Beruflich Dokumente
Kultur Dokumente
h
Healt
Dramat
ic
Movement
Social Studie
s
sic
u
M
Math
Writi
ng
Rea
din
g
Blocks
es
v
i
at
l
u
e
c
n
e
i
c
S
ip
n
y
a
g
o
l
M
T echno
Art
cy
a
r
e
Fiel
Lit
d
Trip
Cooking
s
e
T im
e
l
Sen
c
ch
n
e
C ir
b
k
sor
r
Wo
y
Independent School District of Boise City
Table of Contents
Black-line Masters
Materials for:
-----Kindergarten Registration
-----Kindergarten Orientation
-----Parent Teacher Conferences
-----Kindergarten Assessment
Learning Processes
How Children Learn
Develop a positive self-concept and attitude toward learning, self-control, and a sense of
belonging;
Develop curiosity about the world, confidence as a learner, creativity and imagination, and
personal initiative;
Develop relationships of mutual trust and respect with adults and peers, understand
perspectives of other people, and negotiate and apply rules of group living;
Understand and respect social and cultural diversity - know about the community and social
roles;
Become literate individuals who gain satisfaction, as well as information, from reading and
writing;
Represent ideas and feelings through pretend play, drama, dance and movement, music, art
and construction;
Construct knowledge of the physical world, manipulate objects for desired effects and
understand cause-and-effect relationships;
Acquire knowledge of and appreciation for the fine arts, humanities, and sciences;
Become competent in management of their bodies and acquire basic physical skills, both
gross motor and fine motor; and
Gain knowledge about the care of their bodies and maintain a desirable level of health and
fitness.
The curriculum objectives should be based on the best knowledge of theory, research,
and practice about how children develop and learn, with attention given to the individual needs
and interests in a group in relation to the kindergarten program goals.
! Intrapersonal: Students will excel at understanding their own personal feelings and will use
their feelings to guide their behavior.
Multiple Intelligences fit nicely into a development program because this kind of program
strives to acknowledge the different ways in which students learn and excel. Learning centers
can meet the needs of all learners if the eight Multiple Intelligences are considered in the
development of centers. Examples of how Multiple Intelligences may fit into centers are listed
here:
The Art Center- The art center allows children to show what they know and express
their feelings through their art work. This center builds the Spatial, Interpersonal, and
Intrapersonal Intelligences.
The Block Center- This center allows children to use and develop their Bodily
Kinesthetic and Spatial Intelligence as they use gross motor skills to build structures.
Planning with other children requires them to use their Verbal-Linguistic and
Interpersonal intelligences.
The Dramatic Play Center- This center uses and develops childrens Interpersonal and
Verbal-Linguistic Intelligences as children interact and role-play with one another.
Students also use Bodily-Kinesthetic Intelligence as they move through space.
The Library/ Listening Center- Verbal-Linguistic Intelligence is used in this center as
children listen to, read, and write stories. Musical Intelligence is also being developed
through the music heard in the listening center.
The Writing Center- Students who enjoy expressing themselves in writing will be using
and developing their Intrapersonal Intelligence.
The Manipulative Center- Logical-Mathematics and Bodily-Kinesthetic intelligences
are developed as children work together with small building materials, beads, puzzles and
other manipulatives.
The Sensory Table/Science Center- This center develops Logical-Mathematical and
Naturalist Intelligences as children measure and explore the properties of natural
substances such as water and sand.
Curriculum Content
What Children Learn
Curriculum Content
What Children Learn
!
!
!
!
!
!
!
!
!
Art
Health
Language Arts
Math
Music
Physical Education
Science
Social Studies
Technology
Art
Art can become a means of communication for the kindergarten child. The art
objectives in a developmental kindergarten are devoted to this freedom of expression.
This flexibility allows the teacher to design strategies to meet art objectives that can
apply to almost all other areas of the curriculum. As learning takes place, there should
always be an art form available to children to enhance and help demonstrate mastery of a
skill. That skill may involve discoveries in science, health concepts, writing, social
studies, dramatic play or music.
Art Objectives
The student will be able to:
#
describe the primary color combinations to make green, orange and purple
Health
Within a developmental kindergarten program, health objectives are integrated
into appropriate activities across the curriculum. Strategies for teaching these objectives
can be found primarily in dramatic play centers, circle time activities, writing
opportunities and cooking experiences. In addition, many of the objectives may be
covered in, and supported by, programs offered through the school nurse and school
counselor.
Health Objectives
The student will be able to:
Language Arts
The language arts curriculum integrates easily into many areas of a developmental
kindergarten program. Specific language arts skills can be presented in many forms.
Many literacy objectives may be presented whole group such as shared reading,
interactive writing, language experience activities, authors chair and pattern book
lessons. The objectives may also be presented in center-type activities that correlate with
other centers such as creating a shopping list (writing center) and then using the list to
shop in the grocery store (dramatic play). Music, rhythm and creative movement
strategies are often extensions of a language arts lesson. Art activities are a crucial part
of the writing curriculum when children write and then illustrate their own work or class
book projects. Finally, language arts objectives can be developed with technology as
children learn basic word processing skills and apply them to reading and writing
activities.
Reading
Phonemic Awareness:
$ identify and/or name two or more words that rhyme through completion, production
and recognition activities
$ orally segment sentences into words, syllables into sounds and words into syllables
and/or sounds
$ orally blend phonemes into words
Phonics:
$ recognize names of upper and lower case letters
$ associate letters to letter sounds
$ identify beginning, ending and middle letters in a word
Concepts About Print:
$ identify front of book, title page, table of contents, attend to print, know where to start
reading
$ move left to right, return sweep and match word by word
$ understand first/last of text, top/bottom, order of pages and left/right page
$ identify picture clues and story language
$ identify one or two letters, match upper/lower case and first/last letter in a word
$ discriminate between illustration and text
$ recognize that letters can have different fonts
Reading Strategies:
$ engage personal schema to discuss, generate questions and predict outcomes
$ use picture, pattern and beginning letter sound to identify words and gain meaning
from text
$ use environmental print to locate sources for finding words
Comprehension:
$ offer relevant background information during pre-reading and demonstrate
understanding of vocabulary during post-discussion
$ identify and retell a story with the elements of character, setting, event sequence and
plot resolution
$ determine cause and effect relationships with why, how and what if questions
$ distinguish between fiction/nonfiction and real/pretend
Writing
$
$
$
$
Listening
$
$
$
$
Speaking
$ develop awareness of speaker and audience behaviors including posture, articulation,
volume and use of complete sentences and organization
$ orally share known literature through various presentations and activities
$ express opinions and solve problems while exhibiting courteous, attentive and
appropriate behavior
Viewing
$ develop an awareness of various media
$ demonstrate understanding of main idea from various media sources
$ compare two media that present the same story
Math
The math program in a developmental kindergarten is manipulative-based.
Concepts are developed from the concrete, to the symbolic, and, finally, to the abstract
level. However, many opportunities exist to facilitate learning in the following
mathematical objectives. Cooking activities provide opportunities for explorations of
weights, measurement, volume and temperature. Block-building experiences develop
problem solving skills like sorting and comparing. The workbench center can facilitate
learning in number concepts and estimation. And finally, activities involving the
scientific inquiry process utilize math concepts like counting, addition and subtraction
and evaluating the reasonableness of answer.
Mathematics Objectives
The student will be able to:
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
Music
Music provides a natural form of expression for the
kindergarten child. An appreciation of music is developed through singing, listening,
creative movement, and playing instruments. Music can also be the vehicle to transfer
learning from other areas of the curriculum. It can develop vocabulary, enhance cultural
understandings, complement mathematical and scientific concepts, extend literacy
activities and promote large motor development through the addition of creative
movement.
Music Objectives
The student will be able to:
demonstrate the ability to move to and play a steady
beat
identify and sing high and low sounds
identify and sing loud and soft sounds and the
difference between singing and talking
perform actions to musical selections
perform a dance to a musical selection
demonstrate the use of movement in playing games
demonstrate movement as a response to tempo changes
explore free movement with a steady beat
play unpitched instruments loudly or softly
play unpitched instruments as rhythmic accompaniment to a song or poem
Physical Education
Physical education is an extremely important part of the kindergarten curriculum.
Research illustrates a strong correlation between gross motor and cognitive development.
In the kindergarten program, many of the objectives for physical development are best
addressed during outside activity time. However, opportunities do exist in the classroom
such as creative movement experiences and music activities. Many physical fitness
issues are covered in the health curriculum.
Science
The teaching strategies to meet the following science objectives may take several
forms. Some objectives may be best served through experiment demonstrations, others
may be designed as a scientific inquiry process with one or two students at a time, and
still others may be implemented as an exploration center for small groups. Whatever
strategies are utilized, the curriculum areas that best support the science objectives are
typically, math, block-building, cooking and art.
Science Objectives
The student will be able to:
explore and use various models
understand and explore that change occurs and matter comes in various forms (solid,
liquid, gas)
measure in non-standard units
understand concepts of time (before, after, yesterday, today, tomorrow)
explore form and function
explore the scientific inquiry method by:
1. brainstorming questions
2. conducting scientific observations
3. using scientific tools to gather data (magnifying glasses, tweezers, eyedroppers,
scales, magnets and human tools - the 5 senses)
4. exploring data and evidence
5. making predictions
6. exploring alternative solutions
7. communicating scientific observations
identify different types of animal adaptations (camouflage, hibernation, migration,
evolution)
sort animals into wild, exotic, extinct, endangered and domestic categories
recognize the difference between living and non-living things
recognize that living systems require food, water, and sun to survive
observe and identify the four seasons and their impact on humans
explore evaporation, condensation, precipitation and the water cycle
observe different weather conditions
observe and discuss characteristics of the local environment and how its condition
impacts humans
explore the concept of recycling and conservation of natural resources
Social Studies
By definition, social studies is defined as the study of the conduct, standards,
organization and activities of a group of people living together in a common
environment. In this sense, all the learning that takes place within the kindergarten
classroom is social studies. The applications for teaching social studies objectives can be
found in every aspect of the kindergarten curriculum from a grocery store in dramatic
play to the cultural books in the library/listening center, from field trips to saying the
Pledge of Allegiance at circle time and from Native American pictorial writing to making
maps with blocks. Thematic units in kindergarten are also often develop from the social
studies curriculum such as; Living in Early Times, Transportation, Children
Around the World and Community Helpers. The recognition of patriotic and other
national holidays in kindergarten provides opportunities to develop even more social
studies concepts.
Technology
Computers have a place in the kindergarten classroom as an educational tool to
reinforce learning. As a tool, technology offers the kindergarten teacher an opportunity
to enhance learning in almost every area of the curriculum. Technology can be especially
important to the development of writing skills, as the early learner who is struggling with
fine motor issues can use a word-processing program to create a writing project.
Software programs exist to coordinate with many other areas of the curriculum and more
are being developed each day that target the early learner. An additional outcome from
meeting these technological goals is that the kindergarten child gains mastery over
machinery, thereby gaining self-confidence and enhanced self-esteem which provides
immeasurable benefits to the child.
Technology Objectives
The student will be able to:
@ identify basic software icons
@ use technology to create a piece for publication including; typing own name, typing a
simple sentence and printing and illustrating personal writing
@ view instruction through the use of a TV to P.C. connection to gain knowledge of
appropriate use of software
@ demonstrate an understanding of the basic operation of computer hardware
@ demonstrate the appropriate care of computer hardware and software
@ demonstrate knowledge of the use of the keyboard
@ use appropriate vocabulary to identify the parts of a computer including; monitor,
printer, processor, keyboard, mouse, mouse pad, modem, memory, floppy disk and
hard disks
@ demonstrate knowledge of the use of click-n-drag and left/right mouse buttons
@ demonstrate starting a program from an icon
@ demonstrate shrinking/expanding and opening/closing a window
@ use appropriate technology vocabulary including; cursor, program, software and
hardware
@ understand and follow instructions given in various formats (graphic, audio)
Environment
Creating the Learning Context
Environment
The Learning Context
Creating the Learning Context:
! Teachers Role
! Characteristics of the
Five-Year-Old
! Material Inventory:
Basic Requirements
! Student Supply List
! Room Arrangement
! Classroom Management
! First Day Schedule
! Daily Kindergarten Schedule
Teachers Role
The role of the teacher in the kindergarten classroom offers three equally
important and often simultaneous responsibilities -- teaching, administering and
counseling. These responsibilities cannot always be separated, but the effective teacher
must incorporate all three skills.
The teacher:
# shares knowledge and information.
# listens, questions, and interacts with individuals, small groups and large groups
each day.
# responds to the childs interest.
# evaluates progress in all areas -- emotional, social, physical and cognitive.
# exercises authority necessary to sustain the work and play life of the class.
# identifies needs and arranges for special services.
# creates an atmosphere of mutual respect and trust.
As administrator, the teacher:
# arranges the environment so that learning can take place.
# structures time.
# sanctions what is going on in the classroom.
# encourages and uses parent help while communicating the program to parents,
other teachers, and the community.
# provides opportunities for concept development in sequence.
# plans program based on the developmental needs and interests of the children in
the class.
# arranges space and organizes materials for learning centers.
As counselor, the teacher:
# does not hurry the child.
# encourages and motivates so that the child will stretch the mind and use the body to
reach full potential.
# is perceived as a resource for meeting problems of confusion, fear, loss of direction,
anger, or loneliness.
# understands behavior in the context of the characteristics of a childs stage of
development.
# takes no action that exploits the strength of the adult against the weakness of the
child.
# establishes trust and understanding as a significant adult in the childs life.
# communicates caring and a readiness to give.
# deals with feelings and conflicts so that children can discover appropriate ways to
function cooperatively.
5 1/2 years - the child begins to become brash and combative in some
behaviors as if at war with themselves and the world; one
minute its I love you, the next minute its you stink
6 years
Materials Inventory
The Materials Inventory section is a suggested list of basic furniture, materials
and supplies for establishing a developmental kindergarten classroom. These items are
offered as the Basic Requirements for setting up a new classroom. In addition, each of
the Strategies sections contains a Recommended List of items that will supplement that
particular area or section. After the Basic Requirements have been met and as
additional monies become available, the Recommended List should be found in the
ideal kindergarten classroom.
Basic Requirements
Furniture:
# shelving units (2) on casters
# tables (8) as follows; rectangle (1) kidney (1) round (4) square/trapezoid (2)
# chairs (at least 30), lightweight
# reading loft (if space allows) or small child-sized couch/pillows
# book rack (1)
# big book holder/storage (1)
# woodworking bench
# cubbies (1) with cubbyholes for 25
# letter sorter unit (1) with compartments for 30 or more
# paint easel (1) with storage shelves
# pegboard room dividers (2)
# store front/stage unit (1)
# child-sized stove, fridge, sink unit (hardwood)
# child-sized table (1) and chairs (2)
# hinged shelving unit (1) for block storage
# sensory table
Equipment:
# hardwood unit blocks (1/2 school set)
# hollow blocks (basic set)
# networked computers for electronic education (3) with printer
# stand-alone computer with printer (1)
# listening center; headphones (4)/ cassette player
# CD player/cassette/recorder
# woodworking tools (basic set)
# globe
Materials:
# puzzles (6-20 piece) wooden/foam with rack
# toy cash register
# toy dishes/utensils (set for 4)
# basic plastic food set
# dolls (2)
# open-ended material sets (3) i.e. Duplos, Kiddie Links, Flexiblocks, etc.
# beads and strings (1 set)
# pegs and pegboards (1 set)
# self-help; dolls, frames or boxes (1)
# sewing cards (1 set)
# action play set (1) i.e. Playmobile, Fisher/Price etc.
# flannel/wipe-off/magnetic board
# felt cut-outs, magnetic letters/numbers (1 set each)
# board games (3) i.e. Lotto, Candyland. Chutes and Ladders, etc.
# rhythm instruments (1 class set)
# paint cups with lids, brushes (8)
# art carousel (1); tabletop lazy-susan type
# magnet set (1)
# magnifying glasses (4)
# class thermometer (1)
# domino set (1)
# classroom set; unifix cubes, pattern blocks, wooden inch cubes
# balance scale (1)
# hardwood vehicles (4)
# magnifier on stand (1)
2 - #2 lead pencils
1 - box of crayons
2 - 4 oz. bottles of white glue
1 set of water-base felt markers
Consumable items assigned to a portion of the class; like paper towels, napkins or
facial tissues
Other items may be included that are unique to a specific classroom and may not
exceed a predetermined cost.
It is important to mention that some items may become part of a community
supply. It may be necessary to explain that the kindergarten classroom is set up to foster
cooperative skills and interactive language.
Another recommendation for the supply list would be a reference to a backpack,
book bag or other appropriate alternative for kindergarten use.
The following is a sample kindergarten supply list:
Required Items:
1. 2- #2 lead pencils.
2. Box of crayons, 16 or fewer (more colors than this do not contribute to the
kindergarten curriculum).
3. 2 - 4 oz. bottles white school glue (orange cap recommended).
4. Set of water-base felt markers.
5. Paper towels, napkins of facial tissue (to be assigned by teacher at home visit).
THE FOLLOWING ARE ITEMS WHICH MAY BE REQUIRED BY YOUR CHILDS
TEACHER AND ARE NOT TO EXCEED A TOTAL COST OF $3.00.
6. _________________________________________________________________
7. _________________________________________________________________
8. _________________________________________________________________
9. _________________________________________________________________
Note: Backpack, book bag or other appropriate alternative is recommended.
Date
% For the Kindergarten Curriculum Food Unit, parents may contribute $5.00 per
semester or send ingredients.
% In addition to the Food Unit, some kindergarten teachers have daily snacks. You
may receive more information from your childs teacher regarding this.
% From time to time, you may be asked to make small donations to help your
school provide culturally enriching programs and field trips.
% S.O.S.: Sharing Of Supplies by purchasing extras and leaving them at the
Principals office will help children less fortunate.
Classroom Management
Young children need to be active and learn most effectively when they are in motion.
The kindergarten day should include at least 45 minutes during which the children are free to
choose activities and to move around the classroom as their interests dictate. Providing a
range of activities at varying levels of difficulty and projects with complex and simple
aspects enables each child to find those areas of interest that motivate free and active
participation in the learning process. The ideal learning situation is one, in which the
activities are so enjoyable that the learner considers them both work and play. Providing a
classroom rich in learning experiences will discourage wandering and disruptive behavior.
Choice is important but kindergartners feel more secure when they are able to make
choices within a structured daily schedule. The schedule may be seen as framing and
crisscrossing the day. Although they need to choose and practice socially acceptable ways
of communicating, they are overwhelmed by too much choice. The teacher should state
firmly what is not allowed, what is expected, and be consistent.
The teacher should solicit the childrens input in determining those rules, standards
and guidelines for the kindergarten classroom. This may be done in several ways. During
the first weeks of school the teacher may conduct a class meeting or discussion to brainstorm
possible general guidelines. Or the teacher may wish to develop the standards as they arise;
in the introduction of a new activity or after a problem area has been identified. Whatever
the method, the childrens ideas are important to consider and by allowing them to
contribute to the process, they are more likely to follow the guidelines and live up to the
standards they have helped establish.
The five-year-old is in the process of developing moral structure. Adults with whom
the child relates can contribute to this development in important ways. Modeling warm,
calm, respectful behavior is imperative. Some teachers find it helpful to circulate during free
choice time, supporting purposeful behavior, being sensitive to childrens signals, and
making positive contact as a child works. As children become more secure and familiar with
the classroom rules and begin to relate to one another in positive ways the teacher may be
able to focus energies to a specific center in order to help a small group with a project.
Learning to function in socially acceptable ways is a basic part of the kindergarten
curriculum and should not take a back seat to skills development. During free choice time
children are learning many democratic skills, building leadership and cooperative strategies,
and learning initiative and independence. Guidance will be necessary, usually in the form of
providing a safe, secure environment in which children can work through conflicts
themselves in an atmosphere of protection. Children need to interact with each other in a
noncoercive, nonauthoritarian atmosphere in order to decenter and become aware of
different points of view. They need experience dealing with other children without
excessive adult intervention.
Even though a teacher is working to provide a rich learning environment in which
children have opportunities to move about, make choices, and practice social skills, adult
constraint may become a necessary moment in the management of a situation. The question
of when and how to exercise authority will arise. The following suggestions may be helpful:
#
The teacher should foster a relationship of caring and mutual respect, in every
instance.
The teacher should avoid sanctioning the childs behavior if possible and instead,
help the child focus on the problem and allow the child to choose behavior that is
more appropriate.
The teacher should apply sanctions when necessary and use logical or natural
consequences, such as removing a child to a quiet, isolated area.
The teacher should strive to build empathy and ask the child to consider the effect
of their actions toward another.
Day One
~
~
~
~
~
Day Two
~ Review calendar, manipulative area rules and signal bell
~ Introduce/model use of dramatic play and block center
~ Choice time; using manipulatives, dramatic play, blocks
~ Recess; introduce outdoor equipment rules
~ Closing activities; discussion of classroom standards/guidelines
Day Three
~ Calendar/review
~ Introduce/model use of art center, easels, reading loft/area
~ Choice time; with all the centers/activities introduced to date
~ Recess; introduce outdoor equipment rules
~ Closing activities; discussion of classroom standards/guidelines
Day Four
~ Calendar/review
~ Introduce/model use of library center, writing table, computers
~ Choice time; reviewing center limits
~ Recess; introduce some outside group games i.e. tetherball, hopscotch
~ Closing activities
Day Five
~
~
~
~
~
Calendar/opening activities
Introduce; any other centers or small group activities
Choice time; teacher circulates to monitor and evaluate activity
Recess
Closing activities
By Day Five, the majority of the classroom procedures, policies and routines have
been introduced. By introducing the kindergarten program in this staggered fashion, the
teacher is establishing a solid foundation upon which to build future learning. The investment
the teacher makes in introducing these routines and procedures in an appropriate, clear and
consistent manner will result in never-ending benefits throughout the entire school year.
20-30 minutes
Activities may include; math tub activities, journal writing, alphabet activities, round
robin language instruction, small group rotations for thematic activities
Centers/Free Choice Time
45 minutes
10-15 minutes
Activities may include; free play on playground equipment, organized games with
sports gear, creative movement activities, group games, and physical development
activities
Closing Circle Time
30 minutes
Environment
The Learning Context
Communicating about the Learning Context:
Kindergarten Registration
Mailing Information
Kindergarten Orientation
Kindergarten Booklet
Home Visits
Open House
Parent Night
Volunteers in Kindergarten
Parent/Teacher Conferences
Newsletters
Frequently Asked Questions/
Comments
Kindergarten Registration
Many schools offer an Open House or Kindergarten Registration day in the Spring
for prospective kindergartners. At this event, parents can formally register their child,
verify birth certificates and immunization records and briefly visit a kindergarten teacher
and classroom. For many families, this may be their first introduction to public education
and is an important opportunity to begin to establish those home/school connections. The
following is a list of types of information that may be included in the parent packet at the
time of registration.
Packet materials may include:
letter explaining home visit policy and/or orientation meeting dates sample
(Due to the developmental approach of kindergarten, school supplies may be pooled for use in learning centers.)
Required Items:
1.
Package of pencils.
2.
Box of crayons.
3.
4.
5.
6.
2 Glue sticks.
THE FOLLOWING ARE ITEMS WHICH MAY BE REQUIRED BY YOUR CHILD'S TEACHER AND
ARE NOT TO EXCEED A TOTAL COST OF $3.00:
7.
Tissues A-L
_________________________________________________________
8.
9.
Stickers-seasonal
_________________________________________________________
Building Principal's Signature:
________________________________________ Date:_______________________
Note: Backpack, book bag, or other appropriate alternative for kindergarten is recommended.
For the Kindergarten Curriculum Food Unit, parents may contribute $5.00 per semester or send
ingredients.
In addition to the Food Unit, some kindergarten teachers have daily snacks. You may receive more
information from your child's teacher regarding this.
From time to time, you may be asked to make small donations to help your school
provide culturally enriching programs and field trips.
S.O.S.: Sharing Of Supplies by purchasing extras and leaving them at the Principal's
office will help children less fortunate.
This list will be reviewed during the 2007 - 2008 school year and input will be welcomed.
SAMPLE CALENDAR
Boise School District
Traditional & Optional 2007 - 2008 Calendar
August 7
August 8
August 24
August 24
August 27
September 3
September 14
October 4, 5
October 17, 18, 19
October 18, 19
November 2
November 7, 8, 9
November 8, 9
November 9
November 5- 23
November 21
November 22, 23
December 21
Dec. 24 - Jan. 4 (incl)
January 16, 17, 18
January 18
January 21
February 15
February 18
March 7
March 21
March 24 - 28
March 24 - April 11
April 11
May 2
May 26
June 3, 4, 5
June 5
June 20
Mailing Information
Some kindergarten teachers mail information to all parents of newly enrolled
kindergarten students, before the home visit. This may simply be a personal letter from
the teacher or a whole packet of information. Instead of mailing this information it may
be passed out at Orientation or Home Visits.
Dear ___________________
Its almost time for school to begin. The room is ready but very empty. It
needs you and the other children to make it lively and interesting. Jessi, the
mouse, and Goldie and Charlie, the fish have been at my house all summer.
They will be glad to see you, too. Some blocks are on the shelf, the paints
are mixed, the reading loft is tidy, the kitchen is set up in the dramatics area,
the puzzles and manipulatives are on the shelf, the sand table is aired, the play
dough is made. What will you choose to do? I have had a pleasant summer
doing the things I like to do best visiting with family and friends, reading,
sewing, working in the yard, traveling. I even rode on a jet once. I do look
forward to hearing about your Summer. We will make a graph of your
favorite activity.
I will see you soon.
Sincerely,
_________________________________________
Teacher
___________________________
Home Phone
Kindergarten Orientation
Many teachers have found that an Orientation before or just after Home Visits has
proven to be very valuable in helping families become familiar with the school building,
school procedures, rules, the kindergarten program, and to help the child feel more secure
by having parents in the room during that first contact.
The following is one idea for conducting an orientation prior to the start of
school. The plan described is for one hour in length with both children and parents in
attendance.
Parents can do these activities while the teacher is working with the children;
introduce themselves to each other
read general hand-out
sign volunteer list
complete home visit schedule
With the children, the teacher may;
make name tags
play in centers around the room
gather in a circle for; introductions, a short game , a music activity &
a story
hand out refreshments
take a recess or tour of the building, bathroom and playground (the
refreshments and tour can be done by an aide, sixth grade students, or
ancillary personnel)
While the children are on the tour or recess, the parents and the teacher may;
go over information handouts
discuss any other pertinent housekeeping items
answer questions
The following is a sample letter of an invitation to an Orientation meeting.
Kindergarten Booklet
At Orientation, the teacher may choose to introduce a Kindergarten Booklet. This
booklet may contain information specific to the school and/or the kindergarten classroom
and teacher. Some of the information contained in the booklet might be:
Dear________________
Welcome to _____________________Kindergarten. I know this will be a fun and
interesting year.
Our opening days will be different than those of the first through sixth grades. We would
like you to come to an orientation just for kindergarten.
The schedule will be as follows:
August ________
8:30 9:30
10:00 11:00
August ________
Home Visits
August _________
Home Visits
For five-year olds who may never have been away from home before, the plunge
into an institutional setting is frightening -- even more traumatic for some. The transition
can be more comfortable for the child if the child can meet the teacher at home, where
the child has the security of family and familiar surroundings.
THE PRIMARY PURPOSE FOR A HOME VISIT BEFORE
SCHOOL STARTS IS FOR THE CHILD.
School and teachers are something the child has heard about, but does not know
or understand. Through the home visit the teacher will become a real, warm person
whom the child wants to know, like, and have as a friend. Consequently, that first day of
school will be something to look forward to with a sense of curiosity and yet a feeling of
security.
Home visits also provide a basis for a good parent-teacher relationship. Again the
teacher is discovered to be a person and not just a name associated with an institution.
This is an opportunity to establish a rapport with the parents, which will be the
foundation for a good feeling about their childs school experience.
Another significant benefit of the home visit is the opportunity for informal
assessment. This gives the teacher an opportunity to work individually with each child in
a relaxed, comfortable atmosphere. This time should not be perceived as an opportunity
to test the child. However, the information gained from this meeting may enable the
teacher to provide a more meaningful program that meets the needs of each student.
The examples and suggestions here are just some of the things a kindergarten
teacher might do or take on a home visit conducted prior to the first day of school.
Ideas for the child might include:
taking a name tag to make with the child
asking the child to share a favorite toy and/or pet
taking a camera to take the childs picture to be displayed in the room or
added to a special writing project
sharing a photo album of kindergarten activities
These items could be used to conduct some informal assessments:
wooden puzzles, shapes and small blocks
a lacing shoe
colored markers for drawing
unifix cubes
drawing paper and pencil
a popular storybook
a poster of environmental print
scissors and paper circle
Open House
After a month or so of school, when more specific questions begin to evolve, a
talk session with parents, during an evening, can be a constructive time together. This
could take the form of a school-wide open house.
Parent Night
The teacher may schedule a kindergarten parent night separate from an open
house. Different from the traditional back-to-school night that is usually scheduled for an
entire school, the parent night would be specifically designed to inform parents about
kindergarten.
Some ideas to include in a kindergarten parent night might be:
The parent would be an active participant in the nights agenda, role-playing the
part of a student in the classroom. Parents could ask questions concerning class schedule
and curriculum, but would be encouraged to avoid trying to confer with the teacher about
individual student progress.
Find your childs name card on the teachers desk and place it in the Glad Youre Here
chart on the door.
Paint a picture on the easel or make something from clay at the clay table.
What is the title of the story in the listening center under the reading loft:
_______________________________________________________________
Find your childs birthday cake (under the clock). Which month has the most birthdays?
________________ Which month has the least birthdays?__________________
Take a look in the Kinder Store center. Answer and do the following:
How many sections does the store have?_____________(frozen food, produce,
non- food, etc).
What is your favorite food in the produce section?_________________________________
What is the unbelievable price of eggs at the Kinder Store._______________________
Go out in the hall to the Numeral Boxes. Try at least two approaches to writing a numeral.
Write down the title of one of the books found in the reading loft that interests you.
_______________________________________________________________________
Count the number of cylinder blocks in the block center._________________________
Introduce yourself to at least one person you do not know.
Find a jack-o-lantern or a spooky tree in the hall that your child painted.
Describe one of the activities on the small manipulative game shelves that looks like fun to
you (shelves near the teachers desk).
Make a pattern with two different types of materials from the math tubs (math tubs are on the
tables in the hall).
Choose one Workjob in the hall and place six of the counters on a game board.
Find a Workbox in the hall. Open the lid and follow the directions written there.
Good work!
Volunteers in Kindergarten
Working with parents, as volunteers in the kindergarten classroom can be a
rewarding experience, as well as a demanding one. If used effectively parents can be a
wealth of resources. But planning to make use of these resources demands special
organization and extra preparation time. Providing worthwhile experiences involves a
mutual obligation between the volunteer and the teacher. The teacher is responsible for
explaining expectations and duties. In turn, the parents need to realize the importance of
their role in the classroom. They must be willing to make a definite commitment of time
and energy.
The ways in which parents can be utilized as volunteers in the classroom are
applicable to a variety of situations. The following lists give examples of ways
volunteers can be used in the kindergarten classroom. They are grouped in two ways
either as specialists or as aides in the classroom. They are grouped in two ways either as
specialists or as aides in the classroom. The volunteer specialist may not be available to
help on a regular basis but still represents a valuable resource as an expert in a
particular field. The volunteer aide is directly involved with individual students or small
groups on a regular basis and can lighten the burden of individualization for the
kindergarten teacher.
Involvement Ideas for the Volunteer Specialist:
Art
Careers
Cultures
P.E.
contemporary dance
fitness, aerobics, or special sports
plays
puppetry
Drama
Language
Arts
situations before they occur and prevent them. Help children figure out safe ways to
play.
11. Do for the children only those things they cannot do for themselves. Putting coats
away, dressing, putting finished artwork away, helping clean tables, etc., can be the
childrens responsibility.
12. Interfere in disputes between children only when they seem to be unable to resolve
their difficulty themselves in a manner satisfactory to both parties. Avoid jumping
right in to settle an argument.
13. Children are sometimes slow in making up their minds so do not try to rush them into
things. The timing of a suggestion may be as important as the suggestion itself. Alert
them in advance for a change in activity. Remember, their time machine is much
slower than ours, and they need time to watch or to shift from one activity to another.
14. The art of simple choices of positive statements, such as Where are your brakes,
Fred? or of face-saving moments, such as Did you forget the rule today? can go a
long way in helping children in their social development.
15. Avoid motivating a child by making comparisons between one child and another or
encouraging competition.
16. When limits are necessary, they should be clearly defined and consistently
maintained. The adult in charge can foresee and forestall troubles.
17. Avoid making models when children are using art media or engaging in rhythmic
movements. Encourage them by asking questions about the situation or subject, but
do allow them to discover for themselves. Do not ask, What are you making?
Instead, occasionally ask, Do you want to tell me something about it? If asked by a
child to Draw me a _________, discuss how it might look, shape and size. Let the
suggestion come from the child, with a few questions on your part, e.g., Is it round
or square? If possible take the child to look at real examples.
18. Be pleasant and cheerful in your work. Above all, keep your sense of humor. The
children need it. We all need it. Laugh with the children, not at them.
Conferences
Conferences, the forerunner of all parent/teacher communication, can be defined
as the focused discussion between teacher and parent. Parent conferences will assure
parents that their childs ultimate success in school is the teachers strong concern, and it
is dependent upon the childs experiences. Information relative to the school situation is
shared with the aim of helping the child integrate the school experience to maximum
potential.
Overview of Conference Planning:
Many schools choose to set up conferences school-wide. The teacher should set
up the remaining appointment and follow with notification of the scheduled time to
parents. The teacher should indicate that all parents are being invited, not just those who
have problems and inform parents how long the conference will last. It is advisable to
schedule an easy conference first, if possible.
The following are some factors to consider in preparing for the conference:
Save samples of the students work during the period preceding the conference. The
materials should be from all phases of schoolwork including art, writing, assessments,
etc.
Fill out the conference information sheet for each student well in advance. Decide
the strong points and weak points you wish to discuss so that you will be sure items
are covered during the conference. Reports given to parents should be neatly and
correctly written.
In cases where the service of a specialist has been used, include that person in the
conference or have a report to be used during the conference.
If the teacher desires that the parent help at home in overcoming some specific
educational deficiencies on the part of the child, special directions should be prepared
in advance for the parent to follow.
It is advisable to carefully screen ideas and items you wish to cover in each
conference and keep them to a minimum. To attempt to cover too much will tend to
decrease the value of the interview. It takes considerable thought to determine what
is most essential, due consideration being given to the time element involved.
An over-prepared conference is always more successful than those with inadequate
preparation.
Classrooms and conference areas should be decorated with childrens work and
displays. Parents first impressions about the room environment may directly
influence their conference behavior.
The day of conferences, arrange for early-arriving parents to sit outside the
classroom, and possibly have a table with reading materials to look at including
student journals and class books.
The teacher may want to prepare some information to be sent home for the parent to
read prior to coming to school for the conference.
The Conference:
The physical arrangement during a conference is important. The teacher should
sit next to the parents and not let a desk or table be a barrier. The teacher can begin the
conversation with some simple questions to allow the parents a chance to start the
conference with their ideas, first. Some appropriate questions might be:
What does_________________say about school?
Does __________________ like school?
Do you sense any problems?
Is there something that concerns you about __________________that I should be
aware of?
Factors to Consider during The Conference:
1.
The teachers appearance and attitude are of primary importance. Many parents
see the teacher very little except at the time of the conference. A well poised,
well-groomed individual is in a favorable position. The impression the parents
carry away may have lasting influence.
2.
The teachers greeting should be friendly and relaxed. If hurried or tense, the
parent will know it. It is difficult to discuss a problem with someone who looks
as if they wished you were not there, or would soon leave. Always begin and end
the conference with a positive statement about the child.
3.
Listen and then listen some more. The teacher did not invite the parents in to
deliver a lecture, but to get, as well as to give, help. Encourage the parents to talk,
and then listen to what they have to say.
4.
5.
Remember that parents are warm, human, and do care for their children. If you
are anxious, feel threatened or are defensive, the natural human interactive
relationship will be lost.
6.
Be accepting. That is, accept anything the parents tell you without showing
surprise or disapproval. If the teacher cannot do this, they will not get an honest
picture of the parents attitudes and feelings.
7.
If parents insist on revealing intimate family relationships that you do not care to
hear, make every effort to get the conversation back on the subject of the students
education. However, if parents insist on continuing, about all you can do is to
remain noncommittal.
8.
Do not get ahead of the parents thinking. In other words, the teacher should not
try to push thoughts onto parents before they are ready to see it through a process
of discussion and mutual thinking.
9.
Find out how parents are thinking and feeling about the child. This is important,
because the teacher cannot understand the childs behavior until the parents
attitude is understood.
10.
Most parents cannot be objective about their own children. Therefore, do not
criticize either directly or indirectly. Criticism is fatal to the building of a
cooperative relationship.
11.
It is better not to assume that a parent wants help or advice. Such an assumption
usually brings resistance, because it implies a form of criticism.
12.
If parents are worried about the childs behavior, follow through. Find out why
they are worried. The teacher should not assume to know why. The teacher and
the parents may not feel the same way about the child.
13.
If parents give reasons for a childs behavior, accept the reasons and lead the
discussion on to the consideration of other possible causes. Behavior is the result
of many causative factors, not of one.
14.
15.
If the parents cannot suggest reasons for a childs behavior, or plans of action to
deal with it, the teacher might suggest alternatives for joint consideration. This
might be a possibility What do you think? You know all the facts of the
situation better than I do or We might try this and see what happens. It may
take us awhile to find the source of the difficulty. Such an approach makes the
parents participators in the final decision for tentative plans and leads to
discussion that helps parents to accept the plan as their own.
16.
17.
Avoid giving direct advice when parents give a statement of a problem and then
lean back, and say, Tell me what to do. Let any advice or suggestions grow out
of mutual discussion and a growing insight on the part of parents into the reasons
for the behavior.
Follow-up for Parent Conference
An essential, but often over looked, part of parent teacher conference is the
follow-up.
If it is not feasible for a teacher to take notes during a conference, then some
record of the proceedings should be developed immediately afterward. Such a record
might include the names of conference participants, relevant information communicated,
information gained or modified as a result of the conference, and outcomes or follow-up
activities and responsibilities assigned.
During the conference the teacher may have asked the parent to address a note to
the student which was left in the students cubby to be read the following school day.
The note may mention something new the parent learned about the child or just give
some type of positive feedback.
The teacher may wish to make follow-up phone calls or send notes thanking
parents for the progress the child has shown following the conference.
The teacher should establish a timeline for any additional tasks resulting from the
conference such as testing, communicating with resource personnel, securing special
materials, or planning special instructional sequences.
Newsletters
A newsletter is an excellent opportunity to inform and enlighten parents about
specific activities, learning, and growth taking place in the classroom. The following are
sample newsletters. Teachers may choose to send these letters weekly or month. Either
way, newsletters have proven to be very beneficial in communication between school and
home.
SAMPLE of NEWSLETTER - #1
Dear Parents,
January was certainly a busy month for kindergarten, once we got over the excitement of
Christmas (whew)!
We started off the month with a unit on Our Families. We found out how many people there are
in our families, how many brothers and sisters we have, and the many things that the children like to do
with their families. We made family portraits and special stories about things that we like to do with our
families. We talked about homes, our addresses, and made a class graph chart on our addresses to find out
which street has the most kindergarten children.McMullen has the most (a.m.) with five children and
LaHontan has the most (p.m.) with seven children! The children drew pictures of their homes, copied the
house number on it and we then placed it on a large neighborhood map. Next we will be trying to learn our
telephone numbers. Each child will have a telephone with their number on it, it will be placed above their
house on a telephone pole and once they learn their number, we will connect the wire from the pole to the
house.
As you can see, we have quite a bit of work to do before our caterpillar is complete but we have finished
our work with the initial consonant sounds Bb and Tt. We met Benji Bumble Bee and Timothy Turtle and
we found some very interesting pictures that being with these sounds.
A Special finger-painting project, using shaving cream, provided a great deal of excitement and smooth
faces in our room. So many of the children enjoyed swishing it around on the table and clapping their
hands to watch it fly all over. Of course, we had some children getting ready to shave and they had the
cream covering their entire faces. Some children experienced tasting the shaving cream and they decided
that it didnt taste very good (yech)!
Coming events in our kindergarten include a unit on Fire Safety with (yes) a field trip to the fire
department. Of course, this is the month for Valentines Day and we will be spending some time on some
special projects and will have a Valentines Party!
OPEN HOUSE was a great success and we would like to thank all of you for your participation. The
children worked very hard in preparation and they were very excited to think that their parents were going
to get a chance to come to kindergarten.
SAMPLE OF NEWSLETTER - # 2
Dear Parents,
In the first few months of kindergarten we watched your children change in many ways. The most remarkable
transformations have occurred in the area of social competence within the group. Many new friendships have
begun and old ones have become strengthened. As each child begins to direct (name) school activities so can each
child become a director and supporter of the group; all the time recognizing the individual importance of each
kindergarten member. Each future newsletter will bring with it some hopefully helpful parenting information that
will go along with the newsletter and learning center spotlight! When my own daughter expresses, one restless and
fitful night, that she kind of believed in count Dracula I decide to do some review on childrens emotions and what
I found helped both of us get through the crisis, so I hope the information will be of interest to you. This is
accompanied by an article on childrens emotions.
And now for the news!
Reading:
The wallpaper books that are coming home with your authors are part of an important beginning for
discovering what reading is all about. Not only do the children gain knowledge of the sequencing of events of a
story but also discover important concepts such as book cover, title, page number, and story and illustration
correlation. Authorship is a sophisticated process for five-year-olds and some inconsistencies in time, place, or
sequence of events and continuation of a single story line may occur at first.
The authors are extremely proud and interested in their own books, so read along with them and
place their book along side others on the reading shelf. Sylvia Ashton Warner, author of Teacher and founder of a
reading approach called Organic Reading states:
First books must be made of the stuff of the child, whatever and wherever the child. I reach my
hand into the mind of a child and bring out a handful of the stuff I find there, and use that as our first working
material.
Math:
The pattern unit has proven very successful, thanks to parents who cut shapes at home for us. We
experimented with dot patterns in the feather hats, shape patterns in the tepees; snap, clap, auditory patterns,
and will be doing some bead patterning soon. The concepts involved have proven difficult for some children and we
will continue to incorporate them into future math jobs. Our main focus in math now will be in classifying. They will
begin on their fourth and fifth sets of workjobs on Monday, December 3.
Science:
We have begun our study of food and nutrition. (The holidays seem to be a popular time for everyone
to concentrate on EATING!) The children have an area where they can prepare their own meal from paper
cupboards containing pictures of food from the four food groups. We hope to have a tasting center soon where a
blindfold will make them rely only on these taste buds for discrimination of tastes!
ABC Snacks:
A week turned out great! We made applesauce, Matt K. brought cinnamon, applesauce, Cathy
G. brought animal crackers, and Kathy M. brought apricot snacks. We will be starting on other letters of the
alphabet for December so please check the calendar for your letter. Please send ingredients if it would be simple
enough for us to put together. Or better yet come yourself and prepare it with the children. One mother last
year made enchiladas for E day, so do not hesitate- we will try anything!
TAKE APART CENTER!
We will be adding a new center to our kindergarten after Christmas and we will be needing some old
worn-out appliances, like toasters, and irons and any other mechanical things that we can take apart and discover
how they might work! (Radios, irons, music boxes, hair dryers, mixers, typewriters, old toys, vacuum cleaners,
sewing machinesand anything else you can think of!) Who knows, we might even be able to fix an old lawnmower
you thought was ready for the dump!
Some more junk that we need and you dont!
Sandpaper
Beads
Seeds
Buttons
Magnets
Old keys
Stickers (the kind you get in the mail)
Old mirrors
Telephone wire
Rings
Bread wrapper closures (different sizes
and shapes)
Some teachers find it useful to include one area each month, to talk about in
detail, to explain the goals and the skills involved, and to help the parents see more
clearly the learning that takes place there. Each month one of the following could get the
spotlight: cooking, math, writing, reading, blocks, art, dramatic play, etc. The following
is a sample of just such a letter.
SAMPLE OF NEWSLETTER - #3
December is just around the corner. The Indian tepee will be replaced (somewhat reluctantly) by Santas Workshop, where our busy
little elves can keep busy.
Our Indian experience has given us a chance to do some dying with natural dyes, weaving, picture story writing, hear some legends
and stories about Indian children, play some Indian games, and mainly do some thinking about how we could live without some of the
things we take for granted. The play in the Indian tepee gives a chance to play out the role of someone in a slightly different
cultural setting. Changing from house to tepee demanded a discussion of what we could leave and what we needed to remove or
replace. To get an idea of where their thinking is, I asked if we should leave the telephone. They agreed, No, long ago Indians didnt
have phones, but when asked how they did get a message to someone at a distance, they said get on a horse and ride, yell loud,
smoke signals, and drive your car to where there was a phone and use a walkie talkie. We forget, sometimes, how limited some
of their understanding and experience is.
This is a chance for the children to get the feeling of what another people, with different traditions and different needs or resources,
were like. We try to stress that this is long ago lifethat Native Americans now live like you or me. This gave us a chance to think
about how and where we would get water and food, how we would live, what we would wear, how we would make the necessities for
our lives. In a world of supermarkets and cards and television, it stretches the mind and the imagination to think about such things. I
hope we can appreciate the great contributions the Native Americans made to our early settlers. By being Native Americans and by
being Pilgrims and eating some of the food that the Native Americans introduced to the Pilgrims, we hope there will be an
appreciation of the differences and richness in any culture and a better understanding of another way of life.
kindergarten. However, it may be more helpful for a parent to talk to a trusted adult
familiar with the child in a preschool type environment. A teacher cannot accurately
make a judgement on a child until having worked together for some time. This would not
be an easy decision for a parent to make and it would be best if the whole family agreed
on and felt good about such a decision.
I heard that your district does not teach phonics. Why not?
Phonics is a name given to specific reading skills usually taught at a much higher level
than kindergarten. The way to teach language-related skills at kindergarten age has been
carefully studied and is being taught in an age appropriate manner. No matter what it is
called, letter sound associations will be taught when it is needed. Many teaching
techniques will help your child develop an understanding of what language is and how it
is written.
Why isnt my child bringing home any schoolwork?
Paper pencil activities are not always the best way to learn at this age. Your child is
doing a lot of serious schoolwork that can not come home. Probably the best way for you
to see what is actually happening is to be a volunteer in the classroom and watch.
Teachers know that that is not always possible and remind you that the best thing you can
do at home is continuing reading and discussing what is read occasionally.
Your child works very hard at school, however, if it seems like a game the teacher is
delighted and the child is delighted. None of that very important learning has been done
on paper and can not come home to you. As your child learns and grows this year you
will notice big changes.
Principals:
Theres no money in the budget for materials, but would you like that workbook
series?
Workbooks do not reach kindergarten children in the ways they learn best. Kindergarten
children learn best if they are offered opportunities to play, explore the world around
them and participate in hands-on activities. They also need opportunities to make
choices, communicate and socialize with peers. Five and six year olds must have their
bodies and minds actively engaged. This type of learning through play covers a wide
range of development and curricular goals and meets the needs of all students in my
classroom. Kindergarten children play with words, manipulatives, and props, sand, water
and each other. It is difficult to play with a workbook.
Workbooks do not actively engage the mind and body of a kindergarten child. They tend
to isolate specific skills with only one correct answer, therefore they do not encourage
growth at different developmental levels. Workbooks also isolate learners in a setting
that does not encourage communication among students. Workbooks do not foster
creativity in my classroom.
Thank you for the offer to buy a workbook series. How much do you think a workbook
series would cost? I am sure I could supply a center with appropriate materials for close
to the same amount of money.
How are these cooking activities significant to the curriculum?
Cooking has a great impact on student learning! Our cooking curriculum is set up so that
while students are cooking, they are integrating many different curricular areas. They are
developing math skills as they count, weigh and measure ingredients, literacy skills as
they read recipes, health skills as they learn about nutritious snacks, science skills as they
use their five senses, and social studies skills as they cook foods from different cultures.
Fine motor control is also developed as my students measure, chop and stir. Large
muscle groups are also involved as they knead and mix!
Cooking also helps young children develop many social/emotional skills. The children in
our classrooms are learning to work together in a shared effort. They are building
confidence and a strong self-esteem as they cook things that are good to eat. Parents are
proud of the independence their children show at home when they are able to create a
healthy snack for family members. We also teach our students polite table manners as
they eat the snack they have prepared.
Please come to my classroom on Friday at 9:30 and watch my students work together to
make a fruit salad. If you can not make it, I will be sure to save you a sample!
Your classroom is very active, when do you plan for teacher-directed instruction?
Thank you! Yes, I agree that my classroom is very active. Kindergarten children learn
best if they are offered opportunities to play, explore the world around them and
participate in hand-on activities. They also need opportunities to make their own
choices, communicate and socialize with peers. Five and six year olds must have their
bodies and minds actively engaged. This type of learning through play covers a wide
range of developmental goals across the curriculum, and meets the needs of all the
students in my classroom. Kindergarten children play with words, stories, manipulatives,
props, sand, water and each other.
Teacher-directed instruction certainly has a place in my classroom. Teacher-directed
instruction does not always take place in whole groups. I organize teacher-directed
activities in small groups and in one-on-one situations. Each week we have Circle Time,
shared reading, interactive writing, science and math activities, as well as small group
activities during centers and journal writing. Students observe teacher-directed lessons,
and then they have the opportunity to participate actively in the lesson. The activity you
are witnessing in my classroom now is my students practicing the teacher-directed
activities. It is through this practice that they will gain independence and mastery of
goals.
Could you come back this morning at 10:30? We will be having a short teacher-directed
math activity on creating patterns.
Publishers:
Would you like to know how your children compare to those in the rest of the nation?
Our test can provide that data.
In kindergarten each child is looked at as an individual and their achievement is only
compared to their own personal development. Therefore, a test to see where they
compare to others is not applicable as it is not as important as comparing past
performance in each individual.
Wouldnt it be nice to have a description of where the child should be at the end of the
year?
Each child enters kindergarten with its own unique experiences and abilities. Throughout
the year the goal of the teacher is to enhance each childs experiences and abilities, but
there is not expectation that every child will be in the same place due to their original
wide-range of abilities. Therefore a description would have to be unique to each child.
Can you see the benefits of these colorful workbook pictures over the actual objects?
Young children learn through direct exploration of objects and the manipulation of real
materials. Therefore a workbook with only pictures of objects would be meaningless, a
waste of time and no matter how attractive, the kindergarten child will always show a
preference for real objects.
TEACHER RESOURCES
Teacher Resources
The following references for the kindergarten classroom are organized
alphabetically by subject matter. Also included is a separate list of general professional
resources that are not tied to specific curriculum areas but are good resources for
kindergarten teachers.
Art
Art Experiences for Young Children, Pile, N. F.
Art in Action, Hubbard, G.
Creative Art Experiences, Lord, L.
Glues, Brews, and Goos: Recipes and Formulas for Almost any Classroom
Project, Marks, D.
Block-building
Block Building, Starks, E.B.
The Block Book, Hirsch, E.S.
Cooking
Cook and Learn, Veitch, B. & Harns, T.
Feed Me Im Yours, Lansky, V.
Kinder-Krunchies, Jenkins, K.
The Taming of the C.A.N.D.Y. Monster, Meadowbrook Press
Creative Movement/Physical Development
Feeling Strong, Feeling Free: Movement Exploration for Young Children,
NAEYC
Finger Frolics, Cromwell, L. & Hibner, D.
Learning Through Movement, Rower, B.
Teaching Movement and Dance, High School Press
Health
Creating a Caring Classroom, Letts, N.
Food . . . Early Choices - Kit, Idaho Dairy Council
Kids with Special Needs: Information and Activities to Promote Awareness and
Understanding, Getskow, V. & Konczai, D.
Language Arts
General Resources
Hey, Listen to This: Stories to Read Aloud, Trelease, J
Joyful Learning: A Whole Language Kindergarten, Fisher, B
Multiple Intelligences go to School, Gardner, H. & Hatch, T.
Producing a School Newsletter Parents Will Read!, Jones, R.
Read-Aloud Handbook, Telease, J.
Ready-To-Tell Tales: Surefire Stories from Americas Favorite Storytellers:,
Holt, D. & Mooney, B.
Starting Out Right, National Reading Council
The Creative Curriculum for Early Childhood, Dodge, D. T.
Transitions, Routman, R.
The following list is meant to be a starting point for teachers. Because of the high
rate at which web pages come and go, the teacher should use search engines to find the
most recent sites. Teachers need to use the individual addresses as a way to gather
valuable links. Almost every sit will suggest Additional sites with related information.
Some sites were chosen because of their links, not their specific topic. The teacher
should be aware that these sights are simply recommendations.
ART ACTIVITIES
Art Activities
A developmentally appropriate kindergarten art program is very valuable. It develops
creative thinking, self-expression, promotes problem solving and aids physical coordination. Art
is an individualized activity. The emphasis is on PROCESS rather than PRODUCT. The
kindergarten art center does not include a prescribed course set by the teacher and controlled by
an adult in a dictated art fashion. Project models are not provided and an adult must not alter
the childs work. The teacher should provide appropriate feedback.
Comments to be avoided:
Correcting.............The sky is blue, not yellow.
Valuing.................. I like it or Good work.
Complimentary .....Oh how lovely.
Questioning........... What is it?
Comments to use are:
You have used many colors.
I can tell by the picture that you enjoyed using several colors.
Your drawing is full of fire trucks, fire and a house.
You spent a lot of time on different shapes.
Teachers should foster self-esteem and creativity, and remember that each child is
developmentally an individual. The teacher should allow children to go about artistic discoveries.
Rather than searching for representation in childrens art, they should focus on the abstract,
design, qualities and shape or form. Teachers should use a reflective dialogue when talking
about childrens art. The elements of art provide a good framework for responding to children.
The following list of elements is both manageable and developmentally appropriate for talking
with children about their art:
Color
Line
Mass or volume
Patter
Shape or form
Space
Texture
give a thorough introduction to glue bottles that will save a lot of time for the teacher
later.
demonstrate how to open the glue bottle.
show the children the space made between the cap and the top of the bottle when
opened.
show how the space is not there if the bottle is closed.
demonstrate how to wipe excess glue off the top of the bottle and how to use small
amounts of glue, rather than large puddles.
talk about appropriate storage of glue and how to tap the glue top against a table to
remove dried glue the next time it is used.
when introducing watercolors, show the students how to drip a little water on each color
pad. This will soften the colors and make them brighter on the paper.
#
#
#
#
Colored chalk
Chalkboard erasers
Clay or play dough
Colored yarnassorted
Media mixture for paper mach
newsprint, 18x24
long-handled (10) brushes, with a variety of bristle widths. Wash brushes after each
session and store bristles up in a container
clear plastic containers with lids or heavy glass jars for best visibility of color
Brush Painting
Children enjoy painting on flat surfaces. This prevents dripping as can happen frequently
with easel painting and encourages mixing colors.
Materials
The space for brush painting should be large enough to hold an 18x24 sheet of paper
and a flat tray beside it for mixing paint. (Two school-sized desks side by side work nicely.)
Paint containers (plastic cups, juice cans cut to size) can be placed along one edge of the tray
in spectrum sequencered, yellow, blue, black, and white. Also, near the tray the teacher
should place a bowl of water, a sponge, and one or two brushes. Aluminum trays provide the
best resistance to the mixing brush and give enough space for mixing colors. However,
styrofoam meat trays, aluminum foil plates, or egg cartons will work.
Procedure; the teacher may:
! model dipping the brush into a color and dabbing it on a tray surface.
! model how the brush is washed in the water by rubbing it against the bottom of the bowl.
! remove excess water by touching the brush to the sponge, or wiping the brush against the
water container.
! dip the brush into another color and add that color to the one already on the tray. Helping
children keep the brush clean and changing the water often may be a challenge.
Finger Painting
Finger painting is a tactile, rhythmic, free, big, expansive, colorful, gooey, and messy
activity. As a dried product, it is a meager reminder of the rich PROCESS that proceeded. On an
aesthetic level it encourages creative expression through direct contact between creator and
product and lack of any arbitrary standards. On a psychological level it offers the chance to be
expansive and sensory.
Materials and Procedures: the teacher may:
#
! pour out liquid starch on paper and sprinkle on powder paint for the children to mix.
! apply finger paint directly to a tabletop, which provides the freest painting experience.
(Spraying shaving cream on trays or tables can be a step used before paint.) Using the
tabletops avoids any attention to a saved product.
! apply finger paint to large squares of oilcloth (18x24) which can be wiped off; or use
shelf paper or butcher paper, shiny side up and dip it in a pan of shallow water to wet.
! Allow children to experiment with finger paint in a plastic tray. When child decides to
keep a design, an adult can place drawing paper or top to try to make a print.
! have a pail of water nearby for quick rinsing off, to reassure children who worry about
the mess.
! introduce finger painting with one color first. Then add another color choice. Later, all of
the colors may be available for self-selection. The teacher may let the children decide
how many colors and how much paint they want to experiment with.
! let the children use spatulas, sponges, and a shallow pan to scoop the goop and assist in
clean up.
! The teachers role should be to anticipate appropriate limits and offer those limits only
when the children need them. The teacher should not preface the experience with rules, or
the creative PROCESS will be inhibited. Teachers should get into the finger painting
process during the first few sessions, using both hands and demonstrate motions slowly
and rhythmically.
Clay
Clay is smooth, wet, slimy, chalky, sticky and gooey. It is hard and rough when dry. It can
be a very noisy, but relaxing experience. It is messy, pliable, crumbly, unreliable, heavy and a
mass (MASS). It has an earthy odor. Pounding it and throwing it down on the table are healthy,
aggressive experiences for kindergarten children.
Materials
#
square of masonite board, 18x18(use reverse side), will make the clean up easier
because the children can sponge off their own boards.
covered crock for storage. (Clay should be stored as grapefruit sized balls with a deep
hole in each and filled with water. Water may be poured off the next time or worked into
the clay by the children.)
bucket of water for clean up. (Too much clay in the sink drain may clog it.)
Source of clay: dig your own, with the children and use it in its sandy unrefined state, or
buy ready to use clay in a 50 lb. chunk.
! want to save objects. (This may be done late in the year for those children who have
developed some control and skill. Hopefully, their reproductions will be threedimensional animal or people forms, rather than the stereotyped bowl or plate, which
demand less imagination and personal input.)
The teachers role should be to join in at first, pressing, squeezing, pounding while
verbalizing the actions. The teacher should not direct or criticize the children. Instead, let them
see enjoyment with clay just to get them going. Later, the teacher may sit in to watch, listen and
support with interested comments.
Play Dough
Play dough is not a substitute for clay, but has values all its own. It is usually used with
rollers, cookie cutters and other tools. It is a cleaner material than clay. To the child who is
concerned about cleanliness, it offers less of a threat than clay. It may also serve as a steppingstone to the messier materials such as clay and finger paint. Even if dough is presented without
the use of tools, sensory experience is more limited than in the use of clay.
Recipe: 2 cups flour
2 T. alum powder
1 cup salt
2 cups boiling water
1 T. vegetable oil
food coloring (few drops)
Boil water and add food coloring and oil. Mix dry ingredients and all liquid. Stir
and knead when cool. Add more flour as necessary. Store in an airtight container
for up to two weeks. (Note: Save old play dough and add water to soften. Use as
collage bases on styrofoam tray for poking in leaves or things from nature.)
Crayons, Markers and Chalk
These tools are more confining than painting, water play or clay. They demand more small
muscle control and perceptual maturity. Children can create more representational drawings,
which gives them feelings of pleasure and mastery. Markers are an ideal tool to offer children
who want to draw things, because they move with less resistance and offer brighter colors.
Crayon Materials
#
five and six year olds can control the small crayon, but may prefer the larger ones.
all eight colors in an individual can or box, or, crayons in cans by color. (Children are
encouraged to use interactive language skills when sharing materials, and cleanup
becomes a sorting activity.)
! choose not to provide coloring books which promote dependence, inhibition, frustration,
rigidity and stifling of the innate creative experience. (Coloring adult made drawings
conditions the child towards adult concepts which a child cannot produce. Coloring
pictures from coloring books and creating artwork are not the same.)
! demonstrate that if a crayon gets broken or the paper is peeled off, a bare crayon on its
side makes broad strokes of color.
Marker Materials and Procedures: the teacher may:
! Use large size, water-based markers in all eight colors.
! Use newsprint, colored construction paper or manila paper, 12x18.
! Discourage pounding with the felt end. If it happens, point out how the end gets jammed
up inside, making the marker unusable.
! Demonstrate to children how pens dry out when the caps are not replaced.
Chalk Materials and Procedures: the teacher may:
! provide colored or white chalk on chalkboards or black paper.
! provide chalk on wet butcher paper or shelf paper, 12x18 or larger. (The teacher may
wet the paper with a sponge before coloring with chalk.)
! wet the paper with buttermilk batter (water and buttermilk powder mixed to consistency
of thick pancake batter), and brushed on with a wide brush. Colored chalk applied on top
produces vivid, satisfying colors.
! demonstrate how chalk may be dipped into liquid containers and used on dry paper.
Paper, Scissors and Glue
Paper, glue and scissors aid in the development of the small muscles of fingers and hands,
and promote the ability to coordinate hands with eyes. As the child experiments with
manipulating the size and position of various materials, the child develops new concepts of color,
shape, texture and design. In this way, the child is extending and deepening a connection with
the world by shaping some of it to a personal scale.
Materials
#
paper for background; colored construction, heavy white cardboard, roll ends or
wallpaper samples.
glue or paste in individual containers with no brush or stick. (The sensory opportunity of
paste on the finger is an important experience.)
scissors, some left handed, which work easily. Some scissors work with the left and right
hands. (A few loop scissors may be provided for the less dexterous child.)
Equipment; scissors, staples, paper punches, tape. Small individual bottles of glue for
each child.
collage materials can be organized by kind at first, such as feathers, beads, sticks, pine
cones, sawdust. Later, they should be organized by quality: textured, patterned, seethrough (transparent), shiny and shape. Each variety should be stored in a large, clear
container.
fur scraps
velvet corduroy
burlap or sacking
sandpaper
feathers
absorbent cotton
natural materials (dried moss,
seedpods, leaves or bark)
pipe cleaner
lace scraps
sheet materials
organdy
metal screening
nylon net
mesh wire
colored cellophane
colored gelatins
colored tissue paper
Christmas tinsel
Ribbons
aluminum foil
metallic paper
beans
corks
styrofoam
colored drinking
bottle caps
straws
colored toothpicks
macaroni
tongue depressors
colored cupcake
papers
colored string
rug yarn
bead
wire of various weights, in rolls at florist supply house or from telephone company or
electricians.
#
#
The teachers role should be to show some of the possibilities for using the materials,
to organize the working area, and to be genuinely interested in what is gained by the
individual. The teacher should offer constructions and mobiles as special projects several
times during the year.
Ideas for Art Curriculum Connections
S= Science
M=Math
H=Health
The following are a sample of possible art activities appropriate for kindergarten
children. The possibilities for integrating art into other curriculum areas are limitless.
Offering experiences in art develops all concepts and objectives more fully.
Autumn; the child may:
#
Cut and paste with construction paper using colors present in naturered, orange,
yellow, brown. 3-D construction paper (strips can be glued to stand up.)
create collagesmade from materials gathered during a fall field trip or nature
walk. They may use a play dough or meat tray base and poke in leaves, seeds,
feathers, etc., using glue, if necessary. S, S.S.
create with colored tissue paper torn in strips or fall colored shapes that are
brushed onto wax paper with liquid starch. The child may overlap shapes and
hang by windows to show light and transparency.
make snow collages by cutting and pasting using construction paper, cotton balls
and q-tips (white items).
sponge paint and finger paint with red/blue on white paper and red/white on blue
paper, etc.
#
#
create collages with shells, pebbles, colored sand (a few drops of food coloring
and sand in a bottle and shake) - S
do spring cut and paste with construction paper in pastel colors and add
markers/crayons when needed, maybe cotton balls at Easter.
create pastel Easter eggs from tissue paper torn and put on with starch and use
pre-cut egg shapes of construction paper or waxed paper. S.S.
do stitchery with pastel colors of yarn (threaded double so a large tapestry needle
will not come unthreaded). Children can sew through styrofoam meat trays and
may choose colors for variety. fine motor
If we really believe in
a program of creative experiences,
this (the holiday) is no time
to bring out a step-by-step project
for each child to make
according to instructions.
Hoover
Genius At Work
by
Adelaide Holl
The artist bent over his easel
And took up his palette and brush
He sketched in the curve of an outline
In colors all vivid and lush.
I watched him add high lights and shadows
With deftness and delicacy,
convinced that no Reubens or Titian
Worked with greater absorption than he.
He splashed on a bit of ripe crimson.
He blended in scarlet and maize.
Then at length he leaned back from the canvas
And appraised it with critical gaze.
Slowly he turned and presented
That completed creation of his.
See, Teacher! My pictures all finished
Now, help me decide what it is.
BLOCK BUILDING
Block Center
Blocks are the single most valuable material in an early childhood classroom. Their
potential for learning and growth is extensive in scope and depth, and they require the ACTIVE
use of bodies. Because they are open-ended there is no correct way to use them. Children feel
safe and therefore expressive in using them to clarify and strengthen their understanding of
themselves and their world. Children will explore many possibilities; the combinations are
endless. From the beginning stages of simple assembling and making flat patterns to elaborate
enclosures with doors, windows, tunnels and bridges, each child adapts the blocks to a personal
maturity level.
The satisfaction of creating sturdy, three-dimensional buildings out of wood gives a child
important feelings of power and competence, which are important for building a strong sense of
self at an age when children are feeling small and inadequate in the face of the big world. The
building process, which ideally goes on for at least an hour for the maximum involvement and
learning, requires intense thinking. (See chart for analysis of learning.) Block building offers
teachers a unique opportunity to learn who the children really are -- who can use themselves
fully. Who is inhibited and needs support and encouragement? Does that child seem less timid
when building? Whose energy could be well channeled in block building? How could the
reticent be involved so they could develop strong, active thinking skills, too? What are some
misconceptions in the childrens thinking? What content areas are they interested in? What
could be developed for the whole class? Where could we go to see how bridges span?
As children put the blocks away, they stack and carry them by twos, threes, and fours. If
the positions of the blocks on the shelves are marked with a 2-D representation of the blocks, and
with the block name, some children will match the picture with the block form and others might
associate the printed name with the block.
If the number of blocks provided and the space available are adequate, there need be no
formal selection of children who will play in the block area. Instead, there can be freedom of
movement in and out. When children are in the early manipulative stage, their attention span
with blocks is short. As they gain greater experience, they may work for longer periods of time.
When a teacher provides sufficient time for the children to become thoroughly familiar
with a single shape, they can see more things to do with the shape. Some teachers begin a school
year with one or two sizes of blocks available, and leave those shapes out for a period of time so
that the children may discover the many ways in which they can be combined. As a new shape is
made available, the nature of the structure becomes more elaborate. When cylinders are
introduced after one group of children have been playing for several weeks with units and double
units, the wheel is rediscovered and huge automobile and airplanes can be designed.
Sometimes children create a structure that is so important that they can not bear to take it
down, or they are engaged in dramatic play that they wish to continue at another time. If the
room is not shared with another group, the teacher can easily arrange to keep the structure
standing. A sign might be prepared, such as PLEASE DO NOT KNOCK DOWN OUR
BUILDING or PLEASE SAVE OUR HOUSE. If the room is shared with a second group,
arrangements can be made so that the two groups take turns from week to week. Children soon
learn to respect the structures that others have made, and realize that the area is temporarily off
limits. Buildings left standing, may be added to or elaborated the next day.
Role of the teacher
Children of any culture will play with blocks. How a teacher values block play will
determine the time allotted for this activity, the location and size of the area, the quantity of
blocks made available, and the quality of play that results. Because there are so many facets to a
teachers role, it is often difficult to determine the difference between a positive form of
intervention and interference. If comments are never made, the children may lack challenge. If
comments are made too often, the children may become dependent. Play stops when a teacher is
not there, or they may lose interest in the play because it is not truly theirs. Any question asked
should be open-ended and any comment made should extend learning, encourage thinking, or
clarify concepts. When a teacher mentions an individual block by its proper name it helps build
a childs vocabulary. If there is to be purposeful play with the blocks, a teachers strong support
is required. This may be given in many ways. Often this means that a teacher observes in the
block area. Mere physical presence shows interest in what is happening. In a room where no
block play is going on, children usually begin to build if a teacher sits in the area. It will
probably not be necessary for the teacher to say anything. Silent support is an important role of a
teacher. However the teacher may need to find a way to direct a child toward a project, e.g., the
teacher may raise a question about procedure or involvement, or produce objects to enhance
what is happening,
The teacher may use whole group discussion to create rules for blocks. Consideration may
be given to the following:
Those doing the building may not be those who put the blocks away. If a teacher initiates
and is active in the process, the children will join. A teacher who knows the children in the
group may encourage those who do not ordinarily use them to handle them and become more
familiar with them as they put them back on the shelves.
Although blocks are sturdy and long lasting, care should be taken in handling them so that
they remain in good condition. Children learn to value them when they develop the habit of
not stepping on blocks or throwing them.
As children take risks in block building, some of their structures crash. However, good care
of blocks would mean that falling blocks should not be intentional and the teacher can help
the child find an orderly way of taking down blocks without having the structures fall.
A heap of blocks is not enticing to children. Hence it is important that they be returned to the
shelves so that floor space can be made available for the next group. An orderly arrangement
on the shelf is in itself, a stimulus for construction.
When the block area is carefully supervised, blocks are a very safe medium and can be used
in a variety of ways. Sometimes children build structures higher than themselves or test their
strength by carrying big stacks. If a teacher is comfortable with this and close by that may be
a teachers choice. However, many teacher feel it advisable to limit height or amount
carried.
Some teachers feel that blocks should be reserved for the block area. Some teachers
encourage blocks to be used in other areas of the room. They can be combined with drama to
enhance play and enrich the props in a creative and versatile manner.
W=Writing
M= Math
S= Science
While considering enhancing block building it is helpful to remember that there are natural
developmental stages.
Carrying blocks around.
Repeating patterns.
Bridging.
Making enclosures.
Making decorations with or without symmetry.
Building function designs and naming.
Dramatizing.
Unit blocks are considered by many educators of young children to be the most important
teaching material in the kindergarten. They are unstructured, raw and offer multiple
opportunities for learning on many levels.
Unit blocks:
foster skill in manipulating. ---fine motor
give opportunity for creating 3-D forms in space ---M, S
stimulate a growing understanding of the organization and function of the real world,
through the building of representational models ---SS, S, M
develop relationship thinking as the child makes size selections ---M
help build concepts of space and dimension ---M
encourage language development through the communication of ideas and vocabulary
building --- R, SS
establish working relationships with other children ---SS
Many math concepts and skills are developed as children play with blocks. If blocks are
placed on shelves in categories according to size and shape, children become aware of ordering
and classification. As blocks are put away they are sorted matched and classified according to
shape and size. When there is a pictorial representation of each shape on the shelves, children
have the experience of relating a 3-D object to a 2-D form. ---M
If shelves are labeled with the block name, children identify the block with a symbol. In
handling blocks, children become aware of similarities and differences. ---R
When stacking or making a series of stacks, the child practices one-to-one correspondence in
keeping the stacks equal. ---M
Blocks in a tower are part of the whole structure and the concept of whole and its relationship
to its parts are important to understanding basic mathematical processes of addition, subtraction,
multiplication and division. Experience, as with units and double units, helps the child to
recognize equivalency relationships. If a child builds a structure higher than wanted it will be
required to subtract one or two from the whole. As blocks are carried a child deals with
multiples. When deciding to make a single lane road into two lanes a child practices division. In
building a tower, a child gains experience with sets. The constant size and shape of blocks
permits the child to establish internal units of measure. ---M
If the teacher refers to the blocks using special terminology these terms may build a childs
vocabulary and establish recognition for the requirement for special technical words in
specialized fields. ---R
Children may create a map with blocks. Streets, buildings and parks are often created for
wooden road signs and small vehicles. After a zoo trip children often build animal cages. Farms
are often made with various fields and enclosures using wooden farm animals. ---SS
Pillars
Units
Half Units
Quadruple Units
Triangle
Double Units
Cylinders
Ramps
Double Units
Quadruple Units
Curves
Arches
Quadruple Units
a separate spot adjacent to the Dramatic Play Center. Then the extra space can be used and
structures can be left day after day to extend Dramatic Play.
As with Unit Blocks clean up can be a learning experience and as useful as actual play.
Placing shapes matching the blocks on the wall behind where blocks should be stacked helps in
organization. Introducing a few at a time is also a good idea.
Introducing Hollow Blocks
The teacher may talk through rules for hollow blocks. Leading conclusions with
questions may help children realize the danger of roofs, or outside behavior like sliding,
climbing, or running. The teachers attitude about this being a place to build and not fool
around will help this guidance.
Ideas for Using Hollow Blocks and Curriculum Connections
R=Reading
W=Writing
M=Math
S=Science
SS=Social Studies
An adult may label objects created or write dictation of stories being acted out as play
continues. ---R, W, SS
Hollow Blocks may be used for building experiments with inclined planes using vehicles.
---S
Hollow Blocks can become a puppet theatre or props for plays. Children may dictate
scripts and perform. SS,R, W, Art
Blocks should be stored in an organized way, matching shapes drawn on a storage shelf. The
putting-away process thus becomes a purposeful perceptual differentiation at clean-up time.
A copy of outlines for defining block storage and an illustrated letter showing how blocks
teach many areas of the curriculum follow:
Square
Small Triangle
Unit
Large Triangle
Double Unit
Ramp
Quadruple Unit
Small Column
Ellipse
Large Column
Curve
Small Buttress
circle
Half Arch
Gothic Door
Arch
Large Switch
Half Circle
Small Switch
Roof Board
Pillar
Large Buttress
Half Pillar
!
!
!
!
!
!
!
!
!
!
Autonomy
Self-direction
Construction
Dramatic play
Self-expression
Pleasure
!
!
!
!
!
Security
Power
Independence
Discovery
Initiative
! Feeling of Competence
! Cooperation
! Clean-up
SELF ESTEEM
SOCIAL
DEVELOPMENT
SOCIAL STUDIES
!
!
!
!
! Awareness of others
! Awareness of differences
! Respect for work of others
!
!
!
!
!
PHYSICAL
DEVELOPMENT
ART
BLOCKS
!
!
!
!
!
MATHEMATICS
Size: equality/inequality
Space
Shape
Symmetry
!
Mapping
!
!
!
! Area
! Volume
! Measurement
Depth
Width
Height
Length
! Patterns
! Classification
! Order
! Number
! Fractions
Creative impulse
Design
Symmetry
Balance
Form
LANGUAGE
ARTS
! Balance
! Weights
! Inclined plane ramps
SCIENCE
! Interaction of forces
! Gravity
! Stability
!
!
!
!
!
!
!
!
!
!
CIRCLE TIME
CIRCLE TIME
Circle time (also known as group time or opening) is an important component of
the day. This usually occurs at the beginning of the day and is an opportunity for all
students to gather together in a designated area, settle in and become a community of
learners. Although Circle Time tends to be relatively short, 20-25 minutes, it often sets
the tone of the whole day. The purpose of Circle Time is to help children make a smooth
transition from the morning routines of home and traveling to school, to the learning
environment in the classroom.
In addition to making a transition into the learning environment, Circle Time has
an important impact on many social/emotional goals common to Kindergarten
classrooms. The whole group activities help students increase their attention span,
develop listening and speaking skills, and practice appropriate audience behaviors.
Circle Time is also an opportunity for students to generate topics, express opinions,
identify problems and develop problem-solving skills. Many Circle Time activities are
pre-academic in nature as they encompass literacy, math and science activities. Circle
Time activities are valuable in building vocabulary, developing concepts of number,
providing exposure to environmental print, as well as, developing science concepts such
as weather and seasons.
Setting Up Circle Time
A teacher must first determine when they want Circle Time to occur in their daily
schedule. Although most begin their day with a Circle Time, some teachers prefer to
start the day with a story, activity, or centers and then move into Circle time. Individual
schedules and personal preferences will help determine the best time for Circle Time.
After a time has been established, consider a meeting place in the classroom that
is large enough for the whole class, always available, comfortable and conducive to
teacher-to-student interactions, as well as, student-to-student interactions. Many classes
participate in Circle Time activities while they are seated on the floor in a circle. Other
teachers prefer to have a chair available for each student.
Development of Circle Time
When developing circle time activities, teachers should plan for active
participation and allow for student responses. Center time is filled with a variety of
activities and allows time for children to be physically and verbally engaged. Although
well-planned activities often hold the interest of children, flexibility in schedules must be
maintained for spontaneous, student-generated interactions and topics.
Current Events:
Local newspapers and Internet services provide pictures and articles about
interesting current events that may be shared during circle time. Many
times, students will bring articles of interest to share with the class.
Current events may be used to develop thinking and problem solving
skills. This is also a good time to promote thinking skills by using
questioning techniques that encourage higher levels of thinking (as
described in Blooms Taxonomy) in students.
Discussions:
Many circle time activities lead to discussions. Kindergarten students are
easily reminded of experiences and love to share their personal stories.
These stories open up discussions that encourage children to share exciting
moments, fears, problems and concerns. Such discussions develop
appropriate audience behaviors, listening and speaking skills, vocabulary,
and the sharing of problem solving ideas. Teacher posed questions can
encourage higher levels of thinking (as described in Blooms Taxonomy).
Sharing:
Children love to bring items from home to share with their classmates.
Sharing encourages children to speak before a group with confidence. On
a designated day, children may be asked to bring a share item carefully
hidden in a bag. With a family member, they may write several clues to
read to the class so classmates can guess what is in the bag. Teachers may
ask students to bring items that begin with a specific letter or items that go
well with a thematic unit.
Closing Circle:
Many teachers also hold a short closing circle time at the end of the day.
This time is for students to share creations made or written during the day,
discover solutions to problems that may have occurred, sum up an activity,
interpret a graph made in class, or discuss plans for the next day. Teachers
may encourage students to recall specific activities that occurred in school
so the children have something to report to parents when they get home.
sunny
windy
rainy
cloudy
snowy
foggy
Weather chart
COOKING ACTIVITIES
SNACK
Cooking Activities
Kindergartners can learn a great deal from a cooking experience. Cooking is
exciting to children because they like to do things they see adults do, and cooking offers
them real-life experience. It also provides a way for children to feel important and
achieve a sense of accomplishment.
Development of the Cooking Activity
Cooking is often a part of snack since kindergartners naturally will want to eat
what they have helped cook. Good nutrition should be one of the most important
objectives in a cooking program. The teacher has an opportunity to expose children to
healthy foods and help to develop good eating habits. Recipes requiring refined sugars,
flour and ingredients with little food value should be avoided. A teachers attitude about
foods is conveyed to the children. Cooking can be in a whole group, activity center, or
both. The actual cooking can be done in small groups, or even individually at a center,
while discussion and directions can occur whole group. Good projects do not have a right
or wrong result. If the child has done it alone, it will be enjoyed even if it is
undercooked, lumpy, or burned. An example would be making scrambled eggs. Each
child can crack an egg, beat it with a fork, then take it to the adult at the frying pan and
wait for it to cook, and then take the egg back to the table to be eaten. French toast,
grilled cheese, and many other projects can also be prepared in this way.
Some ways to gather ingredients for cooking activities:
An amount of money is collected at the beginning of the year as part of the supplies
needed.
An assigned snack person brings in the ingredients.
Each child brings in a needed ingredient (e.g., a fruit, for fruit salad).
Setting Up the Cooking Activity
A recipe can be displayed in picture form to allow children to see the sequence of
events in the process of food preparation. A different approach would be to have the
teacher direct a cooking project and then have children create their own recipe to use
again at home. An adult must supervise the cooking activities center, preferably not the
teacher who has to take care of the many distractions and interruptions in the classroom.
The center should be well supervised for safety and health reasons. Some projects, such
as vegetable salad, may require several steps. A table for each activity could be set up
with the children at one table washing and tearing lettuce, another table for cutting carrots
and celery, and still another for grating cheese. In this way, a multiple step-cooking
project could be a cooperative activity. By talking about which children did which
activity, the whole group could enjoy the finished project.
A well-planned cooking project is the secret to success with large groups of
children. It is essential for the teacher to provide enough equipment and ingredients for
each child to have the proper tools. Good organization will guarantee an enjoyable
activity.
W=Writing
M=Math
S=Science
SS = Social Studies
H= Health
Cooking can provide many opportunities for cognitive, social and cultural
learning. ---SS. Children can use their five senses to explore cooking activities. ---S.
Kindergartners also begin to learn about units of weights and measure, how to use tools
properly, and the language of cooking. M,R. Through cooking activities the children
learn to work together in a sharing effort. SS. Because foods and cooking illustrate
cultural difference, children can be exposed to ethnic groups and diversity. SS
A cooking experience is a good example of integration of curriculum areas in the
kindergarten classroom. All learning is through the senses: and as food appeals to all the
senses it becomes a powerful learning tool. Sensory development is enhanced as children
practice taste and smell differentiation; touch and sight to compare food texture, size,
appearance and even hearing, as in tapping melons. Small muscle coordination comes
with chopping, stirring, and squeezing. Kneading, mixing, tossing are large muscle
coordination activities. SS,S, motor skills
The success a child experiences in creating something good to eat improves a
childs self-image and confidence. Cooking skills help develop a sense of independence.
Children also gain experience in cooperation and respect for the work of others. They
share ideas in planning a meal or snack. Foods are identified and named. Food functions
are described. The child may write stories about food, and read recipes to practice
language arts in cooking activities.
--SS, W, R
Cooking and food preparation can awaken artistic expression. Awareness of
color, form, texture, shape, and balance can be enhanced through cookingapples are
red, yellow, or green; grapefruits are spheres and have sections; carrot slices are circles.
The color, texture and shape of food inspire creative expressions. All cooking projects do
not require heat or actual cooking, but rather food preparation; cutting, slicing, chopping,
scrubbing or mixing Art, motor skills
People may be alike and different as they have different tastes. John likes cooked
carrots and Mary does not; but both like vegetable soup. Safety and sanitation are
practiced. The teacher stresses careful use of tools and ingredients in food preparation.
Children can be guided to emulate certain behaviors i.e., sitting straight to digest food,
taking turns serving, taking a fare share of food when eating, to help develop self-respect,
as well as, respect for other children. SS
Cooking experiences help a child become more aware and appreciate family roles
and how working together, sharing tools, and dividing work benefits all. Children enjoy
hearing about and seeing different foods from different countries. They discover much
about their own family background and ethnic backgrounds through food. Differences in
climate and culture can come alive through stories, pictures, and projects. Geography,
transportation, lifestyles, and media impact can determine where food comes from,
availability and food choices. --SS
Science concepts are learned as a child investigates and discovers the nature of
food. The child finds the origin of food plant, animal and synthetic. Food changes
from one state or form to another as the child mixes and creates temperature changes.
Field trips enhance knowledge of food processing and food quality. Kindergarten is a
good time to begin the study of the origin of food and growing things. How does a plant
grow, what does a plant need to grow, where does it grow, and when does it grow? What
is an egg, and why does it hatch? What effect does food have on the way we feel, look,
and behave? S,H
A sense of quantity and measurement are developed through preparing and
serving food. Measuring for recipes, timing, the dividing of proportions (fractions) and
the setting of the table all involve mathematics. The child counts the number of cups in
the recipe. The child can classify the varieties of food and focus on size, shape, and
space. M
As children prepare and eat food, the opportunities to learn, express, write and
read new concepts are endless. As the teacher works with children, the teacher should
use the correct term for the food, equipment, or process i.e., pop corn, dissolve powder in
liquid, squeeze oranges, melt butter, boil water, taste bitter, etc.R.
The child
recognizes and differentiates shapes, sizes, and signs, and begins to read labels and
follow recipe directions. R,M,S The child expresses questions, concerns and exchanges
ideas. Children may want to bring home a recipe to share with families. Picture recipes
for the year may make a great Mothers Day present. Letters to parents help to reinforce
classroom objectives. SS
A cooking activity can center around culture studies (e.g., Native Americans),
literature (e.g., The Gingerbread Man, Stone Soup), ethnic backgrounds (e.g., tacos,
kugel), alphabet letters (e.g. A is for applesauce, B is for butter), or holidays. The
number of times in a year that a class cooks is a teacher and group preference. Cooking
is fun and it offers kindergartners a wide variety of experiences and learning
opportunities. SS,R, W,H
Project_______________________________
small groups
(circle one)
(CHOICE: hot or cold food)
______________________
______________________
______________________
______________________
Procedure step by step (include preliminary preparation if any and what assistant
cooking volunteer can do)
1. _______________________________
6. ________________________________
2. _______________________________
7. ________________________________
3. _______________________________
8. ________________________________
4. _______________________________
9. ________________________________
5. _______________________________ 10. ________________________________
SAMPLE
The following is an example of how a cooking experience may be introduced
and carried out.
Applesauce
Part of an Autumn Apple Unit
+ We tell a star in the center story
+ We write in apple shaped journals and create apple prints at art
+ After graphing the apple color chosen (many colors available) the child
estimates how many seeds are in the apple
+ The estimate is written on a large construction paper apple created by
the child
+ The hand and apple are washed. Clean apples and paper apples are taken
to a table where an adult cuts the apple star out
+ The star and seeds are taped onto the paper apple. The actual number of
seeds are written onto the paper apple and circled.
+ The adult supervises while the child dices the real apple.
+ The entire class will fill an electric frying pan. The adult will measure
with the class watching 1 teaspoon of cinnamon, cup of sugar, and 1 cup
of water
+ The apples need to cook about 15 minutes and cool somewhat.
+ The class helps squish the apples with a potato masher. Discuss while
working how the apples changed. Note the color, the smell, and the
texture
+ The class can eat together. Use cups and spoons. While eating write a
recipe together. It can be sent home in the next newsletter, or made
into a job for the next day. The job could require each child to illustrate
it, write about it and then take it home.
A is for Applesauce
1. 6-8 medium sized apples
2. peel
, slice
Honey
1 slice apple
cut
(1)
slice pineapple
cut
(2)
5 raisins
(3)
banana
cut
5 small marshmallows
(4)
(5)
1 lettuce leaf
torn
1 slice zucchini
cut
Toss in a
Salad bowl
dressing:
sour
cream
(1)
vinegar
sugar
tsp
(2) Tarragon
Vinegar
1T
salt
Pour on salad
(3)
pinch
(4)
dash
(carrots)
2. Peel
(carrots)
3. Grate
(carrots)
In
(bowl):
Put
Put in 10
Put in 1
Stir . . . .
Eat . . . .
Yum! Yum!
(cup)
(carrots)
(raisins)
(spoon)
(pineapple)
Toss
Eat!
Snack Time
Snack time is another opportunity to integrate basic concepts and good nutrition into the
kindergarten program. Snack time can be a whole group activity or a small group activity.
Development of the Snack Program
A calendar may be sent home monthly with a childs name assigned to each day if snack
is done on a daily basis. A basket sent home the day before as a reminder and a carrier is helpful
when snack is done daily. The reminder may also be a simple as a sticker the day before.
To stress good nutrition a letter to parents may be sent home.
Dear Parents,
Starting October 17, we will have a self-help snack area set up in our
kindergarten room during our area time between 9:00-10:00 for morning, and
12:15-1:15 in the afternoon.
This area is set up to provide opportunities in self-help skills; preparing a
snack, cleaning up, pouring, buttering, spooning, etc. This is also a time to sit and
chat with friends.
The area is set up for children to sign in by name, shape, or anything being
worked on that day. They rotate into other areas when they have finished their
snack, to let other children have a turn. Please make snacks easy for the child to
prepare, i.e., with enough napkins, spoons, cups, or whatever is necessary. You
may also want to tell your child or write a note telling how many each child is
allowed, i.e., 2 crackers and 2 pieces of cheese, or 2 slices of apple, or 1 bag of
popcorn. Not all snacks have to be prepared by children - be creative this is a
fun time for the kids.
Birthdays may still be celebrated in a large group snack if the child wishes.
There are 24 children in the morning with a few helpers and 25 with a few helpers
in the afternoon.
We all appreciate the nutritional snacks that we have been eating; fruit,
celery and peanut butter, popcorn, trail mix, peanut butter balls (a big hit), and
many, many more. Thanks for your support.
Bon Appetit!
W=Writing
M=Math
S =Science
SS=Social Studies
H=Health
Snack may be used to reinforce a letter of the week. The name of the food may be written on
a wall chart dictionary being created by the class. ---W, R
Directions for preparing snack may be written by the child providing it, or by the class
dictating it as a whole group. --- R, W, M
Food may be described as falling into a specific section of the basic food groups. ---S, H
Snack times are a social experience providing a time to practice sharing, good manners, and
good hygiene. ---SS, H
DRAMATIC PLAY
teacher choice
No matter how the dramatic play theme is chosen collaboration, at some point,
between the children and teacher is an important part of the process. The theme should
fit certain criteria:
!
does it directly relate to a life situation that is meaningful for the children?
can the theme be supported by gaining information from other sources; such as, field
trips, classroom visitors, audiovisuals or books?
will the choice of theme lend itself to opportunities to expand childrens interests,
experiences and concepts?
does it offer opportunities for discussion and problem solving of social situations as a
means of fostering personal growth and building a sense of community?
thoughtful arrangement will facilitate clean up and foster independence. The equipment
should be sturdy enough for group use and small enough for a child to use alone. Many
times materials from other centers can be appropriated to enhance the dramatic play
center. Hollow blocks are particularly useful in building the foundation for furniture
and other play structures in the center.
Introducing the Dramatic Play Center:
Introducing the center and modeling the kind of play to take place there is critical.
We shouldnt assume that children would know how to use the materials appropriately.
Role-playing some brief activities in the center provides an ideal opportunity to solicit
the childrens help in setting limits and developing rules for play. Depending on the type
of dramatic play center, four children at a time has proven to be a reasonable number in
most classrooms and is an effective playgroup.
Dramatic Play Center Example:
Development
The kindergarten year in Ms. Samples room, started with a house theme
in the dramatic play center. Ms. Sample chose this theme because she felt all
children could relate to some type of home environment, the theme was part of
her school curriculum and she could use materials and props that were readily
available. After several weeks of initial free play in the center, Ms. Sample
noticed the children consistently role-playing as customers and waiters. She then
guided the class in a discussion of eating establishments. They explored the roles
of the workers and customers in a restaurant and Ms. Sample scheduled a field
trip to a local pizza parlor. They decided their next center would be the Kinder
Cafe.
Set Up
With the childrens help, Ms Sample gathered materials for the cafe and
decided what furniture from the house could be used. She decided to use the
same house area because it was relatively self-contained and far enough away
from quieter areas of the room. In an adjacent area, the block center, she placed a
wooden steering wheel platform and hollow blocks that could be used to build a
car to take diners to the restaurant. Within the cafe space she arranged two
seating areas and a kitchen. Props included:
! play food: sorted into six
to look full)
! silk flowers in a vase (2)
! student-made menus with
money
! teacher-made Guest Check
telephones (2)
full length mirror / hand mirror
high chair
cradle
clothes rack
steering wheel platform
housekeeping set (broom, mop, and dustpan)
set of toy pots/pans
dress-up clothes
grocery cart
play money
ironing board/iron
doll stroller
Recreation Areas
Farm
House
Teepee
Trailer
Log Cabin
Aquarium
Bowling Alley
Puppet Theater
Childrens Museum
Campsite
Zoo
Cafe/Restaurant
Architects Office/
Construction Site
Bank
Chicken Farm/Hatchery
Doctors Clinic
Invention Factory
School Office
Space Center
Veterinarians Office
Science Laboratory
Pet Shop
Beauty Parlor/Barber Shop
Department Store
Farm Stand
Greenhouse/Nursery
Grocery Store
Ice Cream Parlor
Toy Shop
Shoe Store
Book Store
Carpentry Shop
Public Service
Fire Station
Drivers License Bureau
Hospital
Library
Police Station
Post Office
Airport
Weather Department/ TV Station
Labeling center props and environmental print are two of the easiest ways to
bring reading into the center. Many times writing opportunities are best served in a
separate center where the writing assignment serves as a ticket to enter the dramatic
play area. Cooking activities and science experiments that are part of the play center will
need to be simple and designed for independent child use with little adult supervision
needed.
Ideas for curriculum connections:
R = Reading
W = Writing
M = Math
S = Science
SS = Social Studies
Homes:
!
!
!
!
!
Recreation Areas:
!
!
!
!
!
Public Service:
poster illustrating the water cycle (TV station) ---S
!
filling out simple health forms (hospital) ---W
!
labeling basic road signs (drivers license bureau) ---R
!
I.D. tags for emergency room workers; ambulance driver, nurse, doctor, orderly
(hospital) ---SS
!
FIELD TRIPS
Field Trips
The purpose of a field trip should be to extend the childs knowledge of the
environment. The goal is to provide the opportunity for the child to gather and assimilate
knowledge in order to gain a more complete understanding about the real world. The trip
is most meaningful when its purpose is to seek answers to childrens questions or satisfy
curiosities about a particular concept that has been introduced in the classroom.
Kindergarten children enjoy first hand experiences; they want to go see for themselves.
People resources, stories, videos, pictures and discussions can supplant these
experiences. Later in the classroom, this information can be assimilated and transformed
by dramatic play in order to produce real learning.
Planning the Field Trip:
An important criterion for choosing field trips for kindergarten children is a trip
that allows children to be active participants and not merely on-lookers or a captive
audience. The teacher should explore possibilities within the community that will meet
the childrens needs. In all cases, the teacher should scout the trip site and chat with the
people being visited. The teacher should arrange transportation well in advance, whether
it is by bus or volunteer drivers. This would be a good occasion to include mothers,
fathers, grandmothers, or grandfathers, as a way of involving them in the education life of
the group and to extend their own perspectives of the community.
The teacher should prepare the children by discussing with them a few days in
advance where you are going and why. The teacher should speculate with them about the
anticipated experience and formulate some simple questions that the trip might answer.
This will give the trip a focus. Kindergarten children need practice developing the
concept of what is a question? The teacher may want to role-play asking questions and
have the students determine true questions from telling stories.
The teacher should plan on carrying a traveling first-aid kit, tissues and a cell
phone. A portable microphone system is helpful. It may be utilized on the bus trip as
well as, to enhance the presentation and help the group stay focused. The teacher or a
volunteer should plan to take a camera to document the experience and add to follow-up
reinforcement activities.
Conducting the Field Trip:
The teacher should review basic safety rules; stay with the group and hold your
partners hand. Adults should space themselves strategically at the front, middle, and end
of the group and be assigned to a small group of children. A 5:1 child to adult ratio is
recommended. Controls are necessary and procedures for travel must be spelled out
clearly and carried through, but over-insistence on perfect lines and handholding will kill
the spirit of the event. Five-year-olds are orderly in a general way but do not expect
army efficiency in conforming to rules.
On the bus ride to and from the field trip, the teacher may utilize previously
learned songs, finger plays, chants and poetry. Open-ended songs/chants that adults can
join work best i.e. Who Stole the Cookies? as well as, songs that can have student
names inserted and childrens classics i.e.: Eency, Weency Spider. Rhythmic clapping
activities are good time-fillers and help to hold the group together if it is beginning to
disintegrate. Doing pattern searches outside the bus windows is another management
idea. If a portable microphone/speaker system is available, passing the microphone
around the bus and allowing children and adults to introduce themselves is another
helpful idea. A battery operated cassette/CD player would be useful to keep the children
in tune or just as a quiet listening activity. (The bus driver will especially appreciate
this one!)
During the presentation the teacher can model and express genuine interest by
asking questions in thought-provoking terms; i.e., I wonder how . . . What do you
suppose . . . with out pressing for an instant answer. This will help guide the children
when the opportunity arises for asking their own questions.
Follow-up from the Field Trip:
After the trip, when the children have digested their impressions, the teacher may
initiate discussions, starting with the main question, and making other simple generalities
using whatever props are appropriate.
Curriculum Connections and Reinforcement activities might include:
W=writing
R=reading
M=music
B=block-building
A=art
!
!
!
L=listening
CM=creative movement
the possibilities for learning should not be overlooked by the teacher. Children need to
have their curiosities aroused. The teacher will want to plan for the visitor and perhaps
write a group invitation and have questions formulated in advance. Follow-up activities
might include a special note of thanks and role-playing and dramatic plays based on
identification with the guest.
Possibilities for Field Trips
!
!
!
!
!
!
!
!
!
!
!
!
!
!
pumpkin farm
apple orchard
turkey farm
general farm with livestock
gas station/auto repair
road construction crew
sign painters
veterinarian practice
fire station
nature preserve
grocery store
train depot
city bus ride
pizza parlor
!chicken hatchery
!bakery
!farmers market
!shoe repair shop
!radio/TV repair
!building site
!horse stables
!post office
!zoo
!local tour train
!pet store
!National Guard Armory
!childrens museum
!hospital
firefighter
mail carrier
carpenter
dentist/hygienist
artist
college athlete
musician
chef
mother/new baby
! police officer
!store manager
!doctor/nurse/EMT
!veterinarian
!TV personality
!armed forces personnel
!dancer
!hair stylist
!scientist
HEALTH ACTIVITIES
Health Activities
With kindergarten as a childs first introduction into public education, it is
important to have a variety of health activities so children get an early start establishing
good health habits. In many schools the school nurse and counselor take an active role in
providing many of the activities, but it is important to provide activities that are not
covered or need extra coverage. Teachers may want to contact the school counselor and
nurse at the beginning of the year to see which person is willing to cover which area.
This will ensure that the identified objectives are covered. Many activities fit well into
other curriculum areas or can even be covered with a center approach.
Introducing Health Activities
Large group activities lend themselves well to the health curriculum. It is
important that children understand that these issues are very serious and beginning with
childrens literature or a short film may help activate interest and create an atmosphere of
seriousness. Some of the topics, like personal safety and bathroom hygiene, may need to
be covered several times throughout the year. An especially good format tot use with
health units is role playing; nothing captures the attention of a kindergarten student more
than watching their peers act out situations.
Recommended list of Health Materials in order of priority
!
!
!
!
!
!
!
!
exercise
! Bring a snack to eat at the park, in a group setting. Or, have a discussion about
(This discussion may well cover many other aspects of the health curriculum as
children talk about smoking, drinking, or drugs)
Communication Skills for Healthy Relationships:
! Use a family set of puppets in the puppet center and/or have each child create their
LIBRARY LISTENING
Library Center
The library center is a comfortable, quiet spot for children to choose, explore and
enjoy a variety of written materials. Reading in this center can be shared with others, or
students can read quietly alone. This center provides a wonderful extension for thematic
units that are occurring in the classroom.
Don Holdaway, a New Zealand Educator, claims in his book Foundations of
Literacy that the developmental model for how children learn to read includes these four
steps:
1. Students observe demonstrations.
2. Students are encouraged to actively participate in the demonstration.
3. Students practice reading independently.
4. Students gradually become confident and competent in their own skills.
The library center plays an important part in a kindergarten language arts
program. It is in the library center that students try out, or practice independently, the
reading skills and strategies they have observed in class. When a student rereads a book
that has been read by the teacher during a shared reading activity, the student will be
strengthening their confidence as a reader. They are establishing an understanding of
story structure, expanding their vocabulary, strengthening conventions of print and
developing sound-symbol relationships.
Development of a Library Center:
The teacher should choose an area in the classroom that will be designated as the
library center. The reading that takes place in this center tends to be a quiet activity, so it
is best to locate this center close to other quiet centers. Many classrooms are able to
define their library center with a reading loft. If reading lofts are not available, a carpet
with beanbag chairs, a small child-sized couch with pillows, a tent, or even an old bathtub
full of pillows may define the space. Whatever is chosen to use for the library center, it
should be kept in mind that the purpose of the library center is to provide children with a
quiet, comfortable place to enjoy books.
When choosing books for the library center, a variety of genres should be
represented. Fact and fiction, poetry, and charts, predictable books, magazines, and classmade books should be included. Most importantly, books the children have enjoyed
during a class shared reading activity should be put into the library Center to provide
children with independent practice. Too many books in this center may overwhelm
children, so only a few books that are appropriate to thematic units and from class read
alouds should be used. Books should be changed often so students do not become tired of
the materials in this center.
Listening Center
Like the library center, the listening center is a quiet place for students to listen to
cassettes and CDs. The listening center provides children with an opportunity to hear a
story repeatedly, developing the associations between written and spoken words.
Conventions of print are also developed in this center as students independently follow a
text with the spoken word. The listening center is a wonderful extension for thematic
units that are being taught in the classroom.
Development of a Listening Center:
A quiet place is needed for the listening center. The center is often placed near the
library center. This center includes a tape player and/or CD player, as well as, headphones
for a specific number of children. The teacher may choose to have a specific tape with
multiple copies of a book in this center, or students may be provided with a choice of
books and tapes. Children also enjoy listening to music and following along in
songbooks.
For management of tapes and books, it is helpful to color code tapes and
corresponding books so children may operate the listening center independently. It is also
convenient to put color codes or markings on the tape player itself so children can also
learn to operate the tape player independently.
Flack, Marjorie, and Kurt Wiese. 1933. The Story About Ping. New York: Viking.
Fox, Mem. 1989. Koala Lou. New York: Harcourt Brace.
1993. Time for Bed. New York: Harcourt Brace.
1995. Tough Boris. New York: Harcourt Brace.
1996. Zoo-Looking. Greenvale, NY: Mondo.
Frasier, Debra. 199 1. On the Day You Were Born. New York: Harcourt Brace.
Freeman, Don. 1964. Dandelion. New York: Viking.
Geisel, Theodore. 1957. The Cat in the Hat. New York: Random House.
Gibbons, Gail. 1985. The Milk Makers. New York: Macmillan.
Giganti, Paul, Jr. 1992, Each Orange Had 8 Slices. New York: Greenwillow
Greenfield, Eloise. 1972. Honey, I Love. New York: Thomas Y. Crowell.
1991. First Pink Light. New York: Black Butterfly Children's Books.
Hague, Michael. 1992. Twinkle, Twinkle, Little Star. New York: Morrow.
Hale, Sarah losepha. 1990. Mary Had a Little Lamb. New York: Scholastic.
Harley, Bill. 1996. Sitting Down to Eat. Little Rock, AR: August House.
Harris, Robie H. 1996. Happy Birth Day! Cambridge, MA: Candiewick.
Hartman, Gail. 1991. As the Crow Flies: A First Book of Maps. New York: Bradbury
Hayes, Sarah. 1986. This Is the Bear. Cambridge, MA: Candlewick.
Heller, Ruth. 1981. Chickens Aren't the Only Ones. New York: Grosset and Dunlap.
1991. Chrysanthemum. New York: Greenwillow.
Henkes, Kevin. 1996. Lillys Purple Plastic Purse. New York: Greenwillow.
Hest, Amy. 1995. In the Rain with Baby Duck. Cambridge, MA: Candlewick.
1996. Baby Duck and the Bad Eyeglasses. Cambridge, MA: Candiewick.
Hill, Eric. 1981a. Spot Visits His Grandparents. New York: G. P. Putnam.
1981 b. Spot's First Walk. New York: G. P. Putnam.
Hoban, Tana. 1989. Of Colors and Things. New York: Greenwillow. -.
1990. Exactly the Opposite. New York: Greenwillow.
Hoberman, Mary Ann. 1978. A House Is a House for Me. New York: Scholastic.
Hopkins, Lee Bennett. 1988. Side by Side: Poems to Read Together. New York: Simon and
Schuster.
Houston, Gloria. 1992. My Great Aunt Arizona. New York: Harper and Row.
Howe, James. 1984. The Day the Teacher Went Bananas. New York: E. P. Dutton. -,
1986. There's a Monster Under My Bed. New York: Atheneum.
Hutchins, Pat. 1968. Rosie's Walk. New York: Macmillan.
1972. Goodnight Owl. New York: Macmillan.
1986. The Doorbell Rang. New York: Greenwillow.
Isherwood, Shirley. 1996. Something for James. New York: Dial.
Jeunesse, Gallimard. 1994. Pyramids. New York: Scholastic.
Johnson, Angela. 1989. Tell Me a Story, Mama. New York: Orchard.
Johnson, Dolores. 1994. Papa's Stories. New York: Macmillan.
Johnston, Tony. 1996. Once in the Country: Poems of a Farm. New York; G. P. Putnam.
Jonas, Ann, 1989. Color Dance. New York: Greenwillow.
Kandoian, Ellen. 1989. Is Anybody Up? New York: G. P. Putnam.
Kellogg, Steven. 1988.Jlohnny Appleseed. New York: Morrow.
Killilea, Marie. 1992. Newf. New York: Philomel.
Literacy Activities
Literacy
Literacy is the ability to use reading, writing, thinking, and speaking in the real word.
Literacy implies that a student will not only read and write in school, but they will also
apply their literacy skills to everyday situations. Literacy acknowledges the reading and
writing connection.
This section deals mostly with the reading aspect of literacy. Writing information can
be found in the Writing section.
Children enter kindergarten classrooms with valuable literacy skills already in place.
They are often able to read environmental print such as the names of favorite restaurants
and favorite toy stores. They possess emerging writing skills such as scribbling or picture
drawing. Their skills have been developed through meaningful situations at home and/or
in a preschool setting.
Kindergarten, being the first year in a public education setting, is a crucial time in the
literacy development of a young child. The goal must be to instill a love of literacy in
children. They must see themselves as readers and writers. Teachers must value the
literacy skills children already possess and help them develop those skills so they enter
first grade with useable knowledge about print. What kindergarten teachers are required
to teach in the area of literacy has changed dramatically in the past five years. Mandated
tests for kindergarten are being implemented to assess how well teachers and students are
doing in this area.
Development of Literacy Activities
New research shows that children need to enter first grade with a strong knowledge
about literacy in order for them to be successful. This knowledge can be grouped into five
main areas:
! Alphabet recognition: Knowing the names of the letters and the sounds they
represent, as well as, the Alphabetic Principle; which includes an understanding that
each phoneme has its own graphic representation.
! Conventions of print: These concepts are also referred to as print awareness skills and
they refer to print concepts such as directionality and book knowledge. Students must
also have the ability to identify the language terms used in reading instruction, such
as word, sentence, space, beginning, middle, end, sound, period and question mark.
! Phonemic Awareness: The knowledge that a word is made up of specific phonemes,
or sounds, and the ability to verbally manipulate these sounds.
! Phonics: The ability to apply the specific sounds in words to our written symbols.
This goal encompasses decoding, word analysis, and word recognition strategies
necessary to reading.
! Instructional language: The ability to identify terms used in reading instruction, such
as word, sentence, space, beginning, middle, end, sound, period and question mark.
variety of writing materials (such as chalkboards or dry erase boards). Teachers should
allow students time to explore and duplicate letters in this center.
5. Alphabet CerealHelp children to discriminate between the similarities found in letters and then look for
the differences found in letters. Alphabet cereal can be used to sort letters according to
similarities and differences.
6. Letter WritingIntroduce letter writing practice along with letter recognition activities. Learning to write
the letters helps children remember the shapes. Students should be provided with lots of
unlined paper as they begin the writing process.
7. Clever poemsUse clever poems as a memory tool to help students remember how to write their letters.
Scholastic Spelling (1998) has a poem for each letter for this purpose as well as the
DNealian Writing program. Waterford Early Reading Program also has a set of sayings
to go along with each letter.
Conventions of Print and Comprehension Activities- the teacher may:
1. Read-a-LoudUsing a read-a-loud is a perfect way to develop concepts of print and reading
comprehension in a whole group lesson, especially if the read-a-loud occurs daily. The
teacher should choose a book with a predictable text. Big books work well for a read-aloud as do poems copied onto large chart paper. Steps to follow might be:
# Introduce the story by looking at the front cover and reading the title. Ask
students to make predictions about what they think may happen in the story. Help
children develop background knowledge (schema) and vocabulary they may need
to understand the text.
# Read the book aloud, stopping occasionally to check for comprehension, ask
questions to stimulate high level thinking skills, and make more predictions.
# Reread the book again, but this time use a pointer and point to each word as you
read. Invite the children to read along with you when they are ready. This will
help children develop many conventions of print such as top to bottom and left to
right progression.
# After reading, promote discussion that will encourage children to summarize the
story, develop character understanding, describe settings, and relate the story to
their own lives. After the read-a-long, place the book or poem in the library center
so students can continue the lesson with independent practice.
2. Poem Anthology with IllustrationsType or copy each poem that has been introduced to the class in a read-a-loud activity.
At the end of the week students may reread the poems with a classmate to insure that
their illustrations match the text of the poem. Then they can illustrate their copy of the
poem. Rereading the poem provides students with independent practice with conventions
of print. These illustrated copies can be put in a notebook for each child to bring home at
the end of the school year.
3. Book Club:
Pull a group of three or four children together and, over a several day period, read many
versions of one story such as the Three little Pigs. The teacher can lead the small group
in discussions that encourage children to compare and contrast the stories.
4. Picture/word/sentence:Take a photo of each student (a digital camera works well for this) and mount it on a
sturdy piece of paper. Under each photo the teacher can write the students first name and
put all the photos into a notebook. After looking at the photos and reading the one word
written under each photograph, the notebook can be placed in the writing center for
several weeks. When students are familiar with the names of their classmates, the teacher
may gather the class together with the notebook and ask students to help you write one
sentence under each photo which will help you learn more about each student. As the
teacher writes the sentences, a description of how the sentence has more than one word,
spaces between words and punctuation marks at the end may be added. Students will love
to study the photo directory in the writing center.
Phonemic Awareness Activities- the teacher may:
1. Rhymes copy a favorite poem with rhyming words onto chart paper. As the class reads the
poem, the teacher can change the poem by inserting different rhyming words.
make rhyming word strings by saying three rhyming words to the class such as
man, can, fan.. and encouraging the class to think of as many words as
possible to add to the string, such as tan, van.
play Read My Mind. The teacher says, I am thinking of a word that rhymes with
dog and starts /h/ hog.
use cloze activities and ask students to complete sentences with a silly rhyme,
such as:
There once was a dog who had a funny ______.
2. AlliterationsMake a class book using alliterations that have been written and illustrated by students.
One student can write alliteration, such as Pink pigs play Ping-Pong and then another
student can illustrate the alliteration. They may be placed in a book in the library center.
4. Taking RollWrite each students name on a card and place in a pocket and choose a question each
morning such as Does your name start with a /s/? The teacher may write a question on
a sentence strip and place at the top of the pocket chart. As students arrive at school they
will find their own names and put them into the YES row or the NO row. Later in the
day, read the pocket chart with the class and count the number of names in each row.
This same activity can be used for beginning, medial and final consonants and also
counts as a math extension activity in graphing.
4. Silly NamesWrite each students name on an index card. Place the cards in a pocket chart. Select one
capital letter and write it several times on separate index cards. Cover the first letter of
each childs name with the capital letter. Invite children to read the new silly names.
5. Silly Soup Class BookDraw a large soup bowl and reproduce for each student in the class. Ask students to
complete the sentence In (Janets) soup there are jelly beans, jewels, and jump ropes.
The teacher may bind all soup bowl pages into a book and place in the library center.
6. Segmenting and Blending Activities:
$ Bean Bag Toss: the teacher may say a CVC word slowly, and as you say each sound
is said, a beanbag will be tossed from student to student. If your word is cat, the
beanbag will be tossed to three people /C/ toss to person one, /A/, toss to person
two, T toss to person three. The whole class then blends the word together.
$
Rubber Band Stretch: The teacher may give each student a fairly large rubber band
and ask them to lock their thumbs and forefingers around the rubber band and
stretch out words. The teacher tells students we are going to stretch out the word
cat. Students may slowly stretch out the rubber band as they say the word
CCCCCCCCAAAAAAAAATTTTTTTTT then snap the word back together again
and say Cat.
GLOSSARY OF TERMS
Alphabetic Principal: The idea that each phoneme has a graphic representation.
Phonemes: Units of speech that are represented by written symbols such as the alphabet.
Phonetics: The way in which speech sounds are articulated, such as how the teeth,
mouth, tongue and vocal chords are used to produce a sound.
Phonics: The system in which symbols represent sound. A method of teaching reading
and spelling that emphasizes sound-symbol or sound-spelling relationships.
Phonological Awareness: An umbrella term that includes phonemic awareness, as well
as other skills dealing with word units larger than a phoneme, such as words within
sentences.
Phonology: The study of rules governing our speech.
Phonemic Awareness: Awareness that our speech is made up of a series of specific
sounds and the ability to manipulate the phonemes found in our speech. Phonemic
Awareness includes the following tasks:
$
Alliteration the ability to hear and produce tongue twisters such as Peter Piper
picked a peck of pickled peppers.
Syllable Splitting the ability to identify onsets and rime. (onsets are the first
consonants in a word that come before the first vowel. A rime is all the sounds that
follow. In the word front, fr is the onset and ont is the rime.
Phoneme Isolation the ability to identify the beginning, ending, and middle sounds
in a word.
Phoneme Addition the ability to add beginning, middle, or ending sounds to a word.
Phoneme Substitution the ability to substitute the phoneme from the beginning,
middle, or end of a word thus creating a new word.
The following are literature lists which are organized by literacy concepts such as:
alphabetic principle, rhyme, alliteration, phonemic manipulation and phonemic
awareness.
ALPHABET BOOKS A TO Z
A, B, See! by T. Hoban (Greenwillow, 1982)
A, My Name Is Alice by J. Bayer (Dial, 1994
The ABC Bunny by W. Gag (Sandcastle, 1978)
ABC: Egyptian Art From The Brooklyn Museum by F. C. Mayers (Harry N. Abrams, 1988)
Abracadabra to Zigzag by N. Lecourt (Lothrop, Lee & Shepard,1991)
Alfred's Alphabet Walk by V. Chess (Greenwillow 1979)
Alison's Zinnia by A. Lobel (Greenwillow, 1990)
All in the Woodland Early: An ABC Book by J. Yolen (Boyd Mills, 1991)
Alphabears: An ABC Book by K. Hague (Holt Rinehart & Winston, 1984)
An Alphabet of Animals by C. Wormell (Dial, 1990)
An Alphabet of Dinosaurs by W. Barlowe.(Scholastic, 1995)
Alphabet Out Loud by R. G. Bragg (Picture Book Studio, 1991)
Alphabet Puzzle by J. Downie (lothrop, Lee & Shepard,1988)
Alphabet Soup by A. Zabar (Stewart, Tabori & Chang,1990)
Alphabet Times Four: An International ABC by R. Brown (Dutton, 1991)
Alphabetics by S. Macdonald (Bradbury Press, 1986)
Animal Alphabet by B. Kitchen (Dial, 1984)
Animalia by G. Base (Abrams, 1987)
Anno's Alphabet: An Adventure in Imagination by A. Mitsumaso (HarperCollins, 1975)
The Ark in the Attic: An Alphabet Adventure by E. Doolittle (David Godine, 1987)
Ashanti to Zulu: African Traditions by M. Musgrove (Dial, 1976)
Aster Aardvark's Alphabet Adventures by S. Kellogg (William Morrow, 1987)
C Is for Curious: An ABC of Feelings by W. Hubbard. (Chronicle Books, 1990)
The Calypso Alphabet by J. Agard (Henry Holt, 1989)
Chicka Chicka Boom Boom by B. Martin, Jr. and J. Archambault (Simon & Schuster, 1989)
City Seen From A to Z by R. Isadora (Greenwillow, 1983)
Crazy Alphabet by L. Cox (Orchard Books, 1990)
David McPhail's Animals A to Z by D. McPhail (Scholastic, 1989)
The Dinosaur Alphabet Book by J. Pallotta (Charlesbridge Publishing, 1991)
Eating the Alphabet: Fruits and Vegetables from..A to-Z by L. Ehlert (Harcourt, 1994)
Eight Hands Round: A Patchwork Alphabet by A. W. Paul (HarperCollins, 1991)
Erni Cabat's Magical ABC Animals Around Farm by E. Cabat (Harbinger House, 1992)
A Farmer's Alphabet by M. Azarian (David Godine, 1981)
From Acorn to Zoo and Everything in Between in Alphabetical Order by S. Kitamura (Farrar,
Straus and Giroux, 1992)
From Letter to Letter by T. Sloat (Dutton, 1989)
The Graphic Alphabet by D. Pelletier (Orchard, 1996)
Geography From A to Z: A Picture Glossary by J. Knowlton (HarperCollins, 1988)
Gretchen's ABC by G. D. Simpson (HarperCollins, 1991)
Gyo Fujikawa's A to Z Picture Book by GFujikawa (Grosset & Dunlap, 1974)
The Handmade Alphabet by L. Rankin (Dial, 1991)
The Icky Bug Alphabet Book by J. Pallotta (Chariesbridge Publishing, 1986)
It Begins with an A by S. Calmenson (Hyperion, 1993)
Jambo Means Hello: Swahili Alphabet Book by M. Feelings (Dial, 1974)
The Monster Book of ABC Sounds by A. SnowA (Dial, 1991)
My Alphabet Animals Draw Along Book by D. Heath (Knight, 1994)
MANIPULATIVES/
FINE MOTOR
gears
plastic coins
colored 1 cubes
multi-colored links
MATH
Math Activities
Math is in every center and part of each day in the kindergarten classroom. Math
experiences may be done in a variety of ways including whole group, small group,
individual child, or center style. Mathematics Their Way, a K-2 program by Mary
Baratta-Lorton, provides a variety of tubbing ideas that may be used for math activities.
Mathematical development in young children is nurtured when children are allowed to
pattern, classify, compare, manipulate concrete objects, count and develop an
understanding of number through free exploration, and through guided learning.
a range of materials from their environment over an extended period of time. The
concept of conservation should be introduced and developed in this way. Activities
involving counting forward (addition), counting backwards (subtraction) and counting be
twos (multiplication) should also be introduced this same way and teachers should
always remember that doing and understanding these activities is more important than the
verbal expression of the actions. The design of the math program should provide for this
gradual evolution of ideas.
The following are examples of strategies to teach math objectives and are
organized according to specific curriculum objectives. For each objective, the teacher
may have children:
Understand and use numbers:
!
Perform computations:
!
at snack time, count snacks and eat one then see how many are left
Problem-solving skills:
!
draw maps to a location charting the shortest distance then use them to check
reasonableness
use playdough and cookie cutters and create number stories and solutions
Apply technology:
!
use a variety of glasses set out in twos, a pitcher of water and fill them in a variety of
ways telling which is more, less, or the same
Measurements:
!
use one inch links to measure objects from around the classroom
play Lift the Bowl (in Math Their Way) with one child manipulating the cubes and
the other documenting the combinations
go on a walk and identify shapes, compare sizes of objects and practice over, under,
around and between while walking
graph who walks, rides the bus and gets picked up from school and discuss how many
are in each category, which is most, least or the same
graph favorite activities using real, pictorial, and representational graphs and discuss
the differences between each graph
create patterns and read them to the teacher when completed and then explain how
the pattern would be extended
Music
Creative Movement
Music Strategies
Music provides a natural form of expression for the child, beginning with
rhythmic movement and basic sound syllables. An appreciation of music is developed
through singing, listening, creative movements, and playing instruments. The child learns
new words, concepts and cultural understanding through music.
The beginnings of music for children are rooted in motor-sensory experiences and
natural play. Children continue to experiment with movement and sound, gradually
learning to associate them with meaningful ideas. Music becomes a deep, integral part of
the personalityan expression of feelings and thinking comparable to painting.
Development of Music Activities
The teacher will need to enjoy music with children in many ways. Singing
spontaneously during cleaning, transitions and circle time are a few ways. Children
actually enjoy a simple sounding voice, so dont worry about your talent. Kindergarten
students sing because it makes them feel good. Teachers should work towards the same
goal, regardless of talent!
Musical experiences that involve the whole child should be provided. The teacher
should use verse or familiar tunes while giving directions or doing daily opening or
transition activities. Teachers should include activities throughout the course of the year
that include the following areas, which are vital to a good music program. These can be
considered goals for a kindergarten music program.
Pulse
Find the basic underlying beat.
(singing games, clap/pat/tap, counting beats)
Rhythmincludes notes of long and short duration.
. Move to a steady beat
. Play a steady beat.
Pitch/Melody
. Identify high and low sounds.
Creative Movement
. Perform actions to a song.
. Perform a dance to a song.
. Play games with movement.
. Move in response to tempo changes.
. Move parts of body (walk, jog or gallop) to a steady beat.
. Explore free movement with a steady beat
Instruments
. Play non-pitched instruments loudly or softly.
. Play non-pitched instruments to a steady beat.
. Play non-pitched instruments as rhythmic accompaniment to the rhythms of a
song or poem.
The teacher should offer easy to play instruments such as tambourines, xylophones,
bells, maracas and shakers. Children can make many of these at the art table. Also,
introduce each item and describe how you would like it used. Talk about what might
happen to the instruments if they are misused. Children should be given an appropriate
amount of time to explore with the instruments, before they can be expected to reproduce
rhythmic patterns or play on cue.
Singing
. Become familiar with new songs and fingerplays.
. Sing in a regular voice instead of a shouting voice.
. Choose songs for the class to sing together.
Teachers should select songs that are easy and fun to sing and sing with the children.
The teacher should use both high and low sounds and teach the children how to produce
them, but choose songs in a limited range of just a few notes and avoid wide skips across
the scales. Many experiences for making up different words to familiar tunes should be
provided.
Listening
. Recognize the presence of soundAuditory Awareness.
(Move to a sound, change directions, freeze to a signal)
. Distinguish between sounds and categorize them such as high/low, loud/soft, or
fast/slowAuditory Discrimination. (Indoor/outdoor sounds, different rhythms)
. Reproducing sounds in a particular orderAuditory Sequencing. (Echo games,
pulse activities, water filled jars for high/low)
Joe Scruggs,
Ella Jenkins,
Nancy Cassidy,
Kidsongs,
Kid Songs
Wee Sing
I
II
Jubilee
Mary Miche,
Earthy Tunes
Jane Murphy,
Metacom Inc.,
Piggyback Series,
Piggyback Songs
Songs for School
Holiday Songs
More Songs for School
Circle Around
Tom Glazer,
Roberta and
Lucille Wood,
SS=Social Studies
M=Math
H=Health
PD=Physical Development
PHYSICAL DEVELOPMENT
!
!
!
!
20 parachute
Bean bags (alphabet bean bags)
Hula hoops (6)
Sponge balls variety of sizes
Jump ropes (6)
The following are examples of strategies to meet physical development goals and are
organized according to specific curriculum objectives. For each objective, the teacher
may have children:
Ability to move through space;
# Find a space in the classroom and listen to a record, tape, or CD and move with the
music. (This is a great way to incorporate music and movement into physical
development activities!)
Science
Science is a perpetual search for whatever information will lead to a deeper and
more clear understanding of the relationships and principles governing the existence
of life on earth.
Science Activities
Very often a science program for kindergarten revolves around a table that
contains magnifiers, plants, rocks, shells, magnets, bones, or a variety of other
collections. This exploration table leads to handling the objects, talking about them,
and making discoveries. Children will begin to identify problems, form and test
hypotheses, and measure, record results, draw conclusions, and make generalizations. As
the children use the scientific process, they develop a sense of wonder and an awareness
of themselves in relation to the world.
Setting up Inquiry Activities:
A good science center does not require a great quantity of expensive materials.
Some basic equipment may be used, like magnifiers (hand held and stand variety)
balance scales, and magnets, and other items may be changed according to the themes
used during the year. By using materials common to their environment, children become
comfortable with the freedom to investigate. A covered water table or a child height desk
would be an excellent place for an inquiry center. Water cannot be used constantly but
often is an extension of the inquiry activities. As in most centers, there should be a limit
to the number of children allowed. Two children can often interact well in this small
center. Since this center is not used whole group (although often introduced whole
group) it can be small and more or less tucked into a small space. This could be a good
use for a few feet to the side of a hall type space even next to a door where the traffic
flow is only when the entire class is going in or out of the room. Posters with a science
content relating to the current activity or theme can be placed on the wall above the table.
Small independent experiment instructions can also be displayed in this manner.
Children come to school with a sense of wonder, already knowing a lot about
themselves and the world. Teachers should strive to build on their existing knowledge
and let their sense of wonder grow and flourish. As a teacher begins a science center, the
childrens interest may dictate areas of inquiry. A teacher may also have a particular
interest in a material or topic and would like the children to share in that area. The
teacher should also consider what themes are being taught throughout the year and what
topics need to be addressed as curriculum goals.
Introducing the Inquiry Activities:
Free exploration is important. Yet the wise teacher should identify rules and
expectations for the children. Most science center materials can be moved easily to a
whole group to introduce, demonstrate, create curiosity, and then returned to be used
independently. The first few days of a new emphasis may be a good time to have a
volunteer hover near the inquiry table. Some activities that need a lot of supervision
may need a checklist and a volunteer to make sure every child has a chance to do the
experiment. A teacher may wish to develop a chart to post near the science table for
volunteers to read while helping.
SAMPLE CHART
FOR GUIDING THE INQUIRY PROCESS
SCIENCE
Child will initiate project, work only at Science Area, and clean space and
return materials to proper space when finished. If interest expands into another
area, an adult must be available and observing.
Examples:
!
!
!
Water and bubbles may be moved outside on the lawn or in the sink
Constructing ramps for velocity and weight experiments may end up in blocks or
on large tables.
Magnets would need to be moved to discover what objects in the room would
attract or repel.
Such integration is desirable. However, this needs adult supervision so materials can
be returned and children remain on task.
Children of kindergarten age need to rediscover knowledge themselves.
Resist the temptation to explain. Instead, ask Why did this happen? What might
happen if . . .? How could we make . . .? Accept answers. Ask children to explain the
reason they think something is. Deal with the process. Encourage problem solving,
curiosity, interest, and allow the materials and activity to stretch the mind and
integrate the scientific method into all phases of life.
Volunteers may opt to take dictation, write stories or equations from what
happens. These may be hung up or shared with the whole group.
Purpose:
Everyday materials can encourage children to explore, manipulate, and
experiment with life in general. The process of understanding cause and effect; and
making guesses and testing them is the basis for all science.
sugar
balloons
cotton
zip sealing bag
A popular science center activity is a sink and float exploration. Many different
variations can be found in most young children science books. The following is an
example of how a simple experiment can include all of the parts of a classic scientific
inquiry experiment.
Sink and Float: a sample of the scientific inquiry process
Brainstorm questions that can be investigated.
Lead a discussion about water. Preferably after there has been adequate time for
free exploration in a water table with many different objects available. Ask what there is
about water that can be investigated. Tell the class that they are all scientists if they just
follow certain steps. The first thing is to find an area of interest about water that can be
made into an experiment. List all suggestions. Agree that you think all these areas could
be investigated. Ask permission to help the class devise a plan to investigate sinking and
floating. Most children would be obliging.
Conduct scientific observations.
Experiment with various tools that are used in gathering data.
Guide the class in discovering a way to sort what sinks or floats. Take all
suggestions. Ask questions about how to keep the water off the floor, how to separate
items, how to remember and make clear to everyone which place is for floating and
which is for sinking. Most classes will want three containers one for unsorted, one for
sinking items clearly marked, and one for floating items clearly marked. You may
suggest a combination of both words and pictures for marking. The class usually decides
to have a laminated paper on the bottom of a container with sponges or towels. Some
think of permanent markers, some even wish clear containers with paper underneath.
Allow the class to spend some time in experiments with no permanent data keeping.
sink
float
1.___________________
1.____________________
2.___________________
2.____________________
Some Hints;
. Have two children work at a time, one to record and keep the paper dry, the other to
actually place the objects in the water.
. Mark objects with a number or letter (letters actually seem to work best)
. Limit the number of objects.
. Check the water table hints under the Sensory Activity section of this guide.
After modeling the procedure, allow students to turn in one paper each over several days.
metal lids the same size with different numbers of holes punched
a plastic bottle with a tube on the top and a small hole in the bottom (a submarinewhen filled with water it will be submerged/when air is blown in and water forced out
it will float)
W=Writing
L=Listening
M=Math
S=Science
SS=Social Studies
The following areas of inquiry are for possible inclusion in a science program.
The science program, of course, is not limited to these areas, does not require the use of
every activity here and is considered an integral part of all other areas of the curriculum.
The science center is an excellent place to meet science curriculum objectives, as well as,
objectives from other content areas.
Inquiry #1: Growing Crystals.
Dampen briquettes, porous rocks or sponges and saturate with a mixture of 6 T. water,
3tsp. Salt, 6T. bluing, 3T. ammonia and food coloring if desired. Sprinkle 3T. salt over
display.
In a few hours a coral-like growth of crystals begins to grow. A chemical change takes
place. The stages of growth can be measured and comparedM
them over.
! Add a sand filled container with a spout as the weighted object.
! Discover and predict the pattern made by the sand pendulum.
! Count the number of times the pendulum crosses midpoint before coming to a stop. --
affection. A pet may take as much time and consideration as a teacher desires. It would
be important to include the children in the cleaning and care of the animal. Local pet
stores can give valuable information on making choices and needed care. Nothing could
be more traumatic than the death of a loved little creature because proper care was
neglected.
Development of the Exploration Table:
The childrens current interests may dictate the focus of the exploration table as
they contribute found items and observe, experiment, and predict. Again, the teacher
may have a personal collection of materials to share with the class or curriculum goals
may dictate the theme of the exploration table.
Setting up the Exploration Table:
The exploration table should be located in a low-traffic area and be placed at a
height that facilitates child discovery. Along with the exploration items, many types of
literature rich in photography and illustrations such as field guides and resource materials
should be presented. An adjacent area can display photographs, artwork, posters, and
hanging specimens. Two children at a time is a reasonable limit and yet still provides
an opportunity for cooperative learning and language/social skill development.
Introducing the Exploration Table:
The teacher should introduce exploration activities to the class as a whole group,
even if this means moving items to a different area to facilitate the introduction. The
teacher should model the use of scientific tools with items on the table. The teacher
should guide the children in a discussion of rules and guidelines. Some items on the table
may be described as just look and it can be explained that other items can be touched.
The distinctions should be made clearly to the children.
Exploration Table Themes and Curriculum Connections
R=Reading W =Writing S=Science SS=Social Studies M=Math
H=Health A=Art
The following themes for exploration tables are suggested topics only. The
kindergarten science program is not limited to these themes nor does it require the use of
these specific ideas.
#
#
#
#
#
#
#
#
#
#
Ocean Life
Birds
Insects/Spiders
Signs of Autumn
Five Senses
Models of Human Anatomy
Plant life
Geology: Rocks
The Environment
Animal Groups
Ocean Life:
Items may include: shells, driftwood, coral, dried animals, models, sand and beach glass
! sorting activities to discriminate plant from animal, living from non-living--M, SS
Fossils:
Items may include: fossils of shellfish, plants, insects and animals/non-fossils may
include; beef, chicken, pork, and reptile bones. Also included: models of fossil skeletons,
museum postcards, seashells, and animal teeth
! sorting activities to discriminate fossils from non-fossils --M
Birds:
Items may include: types of nests, feathers, eggs and eggshells, preserved specimens, owl
pellets
! responding to posted questions i.e. What do birds have that no other animal have?
--R
Insects /Spiders:
Items may include: ant farms, old aquarium with butterfly larva, polyurethane specimen
blocks, live specimen containers, nests and hives, web models.
! weaving materials may include variegated yarn and sticks to make webs.--A
Signs of Autumn:
Items may include: leaves, vegetables, cones, seedpods, nuts, fruits, fur samples
! cultural artifacts may be included to illustrate fall harvest celebrations.--SS
Five Senses:
Items may include: food specimens, dried flowers and herbs, candles, animal hides,
geological specimens, recordings of animal sounds, individual slide projector with slides,
kaleidoscopes, mirrors, and telescopes
! illustrate the sounds on the animal recording. --A
Human Anatomy:
Items may include: models of the ear, eye, heart, skeleton, brain, and posters illustrating
body systems
! matching pictures of healthy habits to related body parts. --H
Plant Life:
Items may include: bulbs, nuts, pinecones, fruits/vegetables, leaves, bonsai plants, seeds
sprouts, various types of plants, soil samples, mulch, water, terrarium.
! growing log to document plant growth. --W
! leaf rubbings, fruit prints, and collages. --A
Geology: Rocks
Items may include: globe, types of rocks; metamorphic, sedimentary, volcanic, etc.
fossils, polished stones, sand, and water
! sort and classify rocks.--M
The Environment:
Items may include: living/non-living items, trash collected from a clean-up walk, manmade and natural trash, recycling signs w/sample items
! list ways to conserve energy.--W
! sort trash by recyclable and garbage. --M
Animal Groups:
Items may include: collections of small animals to illustrate groups like; pets, zoo, exotic,
extinct, farm, wild, endangered, fictional
! animals are graphed according to each group. --M
! illustrations for each animal group. --A
! write stories about animals.W, R
Some Childrens Science Books:
Dear Mr. Blueberry by S. James
The Very Hungry Caterpillar by Eric Carle
The Tiny Seed by Eric Carle
Chameleons are Cool by M. Jenkins
I am a Seed by Jean Marzolla
Lets-Read- And-Find-Out-Science-Books Crowel ,Franklin M. Brantley (eds)
Where Does Thee Butterfly Go When it Rains? By Garelick
The Carrot Seed by Ruth Krauss
Fish is Fish by Leo Lionni
The Chicken and the Egg by Pantheon
The Dead Tree by Alvin Tresselt
A Tree is Nice by Janice May Udry
Endangered Animals by Stone
Recycling by Lepthien, E and Kalbacken, J
Water, Water Everywhere: A Book about the Water Cycle by Berger M& G
Hearing, Sight, Smell, Taste, & Touch by Parramon, J
Earth by Sorensen, L
What Makes the Weather? By Palazzo
Backyard Insects by Selsam, M
Big Bug Book by Facklam, M
Bugs for Lunch by Facklam, M
About Reptiles: A guide For Children by Sill, C
Some Series Listed With Publishers:
What Am I? (Raintree Steck-Vaughn) 8 titles
Ranger Ricks Naturescope Series (Chelsea House) 17 titles
Plants: Lifecycles (Bridgestone) 4 titles
Hello Reader Science Level 1 (Scholastic) 6 titles
Weather Report (Rourke) 6 titles
Look Once, Look Again (Gareth Stevens) 12 titles
SENSORY ACTIVITIES
be responsible for clean up. Long handled brooms are not recommended as they can be
clumsy for use by children. There is an overlap between sand and water. Many of the
containers used for water may also be used with sand.
Recommended List of Sand Materials - listed in order of priority
!
!
!
!
!
!
!
!
W=Writing
M=Math
S=Science
Sand Table
Add props for any thematic unit. Dinosaurs, cars, people, buildings, etc. will
create even more opportunities for social interaction. --SS, S, M
Labeling or dictation of what is happening in sand can be a great activity for a
parent helper. --W, R
(Illustrated directions may be provided for any of the following. --R M)
Sand Painting --S, fine motor, art
.
.
.
.
Place a small amount of sand in the bottle. Add a few drops of food coloring and shake.
Squeeze glue onto paper in any design or manner. Pour colored sand on the paper.
Sand Casting --S, Art
.
.
.
.
Mold damp sand in the lined box. (Fake fossils-- S) Pour in the Plaster of Paris and put
a paper clip in the plaster for a hook.
Sand Timers -- S, M
.
.
.
.
Make a hole with the nail in each lid. Place sand in one jar. Put the lids on both jars.
Tape lids together. Time the sand flow. Vary type and amount of sand to gain desired
time.
Teachers may wish to post a sign for parent helpers. This could be adapted for any
center where a parent volunteer may wish guidance. The following is a sample:
Purpose:
Sand is a good medium for experimentation and necessary to internalize
mass, conservation, and other scientific concepts. The tactile experience is
valuable for some learners, as, well as relaxing. The social interaction and drama
possibilities are endless.
W = Writing
M = Math
S =Science
SS = Social Studies
4Pouring, transferring, forcing, funneling, holding back with a straw, changing with
color, soap, or oil --S, M
4Investigate a wide range of things to determine if they will sink or float, or both (e.g.
cotton). A laminated paper for sorting material may be used. (Show a picture of an
object sinking and write the word sink. The other half would show a picture of
floating and the word float.} This would make such experimentation more
independent and would be a nonpermanent method of recording results. --S, M, R
4Experiment with drops of water on wax paper, look at the shapes, blow them around.
How does soapy or oily water act on wax paper, tin foil, wood, or tissue paper?--S, M
4Pour water into a clear container. Add paper clips until the water is level. How many
clips did it take? Make the water spill over. Try different objects? Compare the size
of the objects with the number it takes.-- S, M
4A chart could be used to record what happens.--W, R
4Does water change things? Try nails, bread, onions, beans, soil, etc.--S, M
4Heat water. Catch steam on a shiny or cold surface. Watch the cover on a boiling pot
of water. Watch steam move a pinwheel.--S
4Freeze Water. What changes? Feel it. Melt an ice cube. How long does it take?
Can you change the speed? Estimate. Experiment. Recheck. Catch snowflakes on
frozen black paper. Look at them under a magnifier.--S, M
4Watch food coloring drop into water. Does it mix without stirring? Use one drop
each of two primary colors. Try all combinations. Try all three. Add two drops of
one and one of another.--S, M, Art
4Look at marbles, buttons, stones, etc., in a clear container of water. How do they
change?--S
Social Studies
Activities
All the learning that takes place in kindergarten could be called Social Studies. Social
Studies is how people live together and share
common experiences. Thematic units in kindergarten are often centered around Social Studies
concepts.
Social Studies
Social Studies is the study of how people that share a common environment define
the conduct, standards, organization and activities of their society.
Within a
developmental kindergarten classroom, all the learning that takes place could be called
social studies. Social Studies concepts are often the ideas that generate the thematic units
that connect the kindergarten curriculum.
Development of Social Studies Units:
The social environments of study for kindergarten are; the concept of self, family
and the community. In addition to these, the kindergarten teacher may develop additional
units that cover other concepts identified in the social studies objectives. Thematic unit
ideas may also generate from the kindergarten children themselves, as the teacher
recognizes a particular interest in their play and conversation. Wherever the idea comes
from; curriculum dictated, teacher assigned, or student generated, social studies objectives
can be easily met through any thematic unit.
Setting Up Social Studies Activities:
Materials for use in social studies come from life situations and require very little
commercial materials. A globe, some maps, posters and some puppets may be all that is
provided in the classroom. The majority of materials can be gathered from real life, as
props and artifacts. Field trips, classroom visitors, audiovisuals and books also support
the social studies concepts. A good literature list is critical to setting up social studies
activities in the kindergarten classroom.
Introducing Social Studies Concepts:
An important area for the introduction of social studies concepts is through the
dramatic play center. A well-developed center can provide opportunities for discussion
and problem solving of social situations as a means of fostering personal growth and
building a sense of community. This center can also provide opportunities for children to
interact with real props and artifacts in order to facilitate their understanding of social
concepts that may be beyond their own experiences. These concepts may be taught
through centers such as dramatic play, but can also be the focus of whole group
discussions.
Curriculum Connections:
The following is a sample of a social studies thematic unit that illustrates some of
the curriculum connections that can be implemented in a kindergarten classroom.
Literacy Activities A shared reading activity with the book Dont Forget the Bacon by P. Hutchins (a story
that plays with rhyme and is about a little boy who is going shopping for his mother)
Manipulatives/Fine Motor Activities Community helper puzzles: doctor, firefighter, police officer, mail carrier, dentist
Game table: Monopoly Junior, Play Mobile Community Set
Math Activities Balance scales and other types of scales used to compare/contrast food items
Food items in the grocery store may have prices added
Music/Rhythm/Creative Movement Activities The Corner Grocery Store by Raffi
The Wheels on the Bus
Do You Know the Muffin Man; change the lyrics to
Do you know the grocery man, the grocery man, the grocery man,
Do you know the grocery man who works at Albertsons?
(garbage man/BFI, doctor/St. Lukes, use parent jobs/workplace, etc.)
Creative movement; children work in pairs to pantomime the actions of workers/jobs
while the rest of the class guesses and then joins in
Physical Development Children form train by locking arms with elbows and chugging up a hill
Science Activities Place small pieces of food into empty film containers, (peanuts, lemons, cinnamon, etc.),
children smell the contents and match a picture to the smell
Sensory Table Sand table; children draw city map in the sand and add props like vehicles, miniature
block houses, small plastic trees, small train set and tracks
Technology Applications Richard Scarrys Busytown by Davidson
Workbench Center Set up a REPAIR SHOP; place old appliances at the workbench and use small hand
tools (screwdriver, hammer, pliers, clamps, etc.) to fix and take apart
Writing Activities As a group, children generate a list of items to be purchased at a grocery store, children
add cut-outs from food ads and magazines, this list is posted in the writing center with
strips of paper for children to write a shopping list before entering grocery store (dramatic
play)
Some other Social Studies thematic ideas might include units called:
!
All About Me
Transportation
Babies/Growing
Food
Clothing
The Farm
Holidays/Seasons
Pets
My Family
Machines
The Neighborhood
TECHNOLOGY
APPLICATIONS
TECHNOLOGY APPLICATIONS
In preparing children to live successfully in our technology driven environment, a
teacher needs to help them become familiar with computers. Kindergarten is certainly not
too early to introduce the variety of services that a computer can perform. Computers
have a place in the kindergarten classroom as an educational tool to reinforce
kindergarten concepts.
Technology applications in the kindergarten classroom include:
4A variety of computer activities, especially those for non-readers;
4A developmentally focused kindergarten program;
4Teacher knowledge of the computer and of young childrens learning.
Development of Technology Applications
Software programs for the kindergarten classroom should be educationally sound.
Programs that consist of simple games are not appropriate. The software should have a
focused goal, such as letter/number identification. There should be a variety of levels
offered, as children will come to school with different abilities. Ask yourself the
following questions about the software programs available:
!
Is it teacher friendly? Can you move about the classroom, or are you tied to the
computer? Can you fix problems easily and quickly? If a program frustrates you, it
probably frustrates the students.
The single largest factor in the success or failure of computers in the kindergarten
classroom is the TEACHER. Computers should be viewed as an opportunity. They may
require work to learn, but the benefits to the students are worth the effort. Important
factors to be considered are the teachers:
!
Professional outlook.
Willingness to learn.
It may be helpful for teachers to spend time presenting a few lessons to acquaint
children with the computer keyboard. A paper copy of the keyboard (see following) may
be used as a whole group activity. The teacher may direct students to find certain keys
like ESC, Enter, Shift, spacebar and arrow keys. It may also be helpful to practice
typing student names on the keyboard.
Introducing Software Programs:
After the teacher previews new software, the teacher may gather the class around
one computer. The teacher may introduce the name of the program and talk about the
options available. For instance, some programs will be simple letter identification. There
are also word processing and publishing programs. The teacher should let the students
know what the program is about and demonstrate some areas they can explore.
Recommended List of Computer Software -listed in order of priority within subjects;
Reading
Sound It Out Land
KidspeakTransparent Language
Dr. Seuss ABCs
Baileys Book House
Franklins Reading World
Writing
Kidworks--Davidsons
Storybook WeaverMECC
Math
James Discovers Math
Millies Math House
Number Maze
Nick Jr. Play Math
Science
The BackyardBroderbund
The TreehouseBroderbund
The PlayroomBroderbund
Multimedia Bug Book
Sammys Science House
ZoopolisKidsoft
McGee SeriesDavidson
Social Studies
Richard Scarrys BusytownParamount
Great Adventure SeriesFisherprice
Gus Goes to Cyberstone ParkKidsoft
Miscellaneous
Trudys Time and Place House
Thinkin Things, Col. 3Edmark
Tessel Mania Deluxe--MECC
Crayolas Amazing Art Adventure
Putt Putt Goes to the Moon
Madeline Pre-K and K Deluxe
Ready for School
Madelines Rainy Day
Parts of the Computer
Computers do many jobs for us. Each part of the computer has its own job.
There are:
4Parts to receive information
4Parts to give information
4Parts to do work
4Parts to remember things while the power is on (short term memory)
4Parts to remember things when the power is off (long term memory)
Item
Duty
Monitor (screen)
Output
Printer
Output
Processor
Work
Keyboard
Input
Graphics
Mouse
Input
Modem
Memory (RAM)
Floppy Disks
Hard Disks
CD Rom
Storage
WORKBENCH CENTER
Workbench Center
A workbench center helps children to express creativity using wood as the media,
and offers building as a means of non-verbal expression. The workbench center offers
children an opportunity to plan and work with others to solve common problems and also
to relieve tensions. Whether it is as a carpentry bench or a take apart center, these
activities help children to discover concepts of quantity, length and inequality, develop
large muscle coordination, problem solve and improve eye-hand coordination.
Development of the Workbench center as a carpentry activity:
The teacher may place a log on end to teach hammering. The grain is open and a
nail can be driven in easily. Roofing nails are easy to hammer into a log. The heads are
wide and the length is short enough to allow children to pull it back out. Later in the year
the teacher may introduce the saw, soft wood scraps, and a nail assortment. It is best to
use only a log, goggles, roofing nails, and hammers during the first hammering
experience.
The log on should be the floor in a position where dividers, walls or the table
surrounds children while hammering. All children must wear safety glasses and it is
recommended to have an adult sized Plexiglas divider surrounding the carpentry table.
Setting up the Workbench Center:
The teacher can draw the shape of the hammers, goggles, saw, and nail containers
on a table or shelf to facilitate cleanup and safety. The saw teeth should be placed against
a barrier to the far left of the table so while a child is hammering the teeth are against a
wall and not in a position to cut hands. Some teachers prefer hanging all equipment on a
divider. The shapes of the equipment can be drawn on the pegboard in the wanted
position. The vise is for holding the wood while being sawed. It should be on the far-left
edge of the table (directly in front of the saw). There should be room for the wood to
extend out through the vise to the left of the table. That is where children will stand
while sawing. Consideration should be given to lighting, storage, ease of cleanup, and
adequate space for movement. Some teachers mark the floor with a line to show where
no one may pass while the center is in use.
Introducing the Carpentry Center:
When starting woodworking for the first time, the teacher should be available
during the whole time for close supervision. Children should be taught that tools must be
kept at the workbench and that they are to be used only for the purpose for which they are
designed. They will need instruction in learning to use the tools properly. The teacher
should point out the seriousness of using adult tools and may want to arrange for a
carpenter to visit the classroom. One child is the safest number to allow in a carpentry
center. It may be advisable to only allow one child as a watcher. In a whole group setting
the teacher should discuss the names of the tools and where they are kept. A child model
may be used to introduce log hammering first, and later, when children are adept at
hammering, sawing and hammering soft wood pieces may be introduced. The teacher
can lead the demonstration using a 13-oz. hammer that is the easiest for most children to
handle, but some children will do well with the 16 oz. The teacher or model should grasp
the hammer near the end of the handle. This gives maximum leverage power and drive.
The head is raised by a backward movement of the forearm and is terminated by a
forward flip of the wrist. The weight of the hammerhead should provide the added force
to drive the nail. The teacher demonstrates tapping the nail till it stands by itself. Then
moves the hand holding the nail out of the way so that fingers and thumb are safe. A
good way to limit time is to allow a child to hammer only three nails. Later when the
desire to hammer has decreased and there are few waiting, children may be shown how to
pull out nails.
When the teacher decides it is time to introduce the saw and soft wood scraps, the
saw may be introduced in the same manner as the hammer. The vise should be used for
holding the wood. When sawing, the teacher should demonstrate placing feet facing the
workbench, slightly apart for balance and control and sawing with the elbow in a straight
line with the saw, and the other hand resting on vise for balance. The teacher can
demonstrate putting the saw teeth on the wood near the handle end and pulling the saw
towards the body several times and making a groove. When sawing, a slow steady
rhythm is better than short fast movements. The teacher may repeat, Back and forth,
back and forth, to demonstrate the rhythm. If the elbow is not in a straight line with the
saw, the saw will bend and not cut. The saw should be held at a 45-degree angle. If the
wood vibrates while being sawed, the wood should be moved into the vise or clamp as
near to the place being sawed as possible and still permits freedom of movement. The
vise serves as an extra hand.
Strict rules should be enforced about always setting the saw back into its place
when not in use. A saw lying around is very dangerous. If a proper place for the saw
exists and it is put away while not actually sawing it will limit accidents. A saw in the
way, while hammering or moving wood, is easily bumped with hands.
After introducing the carpentry bench the teacher may review the following
procedures:
! Choose two pieces of wood (narrow one on top).
! Choose proper nail (should go 2/3 of way into bottom piece of wood).
! Hold the hammer? (near the end of the handle)
! Begin with a few short taps.
! Then move hand out of the way.
! How do we put tools away? Why is it important to put them away?
At circle time, the teacher may have children who have hammered talk about their
experiences.
Many children find satisfaction simply by sawing wood for the supply box and
watching a pile of sawdust grow, or pounding nails into a large, soft chunk of wood. The
teacher should not expect children to create finished products, although some children
will.
Recommended List of Carpentry Center Materials - listed in order of priority;
In addition to the woodworking tool set listed in the Basic Requirements list, the
following is suggested:
!
!
!
!
!
!
Softwoods should be selected for children to use, as they need to feel progress
quickly. It takes about half the time to saw through a piece of softwood as it does to saw
through a piece of hardwood. Working with hard wood is very frustrating to children and
they give up when success is hard to achieve. However, hardwood can be used later in
the year for gluing structures together. The desirable softwoods are white pine, balsa,
poplar and basswood. Plywood is not good for young children. It splinters on one side
when sawed.
Accessories
.
.
.
.
.
buttons
bottle caps
cardboard
cedar
cheese boxes
.
.
.
.
.
cigar boxes
empty spools
glue
leather scraps
lids
.
.
.
.
linoleum
scraps
metal jar tops
pieces of cloth
pieces of soft
.
.
.
wire
string
tubes from
paper towels
Closet poles and broom handles may be cut and drilled to make wheels.
Extra Additions and Curriculum Connections for Carpentry Center
R = Reading
W = Writing
FM = Fine Motor
A = Art
M =Math
S = Science
SS = Social Studies
Children who are using tools for the first time will be interested in nailing and sawing for
its own sake and be content to do just that. --Fine Motor.
They may nail one nail after another into a piece of wood. Some may arrange odds and
ends of wood and nail them together without design or purpose. The teacher should not
insist that children work with a plan while they are going through this exploratory stage.
Most kindergartners will not go beyond this. The teacher needs to permit them to
manipulate and invent according to their desires. --S
Some children may name their product after they have finished because it resembles
something. An adult may make labels at this point or even help write stories. --R, W
As children develop and acquire skills, they have a tendency to begin working with more
definite purpose in mind, and they can carry the job through to completion. They are also
more interested in having their products look realistic. They will use real tools to make
measurements and problem solve. --M
Children often love to add items to their creations and even paint them. This is when a
teacher may add the odd items from the accessory list. --A
Architects drawings, blueprints and illustrations may be displayed in the center to help
children relate skills to a profession.--SS
Development of the Workbench as a Take-Apart Center:
The Take Apart Center extends the childs fine motor skills, problem solving
behavior, and cooperative skills. A child will learn to select the appropriate tool and
discover the inner workings of everyday items.
The Take Apart Center can be introduced at a point in the year when students are
independently discovering extensions. It can be a challenging activity for those who like
to spend long periods in detail oriented activities.
Setting Up the Take-Apart Center:
The Workbench provides a flat solid surface for the Take Apart Center. Safety
glasses and a wide variety of tools are also required. A strong container for tools and
another for parts help keep the bench organized. The teacher should place only one item
at a time in the center to be taken apart. Care should be taken not to use items that can be
dangerous. A request for parents to send broken and unwanted items usually gets good
results.
Introducing the Take-Apart Center:
The teacher should establish names and functions of each tool with a mini lesson,
i.e. screwdrivers can pry but needle nosed pliers will be damaged. The teacher should
emphasize the difference between take apart and pound apart. Take apart is often a
project that needs two people, one to hold while the other works. The teacher may use a
volunteer to assist or to bring ratchet screwdrivers, wrenches, etc. and demonstrate more
complicated versions of these basic tools.
W = Writing
M = Math
S = Science
SS = Social Studies
Besides the obvious fine motor practice, problem solving, and patience building,
with some extensions Take Apart can become an interesting part of the curriculum.
This is an exciting opportunity for the child to actually see what is inside things and can
connect to cultural artifact discussions. --SS, S
A volunteer may help children tape parts onto a poster and label them. --R, W
As children tape parts onto a prepared poster listing common parts, classifying and
counting concepts could be developed. --M, R
Adding a large magnet would help children explore the concept of magnetism.--S
The teacher can encourage children to use discovered wire, glue, and tape to create a new
object. This could be written about, discussed, and displayed.--R,W,S,A
WRITING ACTIVITIES
Writing
Writing, as part of a kindergarten language arts program, gives students the
opportunity to turn their spoken language into written symbols. It is a means of
expressing the personal experiences, feelings, ideas and thoughts that are part
of a childs life. When writing, students use high level thinking skills such as
retelling a story in their own words, sequencing events, remembering details,
conventions of print, and phonemic skills such as sound-spelling relationships
and word segmentation.
A strong relationship exists between reading and writing. Many students learn
to read through the writing process. The child becomes a reader when they share
their own writing with an audience, and often times a childs first reading is
something meaningful which they have written. Robert Gentry, author of My Kid
Cant Spell!, claims that writing Opens the gateway to literacy by helping
children to break the code and learn about sounds in words. Kindergarten
teachers must strive to develop, in each child, the belief that they are readers
and writers.
Development of the Writing Activities
Writing activities can be accomplished at a students developmental level of
writing. The range of writing abilities varies greatly in classrooms. When all
stages of writing, from scribble to invented spelling to conventional spelling, are
accepted and encouraged by the school staff, students will develop into
successful and enthusiastic readers and writers.
When developing writing activities, whether they are to be completed in a
center or as group activities, the developmental stages of writing should be kept
in mind. Stages commonly seen in kindergarten are:
1. Scribble:
____The student is gaining control of the pencil.
____The student scribbles and uses writing-like behaviors in an attempt to
communicate
(may be left to right, top to bottom).
____ Student reads the scribble story to an audience.
2. Pictures:
____Student will draw pictures in place of, or to support, a text.
____Student reads the text to an audience.
3. Letter-like forms:
____Student will write letters or letter-like forms to represent writing, with no
sound-spelling relationships.
____Student will copy words with no knowledge of word meaning.
____Student is able to read the written message.
4. Letter Strings:
____Student uses letters to represent words. (May be copied). At this stage there
is no
knowledge of sound-spelling relationships.
____Student shares writing with an audience.
5. Letters to represent words:
____Student uses one or two letters to represent a word, usually consonants.
The child
is beginning to understand that letters represent sounds.
____Student will copy known words to fit into text.
____Student shares writing with an audience.
6. Invented spelling:
____Student uses invented spellings with initial and final consonants and some
vowels.
____Students ability to segment words is evident in writing.
____Student uses phonetic clues when writing. Student represents each sound
in a word
with a letter.
____Student applies many conventions of print to their writing.
____Student shares writing with an audience.
7. Transition to conventional spelling:
____Student spells many words correctly and others are phonetically correct.
Setting up Writing Activities:
It is the kindergarten teachers responsibility to provide students with a solid
understanding of the print found in their everyday lives. As daily writing activities
and/or centers are set up, the goal should be helping students see that writing
plays a useful, meaningful part of their lives. Like many kindergarten activities,
students will be imitating adult behaviors and activities through play. This is also
true in writing. Writing activities will give children opportunities to imitate adult
uses of writing and will encourage students to take control of their own writing.
Writing Activities
1. The Writing Center
This center is created to let students practice their developing writing skills by writing
books, stories, invitations, notes, letters, lists and signs. Most writing forms have been
modeled for children in a group lesson. The writing center provides students with an
opportunity to practice what they have learned in group lessons. Children will be
working at their own developmental stage and their creations will be personal and
meaningful. The teachers responsibility is to equip the center with a variety of tools that
will encourage students to write in a variety of genres. The writing center should offer a
table or several desks, which allow children to work together. It can be equipped with
pencils, colored pencils, crayons, markers, chalk boards, dry erase boards, a typewriter, a
computer, and a wide variety of paper and envelopes, ABC charts, number charts,
classmates names, and First Dictionaries for student references are also helpful. Bookmaking materials may also be necessary, such as hole punches, yarn, staples and tape.
Children enjoy dating their work with a date stamp.
Holidays and seasonal activities fit well into the writing center. Students will
enjoy making up menus for Thanksgiving dinners, Christmas cards and gift tags
for families and friends, letters to Santa Claus, Valentines, and other holiday
messages.
The writing center can become a starting point before moving to other
centers. Students may write a story and then move into the art center to illustrate
it. After writing a shopping list, students may move into the grocery store for a
shopping trip. A student may draw out their plans for a building, before moving to
the block center. Students also enjoy writing simple stories to be performed in the
Puppet Theater. The writing center may easily be converted to an office center
by adding telephones and adding machines.
Recommended List of Writing Materials - listed in order of priority:
Typewriter
Dry Erase Boards and Markers
Chalkboards
Date stamp
Computer
2. Name Writing
A childs name is one of the first and most personal words they will ever learn
to read and write. Kindergarten classes will find several name charts around the
classroom to be helpful teaching tools. Students can study the name charts and
participate in the following activities:
Sorting
Students will enjoy sorting names by the number of syllables, number of
letters,
names that start with the same letter, names that end with the same letter,
short
names/long names.
Rhyming
The class can invent rhymes with names or cover the first letter of each
name with a
different letter.
Segmenting and blending:
Students can segment names by syllable or phonemes and then blend.
3. Classroom Mailbox
Step 5: Students determine the first word of the sentence and begin to
segment that word orally to determine the beginning letter. Once someone is
able to correctly identify the first word in the sentence they are asked to come to
the chart paper, identify the starting point, and write the first letter on the paper. If
a mistake is made the teacher provides guidance using the ABC letter chart, the
mistake is covered with boo-boo tape and the student writes the correct letter
on the chart paper. For difficult spellings such as silent letters, the teacher may
write the letter using a different color marker. As the year goes on, students work
together to make sure only they get to write the letters and the teachers marker
is never used! This process is continued until a word is competed. Only
conventional spelling is used. At the end of each word, the space holder puts
their hand on the chart paper to hold the space between words.
Step 6: This process continues until all the words and spaces in the sentence
have been written on the chart paper. The space holder may choose the correct
punctuation for the end of the sentence if they wish.
Step 7: Using the pointer, the class reads the sentence aloud, pointing to
each word as they read. Some students will enjoy a turn reading independently
to their classmates. Hang the chart in the room so children may read again later
in the day.
As students become familiar with the process, the teacher may add to the
Interactive Writing lesson using the following statements and questions:
-
How many words have we written so far? How many words do we have
left to write?
Now that we have finished this word, what comes next? (A space) What is
the next word?
Stretch out the words. What sounds do you hear? What letter makes that
sound? How many sounds do you hear? How many syllables are in that word?
-
8. Dictation
Dictation activities help kindergarten students understand that anything they
say can be written down. The teacher simply writes what a child asks them to
write. Dictation can take many forms. It can be a book-making project, writing
captions for childrens drawings, or writing down the title of a piece of art. After
the student has completed dictating and the teacher has completed writing, the
teacher may go back over the written words and reread what was written. This
activity will also reinforce conventions of print.
9. Mr. Bears Journal Activity
This writing activity is found in Bobbi Fischers book Joyful Learning in
Kindergarten. Mr. Bear is a stuffed toy who travels home with a different child or
staff member each night. He travels in a bag along with a composition journal,
pajamas, a toothbrush and other items he may have collected. A letter written by
Mr. Bear is on the front of the journal explaining where he came from and the
general procedure for his visits; Parents, children, and other family members are
encouraged to write and draw in the journal about Mr. Bears visit.
Bobbi
Fischer writes Mr. Bears journal provides a meaningful way for the class to
learn and care about each other, and involves the families in the classroom
community.
(See Black line Masters for an Introductory Letter from Mr. Bear.)
10. Kindergarten news: A Weekly Newsletter for Parents
Kindergarten news can be a single page divided in five boxes, one for each
day of the week. During closing circle a student (maybe the helper of the day) is
chosen to write or draw a picture in the square designated for that day. The
writing/drawing pertains to something all students experienced in school.
Depending on the students writing abilities, the teacher may write the simple
sentence under the picture as the student dictates. This activity is not only
important for developing writing skills, it also a quick method of family
communication.
ASSESSMENT
STRATEGIES
How to Know Learning Has Occurred
needs adult intervention to start, stay on, complete tasks and solve problems.
does not take responsibility for behavior - does not clean up and has trouble using
materials constructively.
Observe the child, and have additional observations by other professionals, e.g.
the principal and/or appropriate specialists.
The profile is marked four times during the school year with the corresponding
numeral 1, 2, 3 or 4
Progress should be marked as moving to the right a higher number should always
be to the right of a lower number.
The Citizenship Standards section is the only area that is not a continuum. All
satisfactory areas are marked with the appropriate numeral and areas of concern are
marked with an asterisk and then expanded upon in the comment section.
Nurse
The role of the school nurse in the kindergarten classroom might be to:
4do some health teaching in the classroom to help meet health curriculum objectives
4share with the teacher the results of immunization surveys, multiphase screening (i.e.
vision, dental, height, and weight) and make referrals and do follow-up, as necessary,
on all students including new arrivals throughout the school year
4act as a consultant and resource person when problems arise with students, i.e.
excessive absences, prolonged illness, concern of abuse or neglect, etc.
4
cooperate with special education services by gathering and recording health
information on students with special physical, psychological, or developmental needs
4
manage communicable disease programs through consistent enforcement of
existing school policies; including HIV awareness presentations
4help maintain a safe and healthful school environment so that conditions which might
interfere with the teaching-learning climate are minimized
4maintain good communication between parent, school and community health
agencies to share resources and facilitates and foster community health education
Counselor
Consistent with a developmental philosophy, school counseling should concern
itself with the developmental process of maximizing potential. Living and functioning
effectively depends on the interaction of an individuals self-concept and the complexity
of influences and experiences that the person accumulates. The counselor can work
within the educational framework and the childs total environment to help each child
understand themselves and their surroundings and to learn to make choices and decisions
which lead to effective functioning as a worthwhile being. The school counselor can
also act as an advocate for the child with parents, teachers, school administrators, courts,
agencies and others. The counselor may counsel children individually or in small groups
and may organize programs to provide developmental activities for classrooms that help
meet health curriculum objectives. The counseling curriculum may include instruction
in safety issues including guns, strangers, good touch/bad touch, and drug awareness.
Counselors should be an integral part of the school staff and can take an active role in
MDT meetings, conduct workshops, and provide support to teachers and other school
staff members.
Psychologist
School psychologists serve as resource persons and consultants to school
personnel in terms of understanding behavior patterns, social/emotional adjustment,
learning styles and abilities. The school psychologist, as a member of the MDT can
assist in development, facilitate implementation of, and evaluate individual educational
programs for children with special needs. A school psychologist can work with children
as individuals or in groups, and be a consultant to teachers and parents who are seeking
more insight into working with a particular child. The psychologist is also a resource for
locating appropriate outside specialists and agencies if requested by parents.
Some kindergarten teachers may feel the need to report more quantifiable
information to parents. This can be accomplished several ways. The comment section
in the Profile of Developmental Outcomes form is extensive. There are no limits on
the amount of comments and each section can be identified with the date of the report.
In addition, the bar graphs above each skill area may accommodate a brief note that
directs parents to more information in the comment section. At any time, the teacher
may choose to conference with parents and share the information on the Kindergarten
Assessment form.
rain_____
card_____
Sound Segments:
Can you stretch the sounds in these words one at a time. (Like cat,/c/, /a/,/t/)
pot
bun
pig
can
stop
clap
Sound Blending:
What word do these sounds make when you put them together? (like /f/-/a/-/t/, fat)
bed pot
lip
man
fast
card
Letter-Sound Relationships:
What letter do these words begin with? (Like diaper D-child names letter.)
bear dog
sun
pen
tent
vest
jar
red
nest lip
fat
kite window hat
garden
Beginning Sounds:
Tell me the first sound you hear in these words. (Like /d/-/o/-/g/-child repeats first
sound.)
top cake
rug
fish
Ending Sounds:
Tell me the last sound you hear in these words. (Like /l/-/o/-/g/-child repeats last
sound.)
fit
kiss
ham ball
Middle Sounds:
Tell me the middle sound you hear in these words. (Like /p/-/i/-/t/)
hog cap
sit
hen
Syllable:
Clap how many beats you hear in these words. (Like dra - gon, clapping 2 xs)
cup baseball boat
bicycle garden
Visual Discrimination
First Name: (Teacher provides visuals.)
Find your name on this paper.
Colors: (Teacher provides visuals.)
Name these colors.
Shapes: (Teacher provides visuals.)
Name these shapes.
Numbers: (Teacher provides visuals.)
Name these numbers.
Letters: (Teacher provides visuals.)
Name these letters. (Upper and Lower Case)
Last Name: (Teacher provides visuals.)
Find your last name on this paper.
Letter/word/sentence: (Teacher provides visual.)
Show me a box with just a letter in it - show me a box with just a word in it - show
me a box with just a sentence in it.
Sight Words:
Can you read these words?
MOM DAD CAT DOG
the
and
was
see
of
go
we
have
LOVE
to
said
Mathematics
Problem Solving:
Tell me what comes next in these patterns. ABAB
AABAAB
ABCABCA
Number Concepts:
. Rote Counting - Let me hear you count.
. One-to-one - Count these blocks.
. Conservation of Number - Does this row have more, the same, or less than this
row (Teacher provides visuals.)
. Number Value/Symbol - Show me the group with this ___ many. (0-8)
(Teacher provides visuals.)
Physical Development
Large Motor:
. Balance - Lets see how long you can balance on one foot?
. Alternate Movement - Can you skip, hop, etc.?
. Catching/Throwing - Throw/catch this bean bag.
Fine Motor:
. Writes Name
. Use Crayons/Pencil - Copy these shapes. (Teacher provides model.)
. Scissors - Cut out this circle. (Teacher provides sample.)
. Trace/Copy #s Letters - 12345 . . . ABCDE . . . abcde . . .(Teacher provides
model.)
Personal Knowledge
.
.
.
.
.
separate number card (in random order) and asks the student to show the group
represented by that number symbol.
Conservation of Number: The teacher may wish to use a blocking method to isolate
the activity and focus attention to one group at a time.
Physical Education
Large Motor: The sequence of the large motor skills follows physical education
guidelines.
Fine Motor/Uses Crayons/Pencils/Scissors: The teacher may wish to have the
student write their name on a separate piece of paper. They may also wish to attach
the cut out circle.
Trace: The teacher may wish to initially have the child trace shapes, letters, and
numbers. Then move to copying.
Copy: This area is very open-ended. The teacher may wish to have the child copy the
numbers in the first assessment. Then, extend the sequence at a later assessment. The
teacher may wish to use a separate piece of paper.
Personal Knowledge
These are not sequential skills. The teacher may wish to utilize adult helpers to gather
this information.
Learning Behaviors
Personal Knowledge
This area is not a continuum of developmental benchmarks. Teachers determine if
skills have been mastered by assessing each skill independently and recording it in the
assessment booklet.
Citizenship Standards
This area is also not a continuum. Teachers determine if skills have been mastered
and record the corresponding number for that area. Any areas of concern are marked
with (*) and then explained in the comment section. The following list may be helpful
in identifying the characteristics that define these district-adopted values. (see chart)
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Live the values of Respect, Dignity, Honesty, Responsibility and Teamwork.
RESPECT is the act of giving particular attention
The child who demonstrates respect. . . .
#
is friendly, polite, and shows common courtesies
#
listens actively to what someone has to say
#
considers the points of view of others
#
cares about the feelings of others
#
uses appropriate words and avoids swearing, name calling, obscene gestures and
inappropriate touching.
#
dresses appropriately
#
listens and follows directions
#
demonstrates self-respect through wellness, fitness and hygiene
DIGNITY is the state of being worthy, honored and esteemed
The child who values dignity. . .
#
finds value in others and lets them know
#
talks out a problem, avoids violence and hurting others
#
has self-respect and a calm self-esteem
HONESTY is a fairness and straightforwardness of conduct and adherence to the facts
The child who values honesty. . .
#
gives credit for a borrowed idea
#
admits and corrects mistakes, even if others dont notice
#
tells the truth
#
returns what is borrowed
#
adheres to; Say what you mean, do what you say and keep promises
RESPONSIBILITY is moral, legal and mental accountability, reliability and
trustworthiness
The child who demonstrates responsibility. . .
#
behaves within the laws and rules of the team, organization, state and the nation
#
accepts the consequences of their actions
#
is prepared and does their share of the work
#
is on time and completes work on time
#
makes positive contributions
#
takes pride in the home, school and community and avoids destructive acts
#
views mistakes as opportunities to learn and takes the risk of trying
TEAMWORK is work done by several people with each doing a share of the work
The child who understands teamwork. . .
#
pitches in to help others
#
asks and encourages others to participate
#
changes habits to meet the groups need when working on a group project
#
encourages others to express their points of view
Teacher
School
INDEPENDENT SCHOOL
DISTRICT OF BOISE CITY
Mastery Level
Comments
Is non-verbal
Uses language to
satisfy basic wants/needs
Describes real
or imaginary situations
Can blend
segmented sounds
into words
Can associate
letters to letter
sounds
Can separate
sound segments
Recognizes shapes,
numbers to age
Recognizes capital
letters
Recognizes numbers
above age
Recognizes lower
case letters
Uses letters or
letter-like signs
to represent writing
Uses letters to
represent words
Copies words
spontaneously
Invents spelling of
words, uses phonetic clues
"Reads" signs
high interest and
sight words
Discriminates between
letters, words,
sentences
Uses reading
strategies independently
(context clues, phonics)
Focuses interest
when read to
Demonstrates
book-handling
knowledge
Chooses reading
and writing independently
Recognizes /extends
patterns (AB) using
a variety of materials
and/or symbols
Creates patterns
(ABCABC) using
a variety of materials
and/or symbols
Classifies by more
than one attribute
at a time (size, color)
Relates number
values to symbol
Focuses attention
on self-selected
tasks
Focuses attention
on teacher-selected
tasks
Follows complex
directions,
maintains focus
Prefers familiar
tasks
Accomplishes tasks
with efficiency
Uses previous
knowledge to solve
tasks independently
Asks questions
cautiously
Asks questions
with confidence
Asks pertinent
questions
Uses resources to
find answers
Explores available
materials
Invents simple
dramatizations or
projects with
materials provided
Works competently
on complex, creative,
imaginative,
self-initiated tasks
Beginning to
develop cooperative
play skills
Consistently plays
cooperatively with
others
Demonstrates leadership
skills in work and play
Participates in group
conversations
Participates responsibly
in group activities
Is sensitive to and
articulate about needs
of others
Demonstrates good
balance
Demonstrates throwing/
catching skills
Demonstrates alternate
movements through
space (jump, hop, skip)
1st Conference
Auditory Discrimination
Recognizes
rhyme
Can count
syllables
Visual Discrimination
Recognizes
colors and
name
Writing
Scribbles and
uses writinglike behavior
Reading
"Reads"/retells "Reads" from
a story using memory word
pictures
for word
1st Semester
"Reads"/asks
questions about
environmental
print
Mathematics
Problem-solving
Manipulates
objects
randomly
Sorts by
likenesses and
differences
spontaneously
Number Concepts
Counts by
rote
Demonstrates one-to-one
correspondence
(counts objects)
3rd Quarter
Learning Behaviors
Attention Span
Has rapidly
changing
focus of
attention
Initiative
Observes
rather than
participates
Curiosity
Watches
silently
Creativity
2nd Semester
Wants to be
told what
to do
Social Skills
Peer Relationships
Observes
play of
others
Plays alone or
is involved in
parallel play
(side by side)
Cooperative Groups
Does not
seek help
when needed
Communicates with
adults primarily to get
help
Physical Development
Large Motor
Demonstrates Demonstrates ability to
maintain body position
movement
control within
own space
Teacher:
Attendance
Fine Motor
Uses crayons
or pencils
appropriately
Uses scissors
efficiently
Personal Knowledge
Knows age
Principal:
Traces shapes,
letters, numerals
Copies shapes,
letters, numerals
Demonstrates detailed
work with good eye-hand
coordination
Knows telephone #
(including area code)
Knows address
(including city, state)
1st Semester
Days Present
Days Absent
Times Tardy
Date
This report card was created with the Hurd PCS Report Card Program. This software was custom created for Boise School District by Hurd PCS, Boise, Idaho.
2nd Semester
BLACK-LINE
MASTERS
(Black-line masters are organized in the sequence in which
they are referenced in the preceding document.)
1. Think about what you want to tell the teacher about your child.
2. How does your child feel about school?
3. What does your child like to do after school?
4. What special interests does your child have (dinosaurs, cars, art, sports,
cooking, etc.)?
5. Is there anything you would like to tell the teacher that would help in
understanding your child?
At the
Conference:
1. Arrive on time.
2. The teacher will be prepared to tell you about your childs school
work. Here are some questions you might want to ask.
a. In what subject does my child do well?
b. What needs improvement?
c. Are there any special programs that could help my child?
d. What can I do at home to help my child?
3. Ask questions about any part of the school program that you have
questions about (homework, recess, test results, etc.).
4. Leave promptly when your conference time ends.
When you
get home:
Preschool
Screening
Services are available for children
with special needs through the
Boise School District Early
Childhood Special Education
Program. Please call to set up an
appointment for a screening if you
have a child who is from 3 to 5
years old and may have possible
problems in one or more of the
following areas:
!
Self-Help Skills
Speech/Language
Social/Emotional
Concepts
Vision
Motor Skills
Screening Dates
August
September
October
November
December
January
February
March
PARENTS:
PLEASE
INFORMATION
FILL
OUT
THIS
ADDITIONAL
REGISTRATION
If you work outside the home, where is your child before and after the kindergarten session?
______________________________________
before
_______________________________________
after
Please explain any allergies (Note: Kindergarten children have snacks at school.)
________________________________________________________________________________
________________________________________________________________________________
Work phone:_______________________________
Emergency phone:____________________
Relationship to child:________________________
_________________________
Date
___________________________________________________
Signature of Parent or Guardian
Permission Slip
I give permission for my child_____________________________________ to participate in
the field trips of the kindergarten during the school year. I understand that I will be notified
beforehand of the date and destination of each trip.
_________________________
Date
___________________________________________________
Signature of Parent or Guardian
I also give permission for my child to have his/her picture taken either for publicity purposes or for
general kindergarten use.
___________________________________________________
Signature of Parent or Guardian
Childs name:____________________________________________________________
Address:________________________________________ Phone:_________________
2.
3.
4.
5.
Does your child have any particular problems that concern you?
(Stumbling a lot, short interest span, bed wetting, temper tantrums, food or animal
allergies)________________________________________________________________
________________________________________________________________________
______________________________________________________
What do you hope the kindergarten experiences will mean to your child?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
___________________________________________________
Childs name:______________________________________________________________
Parents name:_____________________________________________________________
Address:________________________________________ Phone:___________________
There are so many ways that you can help make this year a special one for your child and all
the children at kindergarten. Kindergartners learn best when they are active and selfdirected. This type of program needs extra help if it is to work smoothly.
At home, I will help by:
_______ drawing, making posters, making games, etc.
_______ sewing
________typing
________other__________________________
_______ babysitting for another parent so they can volunteer in the classroom.
If you or someone in your family has a special ability or interest which has not been listed,
please add it here_____________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
For field trips, I will:
_______ drive children in my car and meet the teacher at the destination.
I have liability insurance and seat belts for _______ children.
At school I will come in:
_______ once a week
I can help on ___ Monday ___ Tuesday ___Wednesday ___ Thursday ___ Friday.
______NO
______ At home
Tuesday
AM/PM
AM/PM
Wednesday
Thursday
AM/PM
AM/PM
__________________________________________
Name
Friday
AM/PM
____________________________
Phone
Kindergarten Questionnaire
Childs Name_______________________Nickname:___________________
___Yes
IMMUNIZATIONS FOR
KINDERGARTEN
3
4
1
3
POLIO
DTP
MMR
HEP B
A b
B c
C d
D e
F g
G h
H i
K l
Lm
Mn
N o
P q
Q r
R s
S t
U v
Vw
Wx
X y
A b
apple
f
B c
ball
F g
fish
k
G h
K l
pig
queen
vase
umbrella
Z sh
zoo
ship
turtle
X y
six
ch
thimble
sun
wagon
octopus
S
W x
th
jam
nest
rug
N o
R s
V w
indian
mittens
elephant
M n
Q r
U v
duck
house
lamp
D e
H i
L m
P q
cat
garden
kite
C d
yarn
wh
chain
wheel
Kindergarten Orientation
Ready...
Set...
Learn!
Dear Parents:
Welcome to Kindergarten in the Boise School District! Expectations for
our Kindergarten staff and students are high, and we will do our best to
help all youngsters realize their potential.
We are committed to providing quality educational experiences for every
student enrolled in our school. This handbook provides some suggestions
to help you with this important foundational school year.
We believe that parents and guardians are an important part of our
educational team, especially during the early years. Parent participation
in a childs education enhances the school experience. I encourage you
to take part in the many opportunities for involvement in our school.
I hope you will feel free to contact me with any questions, comments,
suggestions or concerns about our school. We believe we have an
outstanding educational environment and we are always willing to do
anything we can to improve.
Our doors are always open to you. Let's join hands in Educating Today
for a Better Tomorrow.
____________________________
Principal
____________________________
Telephone
Page 2
Ready . . .
Beginning School
Since the Kindergarten year lays the foundation for future success in
learning, both parents and teachers are anxious for children to get a good
start in school. Here are some suggestions to help your child get off to a
good start:
happy place where he will learn many new things. Share the
excitement!
Send your child to school fed and well rested.
Teach your child her first name, last name, address, and phone
number.
It is critical to send your child to school regularly and on time.
Call your child's school if he will be absent for any reason.
Show an interest in your child's school experience. Take his
learning very seriously and give praise often.
Plan to attend Fall parent-teacher conferences to discuss your
child's progress.
Feel free to visit your child's classroom often. Volunteer!
Please call the teacher or the principal if you have any questions
or concerns.
Provide comfortable clothing for your child that she can button,
zip, snap or tie.
Put your child's name on backpacks, sweaters, and outdoor
clothing.
Teach your child good health habits, including washing hands,
toilet needs, covering mouth when coughing or sneezing, and
using a tissue.
Do not send your child to school if he does not feel well (sore
throat, runny nose, cough, headache, fever, etc.).
Page 3
Set . . .
Establishing a Positive Home Environment
Parents are the first and most important teachers a child will ever have.
The home is a powerful factor in determining how well a child will do in
school. Parents want their child to succeed in school and often ask,
"How can I help?"
The ideas in this booklet are intended to help you continue to be your
child's most important teacher and to become a partner in their
Kindergarten experience.
home.
Talk with your child and listen to what she has to say.
Allow children the opportunity to experiment with art materials,
color, cut, paste, clay, trace. The emphasis should be on the
process not the final product.
Most importantly, read to your child daily.
Page 4
Learn!
Reading/Visual Discrimination
HOW TO HELP YOUR CHILD WITH THEIR MAGNETIC LETTERS
that can only be answered yes or no until they guess the letter.
Hide a letter and have your child guess the missing letter.
Sort letters by attributes: curves/straight, consonants/vowels,
colors, etc.
Take one letter and match it to environmental print around the
home.
OTHER IDEAS
I Choose a letter and look for that letter as you read a book
together.
A B
x y z
Page 5
Learn!
Writing/Fine Motor
HOW TO HELP YOUR CHILD WITH THEIR NAME WRITING STRIP
I Using the strip, have your child trace their name saying each
letter, progress to writing their name on their own.
I Placing a thin piece of paper over the strip, have your child copy
I
I
their name. Using that paper cut it apart and have your child
reassemble it.
Pour salt onto a plate and allow your child to write their name in
the salt using the name strip as a model.
Provide clay or play dough and have your child shape the clay
into the letters of his name on or below the name strip.
OTHER IDEAS
Page 6
Learn!
Language/Auditory Discrimination
HOW TO HELP YOUR CHILD WITH THEIR PICTURE CARDS
I Lay out the cards and help your child identify each picture.
I Find pictures that rhyme.
I Present three cards, two that rhyme. Ask your child which one
I
I
I
OTHER IDEAS
I Ask your child to retell a story with a beginning, middle and end.
I Play "I Spy" while driving in the car. Say, "I spy with my little eye
I
something that is red, and round. What is it?" Focus on developing descriptive language.
Read a book with rhyming text. After reading several times let
your child fill in the missing rhyme. Extend the activity and
challenge children to begin identifying other rhyming words,
including nonsense words.
Have your child name as many items in a category as they can.
How many fruits can you name? How many animals can you
name?
I Once your child learns their phone number, allow them to call
your house and leave a message.
Page 7
Learn!
Math
HOW TO HELP YOUR CHILD WITH THEIR NUMBER CARDS
I Lay out the cards and help your child identify each number.
Begin with 0-5.
one is missing.
Match the number card to numbers in the environment, the
clock, the television, the microwave, etc.
Respond to questions by holding up a number card. Say, "How
many fingers on your hand? How many wheels on a car?"
OTHER IDEAS
You say one, they say two, and so on. The next time you play
you take the even numbers and they take the odd numbers.
Provide your child with sorting opportunities, laundry, dishes,
groceries, toys, etc.
Help your child look for one of the four basic shapes, square,
circle, rectangle or triangle in their environment.
1 2
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
338-3430
322-3800
322-3805
338-3436
338-3504
338-3440
338-3445
338-3450
338-3454
338-3457
322-3725
322-3808
338-3460
322-3812
338-3464
338-3474
338-3478
338-3484
322-3815
322-3818
338-3488
322-3824
338-3495
338-3500
338-3643
338-3505
322-3817
424-3200
322-3828
338-3511
338-3493
338-3515
338-3520
338-3508
L
UB
ION
AT
ND
BOIS
EP
OLS E DUCATIO
HO
N
SC
FO
IC
Reading/Visual Discrimination
Page 4
Alphabet magnets
Stickers or stamps
Please carefully review each of the suggested activities, decide which one you will be demonstrating and make sure you
have the materials you need. Ask the parent or guardian to find the correlating page in their handbook. Please tell the
guardian or parent which activity you are modeling.
HOW TO HELP YOUR CHILD WITH THEIR MAGNETIC LETTERS
Writing/Fine Motor
Page 5
Sentence Strip
Vis-a-vis
Please carefully review each of the suggested activities, decide which one you will be demonstrating and make sure you
have the materials you need. Ask the parent or guardian to find the correlating page in their handbook. Please tell the
guardian or parent which activity you are modeling.
HOW TO HELP YOUR CHILD WITH THEIR NAME WRITING STRIP
I Using the strip, have your child trace their name saying each
I
I
I
Language/Auditory Discrimination
Page 6
Picture Cards
Please carefully review each of the suggested activities, decide which one you will be demonstrating and make sure you
have the materials you need. Ask the parent or guardian to find the correlating page in their handbook. Please tell the
guardian or parent which activity you are modeling.
HOW TO HELP YOUR CHILD WITH THEIR PICTURE CARDS
I
I
I
I
I
I
Lay out the cards and help your child identify each picture.
Find pictures that rhyme.
Present three cards, two that rhyme. Ask your child which one does not rhyme.
Lay out the cards. Help your child identify the beginning sounds by having them repeat just the first sound after
saying the word.
Present three cards, two that start with the same sound. Ask your child which one does not belong.
Choose one card. Give descriptive clues about the picture until your child guesses correctly. Take turns.
Math
Page 7
Number Cards
Please carefully review each of the suggested activities, decide which one you will be demonstrating and make sure you
have the materials you need. Ask the parent or guardian to find the correlating page in their handbook. Please tell the
guardian or parent which activity you are modeling.
HOW TO HELP YOUR CHILD WITH THEIR NUMBER CARDS
I
I
I
I
I
Lay out the cards and help your child identify each number. Begin with 0-5.
Sequence the numbers, beginning with 0.
After sequencing, remove one card. Ask the child to guess which one is missing.
Match the number card to numbers in the environment, the clock, the television, the microwave, etc.
Respond to questions by holding up a number card. Say, "How many fingers on your hand? How many wheels on
a car?"
Registration Forms
This is where district forms are filled out and any other materials are distributed. At this station, schools may choose to
provide an alternate activity for the children. Ideas may include a refreshment table, tour of the building, visit to the
Kindergarten classroom or school bus.
Kindergarten Assessment
Booklet (8 pages)
Class Record Sheet (3 pages)
Kindergarten Assessment
Booklet
AUDITORY DISCRIMINATION
Detect Rhyme:
Tell me if these words rhyme. (Like hair chair)
1) cat hat________ 2) bed rug________ 3) ball tall________ 4) man van________ 5) boy-girl________ 6) pill hill ________
Generate Rhyme:
Tell me a word that rhymes with . . .
can__________ dog________ ten________ bug________ rain________ card________
Syllable:
Clap how many beats you hear in these words. (Like dra-gon, clapping 2xs)
cup________ baseball________ kite________ bicycle________ garden________
Sound Blending:
What word do these sounds make when we put them together? (Like /f/-/a/-/t/ - fat.)
bed________ pot________ lid________ man________ fast________ card________
Sound Segments:
Can you stretch the sounds in these words? (Like cat - /c/,/a/,/t/.)
pot________ bun________ pig________ can________ stop________ clap________
Letter-Sound Relationships:
What letter do these words begin with? (Like /diaper/ - d child names letter.)
bear________ dog________ sun________ pen________ tent________ vest________ jar________ red________
nest________ lip________ fat________ kite________ window________ hat________ garden________
Identify Beginning, Middle, and Ending Sounds:
Tell me the first sound you hear in the words, (like /d/-/o/-/g/ - child repeats first sound.)
top________ cake________ rug________ fish________
Tell me the last sound you hear in these words. (Like /l/-/o/-/g/ - child repeats last sound.)
fit________ kiss________ ham________ ball________
Tell me the middle sound you hear in these words. (Like /p/-/i/-/t/ - child repeats middle sound.)
hog________ cap________ sit________ hen________
VISUAL DISCRIMINATION
First Name: Find your name on this paper. (Teacher provides page with class list.)
Colors: Name these colors.
red
orange
yellow
green
blue
purple
brown
black
3
12
20
5
10
26
2
15
39
1
17
43
4
13
52
6
16
55
9
14
68
7
18
74
8
11
100
X
E
A
P
T
R
S
C
I
D
B
F
J
K
Z
M
LOWER CASE:
x
f
p
r
t
a
g
k
w
y
l
h
n
m
q
d
v
Sight Words: Can you read these words? (Underline those read correctly.)
MOM
the
DAD
and
was
CAT
stop
to
DOG
can
of
LOVE
go
we
up
I love my dog.
hat
wagon
Mathematics:
Problem Solving: Read this pattern and tell me what comes next.
ABCABCA
Number Concepts:
Rote Counting Let me hear you count.__________
Number Value / Symbol Show me the group with this many 1__ 2__ 3__ 4__ 5__ 6__
(Teacher shows separate numeral cards in random order.)
!!!
!!!
!!
!!
!!
!!!
!!!
!
!
Conservation of Number Does this row have more, the same, or less than this one?
!!!!!
Physical Development:
Large Motor:
Balance Lets see how long you can balance on one foot?________ Alternate Movement Can you jump_____hop_____skip_____?
Catching/Throwing Throw_____catch_____this bean bag.
Fine Motor:
Use Crayons/pencil Write your name here.
Scissors Cut out this circle.________(Teacher provides item to be cut.)
Trace/copy Copy these shapes.
1 2 3 4 5
A B C D E
a
Personal Knowledge:
Age How old are you?________ First/Last Name What is your first and last name? _______________________________________.
Birth date What is your birth date (month/day)?_______________________________
Phone Number - What is your phone number (area code)?______-______-__________
Address What is your address?____________________________________________
Student Name
Detect
Rhyme
Generate
Rhyme
Sound
Blending
AUDITORY DISCRIMINATION
Sound
Letter-Sound Beginning
Segments
Relationships
Sounds
Ending
Sounds
Middle
Sounds
Syllable
VISUAL DISCRIMINATION
First
Name
Colors
Shapes
VISUAL DISCRIMINATION
Numbers
Upper
Case
Letters
Lower
Case
Letters
Last
Name
Sight
Words
Problem
Solving
Rote
Counting
One-toone
Conservation
of Number
Number
Value
/Symbol
PHYSICAL DEVELOPMENT
Large Motor
Alternate
Catchi
Balance
Movement
ng
Jump/Hop/Skip Throwi
ng
Writes
Name
Age
PERSONAL KNOWLEDGE
First/Last
Phone
Name
Number
Address
Birthdate
Student Name