998;40(suppl. 1):70.


14. Di Todaro N, Piazza C, Otranto D, Giangaspero A. Ticks infesting
domestic animals in Italy: current acarological studies carried out in

Small Anim Pract 2003;33:885904.


icopathological findings in naturally occurring cases of babesiosis
caused by large form Babesia from dogs of Northeastern Italy. Vet
Parasitol 2005;134:7785.