Appl Microbiol Biotechnol (2014) 98:27092717

DOI 10.1007/s00253-013-5220-3

ENVIRONMENTAL BIOTECHNOLOGY

Comparative metagenomic analysis of bacterial populations

in three full-scale mesophilic anaerobic manure digesters
Benoit St-Pierre & Andr-Denis G. Wright

Received: 15 May 2013 / Revised: 27 August 2013 / Accepted: 28 August 2013 / Published online: 2 October 2013
# Springer-Verlag Berlin Heidelberg 2013

Abstract While the use of anaerobic digestion to generate

methane as a source of bioenergy is increasing worldwide,
our knowledge of the microbial communities that perform
biomethanation is very limited. Using next-generation
sequencing, bacterial population profiles were determined in
three full-scale mesophilic anaerobic digesters operated on
dairy farms in the state of Vermont (USA). To our knowledge,
this is the first report of a metagenomic analysis on the bacterial
population of anaerobic digesters using dairy manure as their
main substrate. A total of 20,366 non-chimeric sequence reads,
covering the V1-V2 hypervariable regions of the bacterial 16S
rRNA gene, were assigned to 2,176 operational taxonomic
units (OTUs) at a genetic distance cutoff value of 5 %. Based
on their limited sequence identity to validly characterized species, the majority of OTUs identified in our study likely represented novel bacterial species. Using a nave Bayesian classifier, 1,624 anaerobic digester OTUs could be assigned to 16
bacterial phyla, while 552 OTUs could not be classified and
may belong to novel bacterial taxonomic groups that have yet
to be described. Firmicutes, Bacteroidetes, and Chloroflexi
were the most highly represented bacteria overall, with
Bacteroidetes and Chloroflexi showing the least and the most
variation in abundance between digesters, respectively. All
digesters shared 132 OTUs, which as a core group represented 65.4 to 70.6 % of sequences in individual digesters. Our
results show that bacterial populations from microbial communities of anaerobic manure digesters can display high levels of
diversity despite sharing a common core substrate.
Keywords 16S rRNA . Metagenomic analysis . Anaerobic
digestion . Bacteria
B. St-Pierre : A.<D. G. Wright (*)
Department of Animal Science, The University of Vermont,
570 Main Street, Burlington, VT 05405, USA
e-mail: agwright@uvm.edu

Introduction
The use of biomethanation as a sustainable strategy to generate
energy by metabolizing a wide range of organic waste types is
increasing worldwide (Rittmann 2008). One of the more commonly used substrate or co-substrate in anaerobic digesters and
biogas plants is cow manure, a mixture of urine, excreta, water,
and bedding material that can accumulate in very large quantities on farms (Holm-Nielsen et al. 2009). Biomethanation
from manure not only contributes to energy production, but
also minimizes locally and globally the environmental impacts
of manure storage (Dhillon and von Wuehlisch 2013). Because
biomethanation is performed by microbial communities, future
improvements in anaerobic manure digester performance to
increase energy outputs could be accomplished by selecting or
manipulating particular groups of microorganisms that populate them. However, communities from anaerobic manure
digesters remain largely uncharacterized, so a deeper understanding of population structure, as well as metabolic properties and interactions, is necessary in order to successfully
improve performance through microbiological manipulation.
Biomethanation is the production of methane from anaerobic
digestion of organic substrates. It is a natural decomposition
process accomplished by complex microbial communities
through their collective metabolic activities, which can be divided into four major categories: hydrolysis, acidogenesis,
acetogenesis, and methanogenesis (Thauer et al. 2008;
Angelidaki et al. 2011). Hydrolysis results in the chemical
release of monomeric subunits from large polymers, such as
cellulose, xylan, proteins, or lipids. Acidogenesis consists in the
fermentation of monosaccharides, amino acids, or fatty acids
into organic acids, which can be further metabolized into simpler compounds, such as acetate, formate, H2, and CO2 as a
result of acetogenesis. These products can be used as substrates
for the synthesis of methane, the last step in the decomposition
of organic matter in oxygen-free environments. A number of

2710

different bacterial groups contribute to hydrolysis, acidogenesis,

or acetogenesis, while methanogenesis is exclusively performed
by methanogenic archaea. Although microorganisms within a
community are specialized, they are each dependent on others
to provide them with substrates and/or to metabolize their
products (Johnson et al. 2012). In order to thrive, each bacterial
or methanogen species also requires a specific combination of
physical and chemical conditions, such as pH, temperature, and
salinity in addition to substrate availability. Thus, while microbial communities from different environments, such as marine
and fresh water sediments, soils, and the gastrointestinal tract of
animals, can perform anaerobic digestion through the same
general steps of hydrolysis, acidogenesis, acetogenesis, and
methanogenesis, their composition tends to vary between environments depending on physical and chemical conditions
(Gudelj et al. 2010).
In the state of Vermont (USA), the construction and operation
of anaerobic manure digesters on dairy farms have increased in
recent years as a result of subsidies, logistical support, and
financial incentives that promote the sale of electricity from
bioenergy. Using next-generation sequencing of 16S rRNA
gene amplicons, we performed a bacterial population profile
analysis from mesophilic anaerobic digesters operated on three
Vermont dairy farms. To our knowledge, this is the first
report of a metagenomic analysis on the bacterial populations of anaerobic digesters using dairy manure as their
main substrate. The overall goal of this study was to
uncover common and distinctive microbial community features
between different sites, which would contribute to the identification of critical bacterial groups involved in anaerobic digestion of manure.

Materials and methods

Anaerobic manure digester sampling
Effluent from anaerobic manure digesters operated on three
dairy farms located in Vermont (USA) was collected during
the month of June 2011: Blue Spruce Farm (BSF; Bridport,
VT), Green Mountain Dairy (GMD; Sheldon, VT), and Chaput
Family Farms (CFF; North Troy, VT). These farms sell electrical
power to Vermont customers through Cow Power, a division
of the utility provider Green Mountain Power (Colchester, VT).
At each farm, a single sample was collected from the effluent as
it exited the digester, at a depth between 0.5 and 1.0 m below the
surface. Samples were maintained on ice after collection, and
stored at 20 C within 2 h. Samples remained frozen until
DNA extraction.
The BSF anaerobic digester is a plug-flow design (GHD
Inc, Chilton, WI, USA) with a capacity of 2.27 million liters. It
is operated at a temperature of 37.8 C, with a retention time of
21 days, and has been running since 2006. While dairy cattle

Appl Microbiol Biotechnol (2014) 98:27092717

manure is the main substrate, whey from a local cheese

processing plant is also used. For the month of June 2011,
the BSF digester generated 1.29105 kWh of electricity.
The GMD anaerobic digester also has a plug-flow design
(GHD Inc, Chilton, WI, USA), with a capacity of 3.8 million
liters. It is operated at 38.3 C, with a retention time of 25
27 days, and has been running since March 2007. Manure from
dairy cattle is the main substrate, but it is also supplemented with
waste from an ice cream factory. For the month of June 2011,
the GMD digester generated 9.49104 kWh of electricity.
The CFF anaerobic manure digester has a complete mix
digester design (RCM International LLC, Berkeley, CA, USA),
with a capacity of 3.43 million liters. It is operated at 36.1 C,
with a retention time of 30 days, and has been running since
August 2010. Dairy cattle manure is the main substrate, with
the addition of oil waste from a fish canning plant as a cosubstrate. For the month of June 2011, the CFF digester
generated 1.42105 kWh of electricity.
Microbial DNA isolation and PCR amplification of 16S
rRNA gene sequences
Microbial DNA from manure digester samples was isolated
using the repeated bead beading plus column (RBB+C) method as described by Yu and Morrison (2004). Bacterial 16S
rRNA genomic sequences containing the hypervariable V1V3 regions were amplified from purified digester microbial
DNA by PCR using one pair of universal primers. The forward primer had the following design (5 to 3): Roche 454
adapter A, four nucleotide barcode, and the 27F primer
(AGAGTTTGATCCTGGCTCAG; Lane 1991). The reverse
primer had the following design (5 to 3): Roche 454
adapter B, four nucleotide barcode, and the 519R primer
(GWATTACCGCGGCKGCTG; Turner et al. 1999). PCR reactions were performed using the iProof Taq DNA polymerase
(BioRad) on a C1000 Thermal Cycler (BioRad) under the
following conditions: hot start (3 min, 98 C), followed by
30 cycles of denaturation (30 s, 98 C), annealing (30 s,
50 C) and extension (30 s, 72 C), and ending with a final
extension period (10 min, 72 C). PCR products were
separated by agarose gel electrophoresis, and amplicons of
the expected size (500 bp) were excised for DNA extraction using the QiaexII Gel extraction kit (Qiagen). Two
hundred nanograms of bacterial 16S rRNA gene amplicons
from each digester was pooled and submitted to the DNA
Sequencing Facility at the University of Pennsylvania
(Philadelphia, PA, USA) for barcoded pyrosequencing using
the Roche 454 platform.
Computational analysis of nucleotide sequences
Computational analysis of bacterial digester sequence reads
was performed using MOTHUR (Schloss et al. 2009). Reads

Appl Microbiol Biotechnol (2014) 98:27092717

2711

corresponding to bacterial 16S rRNA sequences containing

the 27F primer sequence were first selected using trim.flows
(Schloss et al. 2011). The command shhh.flows, MOTHURs
implementation of PyroNoise (Quince et al. 2009), was then
used to screen for high quality sequence reads according to
default quality threshold values, and to create consensus
sequences, which were designated as phylotypes. Since a
very limited number of bacterial sequence reads covered the
entire 27F-519R targeted region of the bacterial 16S rRNA
gene, we selected the conserved sequence GTGTATGAAG
from the Escherichia coli 16S rRNA gene (nucleotide position
403412) as the 3end limit of our target region. Bioinformatics
analysis was then performed using the V1-V2 hypervariable
regions of the bacterial 16S RNA gene. Phylotypes were aligned
using the align.seqs function, and alignments were refined manually based on visual assessment. All chimeric sequences (2.0 %
of phylotypes) detected using the chimera-slayer and uchime
functions were removed from further analysis. Genetic distance
data from the aligned chimera-free bacterial digester phylotypes
were generated using dist.seqs, and used to group phylotypes
into operational taxonomic units (OTU) with the function
cluster, based on a 5 % genetic distance cutoff. From comparing the sequences of valid bacterial species from three
genera (Clostridium, Prevotella, and Streptococcus), we estimated that a genetic distance cutoff of 5 % was a species-level
criteria representative of the genetic variation in 16S rRNA
gene sequences for the V1-V2 hypervariable regions between
bacterial species of the same genus. Taxonomic assignment
for OTUs was performed using the web tool RDP classifier
(Wang et al. 2007). The number of sequence reads corresponding to each OTU in individual digesters was tallied
from the shhh.flows derived name files using custom Perlwritten scripts (available upon request).

Table 1 General characteristics of bacterial population profiles in Vermont anaerobic manure digesters

Phylum

OTUs

OTUs

OTUs

Data accessibility

Acidobacteria
Actinobacteria
Armatimonadetes
Bacteroidetes
Chloroflexi
Fibrobacteres
Firmicutes
Fusobacteria
Lentisphaerae
Planctomycetes

2
50
1
59
1
2
354
1
0
1

0.3
7.6
0.2
9.0
0.2
0.3
54.0
0.2
0.0
0.2

4
40
0
86
22
1
632
2
8
2

0.3
3.4
0.0
7.4
1.9
0.1
54.2
0.2
0.7
0.2

2
28
1
57
11
1
531
0
0
1

0.2
3.1
0.1
6.4
1.2
0.1
59.5
0.0
0.0
0.1

Proteobacteria
Spirochaetes
Synergistetes
Tenericutes
Thermotogae
TM7
Verrucomimicrobia
Unclassified

32
2
6
0
1
2
0
142

4.9
0.3
0.9
0.0
0.2
0.3
0.0
21.6

29
4
11
1
2
2
4
316

2.5
0.3
0.9
0.1
0.2
0.2
0.3
27.1

19
2
9
0
1
2
4
223

2.1
0.2
1.0
0.0
0.1
0.2
0.4
25.0

Primary sequence data are available from the NCBI Sequence

Read Archive (run SRR768352 of experiment SRX246946).
The four nucleotide digester-specific barcodes used were:
GGCC (BSF), AACC (GMD), and AATT (CFF).

Results
Combined OTU analysis of bacterial populations in anaerobic
manure digesters
A total of 20,366 non-chimeric sequence reads spanning the
V1-V2 region of the bacterial 16S rRNA gene were recovered
from the effluent of three Vermont Dairy manure digesters
(Table 1). These sequence reads were found to correspond to
5,924 unique bacterial sequences or phylotypes. Bacterial
diversity was assessed by performing an OTU clustering

Digester

Readsa

Total OTUs

Unique OTUsb

Shared OTU
readsc (%)

BSF
GMD
CFF

3,767
6,745
9,854

656
892
1,166

394
560
820

70.6
65.4
65.5

Number of chimera-free sequence reads used for determining the population profile

Number of OTUs with only one single sequence read

Percentage of sequence reads belonging to OTUs shared between all

sampled digesters

analysis at a 5 % genetic distance cutoff, revealing a total of

2,176 OTUs from all digester bacterial sequences. From these,
1,624 OTUs were assigned to 16 validly recognized bacterial
phyla, while 552 OTUs (2,438 combined sequence reads)
were designated as unclassified (Table 2).
Bacteria assigned to the phylum Firmicutes were found to
be the most diverse and abundant group in the sampled dairy
manure digesters, with 1,215 OTUs representing 8,654 of
combined sequence reads. A number of highly represented
OTUs in this category were closely related to species of the
genus Clostridium . OTU 5 (4.3 % of combined sequence
reads) and OTU 10 (1.9 % of combined sequence reads)
showed 95.7 and 97.2 % sequence identity, respectively, to
Clostridium lituseburense. Other more distantly related OTUs
Table 2 Number of OTUs per bacterial phyla
BSF

CFF

GMD

2712

included OTU 4 (5.2 % of combined sequence reads) with

86.5 % sequence identity to Clostridium alkalicellum, OTU 8
(4.1 % of combined sequence reads) with 85.1 % sequence
identity to Clostridium thermocellum, and OTU 9 (3.1 % of
combined sequence reads) with 87.0 % sequence identity to
Clostridium cellobioparum.
In addition to Clostridia, other classes of Firmicutes were
also identified. OTU 11 (1.5 % of combined sequence reads)
was assigned to class Erysipelotrichia because of its 98.9 %
sequence identity to Turicibacter sanguinis. OTU 17 was likely
a member of the class Bacilli, because its closest valid relative
was Paucisalibacillus globulus (85.2 % sequence identity).
Bacteroidetes was the second most diverse and abundant
phylum in anaerobic manure digesters from Vermont, with
151 OTUs and 5,544 combined sequence reads. OTU 2 and
OTU 7, representing 6.0 and 4.3 % of combined sequence
reads, respectively, were assigned to the class Bacteroidia, but
showed very limited sequence identity to valid bacterial species. OTU 3 (5.2 % of combined sequence reads) and OTU 6
(4.3 % of combined sequence reads) were also likely novel
species since they could not be assigned to any currently
known classes of Bacteroidetes.
Chloroflexi was also a well represented phylum, with 2,567
sequence reads distributed between 30 OTUs, including OTU
1, which was the most highly represented in this study. OTU 1
was closely related to members of the family Anaerolineaceae,
which consists of five genera each represented by a single
species. OTU 1 likely belonged to a novel genus in this family,
since its genetic distance from any Anaerolineaceae species for
the 16S rRNAV1-V2 region was 12.919.1 %. In comparison,
the genetic distance between valid Anaerolineaceae species
ranged from 10.5 to 18.6 %.
Other phyla identified in the sampled digesters included
Actinobacteria (93 OTUs, 222 reads), Proteobacteria (69
OTUs, 173 reads), Synergistetes (18 OTUs, 248 reads),
Lentisphaerae (8 OTUs, 18 reads), Verrumicrobia (8 OTUs,
53 reads), Acidobacteria (6 OTUs, 144 reads), Spirochaetes
(6 OTUs, 29 reads), Thermotogae (4 OTUs, 18 reads),
Planctomycetes (3 OTUs, 196 reads), Armatimonadetes
(2 OTUs, 6 reads), Fibrobacteres (2 OTUs, 45 reads),
Fusobacteria (2 OTUs, 4 reads), and Tenericutes (1 OTU,
1 read). Four OTUs (7 sequence reads) were assigned to TM7,
a large group of sequences obtained from environmental
samples that cluster as a major bacterial lineage, but that has
yet to be validly assigned to a phylum.

Appl Microbiol Biotechnol (2014) 98:27092717

81.4 % of sequences in the CFF digester (Fig. 1). Of the three

phyla, Bacteroidetes showed the least variation in abundance,
with a frequency ranging between 25.4 and 29.5 %.
Representation of the Chloroflexi was far more variable,
ranging from 0.4 % (BSF) to 5.9 % (GMD) and 21.9 %
(CFF). All sampled digesters had a similar proportion of
unclassified bacteria.
For the minor phyla, a similar overlap in profile could also be
observed, with Actinobacteria, Acidobacteria, Proteobacteria,
and Synergistetes each found within a similar range in all
digesters. Planctomycetes appeared to be the exception as they
were almost exclusively found in the CFF digester, with only
three combined sequence reads recovered from the BSF and
GMD digesters.
At the OTU level, 132 OTUs were shared between all
sampled digesters, and as a core group represented 65.4
70.6 % of sequences in each digester (Table 1). OTU 2, OTU
3, OTU 4, OTU 5, OTU 7, OTU 8, OTU 9, and OTU 11 were
the most prevalent of the shared OTUs that were also identified
at frequencies within a similar range in all digesters (Fig. 2).
Bacterial profiles were found to be far more diverse at the OTU
level, as indicated by the predominance of digester-specific
OTUs (60.170.3 %; Table 1), which also included wellrepresented OTUs. For instance, OTU 1 (Chloroflexi) and
OTU 6 (Bacteroidetes) combined for 29.9 % of CFF sequences
and were almost exclusive, as very few sequence reads were
recovered from the other digesters. While the BSF and GMD
digesters shared very similar representation (43.6 and 43.5 %) of
the eight core OTUs mentioned above, their OTU profiles were
also distinct. In the BSF digester, OTU 8 (Firmicutes) was the
most highly represented group with 13.0 % of sequence reads.
This digester also had three OTUs (24, 41, and 51), representing
6 % of BSF sequence reads with little or no detection in the
other digesters. For the GMD digester, OTU 3 (Bacteroidetes)
and OTU 4 (Firmicutes) were the most highly represented at 8.9
and 8.8 %, respectively. Some distinctive features of the GMD

Comparative analysis of bacterial population profiles

among manure anerobic digesters
Overall, Firmicutes, Bacteroidetes, and Chloroflexi were the
most highly represented phyla in the anaerobic digesters,
together accounting for 81.9 % of sequences in the BSF
digester, 84.0 % of sequences in the GMD digester, and

Fig. 1 Bar graph diagram showing the phylogenetic representation of

bacteria in the anaerobic manure digesters investigated: Blue Spruce
Farms (BSF), Green Mountain Dairy (GMD), and Chaput Family Farms
(CFF). Taxonomic assignments were obtained using RDP classifier
(Wang et al. 2007)

Appl Microbiol Biotechnol (2014) 98:27092717

BSF

GMD

2713
Table 3 Taxonomic assignment for select OTUs identified in anaerobic
manure digesters
OTU Taxa (phylumclass)

OTU Taxa (phylumclass)

ChloroflexiAnaerolinea

17

FirmicutesBacilli

BacteroidetesBacteroidia

18

FirmicutesClostridia

Bacteroidetesunclassified

19

FirmicutesClostridia

FirmicutesClostridia

20

AcidobacteriaAcidobacteria

FirmicutesClostridia

21

unclassified

Bacteroidetesunclassified

22

Bacteroidetesunclassified

BacteroidetesBacteroidia

23

ChloroflexiAnaerolinea

FirmicutesClostridia

24

unclassified

FirmicutesClostridia

25

FirmicutesClostridia

10

FirmicutesClostridia

26

FirmicutesClostridia

11

FirmicutesErysipelotrichia 27

BacteroidetesBacteroidia

12

ChloroflexiAnaerolinea

28

FirmicutesClostridia

13

Bacteroidetesunclassified

29

FirmicutesClostridia

14

Bacteroidetesunclassified

36

unclassified

15

Bacteroidetesunclassified

41

unclassified

16

Plantomycetesunclassified

51

unclassified

bacterial population structure were OTUs 12 and 23, assigned to

the phylum Chloroflexi, as well as OTU 14 (Bacteroidetes),
OTU 25 (Firmicutes), and OTU 36 (unclassified).

Discussion

CFF

Bacteroidetes, Firmicutes, and Chloroflexi were identified as

the major bacterial phyla from the three Vermont anaerobic
manure digesters. Bacteroidetes showed the least variability
in representation between digesters (Fig. 1), and most
sequences in this groups either belonged to class Bacteroidia
or could only be designated as unclassified Bacteroidetes
(Tables 3 and 4). With five families and 33 genera, Bacteroidia
are a very diverse group, capable of metabolic activities such
Table 4 Frequency (percentage) of sequence reads within classes of
Bacteroidetes and Firmicutes in Vermont anaerobic manure digesters

Fig. 2 Pie chart diagrams showing the OTU profiles of bacterial populations in the BSF, GMD, and CFF anaerobic manure digesters analyzed.
Taxonomic assignments for specific OTUs are shown in Table 3

Phylum

BSF

CFF

GMD

Bacteroidetes
Bacteroidia
Flavobacteriia
unclassified
Firmicutes
Bacilli
Clostridia
Erysipelotrichia
Negativicutes
unclassified

29.5
15.7
0.1
13.7
52.0
1.5
44.4
2.3
0.1
3.7

25.4
10.4
0.0
15.1
34.1
1.0
25.7
1.7
0.1
5.5

28.6
14.5
0.0
14.1
49.5
0.8
42.7
2.6
0.1
3.2

2714

as hydrolysis of polysaccharides and proteins, fermentation of

sugars, and production of VFAs (Krieg et al. 2011). Digester
bacteria assigned to this group, such as OTU 2 and OTU 7
for example, would then be predicted to participate in hydrolysis and acidogenesis during biomethanation. Unclassified
Bacteroidetes also represented a significant proportion of
bacteria, ranging from 13.7 to 15.1 % in individual digesters
(Table 4). While their role in biomethanation was more
difficult to predict, the prevalence of certain OTUs, such as
OTU 3 in all digesters and OTU 6 in the CFF digester, suggested
a significant contribution to anaerobic digestion of manure that
warrants further investigation.
Firmicutes was the most highly represented phylum in all
digesters. Bacteria from this group were represented within a
similar range in the BSF and GMD digesters (52.0 and 49.5 %,
respectively), but at a lower frequency in the CFF digester
(34.1 %). While five different classes of Firmicutes were identified, sequences belonging to class Clostridia were by far the
most predominant group of Firmicutes (Table 4). Since many
species belonging to Clostridia produce cellulosomes, this type
of digester bacteria was predicted to participate in hydrolysis of
plant fibers (Schwarz 2001; Lynd et al. 2002).
In the present study, the high frequency of digester bacteria
affiliated to class Clostridia was consistent with undigested
plant fibers representing a large portion of the energy
available in manure for methane production. The lower
frequency of Clostridia in the CFF digester was then an
intriguing observation. The CFF digester instead showed
the highest representation (21.9 %) of bacteria assigned to
the class Anaerolinea, phylum Chloroflexi. Based on the
properties of individual species that have been reported,
members of the class Anaerolinea are saccharolytic anaerobes
that can metabolize polysaccharides such as pectin and
xylan (Yamada et al. 2006, 2007). Thus, they could potentially be functionally equivalent to Clostridia species that
are more highly represented in the BSF and GMD digesters.
Interestingly, some Anaerolinea species require syntrophic
association with hydrogenotrophic methanogens for efficient
growth (Sekiguchi et al. 2001, 2003; Yamada et al. 2005,
2006). We have recently reported (St-Pierre and Wright 2013)
a metagenomic investigation of the methanogen populations
from the same digester samples described in this study. We
found that 74 % of CFF methanogens were hydrogenotrophic,
while the predominant methanogens in the BSF and GMD
digesters (98.5 and 99.7 % of sequence reads, respectively)
belonged to a single species-level OTU closely related to
acetotrophic species of the genus Methanosarcina. While the
extent of the metabolic potential of the class Anaerolinea still
likely remains to be determined, digester Chloroflexi could be
involved in hydrolysis, acidogenesis, and acetogenesis, and be
associated with digester hydrogenotrophic methanogens.
However, the physical, chemical, and/or biological conditions
that were favorable to Chloroflexi in the CFF digester still

Appl Microbiol Biotechnol (2014) 98:27092717

remain to be determined. Likewise, the conditions favorable to

the high prevalence of a single methanogen OTU in the BSF and
GMD digesters remain to be determined. While manure from
dairy cattle was the main substrate used for biomethanation in
the Vermont digesters sampled in this study, it was supplemented
with other biomass, such as whey (mostly carbohydrates) for
BSF, waste from an ice cream factory (complex mixture of
proteins, carbohydrates, and lipids) for GMD, or fish oil for
CFF. The type of co-substrate used could then have directly or
indirectly favored bacterial species from different phylogenetic groups that can perform similar metabolic activities.
Alternatively, other factors such as temperature, digester design, or hydraulic retention time could also have been involved.
At the OTU level, we identified 132 core OTUs which
were found in all digesters. Due to their combined high
representation in individual digesters, eight of the shared
OTUs could represent targets for future microbiological manipulation with the aim of increasing digester performance.
Five belonged to Firmicutes , while three were assigned
to Bacteroidetes. Based upon nucleotide sequence identity,
OTU 11 (98.9 % to T. sanguinis) and OTU 5 (95.7 % to
C. lituseburense) corresponded to bacterial species that have
already been characterized. However, all other core OTUs
represented novel species, emphasizing the extent of the gaps
in our knowledge of bacterial populations participating in
biomethanation of manure in anaerobic digesters. Further
investigations on core bacterial OTUs, such as culturing,
determination of growth requirements, characterization of
metabolic activity, and ultimately sequencing of their genomic
information would greatly improve our knowledge of manure
digester bacterial populations and their function.
With its high sequence read throughput, next-generation
sequencing greatly improves depth of coverage in metagenomic
investigations of bacterial populations, thus increasing the
likelyhood of detecting low abundance species, and resulting
in the identification of a higher number of OTUs. However,
next-generation sequencing platforms are limited by the
sequence read length they can provide. In the case of the
16S rRNA gene, they are unable to provide the sequence of
its nine hypervariable (V1-V9) regions in full-length individual amplicons. A necessary compromise is to select a
sub-region of the 16S rRNA gene to represent the variability of
corresponding full length sequences. We selected the V1-V2
region based on the in silico analysis of Kim et al (2011) who
reported that V1-V3 region sequences could be clustered in a
number of OTUs that closely matched the number of OTUs
from their corresponding full-length (V1-V9) clones at the
same genetic distance cutoff. It is unclear at the moment to
what extent clustering from a sub-region affects OTU estimates
for 16S rRNA. Such information will require further improvements in sequencing technology.
In a meta-analysis study by Nelson et al. (2011), bacterial
diversity in anaerobic digesters was assessed by analyzing

Appl Microbiol Biotechnol (2014) 98:27092717

near full-length 16S rRNA gene sequences available from

public databases. Their investigation revealed that the
majority of bacterial 16S rRNA sequences identified from
digesters were distributed between Bacteroidetes (711 OTUs,
14.7 % of sequences), Chloroflexi (723 OTUs, 22.7 % of gene
sequences), Firmicutes (1320 OTUs, 15.4 % of sequences),
and Proteobacteria (1614 OTUs, 21.7 % of sequences). In the
Vermont anaerobic manure digesters sampled, Bacteroidetes,
Chloroflexi, and Firmicutes were the most prevalent phyla,
whereas the phylum Proteobacteria was only identified at a
frequency of 0.51.0 %. Nelson et al. (2011) also highlighted
differences in diversity between particular groups of bacteria,
such as a relatively higher ratio of sequences per OTU for
Chloroflexi and Bacteroidetes compared to Firmicutes and
Proteobacteria. Our results were consistent with this observation, as we found that 2,567 Chloroflexi sequence reads were
grouped between 30 OTUs, 5,544 Bacteroidetes sequence
reads were assigned to 151 OTUs, and 8,654 Firmicutes
sequence reads were distributed between 1,215 OTUs.
It has become apparent that multiple factors, including the
nature of the substrate, anaerobic digester design, and operational
parameters, can impact the structure or profile of microbial
communities (Demirel and Scherer 2008). From the available
reports on bacterial population profiles in anaerobic digesters, we
found the highest level of similarity or overlap for dairy manure
with swine manure. A 16S rRNA gene clone library study from
a full-scale biogas plant using swine manure as sole substrate
revealed that Firmicutes (46.5 %), Bacteroidetes (35.2 %), and
Spirochaetes (13.2 %) were the most prevalent phyla (Liu et al.
2009). In a laboratory-scale investigation of co-digesting swine
manure with feathers, the representation of Firmicutes was
higher, with 61 % of 16S rRNA gene sequences belonging to
class Clostridia, while 37 % of sequences were assigned to
Bacteroidetes (Xia et al. 2011).
A certain degree of phylogenetic overlap in bacterial population profiles could also be observed between studies involving
anaerobic digestion of plant biomass. A very diverse bacterial
population was identified in laboratory-scale digesters that
treated beet silage as a mono-substrate, with Firmicutes ,
consisting of Clostridia and Bacilli clones each present at
22 %, Proteobacteria (24 %), and Bacteroidetes (21 %)
(Klocke et al. 2007). When carrot waste was used as a
substrate, Firmicutes clones were also the most prevalent,
consisting of 43.4 % Bacilli and 7.2 % Clostridia, followed
by Bacteroidetes (30.4 %) and the Spirochaetes (13.0 %)
(Garcia et al. 2011). In a full-scale biogas plant treating a
mixture of co-substrates (63 % maize silage, 35 % green rye,
2 % chicken manure), Jaenicke et al. (2011) found using a
metagenomic approach that bacterial populations consisted of
Firmicutes (35.537.7 %), Proteobacteria (17.920.4 %),
and Bacteroidetes (6.18.1 %).
Waste products from ethanol production have also been
investigated as substrates for biomethanation. In laboratory-

2715

scale anaerobic digesters testing the potential of dried distillers

grains with solubles, Bacteroidetes was found overall to be
the dominant bacterial phylum (Ziganshin et al. 2011). The
phyla Actinobacteria , Firmicutes , and Synergistetes were
also significantly represented, but their frequency varied
greatly between individual digesters. From their extensive
metagenomic study of nine biogas plant treating brewery
wastewater, Werner et al. (2011) identified Proteobacteria,
Spirochaetes, Bacteroidetes , and Firmicutes as overall codominant phyla in their study.
Substrates such as household and municipal waste, or
municipal wastewater, have been reported to support a variety
of bacterial profiles, which is likely due to their variable
chemical composition. For instance, Firmicutes (68.0 %),
followed by Proteobacteria (23.5 %), were the prevalent
bacterial clones from microbial communities selected for the
anaerobic digestion of household waste in laboratory-scale
biogas systems (Cardinali-Rezende et al. 2009). In contrast, a
later study by the same group revealed the prevalence of
Bacteroidetes (84 % of bacterial clones) in a full-scale
mesophilic digester treating municipal solid waste (CardinaliRezende et al. 2012). In sludge sampled from municipal
wastewater treatment plants, independent studies on different
facilities reported very distinct bacterial profiles. From their
investigation of seven facilities, Rivire et al. (2009) determined that Chloroflexi were overall the most prominent group
(32 %), while Proteobacteria (18 %), Bacteroidetes (11 %),
and Firmicutes (9 %) represented minor phyla. In contrast,
Chouari et al. (2010) observed less phylogenetic diversity in
their analysis of a municipal wastewater treatment plant, with
Proteobacteria (69.5 %) and Bacteroidetes (15.7 %) identified
as the most prevalent groups.
Thus, there is a limited level of overlap between the bacterial population structure of Vermont manure digesters and
taxonomic profiles previously reported by other groups on
anaerobic digesters. The highest degree of similarity was when
swine manure was used as a substrate (Liu et al. 2009; Xia et al.
2011), highlighting the importance of substrate on bacterial
population structure in anaerobic digesters. This suggests that
improving biomethanation yields through manipulating microbial population performance may require targeting different
bacterial groups depending on the substrate used.
Anaerobic digestion of organic waste to produce renewable
energy is becoming more popular worldwide. While its main
benefit is currently as an effective waste disposal method
rather than a source of revenue, its profitability is expected
to grow, as costs of other energy sources increase and with
the possible implementation of climate policy incentives such as
carbon tax or credits (Zaks et al. 2011). Improving our knowledge base on microbial populations involved in biomethanation
from a variety of substrates is a necessary step towards engineering microbiological improvements to benefit energy yields
and economic return.

2716
Acknowledgments Funding for this project was provided through a
VT-REAP grant from the Vermont Agency of Agriculture, Food and
Markets. The authors would also like to thank the Vermont dairy farm
owners involved in this study for their collaboration: Eugene and Marie
Audet (Blue Spruce Farms), Brian and Bill Rowell (Green Mountain Dairy),
as well as Reg and Mike Chaput (Chaput Family Farms).
Conflict of interest The authors declare that they have no conflict of
interest.

References
Angelidaki I, Karakashev D, Batstone DJ, Plugge CM, Stams AJ (2011)
Biomethanation and its potential. Methods Enzymol 494:327351
Cardinali-Rezende J, Debarry RB, Colturato LF, Carneiro E, ChartoneSouza E, Nascimento AM (2009) Molecular identification and
dynamics of microbial communities in reactor treating organic
household waste. Appl Microbiol Biotechnol 84:777789
Cardinali-Rezende J, Colturato LFDB, Colturato TDB, Chartone-Souza
E, Nascimento AMA, Sanz JL (2012) Prokaryotic diversity and
dynamics in a full-scale municipal solid waste anaerobic reactor
from start-up to steady-state conditions. Bioresour Technol 119:
373383
Chouari R, Le Paslier D, Daegelen P, Dauga C, Weissenbach J, Sghir A
(2010) Molecular analyses of the microbial community composition
of an anoxic basin of a municipal wastewater treatment plant reveal
a novel lineage of Proteobacteria. Microb Ecol 2010:272281
Demirel B, Scherer P (2008) The roles of acetotrophic and hydrogenotrophic
methanogens during anaerobic conversion of biomass to methane: a
review. Rev Environ Sci Biotechnol 7:173190
Dhillon RS, von Wuehlisch G (2013) Mitigation of global warming
through renewable biomass. Biomass Bioenergy 48:7589
Garcia SL, Jangid K, Whitman WB, Das KC (2011) Transition of
microbial communities during the adaption to anaerobic digestion
of carrot waste. Bioresour Technol 102:72497256
Gudelj I, Weitz JS, Ferenci T, Horner-Devine MC, Marx CJ, Meyer JR,
Forde SE (2010) An integrative approach to understanding microbial
diversity: from intracellular mechanisms to community structure. Ecol
Lett 13:10731084
Holm-Nielsen JB, Al Seadi T, Oleskowicz-Popiel P (2009) The future of
anaerobic digestion and biogas utilization. Bioresour Technol 100:
54785484
Jaenicke S, Ander C, Bekel T, Bisdorf R, Drge M, Gartemann KH,
Jnemann S, Kaiser O, Krause L, Tille F, Zakrzewski M, Phler A,
Schlter A, Goesmann A (2011) Comparative and joint analysis of
two metagenomic datasets from a biogas fermenter obtained by 454pyrosequencing. PLoS One 6:e14519
Johnson DR, Goldschmidt F, Lilja EE, Ackermann M (2012) Metabolic
specialization and the assembly of microbial communities. ISME J
6:19851991
Kim M, Morrison M, Yu Z (2011) Evaluation of different partial 16S
rRNA gene sequence regions for phylogenetic analysis of
microbiomes. J Microbiol Methods 84:8187
Klocke M, Mhnert P, Mundt K, Souidi K, Linke B (2007) Microbial
community analysis of a biogas-producing completely stirred tank
reactor fed continuously with fodder beet silage as mono-substrate.
Syst Appl Microbiol 30:139151
Krieg NR, Staley JT, Brown DR, Hedlund BP, Paster BJ, Ward N,
Ludwig W, Whitman WB (eds) (2011) Bergeys manual of systematic
bacteriology, 2nd edn, vol 4 (The Bacteroidetes, Spirochaetes,
Tenericutes (Mollicutes), Acidobacteria, Fibrobacteres, Fusobacteria,
Dictyoglomi, Gemmatimonadetes, Lentisphaerae, Verrucomicrobia,
Chlamydiae, and Planctomycetes). Springer, New York

Appl Microbiol Biotechnol (2014) 98:27092717

Lane DJ (1991) 16S/23S rRNA sequencing. In: Stackebrandt E,
Goodfellow M (eds) Nucleic acid techniques in bacterial systematics. Wiley, New York, pp 115175
Liu FH, Wang SB, Zhang JS, Zhang J, Yan X, Zhou HK, Zhao GP, Zhou
ZH (2009) The structure of the bacterial and archaeal community in
a biogas digester as revealed by denaturing gradient gel electrophoresis and 16S rDNA sequencing analysis. J Appl Microbiol 106:
952966
Lynd LR, Weimer PJ, van Zyl WH, Pretorius IS (2002) Microbial
cellulose utilization: fundamentals and biotechnology. Microbiol
Mol Biol Rev 66:506577
Nelson MC, Morrison M, Yu Z (2011) A meta-analysis of the microbial
diversity observed in anaerobic digesters. Bioresour Technol 102:
37303739
Quince C, Lanzn A, Curtis TP, Davenport RJ, Hall N, Head IM, Read
LF, Sloan WT (2009) Accurate determination of microbial diversity
from 454 pyrosequencing data. Nat Methods 6:639641
Rittmann BE (2008) Opportunities for renewable bioenergy using microorganisms. Biotechnol Bioeng 100:203212
Rivire D, Desvignes V, Pelletier E, Chaussonnerie S, Guermazi S,
Weissenbach J, Li T, Camacho P, Sghir A (2009) Towards the
definition of a core of microorganisms involved in anaerobic digestion of sludge. ISME J 3:700714
Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB,
Lesniewski RA, Oakley BB, Parks DH, Robinson CJ, Sahl JW, Stres
B, Gerhard G (2009) Introducing mothur: open-source, platformindependent, community-supported software for describing and
comparing microbial communities. Appl Environ Microbiol 75:
75377541
Schloss PD, Gevers D, Westcott SL (2011) Reducing the effects of PCR
amplification and sequencing artifacts on 16S rRNA-based studies.
PLoS One 6:e27310
Schwarz WH (2001) The cellulosome and cellulose degradation by
anaerobic bacteria. Appl Microbiol Biotechnol 56:634649
Sekiguchi Y, Takahashi H, Kamagata Y, Ohashi A, Harada H (2001) In situ
detection, isolation, and physiological properties of a thin filamentous
microorganism abundant in methanogenic granular sludges: a novel
isolate affiliated with a clone cluster, the green nonsulfur bacteria,
subdivision I. Appl Environ Microbiol 67:57405749
Sekiguchi Y, Yamada T, Hanada S, Ohashi A, Harada H, Kamagata Y
(2003) Anaerolinea thermophila gen. nov., sp. nov. and Caldilinea
aerophila gen. nov., sp. nov., novel filamentous thermophiles that
represent a previously uncultured lineage of the domain bacteria at
the subphylum level. Int J Syst Evol Microbiol 53:18431851
St-Pierre B, Wright A-DG (2013) Metagenomic analysis of methanogen
populations in three full-scale mesophilic anaerobic manure digesters
operated on dairy farms in Vermont, USA. Bioresour Technol 138:
277284
Thauer RK, Kaster A-K, Seedorf H, Buckel W, Hedderich R (2008)
Methanogenic archaea: ecologically relevant differences in energy
conservation. Nat Rev Microbiol 6:579591
Turner S, Pryer KM, Miao VPW, Palmer JD (1999) Investigating deep
phylogenetic relationships among cyanobacteria and plastids by
small subunit rRNA sequence analysis. J Eukaryot Microbiol 46:
327338
Wang Q, Garrity GM, Tiedje JM, Cole JR (2007) Nave bayesian classifier for rapid assignment of rRNA sequences into the new bacterial
taxonomy. Appl Environ Microbiol 73:52615267
Werner JJ, Knights D, Garcia ML, Scalfone NB, Smith S, Yarasheski K,
Cummings TA, Beers AR, Knight R, Angenenta LT (2011) Bacterial
community structures are unique and resilient in full-scale bioenergy
systems. Proc Natl Acad Sci U S A 108:41584163
Xia Y, Masse DI, McAllister TA, Beaulieu C, Talbot G, Kong Y, Seviour
R (2011) In situ identification of keratin-hydrolyzing organisms in
swine manure inoculated anaerobic digesters. FEMS Microbiol Ecol
78:451462

Appl Microbiol Biotechnol (2014) 98:27092717

Yamada T, Sekiguchi Y, Imachi H, Kamagata Y, Ohashi A, Harada H
(2005) Diversity, localization and physiological properties of filamentous microbes belonging to Chloroflexi subphylum I in
mesophilic and thermophilic methanogenic sludge granules. Appl
Environ Microbiol 71:74937503
Yamada T, Sekiguchi Y, Hanada S, Imachi H, Ohashi A, Harada H,
Kamagata Y (2006) Anaerolinea thermolimosa sp. nov., Levilinea
saccharolytica gen. nov., sp. nov. and Leptolinea tardivitalis gen.
nov., sp. nov., novel filamentous anaerobes, and description of the
new classes Anaerolineae classis nov. and Caldilineae classis nov.
in the bacterial phylum Chloroflexi. Int J Syst Evol Microbiol 56:
13311340
Yamada T, Imachi H, Ohashi A, Harada H, Hanada S, Kamagata Y,
Sekiguchi Y (2007) Bellilinea caldifistulae gen. nov., sp. nov. and

2717
Longilinea arvoryzae gen. nov., sp. nov., strictly anaerobic, filamentous bacteria of the phylum Chloroflexi isolated from methanogenic
propionate-degrading consortia. Int J Syst Evol Microbiol 57:
22992306
Yu Z, Morrison M (2004) Improved extraction of PCR-quality community
DNA from digesta and fecal samples. Biotechniques 36:808812
Zaks DPM, Winchester N, Kucharik CJ, Barford CC, Paltsev S, Reilly
JM (2011) Contribution of anaerobic digesters to emissions mitigation and electricity generation under U.S. Climate Policy. Environ
Sci Technol 45:67356742
Ziganshin AM, Schmidt T, Scholwin F, Ilinskaya ON, Harms H,
Kleinsteuber S (2011) Bacteria and archaea involved in anaerobic
digestion of distillers grains with solubles. Appl Microbiol Biotechnol
89:20392052