Genetics in Asthma and Allergy

Immunol Allergy Clin N Am
25 (2005) ix x
Preface
Genetics in Asthma and Allergy
Deborah A. Meyers, PhD

Guest Editor
Major advances have occurred in the genetics of asthma and allergy, resulting
in further understanding of the underlying pathophysiology of this disease. In
this issue of the Immunology and Allergy Clinics of North America, the various
approaches to these studies are discussed with presentation of current results.
The first article, bPhenotype Definition, Age, and Gender in the Genetics of
Asthma and AtopyQ by Drs. Bottema, Reijmerink, Koppelman, Kerkhof, and
Postma, discusses the critical role of phenotype and phenotype definition. Frequency and expression of these diseases are different in males versus females,
which is also discussed in this article in relationship to the role of genetics and
how sex differences may affect genetic studies and results.
The second article, bFamily Studies and Positional Cloning of Genes for
Asthma and Related PhenotypesQ by Drs. Smith and Meyers, presents an overview of family studies and positionally cloned genes for asthma and related
phenotypes. This article is followed by two articles that provide more detail
on two different positionally cloned genes. The evolving story on the role of
ADAM33 in asthma is presented by Drs. Holgate, Davies, Powell, and Holloway
in the third article, bADAM33: A Newly Identified Gene in the Pathogenesis
of Asthma.Q The fourth article, bHLA-G: An Asthma Gene on Chromosome 6pQ
by Dr. Ober, demonstrates the power of family studies in understanding the
genetics of asthma and allergy.
Family studies are one approach to genetic studies; the other major approach
is casecontrol studies (which may also be family-based), which are discussed in
0889-8561/05/$ see front matter D 2005 Elsevier Inc. All rights reserved.
doi:10.1016/j.iac.2005.09.005
immunology.theclinics.com
preface
the fifth article, bCandidate Gene Association Studies and Evidence for Geneby-Gene InteractionsQ by Michael Kabesch. Clearly, there are multiple susceptibility genes for common diseases such as asthma and allergy; therefore, it
is important to test for gene-by-gene interactions as further discussed in this
article. Just as there are multiple genes involved in common diseases, there are
also strong environmental influences that need to be considered in genetics
studies, which is addressed by Dr. Martinez in the sixth article, bGene
Environment Interactions in Asthma and Allergy: A New Paradigm to Understand Disease Causation.Q
An exciting and important area of genetics is pharmacogenetics (also a gene
environment [therapy] interaction), which is reviewed in the seventh article,
bAsthma PharmacogenomicsQ by Drs. Hawkins, Weiss, and Bleecker. The final
article, bNew Approaches to Understanding the Genetics of AsthmaQ by
Dr. Meyers, discusses several new approaches that are being applied to studies
on common diseases and are beginning to be applied to asthma and allergy.
Together, these articles provide an overview on the important aspects of genetic
studies on asthma and allergy and discussion of current results.
Center for Human Genomics
Wake Forest University School of Medicine
Medical Center Boulevard
Winston-Salem, NC 27157, USA
E-mail address: dmeyers@wfubmc.edu

25 (2005) 621 639
Phenotype Definition, Age, and Gender in the

Genetics of Asthma and Atopy
R.W.B. Bottema, MDa,T, N.E. Reijmerink, MDb,
G.H. Koppelman, MD, PhDc, M. Kerkhof, MD, PhDd,
D.S. Postma, MD, PhDa
a
Department of Pulmonology, University Medical Center Groningen, University of Groningen,

Hanzeplein 1, Groningen 9700 RB, The Netherlands
b
Department of Pediatrics, Beatrix Childrens Hospital, University Medical Center Groningen,
Hanzeplein 1, Groningen 9700 RB, The Netherlands
c
Department of Pediatric Pulmonology, Beatrix Childrens Hospital,
University Medical Center Groningen, Hanzeplein 1, Groningen 9700 RB, The Netherlands
d
Department of Epidemiology, University Medical Center Groningen, Hanzeplein 1,
Groningen 9700 RB, The Netherlands
Asthma and atopy are complex genetic diseases. The development of disease results from an interplay between multiple genes and environmental factors.
The application of genetics has its origin in the tremendous progress in genetic
research over the last decades. This started in 1953 with the seminal paper of
Watson and Crick on the structure of DNA [1]. It was in 1956 that the correct
chromosome number in humans was announced in Copenhagen at the First
World Congress of Human Genetics: a diploid number of 46, not 48 as previously
thought [2]. It was not merely getting the count right that was of importance; it
showed that human chromosomes could be investigated with relative facility.
This led to the discovery of genetic origins of many human diseases with
Mendelian genetic disorders and proceeded with the publication of the working
draft of the sequence of the human genome in 2001 [3,4]. Since then, large steps
have been made in the hunt for genes and in understanding the complexity
involved in the development of complex diseases such as asthma and atopy. The
results of genome screens in 11 different populations identified at least 18 regions
This work was supported by a grant from Zon-Mw, The Netherlands Organisation for Health
Research and Development.
T Corresponding author.
E-mail address: r.w.b.bottema@int.umcg.nl (R.W.B. Bottema).
doi:10.1016/j.iac.2005.07.002
622
bottema et al
of potential linkage to asthma and atopy [5]. Hundreds of genetic association

studies on asthma and atopy have been conducted, and these have reported
variants in more than 64 candidate genes that may contribute to the development
of asthma and atopy [6]. Despite the successes of genetic research, there are great
difficulties in replicating findings between study groups. Various reasons for the
discrepant results of studies have been described, such as (1) the different ethnic
backgrounds of the populations studied, (2) the variable influence of environmental factors in different countries with different lifestyles of the studied
populations, and (3) insufficient power of studies to detect minor genetic effects.
Another equally important reason for the contradicting results are the widespread differences in phenotype definitions. For example, when asthma was
defined as a doctors diagnosis it was shown to reflect less severe asthma than
when it was also confirmed with a measurement of airway hyper-responsiveness
(AHR) [7]. When studying atopy, one can imagine that atopic individuals defined
by self-reported atopy constitute a heterogeneous group compared with an atopic
population defined by a positive reaction to skin-prick testing.
Finally, genetic studies may have different results because important determinants of the asthma phenotype, such as age and gender of the studied populations, differ. Because asthma and atopy are heterogeneous diseases that show
large differences between age groups in disease incidence and prevalence, the
influence of certain genes may be different in childhood compared with adulthood. Also, different genetic mechanisms or geneenvironment interactions may
be involved in the development of asthma and atopy in men or women. Findings
of genetic studies could thus be dependent on the window of time in which the
study subjects are examined and on the gender of the subjects studied. Few
genetic studies deal with age and gender issues, and frequently studies do not
even describe the age and gender of the study population.
This article discusses the importance and influence of phenotype definition.
The influence of age and gender on asthma and atopy phenotypes is addressed as
an epidemiologic issue. Finally, the influence of age and gender on the results of
genetic studies is discussed, and examples from the literature are provided.
Asthma and atopy phenotype definitions

To find the genes contributing to the asthma and atopy phenotypes, it is
important to have a clear definition of the phenotype. Atopy can be defined as
a hereditary predisposition to produce IgE antibodies against environmental
allergens that is associated with one or more atopic diseases such as bronchial
asthma, urticaria, eczema and allergic rhinitis [8]. Asthma has been defined by
the Global Initiative for Asthma [9] as a chronic inflammatory disorder of
the airways in which many cells and cellular elements play a role. The chronic
inflammation causes an associated increase in AHR that leads to recurrent
episodes of wheezing, breathlessness, chest tightness and coughing, particularly
at night or in the early morning. These episodes are usually associated with
phenotype definition, age, and gender
623
Box 1. Possible definitions of asthma and atopy in genetic studies

Asthma
Questionnaire data

Symptoms occurring once or several times at follow-up

(wheeze, dyspnea, cough, nocturnal symptoms)
Self-reported (doctor-diagnosed) asthma
Use of asthma treatment
Video questionnaire
Doctor diagnosis
Intermediate phenotypes of asthma

Airway hyper-responsiveness
Direct (methacholine, histamine)
Indirect (exercise, mannitol, AMP, cold-air challenge)
Reversibility on C2-agonist
Variability of peak expiratory flow
Lung function (eg, FEV1, VC, micro Rint)
Combination of questionnaires and intermediate phenotypes

Asthma score
Asthma algorithm
Atopy
Questionnaire data

Symptoms of atopic asthma, rhinitis, and dermatitis

Self-reported (doctor-diagnosed) atopic asthma, rhinitis,
or dermatitis
Use of atopy treatment
Doctor diagnosis

Intermediate phenotypes of atopy

Serum total IgE

Serum allergen-specific IgE
Allergy skin tests
Number of eosinophils in peripheral blood

624
bottema et al
widespread but variable airway obstruction that is often reversible either spontaneously or with treatment. These definitions show that atopy and asthma have
many features and that there is not a single measurement that confirms or
excludes either disease. To circumvent this problem in studies on the genetics
of asthma and atopy, several strategies have been used (Box 1): use of intermediate phenotypes, an asthma algorithm or asthma score, and (video) questionnaires with questions regarding doctors diagnosis and symptoms. The success
of these strategies depends greatly on the population under study. For example,
in a child under 6 years of age, it is not possible to perform a spirometry and a
bronchial provocation with methacholine. Other methods to measure lung function and bronchial hyper-responsiveness in small children have been developed,
but these methods have not been standardized and validated, and a gold standard
is lacking at that age. Moreover, the methods differ from the standard methods
used in older children and adults. Therefore, comparison of these methods
for small children with the standard methods cannot be justified. One more
example is the difficulty to distinguish asthma from chronic obstructive pulmonary disease in elderly populations because both groups include subjects with
respiratory symptoms, bronchial hyper-responsiveness, and airway obstruction
that is partly reversible. To assess the importance and suitability of an intermediate
phenotype in genetic research of complex diseases, the following criteria can be
used: (1) a high genetic component, (2) regulation by major genes, (3) objective
measurement, (4) quantification, (5) feasibility in every individual, (6) diagnostic
value for asthma or atopy (sensitive and specific), and (7) enabling replication
between studies.
This article focuses on the following phenotypes: asthma assessed by doctors
diagnosis or symptoms, total serum IgE, and sensitization defined as a positive
reaction to skin prick tests or the measurement of specific IgE, and AHR. These
phenotypes have proven their usefulness in genetic studies, and the influence of
age and gender on their expression has been extensively studied [10].
The influence of age and gender: epidemiology

Asthma and age
Asthma is a heterogeneous condition with variability between patients and
within each patient over time. There is a wide variation in how the disease
presents itself and how it is being diagnosed. As a consequence, several different
asthma phenotypes have been described.
Childhood asthma
According to Bel [11], childhood asthma can be divided into four different
phenotypes based on age of onset, remission, (genetic) risk factors, pathogenetic
mechanisms, prognosis, and treatment approaches (Fig. 1). The first description
of different asthma phenotypes in childhood was provided by Martinez and
625
Fig. 1. Clinical phenotypes of asthma in childhood and adulthood. (Data from Bel EH. Clinical
phenotypes of asthma. Curr Opin Pulm Med 2004;10:4450.)
colleagues [12] based on the results of a large prospective study of 1246 newborns
in Arizona (the Tucson Childrens Respiratory Study) [13]: (1) the transient infant
wheezers includes children who show nonatopic wheezing until 3 years of age
and have a favorable prognosis. (2) The nonatopic wheezing toddlers include
children who continue to wheeze beyond the third year of life and seem to develop airway obstruction in relation to viral infection. These two wheezing
phenotypes in childhood are self-limiting and do not reflect asthma. (3) The persistent IgE-mediated wheezers develop persistent, chronic asthma. (4) A fourth
childhood asthma phenotype was derived from a retrospective study by De Marco
and colleagues [14]. This asthma phenotype occurs during or after puberty, affects mainly girls, and has a low remission rate. Most children with mild intermittent asthma outgrow their asthma as adults, but the more troublesome their
asthma in childhood, the less likely they are to outgrow the disease [15].
Adult asthma
Asthma starting in adulthood seems to be different from childhood asthma.
Adult-onset asthma can be subdivided in several subtypes with distinct underlying pathophysiologic mechanisms, such as aspirin-induced asthma or severe
asthma [16] and steroid-resistant asthma [17].
Asthma and gender
Notwithstanding the variation in phenotype definition used to assess asthma,
epidemiologic studies of questionnaire defined asthma find apparent gender
differences in the development and outcome of asthma. During childhood and
626
bottema et al
adolescence, boys are nearly twice as likely as girls to develop asthma. The
higher male incidence [1821] and male prevalence of asthma continues until
16 years of age [2225]. This is reflected by the hospitalization rates from asthma
in early childhood. For instance, the hospital admission rate at 1 year of age is
5.3/1000 for boys and 2.9/1000 for girls in Finland [26]. The higher incidence
and prevalence of asthma in boys reverses around the age of 16 years. In young
adulthood, female gender becomes an important risk factor for the development
of asthma [27], and throughout adulthood incidence and prevalence of asthma are
greater in women [20,23,2832]. Additionally, the subtype severe asthma seems
to affect mainly adult women [16].
Total IgE and age
At birth, IgE concentrations in cord blood are generally low. Johnson and
colleagues [33] found a geometric mean IgE of 0.20 IU/mL in 538 healthy
newborns recruited from a general population. IgE levels seem to rise during
childhood and reach a peak value between 8 and 12 years of age [3339]. During
adolescence, the mean total IgE level of asthmatic and general populations
declines steeply and continues to decline at a slower pace after 35 years of age
[35,38,39] (Fig. 2A). Epidemiologic studies have shown that IgE levels of an
individual track with age; thus, high IgE levels in infancy are highly correlated to
high IgE levels later in life [35,40]. These data are largely based on crosssectional studies and thus may be biased by the rising incidence of allergy
observed in the last decades, which specifically affects younger individuals,
thereby suggesting a reduction with age. This does not seem to offer the full
explanation of the cross-sectional observations because one longitudinal study
finds a pattern of IgE changes with age similar to the description above [39].
Total IgE and gender
Although boys and girls have similar IgE levels measured from cord blood
at birth [33,41] and IgE levels increase with age in both genders, IgE rises more
rapidly in boys. Serum IgE levels are consistently found to be significantly higher
in boys compared with girls above the age of 6 months, and the levels remain to
be higher in boys throughout childhood [33,37,42,43]. In adulthood, men seem
to have a higher total IgE than women in a general and an asthmatic population
[4447]. This observation remains significant when corrected for smoking habits.
It is intriguing that men have higher IgE levels than women because in this age
group asthma prevalence and incidencewhich is known to be highly correlated
to the atopic status of an individualare higher among women.
Sensitization and age
Sensitization is defined as one or more positive skin prick test(s) or the
presence of specific IgE antibodies in serum. During childhood, the time course
627
Fig. 2. Hypothetical figures on the relationship between age, gender, and phenotype based on data
from the literature. (A) The geometric mean total IgE level and age in men and women in Caucasian
populations. (B) Sensitization to inhalant allergens and age (no gender difference). (C) Bronchial
hyper-responsiveness and age in men and women.
628
bottema et al
of sensitization to food and sensitization to inhalant allergens differs. IgE

synthesis starts during fetal life, and specific IgE to food and inhalant allergens
can be measured early in life in cord blood at birth, albeit in low concentrations
[48,49]. Sensitization to food allergens occurs mainly in infancy and tends to be
transient, whereas sensitization to aeroallergens increases throughout childhood
and tends to be persistent [50,51]. In general, sensitization seems to increase
during childhood and adolescence [36,5055] and reaches a peak in the third
decade of life. The prevalence of sensitization and the size of skin prick test
reactions decline in persons older than 30 years of age [35,44,5659] (Fig. 2B).
This time course in sensitization to common allergens was observed in crosssectional studies and may reflect a rising incidence and prevalence of allergic
diseases generally observed during the last decades. In one longitudinal study
[39], skin prick tests were performed at baseline and after a follow-up of 8 years
in 1333 subjects 3 to 65 years of age at baseline. This study shows an increase in
sensitization among all age groups, which has been confirmed by Broadfield
and colleagues [60]. The greatest increase in prevalence occurred among children
and teenagers, with only minimal increases above the age of 65 years. The
strength of the reaction, estimated by skin test index, peaked between 25 and
35 years of age.
Sensitization and gender
Studies on sensitization in relation to gender do not show consistent results.
The results may vary with age of the population studied. The number and species
of the allergens tested also seems to be of importance. Some studies mention a
difference in the type of sensitization between males and females in childhood
and in adulthood [33,44,52,55]. This may reflect a difference in exposure to
environmental influences between males and females. However, in infancy this
explanation is not plausible.
Airway hyper-responsiveness and age
AHR is defined as an exaggerated response to contractile, nonallergic stimuli such as methacholine, histamine, or hypertonic saline [61]. Measurement of
AHR in early childhood is not feasible due to the cooperation and coordination
needed from the child to perform accurate lung function measurements. There is
no standardized measurement available for children younger than 6 years of age.
Because of these difficulties, studies of AHR in childhood are few and have
relatively small numbers of subjects. Furthermore, accurate dosing of the
challenging agents in children continues to be a matter of debate. As a result,
differences in study methods make comparison of studies for AHR in early
childhood difficult to perform. Despite these difficulties, studies in children
above 5 years of age have shown that AHR changes with age (Fig. 2C). In
childhood, airway responsiveness seems to be relatively high. There is a decrease
629
in AHR during adolescence, and this stabilizes in adulthood [6268]. Some

studies mention an increase of airway responsiveness above approximately
55 years of age [63,65,69]. These changes in airway responsiveness with age occur
in symptomatic and in asymptomatic individuals.
Airway hyper-responsiveness and gender

Despite difficulties in comparing studies of AHR at very early age, studies
show evidence for a gender difference in AHR that is similar to the pattern of
incidence and prevalence of asthma. In childhood, le Souef and colleagues [70]
and Paoletti and colleagues [63] describe a greater responsiveness in boys than in
girls, a finding that reverts during adolescence, where girls have a higher
prevalence of hyper-responsiveness. Boys exposed to environmental tobacco
smoke show significantly greater peak expiratory flow variability, reflecting
larger airway lability [41]. A higher prevalence of AHR in women compared with
men [63,65,69,7173] has been identified in large epidemiologic studies in adult
populations. Several explanations for this gender difference at adult age have
been proposed. Correction for smaller airway size, lung volume, or baseline lung
function parameters in women does not explain the gender difference in some
studies [63,69,72,73], but it does in others [69,71]. These discrepancies may be
explained by differences in statistical analysis (eg, the use of a quantitative
measure [slope of dose-response curve] or an absolute measure of AHR [AHR:
yes or no]). Another explanation mentioned for the gender difference is a greater
susceptibility to the effects of smoking in females.
The influence of age and gender: genetics

Theoretically, age and gender effects could be explained by the following characteristics:
1. Similar disease susceptibility genes but different disease expression
modified by age or gender (modifying effect)
2. Different susceptibility genes in childhood asthma compared with adultonset asthma and in males compared with females (genetic heterogeneity).
This could be exemplified by asthma-related genes on the sex chromosomes.
3. Different environmental effects depending on age and gender, for example, the use of oral contraceptives (gene-by-environment interaction)
4. Epigenetic effects that may be dependent on age and gender
Few genetic studies have addressed the influence of age and gender on
the development of atopy and asthma. Notwithstanding the fact that the available
studies are small, they do provide the first evidence for age- and gender-related
effects in the genetics of asthma and atopy.
630
bottema et al
Age-related genetic studies

One of the first attempts to identify whether genetic associations vary with
age was performed by ODonell and colleagues [74]. They performed a genetic
association study on longitudinal data on atopy and a polymorphism of CD14,
a membrane receptor, involved in binding of lipopolysaccharide and thereby
possibly influencing the postnatal Th2/Th1 shift. Failure in this immune system
shift may be associated with atopic development, which makes it plausible that
polymorphisms in the CD14 gene are especially associated with early atopic
development. The CD14/ 159 polymorphism has been associated with altered
soluble CD14 and IgE serum levels in several cross-sectional studies. In an
attempt to identify a possible age effect of CD14/ 159 polymorphism, ODonell
and colleagues collected longitudinal data from age 8 to 25 years on atopy and
AHR from 305 subjects and genotyped these individuals. For atopy, AHR, and
wheeze, these individuals were classified as having early persistent (present at
age 8 or 10 years, then consistently present up to age 18 or 25 years), early
remittent (present at age 8 or 10 years and at the next visit but then consistently
absent up to age 18 or 25 years), late onset (absent at age 8 or 10 years, then
present on at least two subsequent visits, with no visits after the age of 10 years
showing absent), or no disease during follow-up. They discovered that
individuals with 159CC were at higher risk for developing early-onset atopy
and early-onset AHR (OR 2.2 and 2.6) compared with individuals carrying
159CT and 159TT. Cross-sectional analysis showed that the CD14/ 159 CC
genotype was associated with atopy and AHR in childhood but not in adulthood.
Thus, it seems possible that the influence of the CD14/ 159 polymorphism may
cause an effect during childhood that fades away in adulthood. This suggests that
other genetic or environmental factors play a role in the atopic development in
late childhood or early adulthood. Because these findings do not explain why in
other studies on CD14 associations are being found in adulthood [75,76], further
studies need to confirm their observations.
Child and colleagues [77] studied glutathione S-transferase 1 (GSTP-1) because it may be of importance in the development of AHR. The enzyme is
involved in detoxification of many environmental toxins, drugs, and by-products
of oxidative stress that may otherwise cause inflammation of the airways [78].
Furthermore, variants of the GSTP-1 gene have shown association with risk of
AHR and atopy in adults [79,80]. They indicated that it might be important to
adjust for age in genetic association studies using the phenotype AHR. The
interpretation of the measurement of AHR at young age is difficult because body
size, breathing pattern, and baseline lung function may influence the measurement. In an attempt to solve these issues, they describe a method to correct doseresponse slopes and PC20 values for the baseline parameters age, lung function,
atopy, and height in 145 children 7 to 18 years of age [77]. The corrections
made in this study had a marked effect on the AHR status in 70 of 122 children,
5 of 122 to a more severe and 40 of 122 to a less severe PC20 category. The
corrections also resulted in a significant reduction of the mean dose-response
631
slope. The authors showed that this correction influenced the result of a genetic
association study in these children. A previously unidentified association between
the GSTP-1 genotype and AHR was found. This association would not have been
found in this population if uncorrected AHR was tested for association with the
GSTP-1 genotype [77].
One of the most extensively studied candidate genes for asthma and atopy
is interleukin (IL)-13. IL-13, a cytokine primarily produced by T-helper type
2 (Th2) cells, may be important in the development of asthma and atopy because
it promotes B-cell differentiation and is capable of inducing isotype classswitching of B-cells to produce IgE and IgG4 [81]. In mice, IL-13 contributes to
AHR by inducing contractions of smooth muscle cells and stimulating overproduction of mucus [82]. Many studies describe one or more associations between
various polymorphisms of the IL-13 gene with asthma and atopy phenotypes. We
took a closer look at the results of studies investigating IL-13 polymorphisms to
evaluate age and gender of the populations studied. To avoid bias by differences
in ethnicity, we considered only white and Caucasian populations. Table 1 shows
that there seems to be a difference between the associations found in childhood
and associations found in adulthood. In childhood, consistent associations of
single-nucleotide polymorphisms (SNPs) in the IL-13 gene with total serum IgE
are found [8387]. Given the difficulty to establish asthma in young children, in
this age group the asthma phenotype was evaluated in only a few studies, and
no associations with IL-13 SNPs were found [83,88]. In contrast, the studies
performed in adulthood do find associations with asthma or AHR [8991], but
they do not find association with total serum IgE [89,90,92,93]. It is not clear
why IL-13 is associated with IgE in childhood and not in adulthood. Oryszczyn
and colleagues [94] showed that IgE levels seem to be stable in mid-adulthood,
which suggests that in adulthood the environment may have a small effect on
IgE level. In contrast, environmental factors in childhood may have a larger
influence, which may bring about a geneenvironment interaction that is not
apparent in adulthood. Moreover, IgE levels are somewhat lower at adult age,
compared with more variable and higher levels at childhood age, which may
affect the outcome as well.
Finally, Ruse and colleagues [95] showed that serum IgE levels, but not
the high-affinity IgE receptor polymorphisms, were associated with late-onset
airway obstruction. They interpreted their findings as follows: interaction
between environmental and genetic factors control serum IgE levels and disease
pathogenesis may differ between early- and late-onset airway obstruction
phenotypes. Thus, IgE may have different roles in childhood asthma and lateonset asthma.
Animal studies provide evidence for the existence of age-related genetics.
Garret and colleagues [96] conducted time-course genetic analysis in selectively
bred rats to evaluate the genetic causes of albuminuria and proteinuria as early
markers of renal disease. Genome scans performed at 8, 12, and 16 weeks of age
identified quantitative trait loci (QTL) on nine rat chromosomes. The QTL
identified were variable with time and age of the rats. A locus for proteinuria on
207
329
482
1399
666
342
300
368
208
640
Author
Hoffjan [85]
He [88]
Liu [86,87]
Graves [84]
DeMeo [83]
Hummelshoj [92]
Heinzmann [89]
Howard [90]
Van der Pouw

Kraan [91]
Nieters [93]
Not mentioned
Recruitment from outpatient
department of pulmonology;
thus, probably adults.
3565 yr; no further information
Mean 8.16, SD 2.11 yr

Mean 27 (allergic subjects);
31 (controls); range 1766 yr
Young adults; no further
information
Mean 52, range 3476 yr
911 yr
Cohort; 17 yr
1 yr
2 yr
Age
n.a.
n.a.
n.a.
n.a.
P = .04
n.t.
P = .000002
OR 2.38, 95%CI
1.354.21, P = .003
P = .0026
n.t.
Total IgE
Association
n.a.
n.a.
P = .02
n.a.
P = .0069
OR 2.1, P = .0053
OR 3.49, 95%CI
1.528.02 (food allergens)/
OR 2.27, 95%CI 1.044.94
(outdoor allergens)
n.t.
n.a.
OR 2.5, P = .014
Sensitization
n.t.
OR 7.8, P = .002
OR 1.83, 95%CI
1.132.99, P = .014
P = .008, P = .007
n.a.
n.t.
n.t.
n.t.
n.t.
n.a.
Asthma/BHR
Arg130Gln
Arg130Gln
1111C/T
3Vuntranslated
region G/A
1111C/T
Arg130Gln
Arg130Gln
1111C/T
1512A/C
Arg130Gln
1111C/T
Arg130Gln
Arg130Gln
1111C/T
Arg130Gln
1111C/T
IL-13 SNPs
testeda
Abbreviations: BHR, bronchial hyperresponsiveness; CI, confidence interval; n.a., not associated; n.t., not tested; OR, odds ratio; SNP, single-nucleotide polymorphism.
a
Synonyms of SNPs: Arg130Gln = Arg110Gln = Gln110Arg; 1111C/T = C-1112T = 1055C/T = 1024C/T = 1112C/T.
Number of
subjects
Table 1
Association studies on IL-13 polymorphisms in white and/or Caucasian populations
632
bottema et al
633
chromosome 10 was present at age 12 weeks and not at age 8 and 16 weeks. This
suggests that the genes underlying these disease loci have a variable influence on
the phenotype that changes with age. This indicates that the complex genetic
mechanisms causing renal disease differ between early onset and late onset or
progression of the disease. Future studies have to elucidate whether this is also
the case for atopy or asthma.
Gender-related genetic studies
The cytotoxic T lymphocyte-associated 4 receptor (CTLA-4) may be important in the development of atopy and asthma because it is involved in a
costimulatory pathway regulating T-cell activation and subsequent IgE production. Chang and colleagues [97] found an association between the CTLA-4
genotype and cord blood IgE in a population of 644 Chinese newborns. This association with the CTLA-4 (+49 A/G) polymorphism was found only in females. In
an adult Chinese population, Yang and colleagues [98] found an association of
the CTLA-4 (+49 A/G) genotype and serum IgE levels, again only in females.
It had been previously shown that these same CTLA-4 polymorphisms are associated with atopy or asthma [99,100]. However, these studies did not stratify for
gender in their analysis. Thus, the results on a putative role of CTLA-4 SNPs in
the development of atopy and the specific gender effects have been replicated in a
second population. Furthermore, the CTLA-4 (+49 A/G) polymorphism has been
shown to alter T-cell activation in human cells [101]. To our knowledge, there is
no biologic mechanism described to explain the gender differences observed in
this genetic association.
Szczeklik and colleagues [102] have described a polymorphism that shows
a genetic association in women with asthma, but not in men: the prostaglandin
endoperoxide H synthase COX-2 ( 165 G/C). This COX-2 enzyme may be
involved in asthma development as a mediator of bronchial inflammation. The
COX-2 ( 165 CC) homozygotes were over-represented in female but not in
male asthmatics (odds ratio 3.08, 95% confidence interval 1.356.63, P = .01).
A functional effect of this polymorphism was confirmed by investigating prostaglandin production by peripheral blood monocytes in vitro as related to the
genotype of patients. Peripheral blood monocytes obtained from CC homozygous
women produced increased quantities of prostaglandins compared with monocytes from female GG homozygotes. The researchers investigated only monocytes from female patients; thus the question of whether this functional effect was
present only in female monocytes remains unanswered by the authors [102]. An
explanation for the gender difference in this association study is not available.
COX-2 has been studied extensively in relation to heart disease, and this may
provide a clue to the gender differences. One COX-2 inhibitor (Rofecoxib) was
recently discovered to enhance cardiovascular risks and was taken off the market.
This effect on cardiovascular risks was seen particularly in females and especially
in younger women who produce estrogen [103]. COX-2 is known to produce
prostacyclin, and production of this fatty acid is blocked by the COX-2 inhibitors.
634
bottema et al
Prostacyclin acts through the prostacyclin receptor. Egan and colleagues [104]
studied mice lacking this prostacyclin receptor. These mice were highly
susceptible to atherosclerosis. In these mice, there was no gender gap in heart
diseasea divergence long observed in people and in mice in which younger
males are at higher risk for heart disease than younger females. Female mice
lacking this prostacyclin receptor were highly susceptible to atherosclerosis
through susceptibility to oxidative stress from free radicals, which boost plaque
formation in arteries. The authors studied the effect of estrogen in relation
to prostacyclin production and found that in mice, estrogen increased prostacyclin
biosynthesis and depressed oxidative stress. This suggests that in premenopausal
females, the relative protection for atherosclerosis may be induced by their
endogenous estrogen that, acting through one of its receptors, stimulates COX-2
production and prostacyclin production. This also explains why COX-2
inhibitors enhance cardiovascular risks by extinguishing the beneficial effect of
estrogen in premenopausal women. The presumed estrogen dependent biosynthesis of COX-2 also explains why the genetic association of the COX-2
( 165 G/C) polymorphism with asthma before was only found in females. In
males, who have low levels of estrogen, a polymorphism in the COX-2 gene has
small effects.
A polymorphism of the proinflammatory cytokine IL-1b was found to be
associated with asthma only in men in a cohort of 245 asthma patients and
405 controls [105]. The difference in genotype between asthmatics and controls
was seen comparing heterozygote men with homozygote men, irrespective of the
alleles. This is difficult to explain biologically, and the authors could not solve
this problem. There was also no biologic explanation for the gender difference
observed. These results need to be replicated before conclusions are drawn.
Summary
When studying genetics of complex diseases it is important to have a clearly
described and objective phenotype. When drawing conclusions in association
studies, age and gender of the population studied should be considered. Until we
know what causes phenotypic differences between males and females and
between children and adults, we should try to study longitudinal cohorts with
phenotype assessment at different time points and stratify our analyses for gender.
To acquire sufficient power for these types of analyses, international collaboration may be the only way to elucidate the intricate geneenvironmental
interactions in atopy and asthma in an age- and gender-dependent manor.
References
[1] Watson JD, Crick FH. Molecular structure of nucleic acids; a structure for deoxyribose nucleic acid. Nature 1953;171:737 8.
635
[2] Aparicio SA. How to count. . . human genes. Nat Genet 2000;25:129 30.
[3] Venter JC, Adams MD, Myers EW, et al. The sequence of the human genome. Science
2001;291:1304 51.
[4] Lander ES, Linton LM, Birren B, et al. Initial sequencing and analysis of the human genome.
Nature 2001;409:860 921.
[5] Hoffjan S, Ober C. Present status on the genetic studies of asthma. Curr Opin Immunol
2002;14:709 17.
[6] Hoffjan S, Nicolae D, Ober C. Association studies for asthma and atopic diseases: a comprehensive review of the literature. Respir Res 2003;4:14 25.
[7] Masoli M, Fabian D, Holt S, et al. The global burden of asthma: executive summary of the
GINA Dissemination Committee report. Allergy 2004;59:469 78.
[8] Kay AB. Allergy and allergic diseases: first of two parts. N Engl J Med 2001;344:30 7.
[9] NHLBI/WHO. GINA workshop report, global strategy for asthma management and prevention, updated April 2002. Scientific information and recommendations for asthma programs.
Washington, DC7 US Department of Health and Human Services. NIH publication no. 02-3659;
2002. Available at: http://www.ginasthma.com.
[10] Watson L, Vestbo J, Postma DS, et al. Gender differences in the management and experience
of chronic obstructive pulmonary disease. Respir Med 2004;98:1207 13.
[11] Bel EH. Clinical phenotypes of asthma. Curr Opin Pulm Med 2004;10:44 50.
[12] Martinez FD. Development of wheezing disorders and asthma in preschool children. Pediatrics
2002;109(Suppl):362 7.
[13] Taussig LM, Wright AL, Holberg CJ, et al. Tucson Childrens Respiratory Study: 1980 to
present. J Allergy Clin Immunol 2003;111:661 75.
[14] De MR, Locatelli F, Cerveri I, et al. Incidence and remission of asthma: a retrospective study
on the natural history of asthma in Italy. J Allergy Clin Immunol 2002;110:228 35.
[15] Horak E, Lanigan A, Roberts M, et al. Longitudinal study of childhood wheezy bronchitis and
asthma: outcome at age 42. BMJ 2003;326:422 3.
[16] European Network for Understanding Mechanisms of Severe Asthma Study Group. The
ENFUMOSA cross-sectional European multicentre study of the clinical phenotype of chronic
severe asthma. Eur Respir J 2003;22:470 7.
[17] Leung DY, Bloom JW. Update on glucocorticoid action and resistance. J Allergy Clin Immunol
2003;111:3 22.
[18] Larsson L. Incidence of asthma in Swedish teenagers: relation to sex and smoking habits.
Thorax 1995;50:260 4.
[19] Yunginger JW, Reed CE, OConnell EJ, et al. A community-based study of the epidemiology
of asthma: incidence rates, 19641983. Am Rev Respir Dis 1992;146:888 94.
[20] Sunyer J, Anto JM, Kogevinas M, et al. Risk factors for asthma in young adults. Spanish Group
of the European Community Respiratory Health Survey. Eur Respir J 1997;10:2490 4.
[21] Berhane K, McConnell R, Gilliland F, et al. Sex-specific effects of asthma on pulmonary
function in children. Am J Respir Crit Care Med 2000;162:1723 30.
[22] Italian Studies on Respiratory Disorders in Childhood and the Environment Study Group.
Asthma and respiratory symptoms in 67 yr old Italian children: gender, latitude, urbanization
and socioeconomic factors. Eur Respir J 1997;10:1780 6.
[23] Venn A, Lewis S, Cooper M, et al. Questionnaire study of effect of sex and age on the
prevalence of wheeze and asthma in adolescence. BMJ 1998;316:1945 6.
[24] Sennhauser FH, Kuhni CE. Prevalence of respiratory symptoms in Swiss children: is bronchial
asthma really more prevalent in boys? Pediatr Pulmonol 1995;19:161 6.
[25] Gold DR, Rotnitzky A, Damokosh AI, et al. Race and gender differences in respiratory illness
prevalence and their relationship to environmental exposures in children 7 to 14 years of age.
Am Rev Respir Dis 1993;148:10 8.
[26] Harju T, Keistinen T, Tuuponen T, et al. Hospital admissions of asthmatics by age and sex.
Allergy 1996;51:693 6.
[27] Abramson M, Kutin JJ, Raven J, et al. Risk factors for asthma among young adults in
Melbourne, Australia. Respirology 1996;1:291 7.
636
bottema et al
[28] Kjellman B, Gustafsson PM. Asthma from childhood to adulthood: asthma severity, allergies,
sensitization, living conditions, gender influence and social consequences. Respir Med
2000;94:454 65.
[29] Robertson CF, Heycock E, Bishop J, et al. Prevalence of asthma in Melbourne schoolchildren:
changes over 26 years. BMJ 1991;302:1116 8.
[30] Fagan JK, Scheff PA, Hryhorczuk D, et al. Prevalence of asthma and other allergic diseases
in an adolescent population: association with gender and race. Ann Allergy Asthma Immunol
2001;86:177 84.
[31] Martin AJ, McLennan LA, Landau LI, et al. The natural history of childhood asthma to adult
life. BMJ 1980;280:1397 400.
[32] Strachan DP, Butland BK, Anderson HR. Incidence and prognosis of asthma and wheezing
illness from early childhood to age 33 in a national British cohort. BMJ 1996;312:1195 9.
[33] Johnson CC, Peterson EL, Ownby DR. Gender differences in total and allergen-specific
immunoglobulin E (IgE) concentrations in a population-based cohort from birth to age four
years. Am J Epidemiol 1998;147:1145 52.
[34] Barbee RA, Kaltenborn W, Lebowitz MD, et al. Longitudinal changes in allergen skin test
reactivity in a community population sample. J Allergy Clin Immunol 1987;79:16 24.
[35] Cline MG, Burrows B. Distribution of allergy in a population sample residing in Tucson,
Arizona. Thorax 1989;44:425 31.
[36] Gruber C, Kulig M, Bergmann R, et al. Delayed hypersensitivity to tuberculin, total immunoglobulin E, specific sensitization, and atopic manifestation in longitudinally followed early
Bacille Calmette-Guerin-vaccinated and nonvaccinated children. Pediatrics 2001;107:E36 42.
[37] Kulig M, Tacke U, Forster J, et al. Serum IgE levels during the first 6 years of life. J Pediatr
1999;134:453 8.
[38] Wittig HJ, Belloit J, De Fillippi I, et al. Age-related serum immunoglobulin E levels in healthy
subjects and in patients with allergic disease. J Allergy Clin Immunol 1980;66:305 13.
[39] Barbee RA, Halonen M, Kaltenborn W, et al. A longitudinal study of serum IgE in a community cohort: correlations with age, sex, smoking, and atopic status. J Allergy Clin Immunol
1987;79:919 27.
[40] Sherrill DL, Stein R, Halonen M, et al. Total serum IgE and its association with asthma
symptoms and allergic sensitization among children. J Allergy Clin Immunol 1999;104:28 36.
[41] Sheares BJ. Gender-specific pulmonary disease. In: Legato MJ, editor. Principles of genderspecific medicine. San Diego (CA)7 Elsevier; 2004. p. 25 35.
[42] Klinnert MD, Nelson HS, Price MR, et al. Onset and persistence of childhood asthma:
predictors from infancy. Pediatrics 2001;108:E69 76.
[43] Halonen M, Stern D, Lyle S, et al. Relationship of total serum IgE levels in cord and 9-month
sera of infants. Clin Exp Allergy 1991;21:235 41.
[44] Kerkhof M, Droste JH, de Monchy JG, et al. Distribution of total serum IgE and specific IgE
to common aeroallergens by sex and age, and their relationship to each other in a random
sample of the Dutch general population aged 2070 years. Dutch ECRHS Group, European
Community Respiratory Health Study. Allergy 1996;51:770 6.
[45] Siroux V, Curt F, Oryszczyn MP, et al. Role of gender and hormone-related events on IgE,
atopy, and eosinophils in the Epidemiological Study on the Genetics and Environment of
Asthma, bronchial hyperresponsiveness and atopy. J Allergy Clin Immunol 2004;114:491 8.
[46] Jarvis D, Luczynska C, Chinn S, et al. The association of age, gender and smoking with total
IgE and specific IgE. Clin Exp Allergy 1995;25:1083 91.
[47] Oryszczyn MP, Annesi-Maesano I, Charpin D, et al. Relationships of active and passive
smoking to total IgE in adults of the Epidemiological Study of the Genetics and Environment
of Asthma, Bronchial Hyperresponsiveness, and Atopy (EGEA). Am J Respir Crit Care
Med 2000;161:1241 6.
[48] Furuhashi M, Sugiura K, Katsumata Y, et al. Cord blood IgE against milk and egg antigens.
Biol Neonate 1997;72:210 5..
[49] Nambu M, Shintaku N, Ohta S. Relationship between cord blood level of IgE specific for
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
[58]
[59]
[60]
[61]
[62]
[63]
[64]
[65]
[66]
[67]
[68]
[69]
[70]
[71]
[72]
637
Dermatophagoides pteronyssinus and allergic manifestations in infancy. Biol Neonate

2003;83:102 6.
Kulig M, Bergmann R, Klettke U, et al. Natural course of sensitization to food and inhalant
allergens during the first 6 years of life. J Allergy Clin Immunol 1999;103:1173 9.
Rhodes HL, Thomas P, Sporik R, et al. A birth cohort study of subjects at risk of atopy: twentytwo-year follow-up of wheeze and atopic status. Am J Respir Crit Care Med 2002;165:176 80.
Gerritsen J, Koeter GH, de Monchy JG, et al. Allergy in subjects with asthma from childhood
to adulthood. J Allergy Clin Immunol 1990;85:116 25.
Lau S, Nickel R, Niggemann B, et al. The development of childhood asthma: lessons from
the German Multicentre Allergy Study (MAS). Paediatr Respir Rev 2002;3:265 72.
Peat JK, Toelle BG, Dermand J, et al. Serum IgE levels, atopy, and asthma in young adults:
results from a longitudinal cohort study. Allergy 1996;51:804 10.
Ulrik CS, Backer V. Atopy in Danish children and adolescents: results from a longitudinal
population study. Ann Allergy Asthma Immunol 2000;85:293 7.
Barbee RA, Lebowitz MD, Thompson HC, et al. Immediate skin-test reactivity in a general
population sample. Ann Intern Med 1976;84:129 33.
Halonen M, Barbee RA, Lebowitz MD, et al. An epidemiologic study of interrelationships of
total serum immunoglobulin E, allergy skin-test reactivity, and eosinophilia. J Allergy Clin
Immunol 1982;69:221 8.
Kelly WJ, Hudson I, Phelan PD, et al. Atopy in subjects with asthma followed to the age of
28 years. J Allergy Clin Immunol 1990;85:548 57.
Niemeijer NR, de Monchy JG. Age-dependency of sensitization to aero-allergens in asthmatics.
Allergy 1992;47:431 5.
Broadfield E, McKeever TM, Scrivener S, et al. Increase in the prevalence of allergen skin
sensitization in successive birth cohorts. J Allergy Clin Immunol 2002;109:969 74.
Page C. Bronchial hyperresponsiveness: what causes twitchy airways? J Pharm Pharmacol
1997;49(Suppl 3):9 11.
Weiss ST, Tager IB, Weiss JW, et al. Airways responsiveness in a population sample of adults
and children. Am Rev Respir Dis 1984;129:898 902.
Paoletti P, Carrozzi L, Viegi G, et al. Distribution of bronchial responsiveness in a general
population: effect of sex, age, smoking, and level of pulmonary function. Am J Respir Crit
Care Med 1995;151:1770 7.
Clifford RD, Radford M, Howell JB, et al. Prevalence of atopy and range of bronchial response
to methacholine in 7 and 11 year old schoolchildren. Arch Dis Child 1989;64:1126 32.
Hopp RJ, Bewtra A, Nair NM, et al. The effect of age on methacholine response. J Allergy Clin
Immunol 1985;76:609 13.
Hopp RJ, Bewtra AK, Nair NM, et al. Methacholine inhalation challenge studies in a selected
pediatric population. Am Rev Respir Dis 1986;134:994 8.
Morikawa A, Mochizuki H, Shigeta M, et al. Age-related changes in bronchial hyperreactivity
during the adolescent period. J Asthma 1994;31:445 51.
Redline S, Tager IB, Speizer FE, et al. Longitudinal variability in airway responsiveness
in a population-based sample of children and young adults: intrinsic and extrinsic contributing
factors. Am Rev Respir Dis 1989;140:172 8.
Rijcken B, Schouten JP, Mensinga TT, et al. Factors associated with bronchial responsiveness
to histamine in a population sample of adults. Am Rev Respir Dis 1993;147:1447 53.
Le Souef PN, Sears MR, Sherrill D. The effect of size and age of subject on airway
responsiveness in children. Am J Respir Crit Care Med 1995;152:576 9.
Britton J, Pavord I, Richards K, et al. Factors influencing the occurrence of airway
hyperreactivity in the general population: the importance of atopy and airway calibre. Eur
Respir J 1994;7:881 7.
Leynaert B, Bousquet J, Henry C, et al. Is bronchial hyperresponsiveness more frequent
in women than in men? A population-based study. Am J Respir Crit Care Med 1997;156:
1413 20.
638
bottema et al
[73] Trigg CJ, Bennett JB, Tooley M, et al. A general practice based survey of bronchial hyperresponsiveness and its relation to symptoms, sex, age, atopy, and smoking. Thorax 1990;45:
866 72.
[74] ODonnell AR, Toelle BG, Marks GB, et al. Age-specific relationship between CD14 and atopy
in a cohort assessed from age 8 to 25 years. Am J Respir Crit Care Med 2004;169:615 22.
[75] Buckova D, Holla LI, Schuller M, et al. Two CD14 promoter polymorphisms and atopic
phenotypes in Czech patients with IgE-mediated allergy. Allergy 2003;58:1023 6.
[76] Koppelman GH, Reijmerink NE, Colin SO, et al. Association of a promoter polymorphism
of the CD14 gene and atopy. Am J Respir Crit Care Med 2001;163:965 9.
[77] Child F, Lenney W, Clayton S, et al. Correction of bronchial challenge data for age and size
may affect the results of genetic association studies in children. Pediatr Allergy Immunol
2003;14:193 200.
[78] Hayes JD, Strange RC. Glutathione S-transferase polymorphisms and their biological
consequences. Pharmacology 2000;61:154 66.
[79] Fryer AA, Bianco A, Hepple M, et al. Polymorphism at the glutathione S-transferase GSTP1
locus: a new marker for bronchial hyperresponsiveness and asthma. Am J Respir Crit Care Med
2000;161:1437 42.
[80] Mapp CE, Fryer AA, De MN, et al. Glutathione S-transferase GSTP1 is a susceptibility
gene for occupational asthma induced by isocyanates. J Allergy Clin Immunol 2002;109:
867 72.
[81] Cocks BG, de Waal MR, Galizzi JP, et al. IL-13 induces proliferation and differentiation of
human B cells activated by the CD40 ligand. Int Immunol 1993;5:657 63.
[82] Pope SM, Brandt EB, Mishra A, et al. IL-13 induces eosinophil recruitment into the lung by
an IL-5- and eotaxin-dependent mechanism. J Allergy Clin Immunol 2001;108:594 601.
[83] DeMeo DL, Lange C, Silverman EK, et al. Univariate and multivariate family-based
association analysis of the IL-13 ARG130GLN polymorphism in the Childhood Asthma
Management Program. Genet Epidemiol 2002;23:335 48.
[84] Graves PE, Kabesch M, Halonen M, et al. A cluster of seven tightly linked polymorphisms
in the IL-13 gene is associated with total serum IgE levels in three populations of white children. J Allergy Clin Immunol 2000;105:506 13.
[85] Hoffjan S, Ostrovnaja I, Nicolae D, et al. Genetic variation in immunoregulatory pathways
and atopic phenotypes in infancy. J Allergy Clin Immunol 2004;113:511 8.
[86] Liu X, Nickel R, Beyer K, et al. An IL13 coding region variant is associated with a high total
serum IgE level and atopic dermatitis in the German multicenter atopy study (MAS-90).
J Allergy Clin Immunol 2000;106:167 70.
[87] Liu X, Beaty TH, Deindl P, et al. Associations between specific serum IgE response and
6 variants within the genes IL4, IL13, and IL4RA in German children: the German Multicenter
Atopy Study. J Allergy Clin Immunol 2004;113:489 95.
[88] He JQ, Chan-Yeung M, Becker AB, et al. Genetic variants of the IL13 and IL4 genes and atopic
diseases in at-risk children. Genes Immun 2003;4:385 9.
[89] Heinzmann A, Mao XQ, Akaiwa M, et al. Genetic variants of IL-13 signalling and human
asthma and atopy. Hum Mol Genet 2000;9:549 59.
[90] Howard TD, Whittaker PA, Zaiman AL, et al. Identification and association of polymorphisms
in the interleukin-13 gene with asthma and atopy in a Dutch population. Am J Respir Cell Mol
Biol 2001;25:377 84.
[91] van der Pouw Kraan TC, van Veen A, Boeije LC, et al. An IL-13 promoter polymorphism
associated with increased risk of allergic asthma. Genes Immun 1999;1:61 5.
[92] Hummelshoj T, Bodtger U, Datta P, et al. Association between an interleukin-13 promoter
polymorphism and atopy. Eur J Immunogenet 2003;30:355 9.
[93] Nieters A, Linseisen J, Becker N. Association of polymorphisms in Th1, Th2 cytokine
genes with hayfever and atopy in a subsample of EPIC-Heidelberg. Clin Exp Allergy 2004;34:
346 53.
[94] Oryszczyn MP, Annesi I, Neukirch F, et al. Longitudinal observations of serum IgE and skin
prick test response. Am J Respir Crit Care Med 1995;151:663 8.
639
[95] Ruse CE, Hill MC, Burton PR, et al. Associations between polymorphisms of the high-affinity
immunoglobulin E receptor and late-onset airflow obstruction in older populations. J Am
Geriatr Soc 2003;51:1265 9.
[96] Garrett MR, Dene H, Rapp JP. Time-course genetic analysis of albuminuria in Dahl saltsensitive rats on low-salt diet. J Am Soc Nephrol 2003;14:1175 87.
[97] Chang JC, Liu CA, Chuang H, et al. Gender-limited association of cytotoxic T-lymphocyte
antigen-4 (CTLA-4) polymorphism with cord blood IgE levels. Pediatr Allergy Immunol
2004;15:506 12.
[98] Yang KD, Liu CA, Chang JC, et al. Polymorphism of the immune-braking gene CTLA-4 (+ 49)
involved in gender discrepancy of serum total IgE levels and allergic diseases. Clin Exp Allergy
2004;34:32 7.
[99] Howard TD, Postma DS, Hawkins GA, et al. Fine mapping of an IgE-controlling gene on
chromosome 2q: analysis of CTLA4 and CD28. J Allergy Clin Immunol 2002;110:743 51.
[100] Hizawa N, Yamaguchi E, Jinushi E, et al. Increased total serum IgE levels in patients with
asthma and promoter polymorphisms at CTLA4 and FCER1B. J Allergy Clin Immunol 2001;
108:74 9.
[101] Maurer M, Loserth S, Kolb-Maurer A, et al. A polymorphism in the human cytotoxic
T-lymphocyte antigen 4 (CTLA4) gene (exon 1 + 49) alters T-cell activation. Immunogenetics
2002;54:1 8.
[102] Szczeklik W, Sanak M, Szczeklik A. Functional effects and gender association of COX-2 gene
polymorphism G-765C in bronchial asthma. J Allergy Clin Immunol 2004;114:248 53.
[103] Couzin J. Medicine. Estrogens ties to COX-2 may explain heart disease gender gap. Science
2004;306:1277.
[104] Egan KM, Lawson JA, Fries S, et al. COX-2-derived prostacyclin confers atheroprotection on
female mice. Science 2004;306:1954 7.
[105] Karjalainen J, Nieminen MM, Aromaa A, et al. The IL-1beta genotype carries asthma
susceptibility only in men. J Allergy Clin Immunol 2002;109:514 6.

25 (2005) 641 654
Family Studies and Positional Cloning of Genes

for Asthma and Related Phenotypes
Alicia K. Smith, PhDa, Deborah A. Meyers, PhDb,T
a
Centers for Disease Control and Prevention, Atlanta, GA, USA

Center for Human Genomics, Wake Forest University School of Medicine,
Medical Center Boulevard, Winston-Salem, NC 27157, USA
Asthma is characterized by atopy, bronchial hyperresponsiveness (BHR),

inflammation, and intermittent airway obstruction, all of which occur as a result of
the interaction between individual susceptibility and environmental exposures.
Because the relevant environmental exposures may vary, the genes involved may
be different even within a phenotypically similar group of people because of the
complexity and redundancy of many biochemical pathways. Expression of a
functional variant may not be apparent without the presence of a specific
environmental stimulus. Interaction of multiple genes may also be required to
confer susceptibility or to increase severity. Therefore, the phenotypic effects of a
functional variant in one gene may not be apparent without the presence of another
polymorphism. A threshold may also be present at which a certain number of
variants in contributing genes are required before a disease is expressed [1].
Both the incidence of asthma and the cost of treatment have been steadily
increasing for decades. Approximately 6.7 million Americans were affected with
asthma in 1980 compared with 17.3 million in 1998 [2]. Also in 1998, there were
2 million asthma-related visits to emergency departments and 5438 reported
deaths [3]. Asthma was a contributing cause of death in another 6850 individuals, increasing the number of asthma-related deaths to 12,288 for that year
[4]. Total annual costs of asthma in the United States were estimated to be
$11.3 billion in 1998, of which $7.8 billion were direct medical expenses.
Therefore, genetic studies have sought to identify the genes that influence the
development or progression of asthma with the hope of contributing to the understanding of asthma pathogenesis, clinical diagnoses, and treatments.
T Corresponding author. Centers for Disease Control and Prevention, Atlanta, GA.
E-mail address: dmeyers@wfubmc.edu (D.A. Meyers).
doi:10.1016/j.iac.2005.09.003
642
smith
&
meyers
Determination of genetic component

Initially, studies are performed to examine whether or not a particular condition has a genetic component. This often includes family heritability studies
which relate the proportion of total phenotypic variance into genetic and environmental components as described by:
H Vg =Vp
where H represents heritability, Vg represents the proportion of genetic variance, and Vp represents the phenotypic variance due to both genetic and environmental components. Studies of monozygotic versus dizygotic twins, as well
as families, are useful to address this question. The rate of phenotypic discordance is compared between monozygotic twins, who share both genetic and
environmental backgrounds, and dizygotic twins, who share approximately 50%
of their genetic background and share their environment. Significantly higher
disease concordance in monozygotic twins suggests a genetic component of
the disease.
Asthma has been shown to aggregate in families [5], and heritability is estimated from 36% [6] to 75% [7]. The associated phenotype of total serum IgE
levels have been shown to aggregate in families and are correlated with asthma
risk [8]. Family studies have also shown that hyperresponsiveness aggregates in
families with heritability estimated between 22% and 66% [911]. Twin studies
support these observations as well [12]. Twin studies also indicate that genetic
influences regulate components of asthma such as total serum IgE levels and
bronchial hyperresponsiveness [9].
Genome-wide screening
After a genetic component has been suggested, the complexity of the cell
types and signaling molecules involved makes identification of the contributing variants difficult. Candidate gene analysis is based on knowledge about a
gene and its contribution to the pathology of a disease. In a disease where the
etiology is well known and when there are a limited number of genes which may
be involved, this is a reasonable approach. However, if a disease involves
multiple biochemical pathways or if the etiology is not well characterized, genome scans can be used to identify genes for study based solely on position
within the genome.
To perform a genome scan, related individuals are used to determine if regions
of the genome are cotransmitted with a disease or phenotype. Genetic markers are
genotyped in families at evenly spaced intervals throughout the genome. Although
not all family members express the phenotype being studied, it is possible to
determine which markers cosegregate with the disease or a component of it. The
positional cloning of genes for asthma
643
degree of linkage in a family is represented by a lod score which corresponds to

the log10 of the odds for linkage and is represented by the following formula:
zx log10
Lpedigree given x
Lpedigree given 0:5
where z(x) is the two-point log of odds (LOD) score (the linkage between a
marker locus and another marker or phenotype locus) and L is the likelihood of
observing a particular configuration of a phenotype and a marker locus in a family.
q is the fraction of recombinant offspring verses nonrecombinant offspring in a
family, and ranges from 0 for loci that are completely linked to 0.5 for loci that
assort independently. A LOD score of 3.3 would indicate a likelihood ratio of over
1000:1 in favor of linkage and is considered significant evidence of linkage
[13]. However, in common diseases, regions with LOD scores greater than one
may be chosen for further study, especially if the evidence for linkage has been
replicated in multiple populations. Further addition of markers, known as fine
mapping, may be used to refine a linked region or to potentially eliminate false
positive results.
Specifying a model in the LOD score analysis (parametric or model dependent analysis) can often increase the power to detect linkage. In this case, a model
is built that includes estimates of mode of inheritance such as dominant or
recessive and estimated degree of penetrance and phenocopy rate. However,
because the mode of inheritance is often not known in common diseases, a
nonparametric or model independent analysis is usually performed. Analysis of
both qualitative traits (eg, asthma or not) and quantitative traits (eg, log total
serum IgE levels) are often used in genome-wide screens, and quantitative trait
loci analyses are usually more powerful in detecting linkage.
Although multiple regions of the genome have been identified by genome-wide
screens, linked regions are not always replicated between studies. Families often
have different environmental exposures or genetic backgrounds, making detection
of genes with small to moderate effects much more difficult [1]. Other reasons
for the discrepancies may include differences in parameters used in each LOD
score analysis or variations in marker density or information content. To increase
the power of a study, families with a more homogeneous genetic background
are often helpful because there may be fewer disease genes contributing to the
phenotype, and these genes may be easier to identify. However, candidate genes
identified in a more isolated group may not be relevant outside of that population.
In recent years, linkage studies and positional cloning have been used to
successfully identify genes that contribute to asthma and atopy. Genome-wide
linkage studies for asthma or related phenotypes have been completed in at least
10 populations (Table 1). Several of these linked regions have been reported in
multiple populations and with related phenotypes including 1p31-pter, 2q32-q34
5q23-q31, 6p21-p24, 7q11-q22, 9p21-p23, 11p13-p15, 12q13-q21, 12q23-q25,
13q14-q31, and 19q13. Fine mapping and evaluation of candidate genes within
644
smith
&
meyers
Table 1
Linkages reported for asthma and related phenotypes
Pulmonary
function
Chromosome
Asthma
Atopy
1p31-pter
French
Danish
Japanese
Danish
Japanese
German
Dutch
German
Chinese
German
German
Chinese
1p21-22
1q41
2pter
2p25
2q14
2q21
2q24
2q32-34
Hutterite
United States Hispanics
3p23-26
3q22
3q29-qter
Japanese
Danish
Danish
4p13
4q23
4q32
Danish
Finnish
Japanese
Danish
Japanese
4q34-35
5p13-15
5q15
5q23-31
5q33-35
6p21-24
7p14-15
7q11-22
7q32
8q13
9p13
9p21-23
9q31-32
10p14
11p13-15
African Americans
Hutterite
United States Caucasians
Hutterite
Japanese
Danish
Japanese
German
Japanese
Danish
Finnish
Japanese
Finnish
Hutterite
German
Hutterite
German
Japanese
German
German
Dutch
Dutch
German
Hutterites
Dutch
Hutterite
Danish
Dutch
Danish
Chinese
Danish
German
Danish
Australian
Hutterite
Dutch
Dutch
Danish
Danish
Dutch
German
Australian
Danish
Finnish
Dutch
German
Australian
Australian
Hutterite
German
German
Chinese
French
Australian
(continued on next page)
645
Table 1 (continued)
Chromosome
Asthma
11q13
11q25
12q13-21
12q23-25

Hutterite
German
Japanese
Danish
Japanese
Japanese
13q32-qter
14q11-13
15q11
15q22
16p12
16q21
16q24
17p12-q12
17q12-q21
17q25
19q13

22q12-13
Xp11
Xq25-26
Pulmonary
function
Australian
French
Danish
German
13q12-13
13q14-31
21q21-22
Atopy
German
French
Dutch
German
Dutch
Australian
French
Dutch
Dutch
Hutterite
Dutch
German
Chinese
Danish
Hutterite
African American
French
Japanese
United States Caucasian
Hutterite
Hutterite
Danish
Australian
French
Dutch
Hutterite
French
Hutterite
Danish
Danish
German
Chinese
The following populations are represented: Australian [39], US populationsAfrican American,

Caucasian, and Hispanic [22], Hutterite [23,64], German [18], French [14], Japanese [26], Dutch
[16,17], Finnish [60], Chinese [19], and Danish [15]. Studies involving total serum IgE levels, skin
testing, or peripheral blood eosinophils are included under Atopy. Studies involving BHR, FEV1,
FVC, or FEV1/FVC are included under Pulmonary Function.
these areas has led to the identification of several potential susceptibility or

severity genes (Box 1). Some of these regions and genes identified therein are
reviewed below.
Chromosome 1p
Multiple family studies including those in French [14] and Danish [15]
populations have reported that asthma susceptibility genes map to a region on
chromosome 1p31. Other studies link this region to atopy in Dutch [16,17] and
646
smith
&
meyers
Box 1. Fine mapping and candidate gene analysis

Genotype additional markers and narrow region of linkage

Test for association and linkage disequilibrium to further narrow the region of interest
Genotype polymorphisms in candidate genes to test for association with the disease trait (multiple populations)

German [18] populations and to pulmonary function in the Chinese [19]. A

mouse model of asthma showed that gob-5 is involved in mucus secretion and is
upregulated in sensitized mice [20]. Studies of its human homologchloride
channel calcium-activated 1in a Japanese population consisting of adults and
children with asthma reported association of single nucleotide polymorphism
(SNP)s with asthma as well as the identification of risk haplotypes [21].
Chromosome 2q
Evidence for linkage of markers within chromosome 2q32-q34 to asthma has
been observed in a Hispanic population in the United States [22] and to atopic
phenotypes in Hutterite [23], German [18], and Dutch populations [16,17].
Studies of candidate genes within this region have identified CTLA4 which is
expressed exclusively on activated T cells and acts as a negative regulator of
T cell activation. Association studies have reported the association of CTLA4
polymorphisms with asthma susceptibility, total serum IgE levels, and bronchial
hyperresponsiveness in a Dutch population [24] and with total serum IgE levels
in a Japanese population [25].
Chromosome 5q
Multiple family studies have demonstrated that asthma and atopy susceptibility genes map to a region on chromosome 5q23-q35 including those in Dutch
[16,17], American [22], Hutterite [23], Japanese [26], Danish [15], and British
[27,28] populations. A cluster of cytokines important in immune regulation are
located within the region of linkage that has been genetically and functionally
implicated in asthma and atopy. Polymorphisms in interleukin (IL)-4 have been
associated with asthma, increased total serum IgE levels, and pulmonary function
[2932]. Polymorphisms in IL-13 have also been associated with asthma, total
serum IgE levels, and BHR [3335]. Both IL-13 and IL-4 are capable of inducing
isotype class-switching of B cells to produce IgE after allergen exposure, and
binding of either IL13 or IL4 to the IL4 receptor (IL4R) promotes the initial
response for Th2 lymphocyte polarization often observed in asthma.
647
Monocyte differentiation antigen CD14 is also located on chromosome 5q31.

It functions as a receptor for bacterial cell wall components, including endotoxin
and lipopolysaccharide, and may be involved in the polarization of T lymphocytes. Polymorphisms in CD14 have been associated with asthma and total
serum IgE levels in Dutch [36], Indian [37], and Taiwanese [38] populations.
Chromosome 6p
Evidence for linkage of markers within chromosome 6p21-p24 to asthma has
been observed in United States Caucasian [22], German [18], Japanese [26], and
Danish [15] populations and to atopic phenotypes in Dutch [16,17], German [18],
Australian [39], and Danish [15] populations. Candidate genes in this region
include human leukocyte antigen DRB1, a class II molecules of the major histocompatibility complex, which has been associated with both total serum IgE
levels and specific IgE titres to common allergens in 1004 individuals from
230 families from the rural Australian town of Busselton [40]. Moffatt and colleagues also reported a relationship between human leukocyte antigen DRB1
variants and total and specific IgE levels in Australian Aborigines suffering from
endemic hookworm infection [41].
Another well-characterized candidate gene in this region is tumor necrosis
factor a, a multifunctional proinflammatory cytokine. Associations of the tumor
necrosis factor a308 polymorphism has been reported in subjects with mild/
moderate and those with fatal/near fatal asthma versus those without asthma in a
Canadian population [42]. Associations have also been reported with atopy in a
Spanish population [43], self-reported childhood asthma in a UK/Irish population
[44], and atopic asthma in Taiwanese children [45].
Chromosome 12q
Linkage analyses have demonstrated that chromosome 12q13-q21 is likely to
contain genes related to asthma in United States Caucasian and Hispanic populations [22] as well as in the Hutterites [23] and Germans [18]. Pulmonary
function phenotypes have mapped to this region in a German [18] population as
well. Signal transducer and activator of transcription 6 (STAT6) is located on
chromosome 12q13. It is a transcription factor involved in both IL-4 and IL-13
mediated responses and exhibits increased expression in bronchial biopsies of
patients with asthma versus controls [46]. Tamura and colleagues published
the first association study with STAT6 and suggested its association with predisposition to allergic diseases in Japanese children [47]. Additional studies support the association of STAT6 variants to atopic phenotypes including total serum
IgE levels and eosinophilia [4850]. Associations of STAT6 SNPs and haplotypes
with asthma were recently reported in an Indian population [51].
648
smith
&
meyers
Positional cloning
Advances in genetic mapping and technology have yielded more powerful approaches to identifying disease genes. Analysis of single markers can be
enhanced by considering the structure of linkage disequilibrium (LD) blocks
within a region. LD is the nonrandom association of alleles at adjacent loci. In
general, the closer two SNPs are to each other, the more likely they are to be in a
region that is inherited as a block. A study using a SNP within an LD block
can provide information about other markers within that block and has led to
the concept of haplotype tagging SNPs. Use of this technique can reduce the
number of markers needed as well as the cost of experiments. This, combined
with advances in high throughput genotyping, has made genome-wide studies
more accessible and allowed the study of complex diseases to evolve.
The next step in family-based genetic studies, known as positional cloning,
also uses a systematic process of locating genetic regions that are coinherited with
a disease (Fig. 1). Construction of a high-density SNP map is used to identify
common variants in the region. Association studies using these markers can
further narrow the region of interest. Replication in one or more additional populations is often used to focus the associations to the most relevant areas. Positional
cloning can identify disease-related genes based solely on position within the
genome, even if the function of that gene is not yet known, and it requires no
Chromosome Chromosome
from Mother from Father
SNP 1:
SNP 2:
SNP 3:
The high-risk variant

of the disease gene is
located here
C
SNP 3:
The closer together that 2 loci are, the less

likely a recombination event will occur
between them and they tend to segregate
together through generations.
Therefore, evidence for linkage
disequilibrium will be obtained leading to
gene identification
b
Crossover
event
c
d
C
d
Fig. 1. Example of linkage disequilibrium. The location of the risk variant for the disease gene that
is being mapped is displayed on the chromosome inherited from the father. The alleles at the neighboring SNPs 1 and 2 cosegregate. Identification of such a pattern leads to gene identification.
649
assumptions about the probable disease pathogenesis. Therefore, genes that

have been identified by positional cloning can provide additional insight into the
etiology of a disease. Asthma genes identified by this approach include PHF11
[52], GPRA [53], DPP10 [54], and ADAM33 [55] and human leukocyte antigen G
[56]; the latter two genes are discussed elsewhere in this issue.
Plant homeodomain zinc finger gene 11 (PHF11) is located on chromosome
13q14, where linkage for asthma [26] and atopy [14,17,39] has been reported.
Anderson and colleagues [57] had previously reported association in this region
with the novel microsatellite marker USAT24G1 and continued to explore the
region by developing a comprehensive SNP map for the surrounding region.
Fifty-four common variants were studied in 364 individuals from 80 Australian
nuclear families. Association of SNPs and haplotypes to serum IgE levels indicated a 100-kb linkage disequilibrium block that contained SETDB2, PHF11, and
RCBTB1. Further analysis using a stepwise procedure including the most
significant SNP as a covariate until no association remained identified three PHF11
SNPs with independent effects. Six markers were then genotyped in a second set
of Australian atopic families, a British set of families with asthma, and a set of
European families with atopic dermatitis. Haplotype associations were observed
in each of the populations with asthma or total serum IgE levels and suggested a
more localized region influencing total serum IgE levels. Functional analysis
identified multiple transcript variants and noted uniform distribution among tissue
types and prominent expression in immune-related tissues. The function of this
gene is not yet fully known; however, based on structural motifs, it is predicted to
be involved in chromatin-mediated transcriptional regulation [58]. Although these
results have not yet been replicated in additional asthma populations, a familybased association study reported variations in PHF11 were significantly associated
with childhood atopic dermatitis in an Australian cohort [59].
G-proteincoupled receptor for asthma (GPRA) is located in the chromosome
region 7p14-p15, which has been associated with asthma and atopy in a Finnish
Kainuu subpopulation [60]. Sequential rounds of fine mapping and haplotype
association analysis for serum IgE levels in the original Kainuu families and an
additional 103 trios were used to narrow the 20-cM linkage region. A 46-kb
haplotype was identified, and nonrepetitive DNA segments within this haplotype
were sequenced for SNP detection, revealing 72 novel SNPs and eight insertions
or deletions. An additional 131 trios with high IgE levels were genotyped, indicating a conserved 133-kb region. Association analysis with a Canadian population ascertained for asthma and a Finnish population ascertained for high IgE
levels confirmed the same 133-kb region. The two genes within this region were
GPRA and a series of untranslated, alternatively spliced transcripts (asthmaassociated, alternatively spliced 1 [AAA1]) which do not appear to code for a
protein. Bronchial biopsies suggested that one isoform of GPRA was differentially expressed in bronchial epithelial cells and smooth muscle cells from individuals who have asthma when compared with healthy controls [53]. A study
of European children supports these findings [61]. Melen and colleagues [61]
examined the same haplotype blocks as the original study and reported asso-
650
smith
&
meyers
Box 2. Example of fine mapping

Association with D2S308 (allele 3) and asthma (P = .00001)

Based on linkage disequilibrium, asthma gene located with
100 kb of D2S308
Found evidence for significant association with asthma for
SNPs in DPP10

Data from Allen M, Heinzmann A, Noguchi E, et al. Positional cloning of a novel gene influencing asthma from chromosome 2q14.
Nat Genet 2003;35:25863.
ciation of single SNPs and haplotypes with allergic sensitization, asthma, and
allergic rhinoconjunctivitis in western European children. Associations with both
SNPs and haplotypes were also reported in a study of German children [62].
Both studies were able to replicate associations with some of the haplotypes
conferring risk and exerting protective effects as the original study by Laitinen
and colleagues [53].
Dipeptidyl peptidase 10 (DPP10) is a member of a protease family that can
cleave off terminal dipeptides from chemokines and cytokines. It is located at
2q14, where linkage to asthma has been reported [23]. Association of D2S308
with asthma was observed in a population of 244 families. Allen and colleagues
Fig. 2. Example of the use of linkage disequilbirum to identify a disease gene. The degree of
disequilibrium between SNPs is shown in the square, and the degree of association with the phenotype
is shown on the y axis. (From Allen M, Heinzmann A, Noguchi E, et al. Positional cloning of a novel
gene influencing asthma from chromosome 2q14. Nat Genet 2003;35:25863; with permission.)
651
sequenced 462 kb of 2q14 surrounding this microsatellite and constructed a

high-density SNP LD map (Box 2). Association studies with 82 of 105 polymorphisms identified four islands of LD (AD), though associations with asthma
were limited to island B (Fig. 2). The most significant association was with
WTC122P, which alters the consensus binding site of CdxA, a DPP family promoter element. Three SNPs were then examined in 1047 German school children.
The D2S308 allele associated in the family study demonstrated consistent
association with both asthma and atopy. Haplotypes such as WTC122P were
also significant, but it was not reported whether WTC122P was associated on its
own. Because no open reading frames had been reported in the area surrounding D2S308 and WTC122P, a cDNA library was screened. Further characterization including 5V and 3V RACE led to the identification of DPP10. D2S308
and WTC122P were located near exon 2 of this gene. Functional analysis of
the locus indicated a complex pattern of transcript splicing with eight alternate
first exons and reported DPP10 expression in the trachea [54]. A study of
DPP10 function in the central nervous system suggested that it is a modulator of
Kv4-mediated A-type potassium channels [63]. However, its function in airway
physiology remains undetermined.
Summary
Although it is not yet known how many genes may contribute to the susceptibility or the severity of asthma and related phenotypes, genome-wide screens and
positional cloning techniques have been successful in identifying contributing
genes in multiple populations. The results of these studies provide additional
insight into the molecular mechanisms responsible for the development of a variety
of phenotypes. Replication with additional populationsparticularly in large-scale
studieshas been used to distinguish between false positive results or populationspecific effects or to further quantify the conferred risk. Even when individual
markers do not replicate in multiple population, association of the same region or
gene has been useful in directing future studies.
As further understanding of the linkage disequilibrium patterns within the
genome has allowed greater efficiency for genetic studies, advances in highthroughput genotyping technology, genetic analysis methodologies, and a more
in-depth understanding of clinical phenotypes has made genome-wide studies
more accessible and cost-effective. In the future, identification of function variants with clinical relevance may be used to influence the diagnosis and treatment
of asthma.
References
[1] Schork N. Genetics of complex disease. Approaches, problems, and solutions. Am J Respir Crit
Care Med 1997;156:S103 9.
652
smith
&
meyers
[2] National Center for Environmental Health. Asthma at-a-glance. Atlanta (GA)7 Centers for
Disease Control and Prevention; 1999.
[3] National Center for Health Statistics. New asthma estimates: tracking prevalence, health care,
and mortality. Atlanta (GA)7 Centers for Disease Control and Prevention; 2001.
[4] National Heart Lung and Blood Institute. NHLBI reports new asthma data for World Asthma
Day 2001. Washington, DC7 National Institutes of Health; 2001.
[5] Sibbald B, Turner-Warwick M. Factors influencing the prevalence of asthma among first degree relatives of extrinsic and instrinsic asthmatics. Thorax 1979;34:322 37.
[6] Nieminen M, Kaprio J, Koskenvuo M. A population-based twin study of bronchial asthma
in twin pairs. Chest 1991;100:71 5.
[7] Duffy DL, Martin NG, Battistutta D, et al. Genetics of asthma and hay fever in Australian
twins. Am Rev Respir Dis 1990;142:1351 8.
[8] Burrows B, Martinez FD, Halonen M, et al. Association of asthma with serum IgE levels
and skin-test reactivity to allergens. N Engl J Med 1989;320:271 7.
[9] Hopp R, Nair N, Bewtra A, et al. Genetic analysis of allergic disease in twins. J Allergy Clin
Immunol 1984;73:265 70.
[10] Paoletti P, Viegi G, Carrozzi L. Bronchial hyperresponsiveness, genetic predisposition and
environmental factors: the importance of epidemiological research. Eur Respir J 1992;5:
910 2.
[11] Lawrence S, Beasley R, Doull I, et al. Genetic analysis of atopy and asthma as quantitative traits
and ordered polychotomies. Ann Hum Genet 1994;58:359 68.
[12] Laitinen T, Rasanen M, Kaprio J, et al. Importance of genetic factors in adolescent asthma.
A population-based twin-family study. Am J Respir Crit Care Med 1998;157:1073 8.
[13] Lander E, Kruglyak L. Genetic dissection of complex traits: guidelines for interpreting and
reporting linkage results. Nat Genet 1995;11:241 7.
[14] Dizier MH, Besse-Schmittler C, Guilloud-Bataille M, et al. Genome screen for asthma and
related phenotypes in the french EGEA study. Am J Respir Crit Care Med 2000;162:1812 8.
[15] Haagerup A, Bjerke T, Schoitz PO, et al. Asthma and atopya total genome scan for susceptibility genes. Allergy 2002;57:680 6.
[16] Xu J, Postma DS, Howard TD, et al. Major genes regulating total serum immunoglobulin E
levels in families with asthma. Am J Hum Genet 2000;67:1163 73.
[17] Koppelman GH, Stine OC, Xu J, et al. Genome-wide search for atopy susceptibility genes in
Dutch families with asthma. J Allergy Clin Immunol 2002;109:498 506.
[18] Wjst M, Fischer G, Immervoll T, et al. A genome-wide search for linkage to asthma. German
Asthma Genetics Group. Genomics 1999;58:1 8.
[19] Xu X, Fang Z, Wang B, et al. A genomewide search for quantitative-trait loci underlying
asthma. Am J Hum Genet 2001;69:1271 7.
[20] Zhou Y, Dong Q, Louahed J, et al. Characterization of a calcium-activated chloride channel
as a shared target of Th2 cytokine pathways and its potential involvement in asthma. Am J
Respir Cell Mol Biol 2001;25:486 91.
[21] Kamada F, Suzuki Y, Shao C, et al. Association of the hCLCA1 gene with childhood and adult
asthma. Genes Immun 2004;5:540 7.
[22] CSGA. A genome-wide search for asthma susceptibility loci in ethnically diverse populations.
The Collaborative Study on the Genetics of Asthma (CSGA). Nat Genet 1997;15:389 92.
[23] Ober C, Tsalenko A, Parry R, et al. A second-generation genomewide screen for asthmasusceptibility alleles in a founder population. Am J Hum Genet 2000;67:1154 62.
[24] Howard TD, Postma DS, Hawkins GA, et al. Fine-mapping of an IgE controlling gene on
chromosome 2q: analysis of CTLA-4 and CD28. J Allergy Clin Immunol 2002;110:743 51.
[25] Hizawa N, Yamaguchi E, Jinushi E, et al. Increased total serum IgE levels in patients with
108:74 9.
[26] Yokouchi Y, Nukaga Y, Shibasaki M, et al. Significant evidence for linkage of mite-sensitive
childhood asthma to chromosome 5q31-q33 near the interleukin 12 B locus by a genome-wide
search in Japanese families. Genomics 2000;66:152 60.
653
[27] Doull IJ, Lawrence S, Watson M, et al. Allelic association of gene markers on chromosomes
5q and 11q with atopy and bronchial hyperresponsiveness. Am J Respir Crit Care Med 1996;
153:1280 4.
[28] Lonjou C, Barnes K, Chen H, et al. A first trial of retrospective collaboration for positional
cloning in complex inheritance: assay of the cytokine region on chromosome 5 by the consortium on asthma genetics (COAG). Proc Natl Acad Sci USA 2000;97:10942 7.
[29] Burchard EG, Silverman EK, Rosenwasser LJ, et al. Association between a sequence variant in
the IL-4 gene promoter and FEV(1) in asthma. Am J Respir Crit Care Med 1999;160:919 22.
[30] Noguchi E, Shibasaki M, Arinami T, et al. Association of asthma and the interleukin-4 promoter
gene in Japanese. Clin Exp Allergy 1998;28:449 53.
[31] Noguchi E, Nukaga-Nishio Y, Jian Z, et al. Haplotypes of the 5V region of the IL-4 gene and
SNPs in the intergene sequence between the IL-4 and IL-13 genes are associated with atopic
asthma. Hum Immunol 2001;62:1251 7.
[32] Basehore MJ, Howard TD, Lange LA, et al. A comprehensive evaluation of IL4 variants in
ethnically diverse populations: association of total serum IgE levels and asthma in white subjects.
[33] Graves PE, Kabesch M, Halonen M, et al. A cluster of seven tightly linked polymorphisms in the
IL-13 gene is associated with total serum IgE levels in three populations of white children.
serum IgE level and atopic dermatitis in the German multicenter atopy study (MAS- 90).
[35] Howard TD, Whittaker PA, Zaiman AL, et al. Identification and association of polymorphisms
in the interleukin 13 gene with asthma and atopy in a dutch population. Am J Respir Cell Mol
Biol 2001;25:377 84.
[36] Koppelman GH, Reijmerink NE, Stine O, et al. Association of a promoter polymorphism of
the CD14 gene and atopy. Am J Respir Crit Care Med 2001;163:965 9.
[37] Sharma M, Batra J, Mabalirajan U, et al. Suggestive evidence of association of C-159T
functional polymorphism of the CD14 gene with atopic asthma in northern and northwestern
Indian populations. Immunogenetics 2004;56:544 7.
[38] Wang JY, Wang LM, Lin CGJ, et al. Association study using combination analysis of SNP
and STRP markers: CD14 promoter polymorphism and IgE level in Taiwanese asthma children.
J Hum Genet 2005;50:36 41.
[39] Daniels SE, Bhattacharrya S, James A, et al. A genome-wide search for quantitative trait loci
underlying asthma. Nature 1996;383:247 50.
[40] Moffatt MF, Schou C, Faux JA, et al. Association between quantitative traits underlying
asthma and the HLA-DRB1 locus in a family-based population sample. Eur J Hum Genet
2001;9:341 6.
[41] Moffatt MF, Faux JA, Lester S, et al. Atopy, respiratory function and HLA-DR in aboriginal
Australians. Hum Mol Genet 2003;12:625 30.
[42] Chagani T, Pare PD, Zhu S, et al. Prevalence of tumor necrosis factor-alpha and angiotensin
converting enzyme polymorphisms in mild/moderate and fatal/near-fatal asthma. Am J Respir
Crit Care Med 1999;160:278 82.
[43] Castro J, Telleria JJ, Linares P, et al. Increased TNFA*2, but not TNFB*1, allele frequency
in Spanish atopic patients. J Investig Allergol Clin Immunol 2000;10:149 54.
[44] Winchester E, Millwood IY, Rand L, et al. Association of the TNF-alpha-308 (G-A)
polymorphism with self-reported history of childhood asthma and evidence for a putative
interaction with the ACE I/D polymorphism in asthma susceptibility. J Med Genet 2000;37:S69.
[45] Wang TN, Chen WY, Wang TH, et al. Genegene synergistic effect on atopic asthma: tumour
necrosis factor308 and lymphotoxinNcoI in Taiwans children. Clin Exp Allergy 2004;34:
184 8.
[46] Christodoulopoulos P, Cameron L, Hamid QA. STAT6 expression in the nasal mucosa following
in vitro antigen challenge: inhibition with neutralizing IL-4 antibody. J Allergy Clin Immunol
2001;107:S181.
654
smith
&
meyers
[47] Tamura K, Arakawa H, Suzuki M, et al. Novel dinucleotide repeat polymorphism in the first exon
of the STAT-6 gene is associated with allergic diseases. Clin Exp Allergy 2001;31:1509 14.
[48] Duetsch G, Illig T, Loesgen S, et al. STAT6 as an asthma candidate gene: polymorphismscreening, association and haplotype analysis in a Caucasian sib-pair study. Hum Mol Genet
2002;11:613 21.
[49] Weidinger S, Klopp N, Wagenpfeil S, et al. Association of a STAT 6 haplotype with elevated
serum IgE levels in a population based cohort of white adults. J Med Genet 2004;41:658 63.
[50] Schedel M, Carr D, Klopp N, et al. A signal transducer and activator of transcription 6 haplotype
influences the regulation of serum IgE levels. J Allergy Clin Immunol 2004;114:1100 5.
[51] Nagarkatti R, Rao C, Vijayan V, et al. Signal transducer and activator of transcription 6
haplotypes and asthma in the Indian population. Am J Respir Cell Mol Biol 2004;31:317 21.
[52] Zhang YM, Leaves NI, Anderson GG, et al. Positional cloning of a quantitative trait locus on
chromosome 13q14 that influences immunoglobulin E levels and asthma. Nat Genet 2003;34:
181 6.
[53] Laitinen T, Polvi A, Rydman P, et al. Characterization of a common susceptibility locus for
asthma-related traits. Science 2004;304:300 4.
[54] Allen M, Heinzmann A, Noguchi E, et al. Positional cloning of a novel gene influencing asthma
from chromosome 2q14. Nat Genet 2003;35:258 63.
[55] Van Eerdewegh P, Little RD, Dupuis J, et al. Association of the ADAM33 gene with asthma
and bronchial hyperresponsiveness. Nature 2002;418:426 30.
[56] Nicolae D, Cox NJ, Lester LA, et al. Fine mapping and positional candidate studies identify
HLA-G as an asthma susceptibility gene on chromosome 6p21. Am J Hum Genet 2005;76:
349 57.
[57] Anderson GG, Leaves NI, Bhattacharyya S, et al. Positive association to IgE levels and a
physical map of the 13q14 atopy locus. Eur J Hum Genet 2002;10:266 70.
[58] Zhang YM, Leaves NI, Anderson GG, et al. Positional cloning of a quantitative trait locus on
181 6.
[59] Jang N, Stewart G, Jones G. Polymorphisms within the PHF11 gene at chromosome 13q14
are associated with childhood atopic dermatitis. Genes Immun 2005;6:262 4.
[60] Laitinen T, Daly MJ, Rioux JD, et al. A susceptibility locus for asthma-related traits on
chromosome 7 revealed by a genome-wide scan in a founder population. Nat Genet 2001;28:
87 91.
[61] Melen E, Bruce S, Doekes G, et al. Haplotypes of G-protein-coupled receptor 154 are associated
with childhood allergy and asthma. Am J Respir Crit Care Med 2005;171:1089 95.
[62] Kormann MS, Carr D, Klopp N, et al. G-protein coupled receptor polymorphisms are associated with asthma in a large German population. Am J Respir Crit Care Med 2005;171:
1358 62.
[63] Zagha E, Ozaita A, Chang SY, Nadal MS, Lin U, Saganich MJ, et al. Dipeptidyl peptidase 10
modulates Kv4-mediated A-type potassium channels. J Biol Chem 2005;280:18853 61.
[64] Ober C, Cox NJ, Abney M, et al. Genome-wide search for asthma susceptibility loci in a founder
population. The Collaborative Study on the Genetics of Asthma. Hum Mol Genet 1998;7:1393 8.

25 (2005) 655 668
ADAM33: A Newly Identified Gene in the

Pathogenesis of Asthma
Stephen T. Holgate, MD, DSc, FRCP, FMedSci*,
Donna E. Davies, PhD, Rob M. Powell, PhD,
John W. Holloway, PhD
Infection, Inflammation, and Repair Division, School of Medicine, University of Southampton,
Southampton General Hospital, Tremona Road, Southampton,
Hampshire, SO16 6YD, UK
Asthma has a high heritability of up to 75%, involving a few genes with

moderate effects rather than many genes with small effects. Two methods most
frequently used to search for disease-causing genes are the candidate gene
approach and positional cloning (reverse genetics). The candidate gene approach
selects genes that seem to be relevant to the pathophysiology of a particular
disease. Polymorphism in the genes is then directly tested for the genes involvement in the disease by association analyses. A second method is positional cloning, incorporating genome-wide scans. Here the entire genome is screened in a
family-based cohort using a panel of DNA markers spaced at regular intervals
across the genome to identify specific chromosomal regions that seem to be
linked to specific disease phenotypes or partial phenotypes. This is followed by
identification of a gene or genes that underlie the region of linkage and detection
of single-nucleotide polymorphisms (SNPs) within these (candidate) genes that
may predispose to disease. SNPs are used in populations and family-based association studies to strengthen the confidence that a specific gene is causally related
to the disease or partial phenotype. Many genome screens for atopy and atopic
disorders have been completed, with multiple regions of the genome being linked
to varying phenotypes in different population cohorts, reflecting the heterogeneity and complexity of this condition.
T Corresponding author. Southampton General Hospital, Mail Point 810, Level F, Pathology
and Laboratory Block, Southampton SO16 6YD, UK.
E-mail address: sth@soton.ac.uk (S.T. Holgate).
doi:10.1016/j.iac.2005.07.003
656
holgate et al
Identification of ADAM33 to an asthma susceptibility gene

We have reported the first novel asthma-related gene identified by positional
cloning [1]. A genome-wide screen was undertaken using phenotypic data and
DNA from 362 families in Wessex, United Kingdom and 98 families in the
United States with at least two siblings with asthma. Using 401 microsatellite
markers at a density of 9 cM and multipoint linkage analysis, suggestive evidence
for linkage (maximum lod score [MLS] 2.24) was found on the short arm of
chromosome 20 at 9.99 cM. The addition of 13 more markers at 1- to 2-cM
intervals increased the MLS to 2.94 at D20S482 (12.1 cM), which further
increased to 3.93 when bronchial hyper-responsiveness (BHR) was included in
the definition of asthma (despite halving the sample size), thereby exceeding the
threshold for genome-wide significance [2]. In contrast, when asthma was conditioned for serum total IgE and allergen-specific IgE, which are measures of
the allergic component of asthma, the MLS fell to 2.3 at 11.6 cM and 1.87 at
12.1 cM. This indicated that the chromosomal region under the peak of linkage
contained genes more closely linked to altered airway function than to measures
of atopy. Confirmation for linkage on chromosome 20 has come from a separate
analysis of the United Kingdom and United States families and from two separate
genome-wide studies in other United Kingdom and United States outbred populations [3,4].
Physical mapping of the region under the peak of linkage on 20p13 and direct
cDNA selection led to the identification of 40 genes. Single-strand conformational polymorphism analysis and direct sequencing was used to identify SNPs in
case-control association studies involving 130 affected individuals who contributed to the linkage signal on chromosome 20 and 217 controls with no personal or family history of asthma or allergy (ie, hypernormals). In 23 genes
spanning the 90% confidence interval on each side of D20S482, 135 SNPs were
typed, of which 25 were localized to a cluster of five genes, showing significant
association with asthma and BHR. Fourteen of these lay within a single gene
identified as ADAM33, a novel member of the ADAM (A Disintegrin And
Metalloproteinase) family (achieving significance of P = .005 .05). In the combined populations and in the United Kingdom and United States samples when
analyzed separately, additional SNP typing strengthened the location of the signal
to ADAM33, and this was confirmed by haplotype analysis and transmission
disequilibrium testing (TDT).
Replication of ADAM33 as an asthma susceptibility gene

A recent study by Howard and colleagues [5] has provided an important
validation of ADAM33 as an asthma susceptibility gene by replicating the association. Eight SNPs in the 3V portion of ADAM33 were evaluated in three ethnic
groups (African American, Caucasian and Hispanic) from the United States and
in a well-defined Dutch population. Significant associations were observed with
adam33
657
asthma susceptibility in all populations, although no individual SNP was

consistently significant in all groups. The same outcome was found on evaluation
of the associated phenotypes of skin test responsiveness and total serum IgE
levels. Haplotype analysis revealed different haplotype frequencies between cases
and controls, but across the four populations no single haplotype was consistently
more common in the cases than in the controls. The significant associations
support polymorphism of ADAM33 as having a potential role in asthma susceptibility. Further replication has been reported in separate case-control and
family-based association studies in Germany, Korea, and Japan [69]. There are
two published studies showing no evidence of association [10] or, at best, weak
association [11].
Most case-control and family-based association studies looking for diseaserelated genes in complex disorders are statistically underpowered, and far larger
sample sizes are needed [12]. Part of the reason for this is the existence of genetic
heterogeneity with any one gene varying in its influence over a disease phenotype
between populations with differing genetic backgrounds and differing environmental exposures [13]. For example, natural selection may have acted on a disease gene haplotype differentially in different populations, as recently described
for the interleukin (IL)-4 locus on chromosome 5q31-34 [14]. Another example
is the NOD2/CARD 15 gene on chromosome 16, which has been associated
with Crohn disease in some populations [15]. That a statistical association is not
revealed in a particular population irrespective of size does not necessarily mean
that the gene in question is not contributing to the phenotype; rather, the mode of
its influence may be complex, involving genegene or geneenvironmental interactions [16]. For ADAM33 and asthma, Blakey and colleagues [17] have
recently reported the result of a meta-analysis. This involved eight separate
populations that included a large Icelandic and several new United Kingdom
populations totaling 1299 cases and 1665 controls used in case-control association analysis and 4561 families used in TDT. In both types of analysis, several
SNPs were significantly associated with asthma. Based on allele frequencies
for the ST + 7G allele of 84.9% in the asthmatic population and 79.1% in the
controls and an asthma prevalence of 8%, this SNP would potentially contribute
to ~50,000 excess asthma cases in the United Kingdom population. An association between the ADAM33 gene and asthma is strengthened by the existence of
a syntenic region on mouse chromosome 2 at 74 cM that has been linked to BHR
[18], overlying an ortholog of ADAM33 that exhibits ~70% homology with its
human counterpart [19,20].
Potential mechanistic roles for ADAM33 in asthma

The initial study [1] and others [5,7] have revealed some of the strongest
asthma associations with ADAM33 when BHR is incorporated into the asthma
phenotype. The cellular provenance of ADAM33 mRNA and protein in being
restricted to mesenchymal cell types (fibroblasts, myofibroblasts, and smooth
658
holgate et al
muscle) reinforces the view that this molecule is involved in the pathophysiology
of BHR and airway remodeling rather than the immunologic or inflammatory
components of asthma [1,21]. ADAM33 is amply provided with a number of
mechanisms whereby its disordered function could translate into BHR (Fig. 1),
although it is not known whether polymorphic changes linked to asthma relate to
a gain or loss in function.
In many ADAMs, the proteolytic site has the capacity to release cytokines and
growth factors from their precursors. For example, ADAM17 (tumor necrosis
factor [TNF]a-converting enzyme) is responsible for generating soluble TNFa
from cell-bound precursors. Other ADAM17 substrates include TNFa receptor,
transforming growth factor (TGF)-a, L-selectin, IL-1 receptor type II, amyloid
precursor protein [22], the heregulin receptor ErbB4/Her4, and a member of the
epidermal-like growth factor (EGF) receptor family and fractalkine, a CX3C
chemokine. ADAM9 and ADAM12 cleave heparin-binding EGF (HB-EGF)
from its precursor [23].
In a mouse model of hypertension-induced cardiac hypertrophy, a pivotal
role for myocardial ADAM12 has been shown through its capacity to process
HB-EGF. Inhibition of ADAM12 activity by expression of a dominant-negative
construct or by small chemical inhibitor reduced processing of HB-EGF, preventing hypertrophy [24]. One possibility is that ADAM33 also generates growth
factors in the airways that influence the development of smooth muscle linked to
BHR. The ADAM33 metalloprotease domain has been shown to be active when
overexpressed in cells [25], and, although a number of potential biologic substrates have been tested [26], the natural ligand(s) for ADAM33 [26] metalloprotease domain have yet to be identified.
The ADAM and ADAM-TS (A Disintegrin And Metalloprotease with Thrombospondin Motif) family of proteins have diverse functions that reflect the
complex domain structure of these molecules [27]. Although some of these
functions can be attributed to an individual domain, as suggested for the me22 EXONS
A B C D E F GH
ProSignal
sequence domain
J K
Catalytic
domain
L M N
P Q R
TransDisintegrin Cysteine membrane

domain
rich
domain
domain
proteolysis
3 UTR
Promotes efficient
Cytoplasmic maturaton of ADAM 33
domain
EGFdomain
Zn 2+
site
activation
S TU
adhesion
fusion
signalling
Fig. 1. Exon and domain structure of ADAM33. (From Van Eerdewegh P, Little RD, Dupuis J, et al.
Association of the ADAM-33 gene with asthma and bronchial hyper-responsiveness. Nature 2002;
418:42630; with permission.)
adam33
659
talloproteinase domain, it is likely that the other domains play important regulatory roles to these functions by conferring specificity and selectivity. ADAM
proteins are anchored in the trans-Golgi network or plasma membrane [28], but in
some cases, secreted splice variants have been identified. The cysteine-rich and
EGF domains of ADAM proteins have been linked to cell adhesion and membrane
fusion events [29,30]. ADAM12 (meltrin a) is a catalytically active metalloprotease-disintegrin [31] that has a cysteine-rich domain that binds cell-surface
proteins such as syndecans [32], thereby affecting cell adhesion and signaling
events. An alternatively spliced secreted form of ADAM12 (ADAM12-S) provokes myogenesis in a nude mouse tumor model [30]. In addition, ADAM12
and 17 are upregulated in smooth muscle lesions of lymphangioleiomyomatosis [33], a rare lung disease affecting young women. ADAM12, ADAM15,
ADAM19, and Xenopus ADAM13 are the most closely related ADAMs to
ADAM33 and therefore might be expected to display similar activities [19]. The
importance of genetic variation in ADAM proteins has recently been highlighted
by mutations in ADAMTS13 that underlie thrombotic thrombocytopenic purpura [34], whereas decreased levels of ADAMTS2 impair collagen Type 1 processing, leading to fragile skin in Ehlers-Danlos syndrome [35].
Tissue expression of ADAM33

Studies investigating the expression of ADAM33 mRNA in human cells and
tissue show a unique distribution in cells of mesenchymal origin, such as fibroblasts and smooth muscle, and an absence of expression in nonmesenchymal
hematopoietic cells and epithelial cells [1,21]. ADAM33 is 812 amino acids
long with eight domains in total (consistent with the other 34 identified ADAM
family members). Northern blot analysis has identified two transcripts of the
ADAM33 gene of 5.0 and 3.5 kb, but only the latter has been found in cytoplasmic RNA [1]. A transcript of 7 to 8 kb has been noted in tissues expressing
ADAM33 at higher levels, including the uterus, small intestine, and heart [21].
To clone the full-length transcript for ADAM33, van Eerdewegh and colleagues
[1] screened 17 cDNA libraries and identified a 3.5-kb clone containing the
entire open reading frame comprising of 22 exons with the canonical sequence
(CT/AG) present at each splice junction with no polymorphic changes in the
immediate vicinity. Two differentiation control elements motifs have been identified in ADAM33, neither of which is near identified polymorphisms [21].
Studies of mRNA stability reveal the absence of 3VUTR AU-rich elements in
ADAM33 transcripts (Fig. 1). The 3VUTR influences mRNA stability/degradation
[36], controls nuclear export and cellular localization, and influences translational efficiency [37]. Garlisi and colleagues [25] have shown that the 3VUTR of
ADAM33 mRNA is necessary for processing of the mature peptide (zymogen),
specifically for removal of the prodomain [25]. Domains downstream of the
catalytic domain were also implicated as influencing the efficiency of prodomain
removal. In these studies, post-translational processing, but not expression of
660
holgate et al
ADAM33, was affected by the 3VUTR region, indicating that it is able to affect
subcellular localization rather than translational efficiency or mRNA degradation
because the process of prodomain removal from ADAMs occurs in the Golgi
apparatus [25,28].
The potential for multiple alternatively spliced transcripts of ADAM33 is
indicated by variants lacking exons or parts of exons (Fig. 2). Several of these
splice variants have been identified. The alpha (a) and beta (b) isoforms were
cloned in conjunction with the identification of the mouse and human ADAM33
gene [20], and these isoforms differ in protein maturation and protein localization [38]. The occurrence of a soluble form of ADAM33, due to a 37-base deletion in exon R, has also been predicted [39]. This frame-shift mutation gives a
predicted amino acid sequence that deviates from the full-length sequence downstream of the cysteine rich domain and as such has no predicted transmembrane
helical region.
Several other variants within the prodomain of ADAM33 have been reported
in a lung library using a polymerase chain reaction (PCR)-based screening
protocol and multiple primer pairs (600-bp amplicons with 100-bp overlap) [1].
Recently, we have reported marked differences in the tissue expression profile
of the pro- and protease domains, exposing the potential for tissue-selective
Fig. 2. Alternative splice variants of human ADAM33 at protein (top) and gene (bottom) levels.
(From Powell RM, Wicks J, Holloway JW, et al. The splicing and fate of ADAM33 transcripts in
primary human airways fibroblasts. Am J Respir Cell Mol Biol 2004;31:1321; with permission.)
adam33
661
functions of ADAM33 consequent upon alternative splicing [40]. Using real-time

PCR, quantification of each variant in airway fibroblasts, myofibroblasts, and
smooth muscle cells revealed that the a-form is abundant in all of these cell
types, whereas the secreted variant is rare. The prodomain of other ADAM
proteins regulates the corresponding catalytic domain via a cysteine switch
mechanism [41,42]. This involves formation of an intra-molecular complex
between the single free cysteine residue in the pro-peptide domain and the
essential zinc atom in the catalytic domain. Overall, the expression level of transcripts that contain a functional pro- and catalytic domain was found to be low
in mesenchymal cells (b 2%). Although full-length clones of ADAM33 have
been identified in lung mesenchymal cells that express high levels of ADAM33
transcript, the great majority of transcripts encode predicted proteins that lack
this activity (Fig. 2). This raises the possibility that the ADAM33 domains
downstream of the catalytic unit may have distinct functions independent of the
pro-/catalytic domain and that the contribution of ADAM33 to BHR may have
little to do with its ability to cleave protein substrates. The splice variants lacking the pro- and catalytic domains but expressing the downstream domains are
analogous to the ADAM12-S splice variant that induces myogenesis in vivo [30].
The data predict that similar transcripts predominate for ADAM33. If the
domains downstream of the catalytic domain were found to influence the migration of smooth muscle cells in a similar way, this might provide an important functional link between ADAM33 and BHR.
ADAM33 is a highly polymorphic gene containing at least 100 SNPs. Genetic
analyses have identified the 3V portion of the gene that encodes the transmembrane and cytoplasmic domains and 3VUTR as likely to be one of the key
regions linked to asthma and BHR [1]. However, without functional studies, it
is difficult to attribute primacy to any individual SNP because of the extent of
linkage disequilibrium that exists in this region. The cytoplasmic domain of
ADAM proteins is typically rich in proline and has important regulatory functions through interaction with intracellular signaling proteins via SH2 or SH3
domains. A putative casein kinase 1 phosphorylation site is present. Casein
kinase 1 sites may be involved in bidirectional signaling. Furthermore, the presence of alternatively spliced cytoplasmic variants of ADAM22 has been shown
to exhibit cell selective expression. Yeast two hybrid, western blotting, and pulldown assays have identified several proteins that interact with the ADAMs,
including src family kinases, endophilin, a-actinin, PACSIN, and protein kinase
C (PKC) [4346]. Together with the transmembrane domain, the cytoplasmic
domain mediates interactions with the cytoskeleton and is involved in intracellular trafficking of the protein [28]. For example, phosphorylation of ADAM9
by PKC causes trafficking of the protein from the Golgi to the plasma membrane
where it cleaves HB-EGF from its membrane-bound precursor [23]. In the case of
ADAM33, the intracellular domain is relatively short in comparison with its
nearest homologs, but it is rich in prolines and has a putative SH3 binding site
(PsWPLDP) in which the T2 SNP is located and may affect function. There is
also a casein kinase F/II phosphorylation site (SHEPSSHP) and a MAPK con-
662
holgate et al
sensus sequence that could be important regulators of ADAM33 function. Although the T1 SNP causes an MYT substitution, no new recognizable phosphorylation site is generated.
Several of the ADAM family members are involved in cellcell and cell
matrix interactions involving members of the integrin family. Binding of ADAMs
to syndecans members of the tetraspanin family and unknown proteins has also
been shown. Binding of fibroblasts to a soluble ADAM9:Fc fusion protein via
integrin a6 b1 causes a large increase in cell motility, suggesting that the ADAM
could act as a locomotor adhesion receptor [29]. In contrast, overexpression of
ADAM15 decreases cell migration by increasing cellcell contacts without affecting initial cell adhesion. In a recent study, Bridges and coleagues [47]
characterized the integrin-binding properties of the disintegrin-like domains of
human ADAM7, ADAM28, and ADAM33 with the integrins a4b1, a4b7, and
a9 b1. Like ADAM28, the ADAM7 disintegrin domain supported adhesion to
a4 b1 on macrophages, but ADAM33 did not. The lymphocyte integrin domains
of ADAM7 and ADAM28 also interacted with a4b7 but, again, not that of
ADAM33. However, in common with ADAM7 and ADAM28, ADAM33 was
able to interact with a9 b1. The significance of this has yet to be determined, but it
is clear that the disintegrin domain of ADAM33 is highly discriminate.
Although the cysteine-rich and EGF domains of ADAM proteins have been
linked to cell adhesion and membrane fusion, respectively, alternatively spiced
transcripts that involve skipping of exons encoding these domains have been
identified. The skipping of exon Q gives rise to the b-form of ADAM33, which
is present in approximately 30% of transcripts in airway mesenchymal cells.
Although this variant has also been detected in testes, brain, and placenta, its
biologic relevance remains unknown. Because exon Q spans the cysteine-rich
and EGF domains, its absence could lead to the disruption of function of both
domains. The use of an alternative splice site in the EGF domain, which results in
the deletion of 37 bases resulting in a frame-shift in the resulting transcript, is
predicted to produce a protein that does not seem to have any means of cellular
attachment (ADAM33-S). If further confirmed by protein expression, this would
add to the number of soluble ADAM/ADAM-TS proteases that have been
identified [48]. In keeping with other soluble ADAM/ADAM-TS proteins, the
level of mRNA expression of this transcript is low. For soluble ADAM-TS proteins, it has been suggested that this may be because the secreted form has lost
the potential to be tightly regulated by the host cell and that it may be very active.
Of the multiple splice variants identified, three of these use splice junctions
that are predicted by the full-length clone. These clones encode predicted proteins
that are in-frame with the wild-type translation and possess a secretion signal and
a transmembrane anchor. Although the functional domains of ADAM33 are
easily inferred from its sequence, nothing is known about the biologic role of
ADAM33 or the expressed product(s) of this gene that may be relevant to the
pathogenesis of asthma. The potential for multiple isoforms of ADAM33 protein
will result in functions and regulation that will be dependent on the final
composition of the molecule. New methods are being developed using different
adam33
663
statistical approaches to help in narrowing down those SNPs that account for the
disease phenotype. For example, Bureau and colleagues [49] have recently
described a nonparametric approach using random forests that they applied to
the analysis of 44 SNPs in ADAMM33.
ADAM33 as a product of severe and progressive asthma

The selective expression of ADAM33 in mesenchymal cells strongly suggests
that alterations in its activity may underlie abnormalities in the function of airway smooth muscle cells [50] and fibroblasts linked to BHR and remodeling
in asthma [51]. These components of the epithelial-mesenchymal trophic unit
probably share a common fibroblastic progenitor, the mature phenotype of which
is directed by growth factors, including TGF-b [52], whose release from bronchial epithelial cells in its latent and active forms are increased.
Although the precise role of ADAM33 in asthma remains unknown, recent
epidemiologic studies provide some evidence supporting its role as a susceptibility gene for more severe and progressive disease [53]. In 200 asthmatics in
the Netherlands in whom longitudinal data on asthma and FEV1 were available
over a 20-year period, investigation of nine SNPs of ADAM33 when controlled
for other variables (eg, atopy and smoking) showed that two (S2 and Q-1) were
significantly associated with a progressive decline in FEV1 when compared
with normal controls (20.1 versus 6.4 and 22.1 versus 4.1 mL/yr, respectively).
Mechanistically, this may be linked to the capacity of TGF-b to transiently increase ADAM33 expression as part of the differentiation trajectory of primitive
airway mesenchymal cells to myofibroblasts, which are known to be important
in chronic wound repair [54].
ADAM33 in the origins of asthma

The epithelial-mesenchymal interaction and communication linked to airway
remodeling in asthma is fundamental to branching morphogenesis in the developing fetal lung [51]. Airway remodeling and inflammation have been shown
to exist in children who have asthma [52,55] and in infants who subsequently
develop asthma, indicating that pathologic changes occur early in life [56].
This would transfer the origin of asthma into the intrauterine or early postnatal
developmental phases. Thus, interactions between environmental stimuli and
ADAM proteins might be critically involved in the pathologic responses taken
place in the early development of asthma. Many transmembrane growth and differentiation factors, like members of the EGF family, play a crucial role in embryonic development and require ectodomain shedding for proper action in vivo.
Shedding might be responsible for epithelialmesenchymal crosstalk in lung
development and branching morphogenesis and cytodifferentiation [5759].
ADAM17-deficient mice show pulmonary hypoplasia and develop respiratory
664
holgate et al
stress at birth [60]. When cultured in serum-free medium, ADAM17 / embryonic lungs branch poorly compared with wild-type lungs but can be rescued
by the addition of exogenous TGFa [61]. Inhibition of branching morphogenesis in vitro can also be achieved using specific antisense oligonucleotides that
prevent ADAM17 expression; this can also be reversed with TGFa, providing
evidence that ADAM-mediated protein shedding is important for lung development by regulation of growth factor availability. The selective expression of
ADAM33 in mesenchymal cells [1,21,50] strongly suggests that alterations in its
activity underlie abnormalities in the function of airway smooth muscle cells and
fibroblasts that lead to pathologic remodeling in asthma. This process may occur
during early embryonic or fetal development.
Expression of ADAM33 during normal murine [62] and human [63] embryonic lung development suggests that it may regulate tissue morphogenesis.
At the start of embryonic lung branching morphogenesis (Fig. 3), it is expressed
at a lower level, but expression increases during gestation and remains present
into adulthood. A similar increase in ADAM33 expression was observed when
human embryonic lungs underwent branching morphogenesis when cultured in
vitro [62,63]. Thus, ADAM33 could be a candidate gene for the onset of asthma,
especially the more persistent and severe form of the disease associated with
impaired lung function early in life [64]. Variation in ADAM33 alone or in
combination with environmental factors may lead to early abnormal development
of the airway structure. In support of this, we have recently shown that polymorphic variants of ADAM33 predict impaired lung function in children born
of allergic or asthmatic parents [65,66]. From a large birth cohort of 1074 children involved in determining environmental influences on the development of
allergy and asthma (MAAS cohort), we have been able to obtain DNA and
Fig. 3. Fluorescent immunohistochemical analysis of human embryonic lung using whole lung
mounts showing patterns of a smooth muscle actin (green), nuclei (blue), and ADAM33 (red).
(From Haitchi HM, Powell RM, Shaw TJ, et al. ADAM33 expression in asthmatic airways and
human embryonic lungs. Am J Respir Crit Care Med 2005;171:95865; with permission.)
665
adam33
Lung
Function
(FEV1)
ADAM 33
2
ADAM 33
?ADAM 33
ADAM 33
Age (years)
1 = early life
2 = asthma
3 = decline in lung function
4 = COPD
Fig. 4. Periods in life when ADAM33 is incriminated as an airway modeling and remodeling gene.
(1) Lung morphogenesis. (2) Inception of asthma and BHR. (3) Accelerated decline in lung function
in asthma and possibly (4) COPD.
lung function data at the age of 3 years (n = 285) and 5 years (n = 470). Carriers
of the rare allele of F + 1 SNP had reduced lung function measured at 3 years
of age as specific airways resistant. At 5 years of age, the F + 1, S1, ST + 5, and
V4 SNPs were associated with impaired lung function. These findings suggest
that ADAM33 might be a susceptibility gene for reduced lung function rather
than asthma per se and thus may predispose individuals who are susceptible to
atopy to develop asthma (Fig. 4).
Summary
There is much to find out about this fascinating and complex molecule in
relation to the development and progression of asthma. Added to it are three
further new asthma/allergy genes identified by positional cloning: PDH Finger
Protein II (PHF11) on chromosome 13q14, which encodes NY-REN-34 a protein
first described in patients with renal cell carcinoma [67]; Dipeptidyl diptidase 10
(DDP10) on chromosome 2q14 [68]; and G protein-coupled receptor for asthma
susceptibility (GPRA) on chromosome 7p [69]. For each of these genes, as is the
case for ADAM33, determining their normal function(s) and how these become
disordered in asthma is the future challenge [70].
References
[1] Van Eerdewegh P, Little RD, Dupuis J, et al. Association of the ADAM-33 gene with asthma and
bronchial hyper-responsiveness. Nature 2002;418:426 30.
666
holgate et al
[2] Kruglyak L, Lander ES. Complete multipoint sib-pair analysis of qualitative and quantitative
traits. Am J Hum Genet 1995;57:439 54.
[3] Cookson WO, Ubhi B, Lawrence R, et al. Genetic linkage of childhood atopic dermatitis to
psoriasis susceptibility loci. Nat Genet 2001;27:372 3.
[4] Xu J, Meyers DA, Ober C, et al. Genomewide screen and identification of gene-gene interactions
for asthma-susceptibility loci in three US populations: collaborative study on the genetics of
asthma. Am J Hum Genet 2001;68:1437 46.
[5] Howard TD, Postma DS, Jongepier H, et al. Association of a disintegrin and metalloprotease 33
(ADAM33) gene with asthma in ethnically diverse populations. J Allergy Clin Immunol 2003;
112:717 22.
[6] Werner M, Herbon N, Gohlke H, et al. Asthma is associated with single-nucleotide
polymorphisms in ADAM33. Clin Exp Allergy 2004;34:26 31.
[7] Lee J-H, Park H-S, Park SW, et al. ADAM33 polymorphism: association with bronchial hyperresponsiveness in Korean asthmatics. Clin Exp Allergy 2004;34:860 5.
[8] Sakagami T, Hasegawa T, Yoshizawa H, et al. ADAM 33 polymorphisms are associated with
aspirin intolerant asthma in Japanese population. Am J Respir Crit Care Med 2003;167:A750.
[9] Cheng L, Enomoto T, Hirota T, et al. Polymorphisms in ADAM33 are associated with allergic
rhinitis due to Japanese cedar pollen. Clin Exp Allergy 2004;34:1192 201.
[10] Lind DL, Choudhry S, Ung N, et al. ADAM33 is not associated with asthma in Puerto Rican or
Mexican populations. Am J Respir Crit Care Med 2003;168:1312 6.
[11] Raby BA, Silverman EK, Kwiatkowski DJ, et al. ADAM33 polymorphisms and phenotype
associations in childhood asthma. J Allergy Clin Immunol 2004;113:1071 8.
[12] Cookson W. A new gene for asthma: would you ADAM and Eve it? Trends Genet 2003;19:
169 72.
[13] Ioannidis JP, Ntzani EE, Trikalinos TA, et al. Replication validity of genetic association studies.
Nat Genet 2001;29:306 9.
[14] Sakagami T, Witherspoon DJ, Nakajima T, et al. Local adaptation and population differentiation
at the interleukin 13 and interleukin 4 loci. Genes Immun 2004;5:389 97.
[15] Arnott ID, Nimmo ER, Drummond HE, et al. NOD2/CARD15, TLR4 and CD14 mutations in
Scottish and Irish Crohns disease patients: evidence for genetic heterogeneity within Europe?
Genes Immun 2004;5:417 25.
[16] Vercelli D. Genetics, epigenetics, and the environment: switching, buffering, releasing. J Allergy
Clin Immunol 2004;113:381 6.
[17] Blakey J, Halapi E, Bjornsdottir US, et al. The contribution of ADAM33 polymorphisms to the
population risk of asthma. Thorax 2005;60:274 6.
[18] De Sanctis GT, Merchant M, Beier DR, et al. Quantitative locus analysis of airway
hyperresponsiveness in A/J and C57BL/6J mice. Nat Genet 1995;11:150 4.
[19] Yoshinaka T, Nishii K, Yamada K, et al. Identification and characterization of novel mouse and
human ADAM33s with potential metalloprotease activity. Gene 2002;282:227 36.
[20] Gunn TM, Azarani A, Kim PH, et al. Identification and preliminary characterization of mouse
ADAM33. BMC Genet 2002;3:2.
[21] Umland SP, Garlisi CG, Shah H, et al. Human ADAM33 mRNA expression profile and posttranscriptional regulation. Am J Respir Cell Mol Biol 2003;29:571 82.
[22] Black RA. Tumor necrosis factor-alpha converting enzyme. Int J Biochem Cell Biol 2002;34:
1 5.
[23] Izumi Y, Hirata M, Hasuwa H, et al. A metalloprotease-disintegrin, MDC9/meltrin-gamma/
ADAM9 and PKCdelta are involved in TPA-induced ectodomain shedding of membraneanchored heparin-binding EGF-like growth factor. EMBO J 1998;17:7260 72.
[24] Asakura M, Kitakaze M, Takashima S, et al. Cardiac hypertrophy is inhibited by antagonism of
ADAM12 processing of HB-EGF: metalloproteinase inhibitors as a new therapy. Nat Med
2002;8:35 40.
[25] Garlisi CG, Zou J, Devito KE, et al. Human ADAM33: protein maturation and localization.
Biochem Biophys Res Commun 2003;301:35 43.
adam33
667
[26] Zou J, Zhu F, Liu J, et al. Catalytic activity of human ADAM33. J Biol Chem 2004;279:
9818 30.
[27] Primakoff P, Myles DG. The ADAM gene family: surface proteins with adhesion and protease
activity. Trends Genet 2000;16:83 7.
[28] Hougaard S, Loechel F, Xu X, et al. Trafficking of human ADAM12-L: retention in the transGolgi network. Biochem Biophys Res Commun 2000;275:261 7.
[29] Nath D, Slocombe PM, Webster A, et al. Meltrin gamma(ADAM-9) mediates cellular adhesion
through alpha(6)beta(1)integrin, leading to a marked induction of fibroblast cell motility. J Cell
Sci 2000;113:2319 28.
[30] Gilpin BJ, Loechel F, Mattei MG, et al. A novel, secreted form of human ADAM12 (meltrin
alpha) provokes myogenesis in vivo. J Biol Chem 1998;273:157 66.
[31] Loechel F, Gilpin BJ, Engvall E, et al. Human ADAM 12 (meltrin alpha) is an active
metalloprotease. J Biol Chem 1998;273:16993 7.
[32] Iba K, Albrechtsen R, Gilpin B, et al. The cysteine-rich domain of human ADAM12 supports
cell adhesion through syndecans and triggers signaling events that lead to beta1 integrindependent cell spreading. J Cell Biol 2000;149:1143 56.
[33] Krymskaya VP, Shipley JM. Lymphangioleiomyomatosis: a complex tale of serum response
factor-mediated tissue inhibitor of metalloproteinase-3 regulation. Am J Respir Cell Mol Biol
2003;28:546 50.
[34] Levy GG, Nichols WC, Lian EC, et al. Mutations in a member of the ADAMTS gene family
cause thrombotic thrombocytopenic purpura. Nature 2001;413:488 94.
[35] Colige A, Sieron AL, Li SW, et al. Human Ehlers-Danlos syndrome type VII C and bovine
dermatosparaxis are caused by mutations in the procollagen I N-proteinase gene. Am J Hum
Genet 1999;65:308 17.
[36] Beelman CA, Parker R. Degradation of mRNA in eukaryotes. Cell 1995;81:179 83.
[37] Dalgleish GD, Veyrune JL, Accornero N, et al. Localisation of a reporter transcript by the c-myc
3V-UTR is linked to translation. Nucleic Acids Res 1999;27:4363 8.
[38] Umland SP, Wan Y, Shah H, et al. Mouse ADAM33: two splice variants differ in protein
maturation and localization. Am J Respir Cell Mol Biol 2004;30:530 9.
[39] Sheppard P, Baindur N, Bishop P. Mammalian adhesion protease peptides. Seattle (WA)7
Zymogenetics; 2001.
[40] Powell RM, Wicks J, Holloway JW, et al. The splicing and fate of ADAM33 transcripts in
primary human airways fibroblasts. Am J Respir Cell Mol Biol 2004;31:13 21.
[41] Loechel F, Overgaard MT, Oxvig C, et al. Regulation of human ADAM12 protease by the
prodomain: evidence for a functional cysteine switch. J Biol Chem 1999;274:13427 33.
[42] Van Wart HE, Birkedal-Hansen H. The cysteine switch: a principle of regulation of
metalloproteinase activity with potential applicability to the entire matrix metalloproteinase
gene family. Proc Natl Acad Sci USA 1990;87:5578 82.
[43] Howard L, Nelson KK, Maciewicz RA, et al. Interaction of the metalloprotease disintegrins
MDC9 and MDC15 with two SH3 domain-containing proteins, endophilin I and SH3PX1. J Biol
Chem 1999;274:31693 9.
[44] Galliano MF, Huet C, Frygelius J, et al. Binding of ADAM12, a marker of skeletal muscle
regeneration, to the muscle-specific actin-binding protein, alpha -actinin-2, is required for
myoblast fusion. J Biol Chem 2000;275:13933 9.
[45] Cousin H, Gaultier A, Bleux C, et al. PACSIN2 is a regulator of the metalloprotease/disintegrin
ADAM13. Dev Biol 2000;227:197 210.
[46] Poghosyan Z, Robbins SM, Houslay MD, et al. Phosphorylation-dependent interactions between
ADAM15 cytoplasmic domain and Src family protein tyrosine kinases. J Biol Chem 2002;
277:4999 5007.
[47] Bridges LC, Sheppard D, Bowditch RD. ADAM disintegrin-like domain recognition by the
lymphocyte integrins alpha4beta1 and alpha4beta7. Biochem J 2005;387:101 8.
[48] Itai T, Tanaka M, Nagata S. Processing of tumor necrosis factor by the membrane-bound TNFalpha- converting enzyme, but not its truncated soluble form. Eur J Biochem 2001;268:2074 82.
668
holgate et al
[49] Bureau A, Dupuis J, Falls K, et al. Identifying SNPs predictive of phenotype using random
forests. Genet Epidemiol 2004;28:171 82.
[50] Laporte JD, Joubert PO, Fiset PO, et al. Expression of ADAM-33 in cultured human airway
smooth muscle cells. Am J Respir Crit Care Med 2003;167:A329.
[51] Holgate ST, Davies DE, Lackie PM, et al. Epithelial-mesenchymal interactions in the
pathogenesis of asthma. J Allergy Clin Immunol 2000;105:193 204.
[52] Davies DE, Wicks J, Powell RM, et al. Airway remodelling in asthma: new insights. J Allergy
Clin Immunol 2003;111:215 25.
[53] Jongepier H, Boezen HM, Dijkstra A, et al. Polymorphisms of the ADAM33 gene are associated
with accelerated lung function decline in asthma. Clin Exp Allergy 2004;34:757 60.
[54] Wicks J, Powell RM, Richter A, et al. Transient upregulation of ADAM33 by TGFb precedes
myofibroblast differentiation. Am J Respir Crit Care Med 2003;167:A157.
[55] Richter A, Puddicombe SM, Lordan JL, et al. The contribution of interleukin (IL)-4 and IL-13 to
the epithelial-mesenchymal trophic unit in asthma. Am J Respir Cell Mol Biol 2001;25:385 91.
[56] Pohunek P, Roche WR, Tarzikova J, et al. Eosinophilic inflammation in the bronchial mucosa in
children with bronchial asthma. Eur Respir J 2000;11(Suppl 25):160s.
[57] Black JL, Johnson PR. Factors controlling smooth muscle proliferation and airway remodelling.
Curr Opin Allergy Clin Immunol 2002;2:47 51.
[58] Brightling CE, Bradding P, Symon FA, et al. Mast-cell infiltration of airway smooth muscle in
asthma. N Engl J Med 2002;346:1699 705.
[59] Page S, Ammit AJ, Black JL, et al. Human mast cell and airway smooth muscle cell interactions:
implications for asthma. Am J Physiol Lung Cell Mol Physiol 2001;281:L131323.
[60] Zhao J, Chen H, Peschon JJ, et al. Pulmonary hypoplasia in mice lacking tumor necrosis factoralpha converting enzyme indicates an indispensable role for cell surface protein shedding during
embryonic lung branching morphogenesis. Dev Biol 2001;232:204 18.
[61] Zhao J, Chen H, Wang YL, et al. Abrogation of tumor necrosis factor-alpha converting enzyme
inhibits embryonic lung morphogenesis in culture. Int J Dev Biol 2001;45:623 31.
[62] Haitchi H, Powell RM, Wilson DI, et al. ADAM33 expression in embryonic mouse lung. Am J
Respir Crit Care Med 2003;167:A377.
[63] Haitchi HM, Powell RM, Shaw TJ, et al. ADAM33 expression in asthmatic airways and human
embryonic lungs. Am J Respir Crit Care Med 2005;171:958 65.
[64] Taussig LM, Wright AL, Holberg CJ, et al. Tucson Childrens Respiratory Study: 1980 to
present. J Allergy Clin Immunol 2003;111:661 75.
[65] John S, Jury FAC, Holloway J, et al. ADAM33 polymorphisms predict early-life lung function:
a population based cohort study. Am J Hum Genet 2003;73:A37.
[66] Simpson A, Jury F, Cakebread J, et al. Manchester Asthma and Allergy Study: polymorphisms in
ADAM 33 predict lung function at age 5 years. J Allergy Clin Immunol 2004;113:S340.
[67] Zhang Y, Leaves NI, Anderson GG, et al. Positional cloning of a quantitative trait locus on
181 6.
[70] Wills-Karp M, Ewart SL. Time to draw breath: asthma-susceptibility genes are identified. Nat
Rev Genet 2004;5:376 87.

25 (2005) 669 679
HLA-G: An Asthma Gene on Chromosome 6p

Carole Ober, PhD
Departments of Human Genetics and Obstetrics and Gynecology, University of Chicago,
920 East 58th Street, Chicago, IL 60637, USA
In the beginning
The Collaborative Study on the Genetics of Asthma (CSGA) was a National
Heart, Lung, and Blood Institute [NHLBI]-funded initiative to facilitate the
discovery of asthma and atopy susceptibility loci [1]. White, African-American,
and Hispanic families were recruited at five centers in Baltimore, Chicago,
Minneapolis, and Albuquerque. Genome-wide microsatellite markers were
genotyped in members of 266 families by the NHLBI-supported Mammalian
Genotyping Service at Marshfield, Wisconsin, and linkage analyses for asthma
and atopic phenotypes were performed in the total sample and within each racial
and ethnic group [26].
The largest linkage signal for asthma in the CSGA white families was
on chromosome 6p21 [3]. The maximum lod score in 129 white families was
1.91 (P = 0.002) at marker D6S1281, just telomeric to the human leukocyte
antigen (HLA) region. Linkage of asthma and related phenotypes to this region
of chromosome 6 had been reported in six previous genome screens [712],
which makes it one of the most replicated regions of the genome [13]. It was
surprising that all of the evidence for linkage on 6p in the CSGA families
was confined to the 35 white families ascertained in Chicago (Fig. 1A). There
was no evidence for linkage on 6p in families ascertained at the other CSGA
centers (not shown).
This article was supported in part by NIH grants HD21244, HL56399, HL66533, HL70831,
and HL72414.
E-mail address: c-ober@genetics.uchicago.edu
doi:10.1016/j.iac.2005.08.001
670
ober
Fine mapping and positional cloning on 6p21

The HLA region contains many genes that have been associated with asthma
or related phenotypes, such as the class II loci, HLA-DRB1 and HLA-DPB1,
tumor necrosis factor, lymphotxin-a, and the ATP-binding cassette transporter
[14]. After the original linkage scan [3], we genotyped three additional microsatellite markers in the white families, one each in the HLA class II region
(DQ.CAR), the HLA class III region TNFa, and the region just distal to the class I
region (MOGc). The maximum lod score was 3.8 at the microsatellite marker
MOGc, at 51.95 cM from p-ter (Fig. 1A) [15].
MOGc
D6S258
TNFa
Lod Score
DQ.CAR
D6S1281
D6S1680
D6S1019
1
0
0
50
100
30.02
29.96
29.86
29.80
29.61
29.69
29.51
29.42
29.40
29.38
29.20
29.11
29.08
28.93
150
cM distance
Mb distance
Fig. 1. Linkage to 6p21 in the Chicago CSGA families. (A) The dashed line shows the results in the
initial genome screen with framework markers. The solid line shows the results with five additional
short tandem repeat polymorphism (STRP)s between framework markers D6S1281 and D6S1019.
(B) 1 Mb region from D6S258 to D6S265 with positional candidate genes (all known genes [blue],
but not all pseudogenes [brown] and STRPs [green] and intragenic single nucleotide polymorphism
[SNP]s [purple], are included). Circles indicate SNPs; triangles indicate in/dels; squares indicate
STRPs; HLA-A genotype comprised of multiple SNPs is shown as a rectangle. (From Nicolae D, Cox
NJ, Lester LA, et al. Fine mapping and positional candidate studies identify HLA-G as an asthma
susceptibility gene on chromosome 6p21. Am J Hum Genet 2005;76:34957; with permission.)
hla-g: an asthma gene of chromosomep 6p
671
To narrow the region further, we genotyped the Chicago family members and
an additional 46 Chicago white trios (asthma proband and parents) at the HLA-A
locus at the distal end of the HLA class I region (52.94 cM from p-ter) and at
six additional microsatellite loci located between HLA-A and tumor necrosis
factor, which provided microsatellite markers that spanned nearly the entire HLA
region from 52.94 to 53.77 cM from p-ter. There was no evidence of association
with any of the markers, which allowed us to exclude genes within the class I,
class II, and class III HLA regions, which include all of the loci that had been
associated with asthma or related phenotypes in previous studies. In contrast, one
allele at the MOGc locus was associated with asthma in the families (136 bp
allele was transmitted 42 times and was not transmitted 23 times to children with
asthma from heterozygous parents; expected 32.5 and 32.5), which suggested that
the asthma gene was close to this locus. An allele at this locus also was associated
with asthma in the Chicago trios. In the trios, however, the 134 bp allele was
associated (17 transmitted: 6 not transmitted), which suggested that the asthmaassociated allele may be on different haplotype backgrounds in the families and
the trios. Based on these results, we focused our search in the extended class I
region, centered on the MOGc locus, and identified a 1 Mb region between
D6S265 and D6S258 that likely harbored the asthma susceptibility locus that was
segregating in the Chicago families (Fig. 1B) [15]. This region is gene rich and
contains 20 known or predicted genes and at least 30 pseudogenes [16].
From broad region to one gene

Our strategy was to genotype at least one single nucleotide polymorphism
(SNP) in each gene and achieve an average density of at least one SNP per 20 kb
across each gene, including the 5V and 3V flanking regions, whenever possible.
Additional variants were typed in pseudogenes or intergenic regions to provide
uniform coverage across the region. A total of 76 polymorphisms were studied
(Fig. 1B). The first question we asked was whether genotype for any of these 76
polymorphisms could explain the linkage shown in the previous slide. The idea
behind this approach is that the linkage signal was generated by the families
segregating a variant that was shared among affected individuals. If we
condition on the genotype that contributed to the linkage signal and repeat
our linkage analysis, the linkage signal should be reduced or eliminated
altogether. This approach is similar to the one used to positionally clone
CAPN10 as a type 2 diabetes gene [17] and the method subsequently developed
by Sun and colleagues [18]. We tested each of these 76 variants, and only 1
explained nearly all the evidence for linkage [15]: a silent polymorphism at
amino acid 93 (HisYHis; nucleotide + 1489C/T) in exon 3 of the HLA-G gene.
Only variation in HLA-G (but not in any other gene) was significantly associated
with asthma in the Chicago families and trios at P b 0.001, which strengthened
the evidence that HLA-G was the asthma gene on 6p. Similar to the results at the
672
ober
Families
Trios
C CA G G
CC del
TC ins
CG T A
Fig. 2. The HLA-G gene has eight exons, shown as rectangles (see Fig. 4 for details). Nine
polymorphisms (yellow circles) from the 5V-upstream regulatory region to the 3V-untranslated region
were genotyped in the Chicago families. The filled arrow above the gene figure shows the 1489C/T
SNP that explained the linkage in the families. The dashed arrow above the gene figure shows the
964G/A promoter SNP that was studied in the Dutch families. Examples of the family structures in
the Chicago families and trios are shown; probands are shown by arrows. Yellow symbols correspond
to affected individuals (asthma). The parents of the trio probands were not phenotyped and are of
unknown (?) affection status.
MOGc microsatellite locus, however, the associated alleles at the HLA-G locus
also differed between the families and trios (Fig. 2).
We genotyped nine polymorphisms across the HLA-G gene and identified
an extended haplotype in the families that was associated with asthma. The same
analysis in the Chicago trios also identified a haplotype that was associated
with asthma, but it differed at almost every site from the haplotype associated
with asthma in the families. This was surprising because asthma was diagnosed in
the family members and trio probands using identical criteria [1], and both the
families and trios were recruited from the same clinics in Chicago.
The families were ascertained through two affected siblings and extended to
include other relatives. Many families included three generations, and most included more than two affected members. On the other hand, the trios were ascertained through a single affected child and, although the parents donated blood
for genetic studies, no phenotypes were collected in them.
Ying-Yang haplotypes and asthma susceptibility

Because the pattern of association was with opposite haplotypes in the families and trios, we wondered whether the different ascertainment schemes were
influencing our results. In particular, the families required multiple affected individuals for participation, whereas the trios did not. To address the possibility
that family history of asthma was influencing our results, we genotyped selected
SNPs in two populations that previously had shown evidence for linkage of an
asthma-related phenotype to 6p21: Dutch families [11] and a founder population
called the Hutterites [19]. The Dutch study included 200 families, ascertained
673
through an affected parent diagnosed approximately 30 years ago [11]. We

examined the prevalence of bronchial hyperresponsiveness (BHR) in the children,
stratified by parental affection status [15]. First, we focused on parents who were
heterozygous for one of the variants that distinguished the two haplotypes and
looked at transmission of each allele to affected children. We conducted this
analysis separately based on affection status of each parent (Fig. 3). The 964G
allele at this locus was associated with asthma in the Chicago families and the
964A allele in the trios. If there was no association, the G and A alleles would be
equally transmitted to affected children in both sets of families. If an allele is
associated, that allele should be transmitted more often to affected children. In the
Dutch families, the G allele was transmitted more often to affected children if the
mother was affected (61 transmitted; 45 not transmitted) but the A allele was
transmitted more often if the mother was not affected (57 transmitted; 27 not
transmitted). The difference between these two samples was significant
(P = 0.0008). The prevalence of BHR among children with GG genotype is
significantly influenced by mothers affection status (P = 0.001), whereas children
with AA genotype were more likely to be atopic, regardless of mothers affection
status (P = 0.006). There was no association with fathers affection status.
Studies in the Dutch families suggested that maternal phenotype (BHR
status) and childs genotype interact to determine risk in a child. To determine
whether such interactions could underlie the discrepant results between the Chicago families and trios, we stratified the children who had asthma in the Chicago
families by genotype at the variant that we studied in the Dutch ( 964G/A) and
at the variant that explained the evidence for linkage in the families (+1489C/T)
and by mothers BHR status (Fig. 4). At the 964 site, children who had asthma
and were of BHR mothers were more likely to have the GG genotype, whereas
children who had asthma and were of non-BHR mothers were more likely to have
the AA genotype. This relationship was more striking for the variant that explained the evidence for linkage, +1489, in which the C allele was overrepresented among children who had asthma and were of BHR mothers and the
Fig. 3. Studies in Dutch families were stratified by parental affection status. Children of mothers
with BHR (left) and without BHR (right) with the 964A/G genotype are shown with their affected
(BHR, yellow symbols) and unaffected (unfilled symbols) children. Among mothers with BHR there
was excess transmission of the G allele to affected children, but among mothers without BHR there
was excess transmission of the A allele. The difference between these samples was significant
(P = 0.0008). Children who have BHR and are of affected mothers are more likely to have the GG
genotype, whereas children who have BHR and are of unaffected mothers are more likely to have the
AA genotype.
674
ober
Fig. 4. Genotype proportions at the 964A/G SNP (A) and the +1489C/T SNP (B) in children with
asthma in the Chicago families, by mothers BHR, and status. The percentages in the symbols
correspond to the proportion of affected children with each genotype. The affected children of mothers
who have BHR are more likely to have the 964 GG and +1489 CC genotypes, whereas affected
children of unaffected mothers are more likely to have the 964 AA and +1489 TT genotypes.
T allele was overrepresented in children who had asthma and were of non-BHR
mothers (P = 0.009) [15]. We observed a similar trend in the Hutterites, in whom
the frequency of the 964G allele was higher in children who had asthma and
were of BHR mothers than among children who had asthma and were of nonBHR mothers (0.69 versus 0.60), but the difference was not statistically
significant [15].
HLA-G: an important immunomodulatory molecule in pregnancy

These data in Chicago families, Dutch families, and Hutterites suggested
that the prenatal environment in affected and unaffected mothers differentially
affects risk for asthma in the fetus in a genotype-specific manner [15]. In fact, the
relationship between maternal affection status and childs genotype was not that
surprising given the known function of this gene. HLA-G is best known for the
critical role that it plays during pregnancy [20,21]. This gene is the most highly
expressed HLA gene in the most invasive fetal placental cellsthose that embed
deep into the maternal decidua, line the spiral arteries, and make direct contact
with maternal immune cells. In these invasive placental cells, the classic HLA
genes are suppressed. The expression of HLA-G protein inactivates maternal
immune cells [2225], which is consistent with its putative role in either eliciting
or maintaining maternal tolerance of the allogeneic fetus during pregnancy
[20,26,27]. Pregnancy, like asthma and allergy, is characterized by a predomi-
675
nance of Th2 cytokines [28], and HLA-G is believed to be a key player in this
shift [29].
HLA-G expression in the lung

Although it was believed that expression of HLA-G protein was limited to
fetal cells at the maternal-fetal interface during pregnancy, research recently has
shown that selected isoforms of HLA-G are expressed in adult tissues. Expression
of this protein has been demonstrated in malignant tumor cells [30,31], in transplanted tissues [3235], and in inflammatory diseases, such as atopic dermatitis
[36], inflammatory bowel disease [37], multiple sclerosis [38], and pulmonary
disease [15,39,40]. A recent paradigm has emerged implicating HLA-G as an
anti-inflammatory immunomodulatory molecule in adult tissues.
Fig. 5. Polymorphisms in (A) exons of HLA-G. All known polymorphisms in exons 14 and a 14 bp
insertion/deletion polymorphism in exon 8 are shown. Polymorphisms in (B) the 5V-upstream
regulatory region. The approximately 1300 bp upstream of exon 1 contain all known regulatory
elements (numbering from the translational start site); 18 polymorphisms are shown (Modified from
Ober C, Aldrich CL, Chervoneva I, et al. Variation in the HLA-G promoter region influences
miscarriage rates. Am J Hum Genet 2003;72:142535; with permission.) Cis-acting regulatory elements: TATA, TATA box; CCAAT, CAAT box; S/X1, Pan HLA regulatory elements; ISRE, interferonspecific regulatory element; EnhA, enhancer A; HSE, heat shock protein element; GAS, gamma
(interferon) activated site; LCR, locus control region; TSRE, tissue-specific regulatory element.
(Data from Solier C, Mallet V, Lenfant F, et al. HLA-G unique promoter region: functional implications. Immunogenetics 2001;53:61725.)
676
ober
To determine whether HLA-G could participate in a local immune response in

the lung, we demonstrated by immunohistochemistry the expression of a soluble
isoform of HLA-G, called G5 [41], in bronchial epithelial cells from two
individuals who had asthma, with much weaker expression in the lungs of an
individual who did not have asthma [15]. This immunomodulatory protein could
influence response to inhaled allergens, perhaps skewing the response toward a
Th2-like profile.
HLA-G is an unusual HLA gene

HLA-G is considered a nonclassic, class I HLA gene. Although its structure
is similar to the classical, class I genes (HLA-A, HLA-B, HLA-C), it has a shortened cytoplasmic tail, a more restricted tissue distribution, and relatively few
polymorphisms in its coding region (Fig. 5A) [42]. In particular, compared with
the classic genes, which are among the most polymorphic in the human genome,
there are only four polymorphisms in HLA-G that alter the protein: one amino
acid substitution each in exons 2, 3, and 4 that encode the extracellular domain
(Thr31Ser, Leu110Ile, and Thr258Met, respectively) and a single base pair deletion of a cytosine at nucleotide 1597 (exon 3) that results in a null allele for the
full length proteins, G1 and G5 [43]. A 14 bp insertion/deletion polymorphism
in the 3V-untranslated region has been associated with mRNA expression levels
[44,45]. In contrast, the 5V-upstream region that contains all of the known
promoter elements is highly polymorphic, with 18 SNPs over approximately
1300 base pairs (Fig. 5B) [46,47]. Many of these SNPs coincide with or are close
to transcription factor binding sites and could influence transcription.
Another feature that distinguishes HLA-G from the other class I genes is
the generation of at least seven transcripts that result from alternative splicing.
Four of these transcripts have been shown to exist as protein isoforms by immunohistochemistry [48]. The isoform expressed in bronchial epithelial cells [15]
is called HLA-G5, which is a soluble protein that results from the inclusion of
intron 4 sequence in the mature message [41].
Summary
We identified HLA-G as an asthma susceptibility gene in multiple populations and demonstrated that variation in this gene influences subsequent
risk for asthma. Prenatal exposure to factors that are correlated with maternal
BHR (or perhaps BHR itself) interacts with fetal genotype to determine this
risk, however. Among fetuses of unaffected mothers, the +1489TT genotype is a
marker for increased risk, whereas among fetuses of affected mothers, the
+1489CC genotype is a marker for increased risk. Studies are underway to understand the mechanism for this interaction and the role of this gene in the pathogenesis of asthma.
677
References
[1] Lester LA, Rich SS, Blumenthal MN, et al. Ethnic differences in asthma and associated
phenotypes: Collaborative Study on the Genetics of Asthma. J Allergy Clin Immunol 2001;108:
357 62.
[2] Collaborative Study on the Genetics of Asthma. A genome-wide search for asthma susceptibility
loci in ethnically diverse populations. Nat Genet 1997;15:389 92.
[3] Xu J, Meyers DA, Ober C, et al. Genome-wide screen and identification of gene-gene
interactions for asthma-susceptibility loci in three US populations: Collaborative Study on the
Genetics of Asthma. Am J Hum Genet 2001;68:1437 46.
[4] Mathias RA, Freidhoff LR, Blumenthal MN, et al. A genome-wide linkage analyses of total
serum IgE using variance components analysis in asthmatic families. Genet Epidemiol 2001;
20:340 55.
[5] Blumenthal MN, Langefeld CD, Beaty TH, et al. A genome-wide search for allergic response
(atopy) genes in three ethnic groups: Collaborative Study on the Genetics of Asthma. Hum
Genet 2004;114:157 64.
[6] Blumenthal MN, Ober C, Beaty TH, et al. Genome scan for loci linked to mite sensitivity:
the Collaborative Study on the Genetics of Asthma (CSGA). Genes Immun 2004;5:226 31.
[7] Daniels SE, Bhattacharrya S, James A, et al. A genome-wide search for quantitative trait loci
[8] Wjst M, Fischer G, Immervoll T, et al. A genome-wide search for linkage to asthma. Genomics
1999;58:1 8.
[9] Ober C, Tsalenko A, Willadsen SA, et al. Genome-wide screen for atopy susceptibility alleles in
the Hutterites. Clin Exp Allergy 1999;4(Suppl):11 5.
childhood asthma to chromosome 5q31-q33 near the interleukin 12 B locus by a genome-wide
[11] Koppelman GH, Stine OC, Xu J, et al. Genome-wide search for atopy susceptibility genes in
Dutch families with asthma. J Allergy Clin Immunol 2002;109:498 506.
[12] Haagerup A, Bjerke T, Schiotz PO, et al. Asthma and atopy: a total genome scan for
susceptibility genes. Allergy 2002;57:680 6.
[13] Hoffjan S, Ober C. Present status on the genetic studies of asthma. Curr Opin Immunol 2002;14:
709 17.
[14] Hoffjan S, Nicolae D, Ober C. Association studies for asthma and atopic diseases: a comprehensive review of the literature. Respir Res 2003;4:14 28.
HLA-G as an asthma susceptibility gene on chromosome 6p21. Am J Hum Genet 2005;76:349 57.
[16] Mungall AJ, Palmer SA, Sims SK, et al. The DNA sequence and analysis of human chromosome 6. Nature 2003;425:805 11.
[17] Horikawa Y, Oda N, Cox NJ, et al. Polymorphism in the calpain 10 gene affects susceptibility
to type 2 diabetes in Mexican Americans. Nat Genet 2000;26:163 75.
[18] Sun L, Cox NJ, McPeek MS. A statistical method for identification of polymorphisms
that explain a linkage result. Am J Hum Genet 2002;70:399 411.
[19] Ober C, Tsalenko A, Parry R, et al. A second generation genome-wide screen for asthma
susceptibility alleles in a founder population. Am J Hum Genet 2000;67:1154 62.
[20] Ober C. HLA and pregnancy: the paradox of the fetal allograft. Am J Hum Genet 1998;62:1 5.
[21] Hunt JS, Petroff MG, McIntire R, et al. HLA-G and immune tolerance in pregnancy. FASEB J
2005;19:681 93.
[22] Rouas-Freiss N, Goncalves RM, Menier C, et al. Direct evidence to support the role of HLA-G
in protecting the fetus from maternal uterine natural killer cytolysis. Proc Natl Acad Sci U S A
1997;94:11520 5.
[23] Khalil-Daher I, Riteau B, Menier C, et al. Role of HLA-G versus HLA-E on NK function:
HLA-G is able to inhibit NK cytolysis by itself. J Reprod Immunol 1999;43:175 82.
678
ober
[24] Fournel S, Aguerre-Girr M, Huc X, et al. Cutting edge: soluble HLA-G1 triggers CD95/CD95
ligand-mediated apoptosis in activated CD8 + cells by interacting with CD8. J Immunol
2000;164:6100 4.
[25] Solier C, Aguerre-Girr M, Lenfant F, et al. Secretion of pro-apoptotic intron 4-retaining soluble
HLA-G1 by human villous trophoblast. Eur J Immunol 2002;32:3576 86.
[26] Hunt J, Orr HT. HLA and maternal-fetal recognition. FASEB J 1992;6:2344 8.
[27] Le Bouteiller P, Mallet V. HLA-G and pregnancy. Rev Reprod 1997;2:7 13.
[28] Piccinni MP, Beloni L, Livi C, et al. Defective production of both leukemia inhibitory factor
and type 2 T-helper cytokines by decidual T cells in unexplained recurrent abortions. Nat Med
1998;4:1020 4.
[29] Carosella ED, Moreau P, Aractingi S, et al. HLA-G: a shield against inflammatory aggression.
Trends Immunol 2001;22:553 5.
[30] Paul P, Rouas-Freiss N, Khalil-Daher I, et al. HLA-G expression in melanoma: a way for tumor
cells to escape from immunosurveillance. Proc Natl Acad Sci U S A 1998;95:4510 5.
[31] Wiendl H, Mitsdoerffer M, Hofmeister V, et al. A functional role of HLA-G expression in human
gliomas: an alternative strategy of immune escape. J Immunol 2002;168:4772 80.
[32] Creput C, Durrbach A, Menier C, et al. Human leukocyte antigen-G (HLA-G) expression in
biliary epithelial cells is associated with allograft acceptance in liver-kidney transplantation.
J Hepatol 2003;39:587 94.
[33] Creput C, Le Friec G, Bahri R, et al. Detection of HLA-G in serum and graft biopsy associated
with fewer acute rejections following combined liver-kidney transplantation: possible
implications for monitoring patients. Hum Immunol 2003;64:1033 8.
[34] Lila N, Rouas-Freiss N, Dausset J, et al. Soluble HLA-G protein secreted by allo-specific CD4 +
T cells suppresses the allo-proliferative response: a CD4 + T cell regulatory mechanism. Proc
Natl Acad Sci U S A 2001;98:12150 5.
[35] Lila N, Amrein C, Guillemain R, et al. Human leukocyte antigen-G expression after heart
transplantation is associated with a reduced incidence of rejection. Circulation 2002;105:
1949 54.
[36] Khosrotehrani K, Le Danff C, Reynaud-Mendel B, et al. HLA-G expression in atopic dermatitis.
J Invest Dermatol 2001;117:750 2.
[37] Torres MI, Le Discorde M, Lorite P, et al. Expression of HLA-G in inflammatory bowel disease
provides a potential way to distinguish between ulcerative colitis and Crohns disease.
Int Immunol 2004;16:579 83.
[38] Fainardi E, Rizzo R, Melchiorri L, et al. Presence of detectable levels of soluble HLA-G
molecules in CSF of relapsing-remitting multiple sclerosis: relationship with CSF soluble HLA-I
and IL-10 concentrations and MRI findings. J Neuroimmunol 2003;142:149 58.
[39] Pangault C, Le Friec G, Caulet-Maugendre S, et al. Lung macrophages and dendritic cells
express HLA-G molecules in pulmonary diseases. Hum Immunol 2002;63:83 90.
[40] Rizzo R, Mapp CE, Melchiorri L, et al. Defective production of soluble HLA-G molecules by
peripheral blood monocytes in patients with asthma. J Allergy Clin Immunol 2005;115:508 13.
[41] Fujii T, Ishitani A, Geraghty DE. A soluble form of the HLA-G antigen is encoded by a
messenger ribonucleic acid containing intron 4. J Immunol 1994;153:5516 24.
[42] Solier C, Mallet V, Lenfant F, et al. HLA-G unique promoter region: functional implications.
Immunogenetics 2001;53:617 25.
[43] Ober C, Aldrich CL. HLA-G polymorphisms: neutral evolution or novel function? J Reprod
Immunol 1997;36:1 21.
[44] Rousseau P, Le Discorde M, Mouillot G, et al. The 14 bp deletion-insertion polymorphism
in the 3V UT region of the HLA-G gene influences HLA-G mRNA stability. Hum Immunol
2003;64:1005 10.
[45] Hviid TV, Hylenius S, Rorbye C, et al. HLA-G allelic variants are associated with differences in
the HLA-G mRNA isoform profile and HLA-G mRNA levels. Immunogenetics 2003;55:63 79.
[46] Ober C, Aldrich CL, Chervoneva I, et al. Variation in the HLA-G promoter region influences
miscarriage rates. Am J Hum Genet 2003;72:1425 35.
679
[47] Hviid TV, Sorensen S, Morling N. Polymorphism in the regulatory region located more than 1.1
kilobases 5V to the start site of transcription, the promoter region, and exon 1 of the HLA-G gene.
Hum Immunol 1999;60:1237 44.
[48] Morales PJ, Pace JL, Platt JS, et al. Placental cell expression of HLA-G2 isoforms is limited to
the invasive trophoblast phenotype. J Immunol 2003;171:6215 24.

25 (2005) 681 708
Candidate Gene Association Studies and

Evidence for Gene-by-Gene Interactions
Michael Kabesch, MD
University Childrens Hospital, Ludwig Maximilians University Munich, Lindwurmstrasse 4,
Munchen D-80337, Germany
Asthma: a major gene disease?

Asthma is a complex disease with different faces and facets. Although it is
the most common chronic disease in childhood in the western world, its true
causes are not known. Strong evidence suggests that genetic predisposition and
environmental factors contribute to the development of the disease [13].
Epidemiology has identified a number of risk factors for asthma and atopy in
recent years, but it is well known in clinical practice that the presence of asthma
in first-degree relatives of a child is the single most important risk factor for the
development of the disease [3]. Different environments may only influence,
trigger, or protect from a disease that is predominantly the result of an individuals genetic background.
The interaction between numerous environmental influences and the genetic
predisposition makes asthma a complex and multifactorial disease in which the
effect of a single genetic factor may be hard to detect and evaluate. Models
simulating environmental and genetic influences on the occurrence of a disease
over generations have been tested in family studies. If the cause for an illness is
environmental (eg, pollution), regional patterns of the disease may be identified;
if the cause for an illness is an infection, epidemic characteristics become evident;
and in genetic diseases, heritability is observed. In asthma and other atopic
diseases, such as allergic rhinitis or atopic dermatitis, these segregation analyses
revealed a strong but not exclusive genetic contribution [47]. Instead of a
E-mail address: Michael.Kabesch@med.uni-muenchen.de

doi:10.1016/j.iac.2005.07.001
682
kabesch
Mendelian pattern of inheritance, mixed models of genetic and environmental

influences gave the best match with the observed distribution of asthma in
extended families. Furthermore, when the occurrence of asthma was investigated
in twin studies, genetic effects played a more important role than environmental
factors in the development of the disease. Heritability (ie, the contribution of
genetics) was determined to be between 60% and 80% in different studies [8,9].
Although no doubt exists that genetic predisposition influences the development
of asthma, the nature of this predisposition is a matter of debate. In early asthma
genetics, a common expectation was that alterations in a major gene, similar to
monogenetic diseases, may lead to asthma. This seems not to be the case because
the mechanisms underlying asthma are complex and because the phenotypic
presentation of the disease is extremely variable. More likely, a number of
alterations in different genes contribute to the genetic predisposition of an
individual to develop atopic diseases and asthma. It may be argued how many
genes contribute and how big their proportional influence may be. It may be a
handful of major genes exerting major effects or a larger number of genes adding
smaller contributions (Fig. 1). Here, an inverse relationship exists: The more
genes there are contributing to a disease, the smaller their individual effect on the
phenotype. No major gene for asthma has been identified, and the attributable
risk of any single gene identified in asthma genetics has been rather small. Thus,
there may be some reason to believe that asthma is a polygenic disease in which a
large number of genetic alterations in many genes contribute to the predisposition
for the disease. The term polygenetic in population genetics implies not only
that numerous genes are involved in the expression of the phenotype but also that
these genes or genetic alterations act independently from each other. Similar
phenotypic expressions of asthma may have been caused by the activation of
different pathomechanisms, and there may be little argument that a number of
(A)
Phenotype
effect
(B)
1
Number of genes
Fig. 1. The association between the number of genes associated with a disease and the phenotype
effect per gene differs between major gene diseases and polygenic diseases. In the case of major gene
diseases (A), a limited number of genes affects the phenotype dramatically, whereas in polygenic
diseases, a large number of genes exert small effects on the phenotype.
683
gene association studies
independent immunologic or lung-specific pathways may lead to the development of asthma. There is an increased knowledge of the complex nature of
balance in immunologic networks and the profound interactions between different feedback mechanisms. Evidence is increasing that genetic alterations in
asthma genes may not act completely independently from each other; rather,
biologic interactions may be crucial for the development of the disease.
In this context, the likelihood of a genetic predisposition to result in a clinical disease, also called penetrance, has to be discussed (Fig. 2). Therefore, it is
possible that an individual may display a strong genetic risk to develop asthma,
but this risk may be modified by the environment in a way that no clinical disease
becomes apparent or its manifestation is drastically diminished. Also, the opposite effect of multifactorial interaction may occur. As a third possibility, environmental factors alone may result in a phenocopy of asthma, a disease similar to
genetically determined asthma but without detectable genetic influences. Taking
all this into account, it may seem impossible to disentangle the complex genetics
of asthma and atopy. However, with increasing experience in complex genetics,
study tools have been developed, adapted, and improved over the years. Promising ideas have been proposed, large and informative study populations around
the world have been established for asthma genetics, and a network for
replication studies has evolved. Although no single research group may hope
to solve the riddle of asthma genetics, a common effort may be successful. Some
approaches to asthma genetics are discussed in this article.
Asthma-Phenotype
D
A
B
C
Environment
Genetics
Fig. 2. From genotype to phenotype. The sum of a strong genetic susceptibility for asthma may
directly lead to the expression of an asthma phenotype independent of environmental effects (A). An
asthma phenotype may also result from an interaction between genetic and environmental effects (B).
Genetic predisposition and environmental factors may cancel each other so that no clinical expression
of asthma occurs (C). Asthma may result from strong environmental factors in the absence of genetic
predisposition (D).
684
kabesch
Candidate gene studies: the rationale

By definition, a candidate is an applicant for a position. So how do genes
apply for a position in asthma genetics? Usually, they do so by using three
different approaches. (1) Their candidate status derives from linkage studies in
asthmatic families and subsequent positional cloning, (2) they are drafted to the
field by their association with the mechanisms that are believed to be involved in
the development of asthma, or (3) they are differentially expressed in asthmatics
and nonasthmatics in microarray experiments of gene expression or proteomics
(Fig. 3). Classically, a distinction has been made between family-based linkage
studies and candidate gene association studies. However, once a gene has been
identified by linkage and positional cloning, it becomes a candidate gene and is
available for further analysis by association approaches, which is a more powerful statistical tool.
All three approaches to the candidate gene have advantages and disadvantages. Linkage studies and positional cloning usually rely on a limited number of
families of affected children, and selection bias or family effects may alter the
results. The recruitment of these families is expensive and time consuming, and
therefore the statistical power of these approaches may be limited by the number
of subjects in these studies. On the other hand, with the linkage approach, no
preexisting hypotheses are necessary because a systematic genetic analysis of the
whole genome is performed. Although previously the density of markers on the
genome was limited, new collections of thousands of single-nucleotide polymorphisms (SNPs) covering the whole genome allow for a much more extensive
Asthma candidate gene
Systematic genetic
approach to detect
new genes using
linkage studies and
positional cloning
Gene expression
studies using
microarray technology
to identify disease
genes
Functional approach
using experimental
data in human and
animal models to
select genes
Fig. 3. How to become a candidate gene. Candidate genes may derive from linkage studies and
positional cloning (A), by microarray-based screens of gene expression in health and disease (B), or
by a functional approach where the role of a certain gene in asthma has already been established by
experimental research (eg, by immunology or pulmonology) (C).
685
approach. However, with the enormous increase of markers, the question of

correction for multiple testing has to be addressed, and new statistical software
may have to be developed. At least 15 whole-genome linkage studies have been
performed in sufficiently large study populations. Linkage peaks with asthma
and other atopic diseases are distributed over the whole genome, and all
chromosomes show linkage with asthma or atopy in at least one of these linkage
studies. Some of the linkage peaks are shared between different studies, but the
majority of peaks is restricted to one or two population samples. This diversity of
results may express the diversity of genetic contributions to the disease in
different populations and the polygenetic nature of asthma and atopy. However,
some of these linkage signals may be false positive. Recently, four genes have
been identified as candidate genes by a linkage study and positional cloning
approach. From linkage peaks, the genes responsible for the respective signals
have been narrowed down. By this approach, ADAM33, DPP10, PHF11, and
GPRA have been detected as genes previously not associated with atopic diseases
[1013]. These genes have been tested in numerous association studies, and it
remains to be seen if the initially observed results can be replicated sufficiently.
Using a candidate gene approach in association studies may be more efficient in
terms of time and money. Here, a large number of subjects may be phenotyped
in different study settings using family-based trios, cross-sectional population
studies, or case-control designs. Recruitment of subjects for this study may be
much easier, but a large proportion of the phenotyped subjects may be less
informative than in family-based linkage studies. A further problem may lie in the
approach per se: A candidate gene is selected based on the assumption of its role
in the pathogenesis of asthma, and thus the success of the study relies heavily on
the quality of the hypothesis and the biologic plausibility of the candidate gene.
Because we know little about the mechanisms involved in the development of
number of publications
120
100
80
60
40
20
0
1995 1996 1997 1998 1999 2000 2001 2002 2003 2004
year
Fig. 4. Published candidate gene studies over the years. Using the terms asthma or atopy in
combination with gene* or polymorph*, a MEDLINE search for association studies in asthma and
atopy was performed. All identified association studies were grouped per year for the last 10 years.
686
kabesch
asthma, almost all of the estimated ~22,300 human genes could qualify as asthma
candidate gene in one way or another. This is the impression given when we look
at the recent increase of association studies in the asthma genetics literature
(Fig. 4). It seems that some of the published studies may be affected by a positive
publication bias. Replication is crucial for these studies, and recently quality
criteria have been proposed for the publication of association studies.
The third approach leading to the identification of a candidate gene may be
the differential expression of genes in asthmatics and healthy individuals. Based
on microarray technology where the mRNA expression of thousands of genes in
a biologic specimen can be analyzed simultaneously with a detection chip, this
approach has been applied in a number of different diseases successfully [14].
However, little microarray data have been published in the asthma field, and no
systematic studies combining candidate gene detection by microarray and subsequent genomic investigation of SNPs have been published [15,16].
Candidate gene studies

Until recently, candidate studies usually assessed the correlation between one
genetic alteration in a gene and the development of a disease. Within the last
years, fueled by technical improvements in mutation analysis and high throughput genotyping, it became more common to not only test one genetic alteration/
polymorphism but also to screen a whole gene of interest and its surrounding for
polymorphisms. In most genes, a number of polymorphismsusually SNPs
equivalent to a single base-change or deletion and insertion polymorphisms,
defined by the lack or addition of a single baseare detectable. A ratio of
approximately one polymorphism in every 1000 bases can be expected, with
considerable variation between different genes. These polymorphisms may be
inherited in packages and different allelic blocks, so-called haplotypes, representing the sum of genetic alterations in one gene. Modern genetic association
studies should comprise a comprehensive mutation analysis and the involvement
of haplotypes in their analysis.
In association studies of asthma genetics, different outcome variables are often
studied at the same time: atopy as defined by skin prick test and by total and
specific serum IgE; bronchial hyper-responsiveness (BHR) as measured by
different techniques, markers of disease severity, and treatment; and a number
subphenotypes. The initial intention of subphenotypes was to narrow the gap
between a genetic alteration and the outcome effect. It was argued that, due to the
multifactorial nature of asthma as a complex disease, uncontrolled effects such as
environmental modifications and interactions may make it impossible to see the
effect of genetics in the far downstream outcome of clinical asthma expression.
This idea has often been abused in that fishing expeditions with subphenotypes
may have been performed to find arbitrary associations. Multiple testing without
correction becomes a problem, and the interpretation of the reported results may
be difficult.
687
Asthma, atopic dermatitis, and rhinitis often are assessed at the same time in
the same study population. Selection bias may occur in this situation. This is
especially true when a disease has been used as an indicator for recruitment in a
case-control setting. Thus, a population (eg, recruited on the premises of at least
one child with asthma in the family) may be biased for the analysis of atopic
dermatitis because these two diseases overlap. Instead of studying the genetic
background of atopic dermatitis in this situation, the genetics of asthma and
concomitant atopic dermatitis may be studied.
This leads to a further problem of asthma genetics that in the end may be
crucial: the definition of asthma in genetic studies. Good association studies rely
on two factors: (1) a sound hypothesis of why a candidate gene should be
involved in the disease of question and (2) a high degree of certainty about the
disease status of the study subjects. If we cannot be sure about the entity of
asthma as a disease or as a complex syndrome, some associations may be false on
the grounds that they may be associated with some vaguely defined pulmonary
illness instead of asthma. In asthma genetics, this may also affect the reproducibility of association results in different study populations. Depending on the
definition of asthma and other atopic phenotypes, results may vary between
populations, and slightly different phenotypes may not qualify as true replications. There is an urgent need for an international consensus.
The unlimited supply of candidate genes

The human genome project has identified ~22,300 independent human genes,
which is much less than what was initially expected. The regulation of genes may
be more important than previously believed. This implies that differential splicing
and expression levels of genes may have an important influence on biologic
functions. In this context, even small genetic changes, such as polymorphisms
in gene promoters or regulatory intronic regions, may contribute substantially to
the alteration of biologic functions and the development of the disease. Four
genes have become asthma candidate genes based on positional cloning, but the
vast majority of candidate genes derive from the crosstalk between genetics,
experimental immunology, and pulmonology. Usually, the function of a certain
protein is established in experimental settings, and an association between its
occurrence and asthma is observed, as is the case for a number of cytokines. The
position on the chromosome is established for almost all genes corresponding to
proteins, and most genes are easily accessible for mutation screens and
association studies. The key is the value of the initial hypothesis derived from
immunology or pulmonology. If the protein is not truly involved in the pathogenesis of asthma, genetic association studies are doomed from the beginning.
However, due to chance, linkage disequilibrium, multiple testing, and publication
bias, these association studies may yield some spurious associations between
some genetic markers and a selected phenotype that may never be replicated. A
critical approach has to be applied in the evaluation of candidate studies of
688
kabesch
asthma and atopy. Even though a polygenetic disease, not all of the more than
150 candidate genes suggested and published in the asthma field may be of value
in determining the genetic susceptibility for asthma.
From candidates to risk genes: the selection criteria

How should we proceed in assessing the role of candidate genes proposed
to contribute to the genetic susceptibility for asthma? How may we differentiate
between a good and a bad candidate gene? Some criteria have been proposed for
readers of association studies so that they may make their own conclusions
(Fig. 5) [17]. (1) Suggested associations shall be biologically plausible. The protein shall play an important function in the disease mechanisms. However, due
to the complexity of immune regulatory pathways and systems, many hypotheses
seem plausible, and the reader may depend on the information provided by the
authors of any given study. (2) The selected population should be adequate for
the purpose of the study. This means that selection criteria and phenotype
definitions should be standardized and that foreseeable bias should be avoided. A
major issue is the size of the population; few study population in candidate gene
association studies in the literature have the unrestricted power to detect multiple
associations. (3) Phenotyping should follow state-of-the-art guidelines. One may
be able to correct for most other pitfalls in association studies, but problems in
phenotyping corrupt the whole study irretrievably. (4) Genotyping has to be
performed well, and quality controls have to be applied. These include defined
sample tracking procedures, replication of genotyping results in a subset of individuals, and plausibility controls, such as the calculation of the Hardy Weinberg
Equilibrium. (5) The statistical methodology has to be adequate to answer the
research question. Specific software may have to be applied, and established
Fig. 5. Suggested criteria for association studies with candidate genes. General quality criteria for the
assessment of genetic association studies are shown.
689
procedures have to be followed (eg, in haplotype analysis). Multiple testing has

to be addressed where necessary, and precautions have to be applied for other
bias, such as population heterogeneity. (6) Evidence for a functional role of a
polymorphism associated with a disease should be presented on the level of
molecular biology. This is probably the most challenging aspect. It implies that in
experimental in vitro and in vivo systems, the link between a genetic alteration/
polymorphisms and the disease is established. In the case of a promoter polymorphisms associated with elevated serum IgE levels, this involves showing that
this specific promoter polymorphisms leads to an increased transcription of the
candidate gene (eg, by alternative binding of a transcription factor or epigenetic
regulation). It has to be shown that more transcription leads to more translation of
the gene into a protein and that more protein expression of the candidate gene
leads to an increase of IgE. To establish this chain of causality may take some
time, and these data may not be available at the same time as association studies.
Thus, the last point is ever more important until finally, causality of a certain
polymorphism in a candidate gene is proven by functional studies. (7) Independent replication studies are necessary. These replications need to be
performed in large and independent population samples to have the power to
replicate the initially reported associations that, by statistical laws, are stronger
than in replications (winners curse) [18].
From candidates to risk genes: the evidence

If candidate genes apply for a position, what is the status they reach if enough
evidence is amassed to prove their involvement in the pathogenesis of asthma?
They may become asthma risk genes. This implies that associations between
polymorphisms or mutations in these genes and the disease are stably reproducible and that the biologic causality of the polymorphism in the context of
the disease has been shown. The knowledge of asthma risk genes and asthma
relevant mutations has important implications. These may some day allow for a
diagnostic tool to predict the individual asthma risk and may help to improve the
diagnosis of asthma at an early age. However, because many genes may
contribute small effects, it may be tedious to develop genetic tests even when true
asthma risk genes are identified. Different genes and polymorphisms, or haplotypes, may be of various importance in different populations, and parallel mutation screens and association studies in diverse populations, such as Caucasians
and Black Americans, seem to show just that. It may be misleading to expect
universally applicable genetic associations between certain polymorphisms and
asthma. Although no asthma candidate gene deserves the label as an asthma
risk gene, the evidence may be stronger for some genes and polymorphisms than
for others. Some of the most intriguing asthma genes are presented in Table 1
[1976]. This table is not complete, and some promising genes may have been
missed. In the following section, some examples of asthma candidate genes are
690
kabesch
Table 1
Promising asthma candidate genes
Class
Official gene name
Innate immunitygenes that interact with the

microbial environment and are involved in
host defence
Positional clonedgenes identified as a result
of positional cloning experiments
C5 [19], C5R1 [19,20], CARD15 [96],

CD14 [21], TLR2 [101], TLR4 [22,107],
TLR6 [23], TLR9 [24], TLR10 [25]
ADAM33 [7781,121], DPP10 [10], MS4A2
(FCERIB) [26,27], GPR154 (GPRA) [28],
PHF11 [13]
CC16 [2944], CCR5 [3539], CD28 [40],
CTLA4 [40,146], GATA3 [41], IL1RN [42],
IL10 [43], IL13 [44,45,125,126], IL15 [46],
IL18 [4749], IL4 [50,122,127], IL4R
[5153,139], STAT6 [41,54,124,132,133],
TNF [5560]
ADRB2 [6164], NOS1 [65,66], NOS3 [67,68],
SPINK5 [69,70], TGFB1 [71,72,128], VDR
[73,74]
Inflammatory responsegene-encoding
cytokines, chemokines and genes involved
in immune signaling, immune pathways
and immune cell development
Growth, development and modifiersgenes

involved in lung, cell, and tissue development
and maintenance/modification of the
mucosal barrier
Environmental modifiersgenes that modify
the oxidation of pollutants and other
environmental exposures (eg, tobacco smoke)
GSTM1 [75,111,112,116], GSTP1 [76],

GSTT1 [75,111,112,116]
discussed. The genes that are discussed have been selected on the basis that they
may reveal some of the peculiarities of asthma genetics.
ADAM33: the solution?

ADAM33 was the first new asthma candidate gene published that was detected by a positional cloning approach, and it is discussed in more detail
elsewhere in this issue. In this article, ADAM33 is used as an example to discuss
general issues of positional cloning as one approach to derive candidate genes
and the implications of new genes in asthma genetics.
Researchers from the United Kingdom, together with a company from the
United States, established a large family-based study population in England and
America, performed linkage studies, narrowed down an area on chromosome
20p13, and finally could show by positional cloning that this area harbors a
promising candidate gene for asthma that previously was unknown. The gene was
named ADAM33 for A Disintegrin And Metalloproteinase Domain 33 [12]. A
total of 135 SNPs were analyzed in and around the gene, and some limited
evidence for replication was given in the original publication where six SNPs
in ADAM33 showed associations with asthma and BHR in an American and
English population that was also used in part for the detection of the linkage
signal. In short succession, various research groups tried to replicate the initial
associations, but these replications were quite heterogeneous [7781]. The
original study indicated that 19 SNPs in ADAM33 showed associations with
691
asthma and BHR among the American and English populations that were used in
part for the detection of the original linkage signal. The association increased
when asthma with BHR was analyzed as a distinct phenotype. Thus, it was
suggested that ADAM33 may be more of a lung gene involved in airway
remodeling than one of general immunologic importance. Indeed, gene expression could be detected in lung fibroblasts and airway smooth muscle cells.
Replication studies mostly focused on those 19 polymorphisms that were
associated with asthma in at least one of the original populations. In a German
family-based study, association was found with 3 out of 15 tested SNPs, even
though the ADAM33 locus did not show any linkage signal in these German
families. When the same SNPs were retested in a cross-sectional population by
the same researchers, these associations could not be replicated, but a different
SNP showed a significant association with asthma [81]. In a Dutch cohort of
200 asthmatics followed over 20 years, it was shown that one out of eight tested
polymorphisms in the ADAM33 gene was associated with increased lung
function decline over the years; this may support the hypothesis that ADAM33 is
involved in airway remodeling [78]. However, this SNP was not identical to any
SNP replicated by the German study. Furthermore, Howard and coworkers [77]
tested eight SNPs in four ethnically diverse populations: Dutch, white, black, and
Hispanic Americans. In this study, different SNPs showed associations with
asthma and other atopic phenotypes. The same SNP that gave a positive
association in the German cross-sectional study was consistently associated with
asthma in three of the four tested populations by Howard [77]. Another large
American study, based on 650 families with asthma, investigated 16 SNPs in
the ADAM33 gene and could not find any associations of single SNPs in
white and black Americans. Two SNPs showed marginal associations with
asthma in the Hispanic subpopulation [80]. An association between a common
16 SNP haplotype and asthma was observed. In contrast, no association between
ADAM33 SNPs and asthma could be observed in two large studies from Mexico
and Puerto Rico that included almost 1000 asthmatics [79].
Although all except one published studies reported some associations between
ADAM33 and asthma susceptibility (which may in part be due to a positive
publication bias), the amount of variation between these associations is profound. The two largest studies conducted on ADAM33 [79,80] concluded that no
significant association can be assumed between ADAM33 polymorphisms and
asthma. All replication studies tested multiple SNPs and multiple outcome
variables. Thus, caution is necessary in the interpretation of studies that report
positive association results. Even in the positive studies, there is little consensus
about those SNPs that show associations in different populations. Heterogeneity,
genetic and environmental, may be one possible explanation for this diversity
between study populations.
Other factors may contribute to these incoherent results of replication. It may
be that the reported ADAM33 polymorphisms are not the true cause for the
linkage signal observed in the original population and that other SNPs in
ADAM33 or even in other genes in linkage with ADAM33 are responsible for
692
kabesch
the observed associations. By testing the published ADAM33 SNPs, one may
concomitantly measure the effect of the true asthma risk gene on chromosome
20p13 because different populations may represent different haplotype and
linkage blocks, linking or not linking certain ADAM33 SNPs to the real risk gene
or risk polymorphism.
Although ADAM33 is an attractive candidate gene for asthma based on the
model proposed for its function by comparison with other ADAM genes and
its expression in certain cells that are important in the lung, no evidence for
its function in asthma or airway remodeling exists, and no functional role of
ADAM33 polymorphisms has been described. ADAM33 can be viewed only as
an intriguing candidate gene for asthma. ADAM33 may only be proven to be an
asthma risk gene in the future, and causal SNPs may be detected in the gene.
What can be learned from ADAM33 is that single linkage or association
studies may be misleading. Even when linkage has been established and positional cloning has been used, it is important to be cautious when interpreting
these results. Replication has to be consistent in that the same SNPs are associated with the same phenotype and not, like in the case of ADAM33, different
SNPs in the gene with similar but differently assessed phenotypes. On the other
hand, heterogeneity in replication studies may have to be expected to some
degree due to the heterogeneity of different populations and the different weight
of certain SNPs in the development of asthma in different populations. Thus, the
main genetic factors leading to asthma may not be the same in Caucasians and
Africans or in Europeans and Japanese. Functional data, which is difficult to
acquire, has to be added to any association data.
CD14, Toll-like receptors, and CARD receptors: the bridge between innate
and adaptive immunity?
One of the most appealing hypotheses in recent asthma research is that exposure to environments with high levels of microbial components, such as day care
centers and farms, may protect one from the development of asthma and atopy [82].
It has been speculated that in a setting of high exposure to microbial matter, effects
on the adaptive immune system, such as enhancement of T-helper (Th)1-like
responses by microbial compounds or modifications of Th2-like responses, are
mediated by the activation of the innate immune system. Microbial compounds,
such as lipopolysaccharide (LPS), are first recognized by the antigen receptors of the
human innate immune system. The innate immune system is an evolutionarily old,
conserved defense system [83,84]. Examples of pattern recognition receptors are
CD14 [85], members of the family of Toll-like receptors (TLRs) [86,87], and
CARDs (for Caspase recruitment domain). The innate and the adaptive immune
system do not act independently of each other. Rather, they interact in many
ways [88], and the activation of the innate immune system is a prerequisite for
the activation of an adaptive immune response [89]. TLRs, CD14, and CARDs may
be critical proteins linking innate and adaptive immunity [90,91].
693
For TLRs, a variety of different ligands has been identified that seem to
specifically activate certain downstream signaling pathways. Ligands for TLRs
include bacterial components such as peptidoglycans (TLR2), LPS (TLR4), unmethylated CpG motifs of bacterial origin (TLR9), and double-stranded viral
DNA (TLR3). A complex intracellular signaling system of different, partially
redundant pathways leads to the activation of downstream effector mechanisms
of immunologic defense (for a review see [87]). Intracellular pathogen-associated
molecular patterns receptors, such as the NOD1/APAF1 gene family, have
been discovered (renamed CARD for Caspase recruitment domain). CARD15
molecules, which are primarily expressed in monocytes, activate nuclear factor
(NF)-kB on stimulation with LPS, thereby initiating apoptosis and other immune regulatory effects. It has been shown that LPS from different bacterial
sources has different effects on the CARD15 (NOD2)-dependent NF-kB
activation [92]. CARD4 (NOD1) is another pathogen receptor that may play a
role in innate immunity function.
Human genes coding for components of the innate immune response against
microbial matter play a key role in the interaction with the environment.
Mutations and polymorphisms in these genes may result in profound functional
changes and lead to the development of various diseases. The interaction between
environmental exposure and genetic makeup determines the potential repertoire
of host responses on an individual level. Different studies have indicated that
SNPs in innate immunity genes, such as the CD14 receptor [93,94], TLRs [95],
and the intracellular receptor CARD15 [96], may be associated with the development and severity of atopic diseases and airway reactivity.
In CD14, a promoter polymorphism was identified that leads to a 20% increase in CD14 gene expression after endotoxin stimulation [97]. The increased
CD14 expression was seen on the level of mRNA and soluble CD14 [93]. An
inverse association between the CD14 polymorphisms, soluble CD14, and decreased serum IgE levels was observed in some populations but not in others
[94,98]. It was proposed that environmental differences may have contributed to
the discrepant results [99]. An endotoxin switch has been proposed by Vercelli
[99] where the CD14 promoter polymorphism changes the threshold at which
environmental endotoxin stimulation leads to a Th2 immune response. According
to this hypothesis, the CD14 promoter polymorphism would not influence the
development of atopy at very low or very high concentrations (eg, in farmers)
of environmental endotoxin. However, the translation of endotoxin stimulation into an IgE-related response may be complex and may involve regulation
through timing of stimulation, molecular interaction with other immune pathways, and external signals apart from endotoxin. In a large study of different
German populations of different ages and putative microbial exposure levels
comprising more than 3000 individuals, a significant association between the
CD14 promoter polymorphism and soluble CD14 expression was found in
accordance with the functional data presented by Le Van and colleagues [97], but
no association with IgE levels or atopic phenotypes was observed [100]. Thus,
the relevance of the CD14 promoter polymorphisms may depend on the presence
694
kabesch
or absence of other unknown exposures or genetic cofactors present in different populations.

TLR2 was screened for mutations, and a promoter polymorphism was detected. This polymorphism did not influence the expression of asthma and atopy in a general population, but when a population of farming children was
investigated, it was shown that this SNP had a profound effect only in children
who were heavily exposed against microbial compounds. In these children,
carriers of the TLR2 promoter polymorphism were strongly protected against the
development of atopy and asthma [101]. Caution in the interpretation of these
results is necessary because this subgroup analysis relies on a small number of
children, and replication of the results has to be awaited. For TLR4, it has been
shown that two common co-segregating mis-sense mutations in the extracellular
domain of the receptor confer hyporesponsiveness to inhaled LPS [95]. In a
population of adults in whom exposure levels to LPS were measured, these
polymorphisms were associated with a modified response to endotoxin. In a
population-based study, high endotoxin levels measured in the house of study
subjects correlated with more asthma in individuals without TLR4 polymorphisms. Carriers of TLR4 polymorphisms showed a trend for a lower risk to
develop asthma [102].
Functional polymorphisms have been identified in the intracellular LPS
receptor family NOD1/APAF1. Recent reports have shown that three SNPs in the
CARD15 gene that impair the ability to mount a NF-kB response to LPS were
not only associated with the development of Crohn disease [92] but also with the
development of atopic diseases [96]. It is tempting to hypothesize that CARD15
polymorphisms influence the development of atopic diseases by changes in the
general capability to mount an adequate NF-kB response after bacterial challenges. It has also been shown that CARD15 enhances apoptosis through
caspase-9 [103]. The shared genetic background between atopy and Crohn disease supports the notion that it is a malfunctioned recognition of microbial exposures that contributes to an excessive response of both types of immune
responses. The prevalence of atopic and autoimmune diseases such as Crohn
disease has increased concomitantly over the last decades in Western societies
[104]. This may challenge the paradigm of a dichotomy opposing allergic illnesses as the prototype of a Th2-like immune response to autoimmune disorders
as antagonistic Th1-driven diseases.
It may be speculated that the impairment of recognition of microbial compounds due to polymorphisms reduces the general capability of the innate immunity to interact with bacterial matter early in life and to develop a robust
regulatory T-cell reservoir [105]. Repeated early stimulation of the regulatory
T-cell system and innate immunity feedback loops may suppress unwanted and
exaggerated responses against pathogens. If such early stimulation is absent or if
this interaction is impaired by genetic predisposition, autoimmune and atopic
diseases may emerge [105], and the protective effect against the development of
atopic diseases that is conferred by early contact with microbial matter may be
diminished [106].
695
Although previous studies have focused on the assessment of environmental

exposure effects or genetic changes within innate immunity genes, future studies
have to address interactions between genes and the environment. First results
from genetic studies in farming and nonfarming populations indicate that genetic
variations in innate immunity genes, such as CD14 or TLR2, may have different
effects depending on environmental conditions: Polymorphisms that lower the
potential to mount a strong immune responses when encountering pathogens may
be advantageous in a setting of high bacterial exposure by avoiding a continuing
excessive activation of the immune system. However, in a setting of low levels of
microbial exposure, carriers of the same polymorphisms may not be able to react
adequately to microbial challenges, and a predominant Th2 like immune reaction results.
Glutathione S transferases and the environment: susceptibility genes for air

pollution?
Air pollution influences the clinical expression of asthma. Numerous studies
have reported an association between environmental tobacco smoke (ETS) exposure and respiratory diseases. Maternal smoking during pregnancy and early
childhood is associated with impaired lung growth and diminished lung function
[107], and in asthmatic children parental smoking increases symptoms and
frequency of asthma attacks [108]. The metabolism and detoxification of tobacco
smoke components are essential mechanisms to minimize the toxic effects of
ETS. In humans, glutathione S transferases (GSTs) are involved in a broad range
of these detoxification processes [109]. GSTs facilitate responses to oxidative
stress reactions, are involved in major detoxification pathways of polycyclic
aromatic hydrocarbons, and detoxify benzo [a]pyrene, a carcinogen found in
tobacco smoke [109,110]. It is likely that genetic alterations of GST enzymes
change the ability of the airways to deal with toxic substances found in ETS and
in other sources of air pollution, thereby influencing airway inflammation and
lung development. Therefore, GST genes have been suggested as candidate genes
for asthma [111].
Genetic studies of the GST system have focused on the genes GSTM1
(chromosome 1p13.3) and GSTT1 (22q11.2), which code for the enzymes GSTm
and GSTq, respectively [111114]. Whole-gene deletions of GSTM1 and GSTT1
resulting in a complete loss of function of the certain members of the GST
enzyme family affect 20% to 50% of the Caucasian population (GSTM1 and
GSTT1). A number of studies on the effects of genetic alterations in GSTM1
and GSTT1 have reported associations between these genes and asthma, BHR,
and lung development [113,115,116]. The loss of these genes seems to lead to
clinical manifestations of respiratory diseases when children are also exposed to
air pollution. This may be caused by maternal, in utero, or household tobacco
smoke or by air pollution at high levels (eg, levels found in major urban centers
such as Mexico City) [117]. A significant interaction between the genetically
696
kabesch
determined absence of GST enzymes and environmental pollution could be

described [116]. Furthermore, a potential biologic explanation for the effects
of GST deficiency on the development of atopic immune reactions has been
presented in functional studies [118]: The deficiency of GSTM1 may increase the
allergic reaction against diesel exhaust particles in the presence of allergens, as
shown in nasal mucosa. It remains to be seen whether this effect is present in the
lung and if this is the biologic explanation for the increase of asthma and asthma
symptoms in the absence of GSTM1 and the concomitant presence of other air
pollutants, including ETS. These functional results point out that some genetic
alterations may have profound immunologic effects in certain conditions of environmental exposure. Therefore, it becomes more and more important to see
genetic studies in the light of environmental effects. Combined analysis may be
necessary to evaluate the true effects of genetic alterations in real-life situations.
A more in-depth look into this issue is given in the article by Martinez elsewhere
in this issue.
Gene-by-gene interaction: does it exist?

Asthma is a complex multifactorial disease of polygenic nature. The question
arises whether different genetic alterations in various asthma candidate genes
interact with each other. This interaction, which is called epistasis, is likely to
occur because many steps in immunologic pathways interacting with each other
may be necessary before the clinical manifestation of an atopic disease becomes
present. The immune system is a delicate and finely tuned machinery that works
with feedback loops, parallel pathways to back up important functions, and some
bottle necks that may be decisive for the survival and evolution of an organism.
There may be different steps necessary to activate an immune pathway, and one
genetic alteration in a single pathway may not be sufficient to influence or change
the direction of an immune reaction sufficiently. Thus, genetic alterations in one
gene may not influence only one aspect of the immune response but may alter
different pathways. Furthermore, different steps of genetic alterations may be
necessary to reach a certain threshold that leads to the manifestation of a specific
immune reaction, inflammation, and a clinically relevant manifestation of a
disease. It becomes more and more apparent that this is happening in asthma
genetics where different patho-mechanisms may lead to the disease based not
only on the alteration of one aspect of immunology but also by mechanisms
affecting a whole system. Pathway genetics may be the key in understanding
the true nature of genetic influences on the development and natural history
of asthma.
Although this insight has been growing over the last years, few studies have
addressed this issue. For some genes and gene families, some steps toward a
pathway genetics analysis have been taken. The most prominent pathway that has
been thoroughly investigated is the IL-4/IL-13 signaling cascade.
697
Genes of the IL-4/IL-13 signaling pathway

The switching of immunoglobulin production from immunoglobulin class M
to E in activated B lymphocytes, which is largely influenced by the activation of
the IL-4/IL-13 cytokine pathway, is a key biologic feature of atopic diseases and
asthma [119]. IL-4 and IL-13 signal through a common pathway [120]. On the
surface of T cells, binding of IL-4 and IL-13 is facilitated through a heterodimeric
receptor composed of the IL-4 receptor chain a (IL-4Ra) and the common
g chain (for binding IL-4 and IL-13) or the IL-13Ra chain (for exclusive IL-13
binding). Activated through the binding of the ligand, intracellular signaling is
initiated through the Janus tyrosine kinase mediated phosphorylation of STAT6.
Once phosphorylated, STAT6 molecules form homodimers, which penetrate the
nucleus and activate the transcription of target genes, inducing IgE switching
(Fig. 6). In addition to IgE switching, IL-4 and IL-13 are involved in a number of
immunoregulatory and proinflammatory activations inducing, enhancing, and
controlling features of atopic inflammation and asthma [121].
Genetic alterations have been identified in all four major genes of the IL-4/
IL-13 signaling pathway (IL-4, IL-13, IL-4Ra, and STAT6) [122128]. For all
of these genes, studies have been performed showing effects of single polymorphisms or SNP-haplotypes in these genes on asthma, IgE regulation, and
atopy. For all these genes, it may be suspected that at least one SNP in each gene
alters the function of the respective gene. For IL-4, the SNP C-589T, located in
the proximal promoter region of the IL-4 gene, was shown to alter the binding of
a transcription factor in the presence of the polymorphic base T [129]. In the light
Fig. 6. Schematic depiction of the IL-4/IL-13 pathway. Activation of receptors containing IL-4Ra by
IL-4 or IL-13 lead to the phosphorylation (by Janus kinases) and transduction of STAT6 into the
nucleus, inducing target genes and the production of IgE.
698
kabesch
of previously published association studies, it can be speculated that this SNP

may lead to an overexpression of the IL-4 gene and thus increase the strength
of any IL-4dependent immunologic reaction. However, at least two other SNPs
in the IL-4 gene have been shown to be in close linkage disequilibrium with
C-589T, and it cannot be determined which of these polymorphisms is causally
related to the observed association.
In the IL-4Ra gene, SNP A148G alters an amino acid in the extra cellular part
of the receptor (I50V), which leads to an increased downstream activation of
STAT6 and increased IgE production in B cells [130]. Different studies have
assessed the effect of this polymorphism on atopic diseases. The associations
between IL-4Ra polymorphisms and asthma and IgE levels were minor [124].
In IL-13, the existence of polymorphisms may be of functional relevance.
One polymorphism alters an amino acid in the last part of the protein known to
be involved with receptor binding. Two other polymorphisms in the promoter
may also be of importance and have shown association with asthma and IgE
regulation in different populations. First results from gene expression studies and
transcription factor binding analysis by electrophoretic mobility shift assay
strongly support a functional role for one of these promoter polymorphisms,
C-1112T, located within the extended matrix of a STAT binding site in the IL-13
promoter. These polymorphisms may alter IL-13 gene expression [131]. Based on
these data, it can be speculated that this site may be involved in a STAT6
dependent regulatory loop in the signaling pathway.
STAT6, the intracellular transcription factor that transfers the effects of the
activation of the IL-4/IL-13 pathway to target genes, may not be involved only in
the regulation of its own pathway. It is a key regulatory element of the Th2
immune response activating a number of Th2-specific gene promoters. Studies
have consistently shown that the SNP C2892T in the second intron of the STAT6
gene is associated with elevated serum IgE levels [124,132,133]. The SNP
disrupts an NF-kB site that may have regulatory effects on the STAT6 gene
because it is located in a putative enhancer region.
Thus, a number of functional relevant gene alterations may exist in the
IL-4/IL-13 signaling pathway. Due to their close relationship with each other in
one functional pathway, it seems reasonable and relatively easy to study geneby-gene interactions in this system.
How to assess gene-by-gene interactions

In population genetic studies, interaction between genes may be assessed
using multiple regression models. This approach may be limited to small numbers of genes. With every new gene added in the analysis, the need for extensively large population samples increases. In a number of studies, gene-by-gene
interactions have been assessed using subgroup analyses. Subgroups of carriers of a specific combination of polymorphisms have been compared with
individuals with no genetic alteration in any of the investigated genes or to
699
individuals who did not have all polymorphisms of interest. These studies did not
assess interactions; rather, they assessed the combined effect of genetic alterations
in subgroups. For the evaluation of interaction, specific procedures have been
proposed in which the statistical significance of the interaction and not that of
polymorphisms on the disease are tested. This gene-by-gene interaction was
termed epistasis by William Bateson in 1909 and originally described the
distortion from Mendelian segregation ratios. These effects may be additive or
multiplicative. According to classical statistic guidelines, statistical significance
of interactions is reached only if the observed effect exceeds the expected
multiplicative effects. This stringent definition of statistical interaction is debated.
Some statisticians argue that additive and multiplicative effects may be different
aspects of interactions. According to this interpretation, additive interaction may
be observed if two terms act independently from each other while influencing
the same target-outcome by independent means. In contrast, multiplicative effects
may be observed if two genes interact directly with each other (eg, influencing
the same pathway or when a polymorphism in a ligand and a receptor influence
the signal transduction). However, statistical interaction does not prove biologic
interaction, and vice versa. Biologic interaction may not be detectable statistically
due to overlapping effects with other factors not controlled for, and, even though
biologically two genes may not interact, they may affect distinct but distant
pathways of the same system. In simpler organisms, such as yeast [134], these
interactions have been studied in a network of more than 800 genes. As discussed
by Moore [135], these first steps of network genetics in simple organisms may
soon lead to system genetics even in higher organisms. It may be a long time
before these extensive systems of gene-by-gene interactions are available for
studies in humans.
Cordell and colleagues [136138] proposed a methodology to study epistasis
in population genetics, assessing the deviation from the expected interaction
effects. This approach is based on a stepwise logistic regression procedure, and,
rather than using full haplotype effects, these procedures use tests with few
degrees of freedom to detect relevant determinants. These tests are powerful tools
for studying epistasis in family-based and cross-sectional case control settings.
The evidence for gene-by-gene interactions

Is there some evidence for gene-by-gene interaction in asthma genetics?
Due to the complex nature of the disease, we expect the answer is yes. The
question remains whether it has been studied and shown adequately. A number of
approaches in population genetics have been made to address this issue, and most
of them have focused on the IL-4/IL-13 signaling pathway. The first published
approach to studying gene-by-gene interaction in asthma genetics comes
from Howard and colleagues [139], who studied the effect of two genes in the
IL-4/IL-13 pathway concomitantly. IL-13 and IL-4Ra polymorphisms were
assessed in a longitudinal population of Dutch adults who had asthma. Polymor-
700
kabesch
phisms in both genes per se showed statistical significant associations with

elevated serum IgE levels in this population of asthmatics. When carriers of a
promoter polymorphism in the IL-13 gene (C-1112T) and an amino acid substitution the IL-4Ra gene (Pro478Ser) were compared with individuals who had
wild-type alleles in both locations, the association with serum IgE levels increased fivefold, using a logistic regression model to test for gene-by-gene interaction. Based on the published data, the combined effect exceeded the expected
multiplicative effect of the single gene associations, but this interaction did not
reach statistical significance in terms of deviation from the expected multiplicative effect. However, because the sample size was small for an interaction
analysis, the observed strength of the interaction may suggest interaction. From a
biologic point of view, an association is likely because both tested polymorphisms may interact in modulating the function of the IL-4/IL-13 pathway.
In a recent study, a Korean group investigated potential gene-by-gene
interaction effects in the IL-4/IL-13 signaling pathway [140]. In this study, a
promoter polymorphism in the IL-4 gene (C-589T) was assessed in combination
with the IL-4Ra polymorphism Arg551Glu in a population of 256 asthmatics and
100 healthy control subjects. The effect of IL-4Ra polymorphisms Ile50Val and
Pro478Ser were also studied but did not reach statistical significance. In contrast,
carriers of the Arg allele at position 551 showed an increased risk for asthma
(odds ratio [OR] 1.97, 95% confidence interval [CI] 1.073.71). Combinations
of the IL-4 589 T allele and the IL-4Ra Arg allele increased the risk for
development of asthma (OR 3.70, 95% CI 1.0712.78, P=.038). The significance
of the gene-by-gene interaction was not assessed in this study, but a subgroup
comparison was performed. Due to missing information on raw data in this study,
the significance of the interaction cannot be determined. The population size
was small for studying gene-by-gene interactions, and replications of these results
are needed.
This study extends the initial findings by Howard and colleagues [139] in the
sense that a second combination of genes seems to interact in the IL-4/IL-13
pathway. From a biologic perspective, the interactions between IL-4 and the
IL-4Ra receptor are suggestive: IL-4 promoter polymorphism 589 is associated
with an alternative binding of transcription factors and may be associated with
differential expression of the gene [141]. IL4-Ra polymorphism may influence
signal transduction once IL-4 binds to it [142]. If the level of IL-4 is elevated by
promoter polymorphism effects and signal transduction is amplified by an IL4Ra polymorphism, this could result in an increased activation of the complete
IL-4/IL-13 pathway, thus upregulating the systemic allergic immune reaction,
making the development of asthma in these individuals more likely.
Other researchers failed to replicate interactions between polymorphisms in
the IL-4/IL-13 pathway. Liu and colleagues [143,144] investigated a number of
polymorphisms in the pathway in a longitudinal study of allergy in Germany
(a multicenter atopy study) where almost 1000 children were followed from birth.
In this setting, the effects of genetic variation in the IL-4/IL-13 pathway on
specific and total serum IgE levels were analyzed. Although the authors could
701
confirm a role of IL-13 polymorphisms in the regulation of total and specific

serum IgE, other SNPs in IL-4 and the IL-4Ra gene were significantly associated
only with the development of certain specific IgE responses in these study
populations. The authors state that they did not find any significant interactions
between polymorphisms in the three genes they investigated in this pathway.
Recently, the genetic analysis of the IL-4/IL-13 signaling pathway has been
extended to include STAT6, a final step in the intracellular mechanisms by which
IL-4 and IL-13 exert their biologic effects, such as in IgE switching. Duetsch
and colleagues [124] screened the gene for polymorphisms, and associations
with IgE regulation and the development of eosinophilia were observed, although
no association with asthma was initially reported. Two other studies in large
population samples were in agreement that a specific polymorphism in the
STAT6 gene is associated with elevated total serum IgE levels [133], and
Schedel and colleagues [132] reported an association with asthma in childhood.
From these data, it can be concluded that STAT6 polymorphisms add
significantly to the genetic regulation of IgE and asthma susceptibility. Thus,
including STAT6 in studying epistasis in the IL-4/IL-13 pathway seems intriguing. First results indicate that gene-by-gene interaction is becoming increasingly strong with the inclusion of STAT6 polymorphisms. In a Cordell
model that includes polymorphisms in IL-4 (C-589T), IL-13 (C-1112T), IL-4Ra
(I50V), and STAT6 (C2892T), significant gene-by-gene interactions were
observed, with IgE regulation and asthma exceeding the multiplicative model
in a population of more than 1100 children. Affecting approximately 5% of
children in a general population sample, the risk for elevated serum IgE increased
to an OR of 10.8-fold, compared with the maximum individual effect of any
tested SNP and 16.8-fold for asthma (unpublished data).
Although these data suggest that epistasis occurs in the IL-4/IL-13 pathway, it
would be wrong to expect that epistasis is limited to this pathway or that genetic
variation in the IL-4/IL-13 pathway would exclusively explain asthma genetics.
The IL-4/IL-13 pathway may, when seen as an entity, contribute significantly to
the overall genetic susceptibility to develop asthma and atopy, but a large number
of other genes and pathways may be involved in this complex disease. Other
genes have been suggested to show epistasis: FCER1B 237Gly and NOS2A
D346D may interact in determining atopic phenotypes [145], and combinations
of CTLA4 and FCER1B polymorphisms may increase total serum IgE levels in
patients who have asthma [146].
Increasing evidence is emerging indicating that epistasis plays an important
role in the development of asthma. In the future, gene-by-gene and geneby-environment interactions will be essential in our understanding of the multifactorial nature of asthma genetics. However, population studies aimed at
disentangling these complex interactions may have to be large. International
collaborations are necessary to achieve these aims in the near future, and new
statistical tools must be developed to handle these enormous data sets. A number
of suggestive interactions have been reported in population genetics. It is
necessary to replicate these findings (eg, the promising interactions observed in
702
kabesch
the IL-4/IL-13 pathway). The biologic mechanisms by which candidate genes

interact with each other have to be analyzed in detail in functional studies. Much
experimental work still has to be done.
Summary
Candidate gene studies in asthma are a powerful and valuable tool in asthma
genetics. Although the quality of small-scale, freely associating studies has been
questionable, increasingly serious efforts are made to establish, replicate, and
verify association results. Association studies may help us to better understand
the mechanisms underlying asthma. They may create hypotheses and help to
direct functional studies to targets that are likely to give valuable results. However, they should not be over-interpreted; only biologic proof can verify associations between genetic variations and a certain disease outcome. The insight
that gene-by-gene and gene-by-environment interactions may be crucial for understanding and pinpoint the complex mechanisms of genetic regulation of
multifactorial diseases has gained momentum in the last years when technical
improvement allowed for the effective genotyping and analysis of great numbers
of polymorphisms in large populations. It can be expected that from this area of
research new and exciting results will follow soon.
References
[1] Bleecker ER, Postma DS, Meyers DA. Genetic susceptibility to asthma in a changing
environment. Ciba Found Symp 1997;206:90 9.
[2] Kauffmann F. Post-genome respiratory epidemiology: a multidisciplinary challenge. Eur Respir J 2004;24:471 80.
[3] Vercelli D. Genetics, epigenetics, and the environment: switching, buffering, releasing.
J Allergy Clin Immunol 2004;113:381 6 [quiz: 387].
[4] Holberg CJ, Elston RC, Halonen M, et al. Segregation analysis of physician-diagnosed asthma
in Hispanic and non-Hispanic white families: a recessive component? Am J Respir Crit Care
Med 1996;154:144 50.
[5] Martinez FD, Holberg CJ. Segregation analysis of physician-diagnosed asthma in Hispanic and
non-Hispanic white families. Clin Exp Allergy 1995;25(Suppl 2):68 70 [discussion: 956].
[6] Meyers DA, Xu J, Postma DS, et al. Two locus segregation and linkage analysis for total
serum IgE levels. Clin Exp Allergy 1995;25(Suppl 2):113 5.
[7] Townley RG, Bewtra A, Wilson AF, et al. Segregation analysis of bronchial response
to methacholine inhalation challenge in families with and without asthma. J Allergy Clin
Immunol 1986;77:101 7.
[8] Duffy DL, Martin NG, Battistutta D, et al. Genetics of asthma and hay fever in Australian
twins. Am Rev Respir Dis 1990;142:1351 8.
[9] Harris JR, Magnus P, Samuelsen SO, et al. No evidence for effects of family environment on
asthma: a retrospective study of Norwegian twins. Am J Respir Crit Care Med 1997;156:43 9.
[10] Allen M, Heinzmann A, Noguchi E, et al. Positional cloning of a novel gene influencing
asthma from chromosome 2q14. Nat Genet 2003;35:258 63.
703
[11] Melen E, Bruce S, Doekes G, et al. G-protein-coupled receptor for asthma susceptibility
(GPRA) haplotypes are associated with childhood allergy and asthma: the PARSIFAL and
BAMSE studies. Am J Respir Crit Care Med, in press.
[12] Van Eerdewegh P, Little RD, Dupuis J, et al. Association of the ADAM33 gene with asthma
and bronchial hyperresponsiveness. Nature 2002;418:426 30.
chromosome 13q14 that influences immunoglobulin E levels and asthma. Nat Genet 2003;
34:181 6.
[14] Stoughton RB. Applications of DNA microarrays in biology. Annu Rev Biochem 2005;74:
53 82.
[15] Laprise C, Sladek R, Ponton A, et al. Functional classes of bronchial mucosa genes that are
differentially expressed in asthma. BMC Genomics 2004;5:21.
[16] Zimmermann N, King NE, Laporte J, et al. Dissection of experimental asthma with
DNA microarray analysis identifies arginase in asthma pathogenesis. J Clin Invest 2003;111:
1863 74.
[17] Freely associating [editorial]. Nature 1999;22:1 2.
[18] Lohmueller KE, Pearce CL, Pike M, et al. Meta-analysis of genetic association studies supports
a contribution of common variants to susceptibility to common disease. Nat Genet 2003;33:
177 82.
[19] Hasegawa K, Tamari M, Shao C, et al. Variations in the C3, C3a receptor, and C5 genes affect
susceptibility to bronchial asthma. Hum Genet 2004;115:295 301.
[20] Barnes KC, Caraballo L, Munoz M, et al. A novel promoter polymorphism in the gene
encoding complement component 5 receptor 1 on chromosome 19q13.3 is not associated with
asthma and atopy in three independent populations. Clin Exp Allergy 2004;34:736 44.
[21] Baldini M, Lohman I, Halonen M, et al. A polymorphism in the 5V flanking region of the
CD14 gene is associated with circulating soluble CD14 levels and with total serum immunoglobulin E. Am J Respir Cell Mol Biol 1999;20:976 83.
[22] Raby BA, Klimecki WT, Laprise C, et al. Polymorphisms in toll-like receptor 4 are not
associated with asthma or atopy-related phenotypes. Am J Respir Crit Care Med 2002;166:
1449 56.
[23] Tantisira K, Klimecki WT, Lazarus R, et al. Toll-like receptor 6 gene (TLR6): single-nucleotide
polymorphism frequencies and preliminary association with the diagnosis of asthma. Genes
Immun 2004;5:343 6.
[24] Lazarus R, Klimecki WT, Raby BA, et al. Single-nucleotide polymorphisms in the Toll-like
receptor 9 gene (TLR9): frequencies, pairwise linkage disequilibrium, and haplotypes in three
US ethnic groups and exploratory case-control disease association studies. Genomics 2003;
81:85 91.
[25] Lazarus R, Raby BA, Lange C, et al. TOLL-like receptor 10 genetic variation is associated with
asthma in two independent samples. Am J Respir Crit Care Med 2004;170:594 600.
[26] Sandford AJ, Shirakawa T, Moffatt MF, et al. Localisation of atopy and beta subunit of highaffinity IgE receptor (Fc epsilon RI) on chromosome 11q [see comments]. Lancet 1993;341:
332 4.
[27] Shirakawa T, Li A, Dubowitz M, et al. Association between atopy and variants of the beta
subunit of the high-affinity immunoglobulin E receptor [see comments]. Nat Genet 1994;7:
125 9.
[29] Gao PS, Mao XQ, Kawai M, et al. Negative association between asthma and variants of
CC16(CC10) on chromosome 11q13 in British and Japanese populations. Hum Genet 1998;
103:57 9.
[30] Laing IA, Goldblatt J, Eber E, et al. A polymorphism of the CC16 gene is associated with an
increased risk of asthma. J Med Genet 1998;35:463 7.
[31] Laing IA, Hermans C, Bernard A, et al. Association between plasma CC16 levels, the A38G
polymorphism, and asthma. Am J Respir Crit Care Med 2000;161:124 7.
704
kabesch
[32] Mansur AH, Fryer AA, Hepple M, et al. An association study between the Clara cell secretory
protein CC16 A38G polymorphism and asthma phenotypes. Clin Exp Allergy 2002;32:994 9.
[33] Mao XQ, Shirakawa T, Kawai M, et al. Association between asthma and an intragenic variant
of CC16 on chromosome 11q13. Clin Genet 1998;53:54 6.
[34] Sengler C, Heinzmann A, Jerkic SP, et al. Clara cell protein 16 (CC16) gene polymorphism
influences the degree of airway responsiveness in asthmatic children. J Allergy Clin Immunol
2003;111:515 9.
[35] Hall IP, Wheatley A, Christie G, et al. Association of CCR5 delta32 with reduced risk of
asthma. Lancet 1999;354:1264 5.
[36] Helms PJ. CCR5-delta32 polymorphism in asthma. Lancet 2001;357:802.
[37] Mitchell TJ, Walley AJ, Pease JE, et al. Delta 32 deletion of CCR5 gene and association with
asthma or atopy. Lancet 2000;356:1491 2.
[38] Nagy A, Kozma GT, Bojszko A, et al. No association between asthma or allergy and the
CCR5Delta 32 mutation. Arch Dis Child 2002;86:426.
[39] Sandford AJ, Zhu S, Bai TR, et al. The role of the CC chemokine receptor-5 Delta32
polymorphism in asthma and in the production of regulated on activation, normal T cells
expressed and secreted. J Allergy Clin Immunol 2001;108:69 73.
[40] Howard TD, Postma DS, Hawkins GA, et al. Fine mapping of an IgE-controlling gene on
chromosome 2q: analysis of CTLA4 and CD28. J Allergy Clin Immunol 2002;110:743 51.
[41] Pykalainen M, Kinos R, Valkonen S, et al. Association analysis of common variants of STAT6,
GATA3, and STAT4 to asthma and high serum IgE phenotypes. J Allergy Clin Immunol
2005;115:80 7.
[42] Gohlke H, Illig T, Bahnweg M, et al. Association of the interleukin-1 receptor antagonist gene
with asthma. Am J Respir Crit Care Med 2004;169:1217 23.
[43] Lyon H, Lange C, Lake S, et al. IL10 gene polymorphisms are associated with asthma
phenotypes in children. Genet Epidemiol 2004;26:155 65.
serum IgE level and atopic dermatitis in the German multicenter atopy study (MAS-90).
[45] van der Pouw Kraan TC, van Veen A, Boeije LC, et al. An IL-13 promoter polymorphism
associated with increased risk of allergic asthma. Genes Immun 1999;1:61 5.
[46] Kurz T, Strauch K, Dietrich H, et al. Multilocus haplotype analyses reveal association between
5 novel IL-15 polymorphisms and asthma. J Allergy Clin Immunol 2004;113:896 901.
[47] Heinzmann A, Gerhold K, Ganter K, et al. Association study of polymorphisms within
interleukin-18 in juvenile idiopathic arthritis and bronchial asthma. Allergy 2004;59:845 9.
[48] Higa S, Hirano T, Mayumi M, et al. Association between interleukin-18 gene polymorphism
105A/C and asthma. Clin Exp Allergy 2003;33:1097 102.
[49] Kruse S, Kuehr J, Moseler M, et al. Polymorphisms in the IL 18 gene are associated with
specific sensitization to common allergens and allergic rhinitis. J Allergy Clin Immunol 2003;
111:117 22.
[50] Rosenwasser LJ. Genetics of atopy and asthma: promoter-based candidate gene studies for
IL-4. Int Arch Allergy Immunol 1997;113:61 4.
[51] Ober C, Leavitt SA, Tsalenko A, et al. Variation in the interleukin 4-receptor alpha gene confers
susceptibility to asthma and atopy in ethnically diverse populations. Am J Hum Genet 2000;66:
517 26.
[52] Sandford AJ, Chagani T, Zhu S, et al. Polymorphisms in the IL4, IL4RA, and FCERIB genes
and asthma severity. J Allergy Clin Immunol 2000;106:135 40.
[53] Wjst M, Kruse S, Illig T, et al. Asthma and IL-4 receptor alpha gene variants. Eur J
Immunogenet 2002;29:263 8.
[54] Nagarkatti R, Ghosh B. Identification of single-nucleotide and repeat polymorphisms in two
candidate genes, interleukin 4 receptor (IL4RA) and signal transducer and activator of
transcription protein 6 (STAT6), for Th2-mediated diseases. J Hum Genet 2002;47:684 7.
[55] Albuquerque RV, Hayden CM, Palmer LJ, et al. Association of polymorphisms within the
tumour necrosis factor (TNF) genes and childhood asthma. Clin Exp Allergy 1998;28:578 84.
705
[56] Beghe B, Padoan M, Moss CT, et al. Lack of association of HLA class I genes and TNF
alpha-308 polymorphism in toluene diisocyanate-induced asthma. Allergy 2004;59:61 4.
[57] Moffatt MF, Cookson WO. Tumour necrosis factor haplotypes and asthma. Hum Mol Genet
1997;6:551 4.
[58] Shin HD, Park BL, Kim LH, et al. Association of tumor necrosis factor polymorphisms with
asthma and serum total IgE. Hum Mol Genet 2004;13:397 403.
[59] Winchester EC, Millwood IY, Rand L, et al. Association of the TNF-alpha-308 (GYA)
polymorphism with self-reported history of childhood asthma. Hum Genet 2000;107:591 6.
[60] Zhu S, Chan-Yeung M, Becker AB, et al. Polymorphisms of the IL-4, TNF-alpha, and
Fcepsilon RIbeta genes and the risk of allergic disorders in at-risk infants. Am J Respir Crit
Care Med 2000;161:1655 9.
[61] Liggett SB. Genetics of beta 2-adrenergic receptor variants in asthma. Clin Exp Allergy
1995;25(Suppl 2):89 94 [discussion: 956].
[62] Martinez FD, Graves PE, Baldini M, et al. Association between genetic polymorphisms of
the beta2-adrenoceptor and response to albuterol in children with and without a history of
wheezing. J Clin Invest 1997;100:3184 8.
[63] Potter PC, Van Wyk L, Martin M, et al. Genetic polymorphism of the beta-2 adrenergic receptor
in atopic and non-atopic subjects. Clin Exp Allergy 1993;23:874 7.
[64] Reihsaus E, Innis M, MacIntyre N, et al. Mutations in the gene encoding for the beta
2-adrenergic receptor in normal and asthmatic subjects. Am J Respir Cell Mol Biol 1993;8:
334 9.
[65] Ali M, Khoo SK, Turner S, et al. NOS1 polymorphism is associated with atopy but not exhaled
nitric oxide levels in healthy children. Pediatr Allergy Immunol 2003;14:261 5.
[66] Grasemann H, Yandava CN, Storm vans Gravesande K, et al. A neuronal NO synthase
(NOS1) gene polymorphism is associated with asthma. Biochem Biophys Res Commun 2000;
272:391 4.
[67] Holla LI, Buckova D, Kuhrova V, et al. Prevalence of endothelial nitric oxide synthase gene
polymorphisms in patients with atopic asthma. Clin Exp Allergy 2002;32:1193 8.
[68] vans Gravesande KS, Wechsler ME, Grasemann H, et al. Association of a missense mutation in
the NOS3 gene with exhaled nitric oxide levels. Am J Respir Crit Care Med 2003;168:228 31.
[69] Kabesch M, Carr D, Weiland SK, et al. Association between polymorphisms in serine protease
inhibitor, kazal type 5 and asthma phenotypes in a large German population sample. Clin Exp
Allergy 2004;34:340 5.
[70] Walley AJ, Chavanas S, Moffatt MF, et al. Gene polymorphism in Netherton and common
atopic disease. Nat Genet 2001;29:175 8.
[71] Buckova D, Izakovicova Holla L, Benes P, et al. TGF-beta1 gene polymorphisms. Allergy
2001;56:1236 7.
[72] Silverman ES, Palmer LJ, Subramaniam V, et al. Transforming growth factor-beta1 promoter
polymorphism C-509T is associated with asthma. Am J Respir Crit Care Med 2004;169:214 9.
[73] Poon AH, Laprise C, Lemire M, et al. Association of vitamin D receptor genetic variants with
susceptibility to asthma and atopy. Am J Respir Crit Care Med 2004;170:967 73.
[74] Raby BA, Lazarus R, Silverman EK, et al. Association of vitamin D receptor gene polymorphisms with childhood and adult asthma. Am J Respir Crit Care Med 2004;170:1057 65.
[75] Gilliland FD, Harms HJ, Crowell RE, et al. Glutathione S-transferase P1 and NADPH quinone oxidoreductase polymorphisms are associated with aberrant promoter methylation of
P16(INK4a) and O(6)-methylguanine-DNA methyltransferase in sputum. Cancer Res 2002;62:
2248 52.
[76] Fryer AA, Bianco A, Hepple M, et al. Polymorphism at the glutathione S-transferase GSTP1
locus: a new marker for bronchial hyperresponsiveness and asthma. Am J Respir Crit Care Med
2000;161:1437 42.
[77] Howard TD, Postma DS, Jongepier H, et al. Association of a disintegrin and metalloprotease 33
(ADAM33) gene with asthma in ethnically diverse populations. J Allergy Clin Immunol 2003;
112:717 22.
706
kabesch
[78] Jongepier H, Boezen HM, Dijkstra A, et al. Polymorphisms of the ADAM33 gene are
associated with accelerated lung function decline in asthma. Clin Exp Allergy 2004;34:757 60.
[79] Lind DL, Choudhry S, Ung N, et al. ADAM33 is not associated with asthma in Puerto Rican
or Mexican populations. Am J Respir Crit Care Med 2003;168:1312 6.
[80] Raby BA, Silverman EK, Kwiatkowski DJ, et al. ADAM33 polymorphisms and phenotype
associations in childhood asthma. J Allergy Clin Immunol 2004;113:1071 8.
[81] Werner M, Herbon N, Gohlke H, et al. Asthma is associated with single-nucleotide polymorphisms in ADAM33. Clin Exp Allergy 2004;34:26 31.
[82] Braun-Fahrlander C, Riedler J, Herz U, et al. Environmental exposure to endotoxin and its
relation to asthma in school-age children. N Engl J Med 2002;347:869 77.
[83] Hoffmann JA, Reichhart J-M. Drosophila innate immunity: an evolutionary perspective. Nat
Immunol 2002;3:121 6.
[84] Janeway CJ, Medzhitov R. Innate immune recognition. Annu Rev Immunol 2002;20:197 216.
[85] Pugin J, Heumann D, Tomasz A, et al. CD14 is a pattern recognition receptor. Immunity 1994;
1:509 16.
[86] Lien E, Sellati T, Yoshimura A, et al. Toll-like receptor 2 functions as a pattern recognition
receptor for diverse bacterial products. J Biol Chem 1999;274:33419 25.
[87] Medzhitov R, Janeway CJ. Decoding the patterns of self and non-self by the innate immune
system. Science 2002;296:298 300.
[88] Fearon DT, Locksley RM. The instructive role of innate immunity in the acquired immune
response. Science 1996;272:50 3.
[89] Janeway CJ. Approaching the asymptote? Evolution and revolution in immunology. Cold
Spring Harb Symp Quant Biol 1989;54:1 13.
[90] Akira S, Takeda K, Kaisho T. Toll-like receptors: critical proteins linking innate and acquired
immunity. Nat Immunol 2001;2:675 80.
[91] Medzhitov R, Janeway CJ. Innate immunity: impact on the adaptive immune response. Curr
Opin Immunol 1997;9:4 9.
[92] Ogura Y, Bonen DK, Inohara N, et al. A frameshift mutation in NOD2 associated with
susceptibility to Crohns disease. Nature 2001;411:603 6.
[93] Baldini M, Lohman IC, Halonen M, et al. A polymorphism in the 5V flanking region of the
CD14 gene is associated with circulating soluble CD14 levels and with total serum immunoglobulin E. Am J Respir Cell Mol Biol 1999;20:976 83.
[94] Koppelman GH, Reijmerink NE, Colin Stine O, et al. Association of a promoter polymorphism
of the CD14 gene and atopy. Am J Respir Crit Care Med 2001;163:965 9.
[95] Arbour NC, Lorenz E, Schutte BC, et al. TLR4 mutations are associated with endotoxin
hyporesponsiveness in humans. Nat Genet 2000;25:187 91.
[96] Kabesch M, Peters W, Carr D, et al. Association between polymorphisms in caspase recruitment domain containing protein 15 and allergy in two German populations. J Allergy Clin
Immunol 2003;111:813 7.
[97] LeVan TD, Bloom JW, Bailey TJ, et al. A common single nucleotide polymorphism in the
CD14 promoter decreases the affinity of Sp protein binding and enhances transcriptional
activity. J Immunol 2001;167:5838 44.
[98] Sengler C, Haider A, Sommerfeld C, et al. Evaluation of the CD14 C-159 T polymorphism in
the German Multicenter Allergy Study cohort. Clin Exp Allergy 2003;33:166 9.
[99] Vercelli D. Learning from discrepancies: CD14 polymorphisms, atopy and the endotoxin
switch. Clin Exp Allergy 2003;33:153 5.
[100] Kabesch M, Hasemann K, Schickinger V, et al. A promoter polymorphism in the CD14 gene
is associated with elevated levels of soluble CD14 but not with IgE or atopic diseases.
Allergy 2004;59:520 5.
[101] Eder W, Klimecki W, Yu L, et al. Toll-like receptor 2 as a major gene for asthma in children
of European farmers. J Allergy Clin Immunol 2004;113:482 8.
[102] Werner M, Topp R, Wimmer K, et al. TLR4 gene variants modify endotoxin effects on asthma.
707
[103] Ogura Y, Inohara N, Benito A, et al. Nod2, a Nod1/Apaf-1 family member that is restricted to
monocytes and activates NF-kappaB. J Biol Chem 2001;276:4812 8.
[104] Simpson CR, Anderson WJ, Helms PJ, et al. Coincidence of immune-mediated diseases
driven by Th1 and Th2 subsets suggests a common aetiology: a population-based study using
computerized general practice data. Clin Exp Allergy 2002;32:37 42.
[105] Gale EA. A missing link in the hygiene hypothesis? Diabetologia 2002;45:588 94.
[106] Riedler J, Braun-Fahrlander C, Eder W, et al. Exposure to farming in early life and development
of asthma and allergy: a cross-sectional survey. Lancet 2001;358:1129 33.
[107] Cook DG, Strachan DP, Carey IM. Health effects of passive smoking. 9: parental smoking
and spirometric indices in children. Thorax 1998;53:884 93.
[108] Cook DG, Strachan DP. Health effects of passive smoking. 3: parental smoking and prevalence
of respiratory symptoms and asthma in school age children. Thorax 1997;52:1081 94.
[109] Sheehan D, Meade G, Foley VM, et al. Structure, function and evolution of glutathione
transferases: implications for classification of non-mammalian members of an ancient enzyme
superfamily. Biochem J 2001;360:1 16.
[110] Alexandrov K, Cascorbi I, Rojas M, et al. CYP1A1 and GSTM1 genotypes affect benzo[a]
pyrene DNA adducts in smokers lung: comparison with aromatic/hydrophobic adduct formation. Carcinogenesis 2002;23:1969 77.
[111] Ivaschenko TE, Sideleva OG, Baranov VS. Glutathione-S-transferase micro and theta gene
polymorphisms as new risk factors of atopic bronchial asthma. J Mol Med 2002;80:39 43.
[112] Gilliland FD, Gauderman WJ, Vora H, et al. Effects of glutathione-S-transferase M1, T1, and
P1 on childhood lung function growth. Am J Respir Crit Care Med 2002;166:710 6.
[113] Gilliland FD, Li YF, Dubeau L, et al. Effects of glutathione S-transferase M1, maternal smoking during pregnancy, and environmental tobacco smoke on asthma and wheezing in children.
Am J Respir Crit Care Med 2002;166:457 63.
[114] Menegon A, Board PG, Blackburn AC, et al. Parkinsons disease, pesticides, and glutathione
transferase polymorphisms. Lancet 1998;352:1344 6.
[115] Brasch-Andersen C, Christiansen L, Tan Q, et al. Possible gene dosage effect of glutathioneS-transferases on atopic asthma: using real-time PCR for quantification of GSTM1 and GSTT1
gene copy numbers. Hum Mutat 2004;24:208 14.
[116] Kabesch M, Hoefler C, Carr D, et al. Glutathione S transferase deficiency and passive smoking increase childhood asthma. Thorax 2004;59:569 73.
[117] David GL, Romieu I, Sienra-Monge JJ, et al. Nicotinamide adenine dinucleotide (phosphate)
reduced:quinone oxidoreductase and glutathione S-transferase M1 polymorphisms and childhood asthma. Am J Respir Crit Care Med 2003;168:1199 204.
[118] Gilliland FD, Li YF, Saxon A, et al. Effect of glutathione-S-transferase M1 and P1 genotypes
on xenobiotic enhancement of allergic responses: randomised, placebo-controlled crossover
study. Lancet 2004;363:119 25.
[119] Holt PG. Parasites, atopy, and the hygiene hypothesis: resolution of a paradox? Lancet 2000;
356:1699 701.
[120] Kelly-Welch AE, Hanson EM, Boothby MR, et al. Interleukin-4 and interleukin-13 signaling
connections maps. Science 2003;300:1527 8.
[121] Corry DB, Kheradmand F. Induction and regulation of the IgE response. Nature 1999;402:
B18 23.
[122] Basehore MJ, Howard TD, Lange LA, et al. A comprehensive evaluation of IL4 variants in
ethnically diverse populations: association of total serum IgE levels and asthma in white
subjects. J Allergy Clin Immunol 2004;114:80 7.
[123] Deichmann K, Bardutzky J, Forster J, et al. Common polymorphisms in the coding part of
the IL4-receptor gene. Biochem Biophys Res Commun 1997;231:696 7.
[124] Duetsch G, Illig T, Loesgen S, et al. STAT6 as an asthma candidate gene: polymorphismscreening, association and haplotype analysis in a Caucasian sib-pair study. Hum Mol Genet
2002;11:613 21.
[125] Graves PE, Kabesch M, Halonen M, et al. A cluster of seven tightly linked polymorphisms
708
[126]
[127]
[128]
[129]
[130]
[131]
[132]
[133]
[134]
[135]
[136]
[137]
[138]
[139]
[140]
[141]
[142]
[143]
[144]
[145]
[146]
kabesch
in the IL-13 gene is associated with total serum IgE levels in three populations of white
children. J Allergy Clin Immunol 2000;105:506 13.
Heinzmann A, Mao XQ, Akaiwa M, et al. Genetic variants of IL-13 signalling and human
asthma and atopy. Hum Mol Genet 2000;9:549 59.
Kabesch M, Tzotcheva I, Carr D, et al. A complete screening of the IL4 gene: novel polymorphisms and their association with asthma and IgE in childhood. J Allergy Clin Immunol
2003;112:893 8.
Rosenwasser LJ. Promoter polymorphism in the candidate genes, IL-4, IL-9, TGF-beta1, for
atopy and asthma. Int Arch Allergy Immunol 1999;118:268 70.
Rosenwasser LJ, Borish L. Promoter polymorphisms predisposing to the development of
asthma and atopy. Clin Exp Allergy 1998;28(Suppl):13 5 [discussion 168].
Mitsuyasu H, Yanagihara Y, Mao XQ, et al. Cutting edge: dominant effect of Ile50Val variant
of the human IL-4 receptor alpha-chain in IgE synthesis. J Immunol 1999;162:1227 31.
Vercelli D. Genetics of IL-13 and functional relevance of IL-13 variants. Curr Opin Allergy
Clin Immunol 2002;2:389 93.
Schedel M, Carr D, Klopp N, et al. A signal transducer and activator of transcription 6 haplotype influences the regulation of serum IgE levels. J Allergy Clin Immunol 2004;114:1100 5.
Weidinger S, Klopp N, Wagenpfeil S, et al. Association of a STAT 6 haplotype with elevated
serum IgE levels in a population based cohort of white adults. J Med Genet 2004;41:658 63.
Segre D, Deluna A, Church GM, et al. Modular epistasis in yeast metabolism. Nat Genet
2005;37:77 83.
Moore JH. A global view of epistasis. Nat Genet 2005;37:13 4.
Cordell HJ. Epistasis: what it means, what it doesnt mean, and statistical methods to detect it
in humans. Hum Mol Genet 2002;11:2463 8.
Cordell HJ, Clayton DG. A unified stepwise regression procedure for evaluating the relative
effects of polymorphisms within a gene using case/control or family data: application to HLA
in type 1 diabetes. Am J Hum Genet 2002;70:124 41.
Cordell HJ, Todd JA, Hill NJ, et al. Statistical modeling of interlocus interactions in a complex disease: rejection of the multiplicative model of epistasis in type 1 diabetes. Genetics
2001;158:357 67.
Howard TD, Koppelman GH, Xu J, et al. Gene-gene interaction in asthma: IL4RA and IL13 in
a Dutch population with asthma. Am J Hum Genet 2002;70:230 6.
Lee SG, Kim BS, Kim JH, et al. Gene-gene interaction between interleukin-4 and interleukin-4
receptor alpha in Korean children with asthma. Clin Exp Allergy 2004;34:1202 8.
Rosenwasser LJ, Borish L. Genetics of atopy and asthma: the rationale behind promoterbased candidate gene studies (IL-4 and IL-10). Am J Respir Crit Care Med 1997;156(Suppl):
S152 5.
Kruse S, Japha T, Tedner M, et al. The polymorphisms S503P and Q576R in the interleukin-4
receptor alpha gene are associated with atopy and influence the signal transduction.
Immunology 1999;96:365 71.
Liu X, Beaty TH, Deindl P, et al. Associations between specific serum IgE response and
6 variants within the genes IL4, IL13, and IL4RA in German children: the German Multicenter
Atopy Study. J Allergy Clin Immunol 2004;113:489 95.
Liu X, Beaty TH, Deindl P, et al. Associations between total serum IgE levels and the
6 potentially functional variants within the genes IL4, IL13, and IL4RA in German children:
the German Multicenter Atopy Study. J Allergy Clin Immunol 2003;112:382 8.
Hoffjan S, Ostrovnaja I, Nicolae D, et al. Genetic variation in immunoregulatory pathways
and atopic phenotypes in infancy. J Allergy Clin Immunol 2004;113:511 8.
Hizawa N, Yamaguchi E, Jinushi E, et al. Increased total serum IgE levels in patients with
108:74 9.

25 (2005) 709 721
GeneEnvironment Interactions in Asthma and

Allergies: A New Paradigm to Understand
Disease Causation
Fernando D. Martinez, MD
Arizona Respiratory Center, College of Medicine, The University of Arizona,
1501 N. Campbell Avenue, 2349, Tucson, AZ 85724-5030, USA
Twin studies have suggested that asthma and allergies are the result of a
combination of the effects of environmental factors and genetic influences [1].
Until recently, the role of these two potential sources of susceptibility in these
conditions was studied separately, or at most, the potential interaction between
genes and environment was evaluated by stratifying the effect of exposures by
family history [2]. The Human Genome Project has made it possible to assess the
potential role of geneenvironment interactions as determinants of asthma and
allergies in a systematic way. Moreover, and contrary to what was the case during
most of the twentieth century, the real limiting step today is the difficulty to
comprehensibly assess the degree and timing of environmental exposures.
This article summarizes the theoretical basis on which to insert any studies
of geneenvironment interactions. It also outlines a specific example of such
interactions, as represented by the role of genetic variations in the CD14 gene in
relation to exposure to one of the ligands of CD14namely endotoxin.
The concept of interaction

Interactions between risk factors or causes are not always conceptually easy to
grasp. Because in everyday parlance an interaction is often understood as two
elements that contribute to the determination of a certain outcome, even when
The author was funded by grants HL 67672, 66447, and 56177 from the National Heart, Lung,
and Blood Institute.
E-mail address: Fernando@arc.arizona.edu
doi:10.1016/j.iac.2005.09.001
710
martinez
acting independently from each other, many authors who comment about gene
environment interactions tend to use the term with this same additive meaning.
This is not, however, the meaning with which the word interaction is used in
this article.
Perhaps an easy way to understand the concept is to express it graphically.
In 1909, Wolterek proposed the term norm of reaction to represent graphically
the different expressions that a certain phenotype could acquire in different
environments and in individuals who have different genotypes [3]. In one
possible scenario, only additive effects of genetic and environmental influences
are present with no real interaction between them. In this case, phenotypic
variation (Vp) is simply the addition of the influence of the genetic variation and
that of the environmental variation (Vg and Ve, respectively): Vp = Vg + Ve.
In this situation (Fig. 1), the influence of the environmental factor on the
phenotype is the same for all genotypes and, similarly, the influence of the
genotypes on the phenotype is always the same, regardless of the level of environmental exposure. No interactive effect is necessary to explain this particular
phenotype. One important consequence of the situation represented in Fig. 1 is
that measured heritability will be approximately the same in all environments.
Therefore, if the environmental influences represented in Fig. 1 are considered
generically as the final result of several different exposures, the genetics of this
phenotype can be studied in different environmental contexts without the need
for specifically assessing the exposures in those contexts. Well-designed and
well-performed genetics studies should provide replicable results, provided that
the frequencies of the different genotypes under study are similar in the different
populations, and that, if they are not, genegene interactions are not crucial
determinants of the phenotype.
It is also possible, however, that the extent of the influence of the genotypes on
the phenotypes may be different in different environments. In the same context, it
is possible that the influence of environmental exposures may be different for
Genotype A
Genotype B
Trait
Values
Genotype C
Vp = Vg + Ve
Environment exposure
Fig. 1. A norm of reaction, in which the association between a phenotype ( y axis) and an
environmental exposure (x axis) is plotted for different genotypes. In this example, there is no gene
environment interaction, and therefore the curves for the three genotypes are parallel to each other.
711
geneenvironment interactions
Trait
Values
Vp = Vg + Ve + Vge
Environment
Fig. 2. Norm of reaction for a case in which geneenvironment interaction is present. Genotype A (top),
genotype B (middle), and genotype C (bottom). Vge, variation explained by geneenvironment interaction.
different genotypes. Fig. 2 presents one potential situation of this type, where it
can be clearly seen that the influence of the genotype on the phenotype is much
higher at high levels of exposure (right side of the graph) than at lower levels
of exposure (left side of the graph). In this context, paradoxically, the degree
of heritability of this phenotype is strongly determined by the environmental
exposure (Fig. 3). Researchers who are studying the influence of this genotype in
areas of high exposure are much more likely to find an association between
genotype and phenotype than researchers who are studying the same phenotype
in relation to the same genotype but at lower levels of exposure. Replication of
genetic studies in this context is not a given. In this example, power to find an
association at high levels of exposure is much higher than at low levels; therefore, it would be possible that a genotype that has a significant influence on the
phenotype may be found, or not found, to significantly determine the phenotype in different studies because the power will change with the degree of the
Very high
heritability
Very low
heritability
Trait
Values
Environment
Fig. 3. Measured heritability is paradoxically dependent on environmental exposure when a gene
environment interaction exists. For this reason, power to detect association between a phenotype and a
particular genetic polymorphism may depend on the degree of exposure to an environmental factor
that interacts with that polymorphism in the population under study.
712
martinez
exposure. The case presented in Fig. 2 is only an example. It could also be

possible that, for other geneenvironment interactions, the power to detect a
genetic association could be higher at lower doses of exposure.
Fig. 2 also illustrates that the influence of an environmental exposure
may depend on the genetic characteristics of the population. If a large proportion
of the subjects under study, for example, are carriers of genotype C, the
environmental exposure will not be found to be strongly associated with the
phenotype. Conversely, if the population under study has a large number subjects
with genotype A, a very strong effect of the environmental exposure will be
found. Therefore, the strength of environmental influences on phenotypes may
depend on the genotypes of the individual under study. This can be expressed as:
Vp = Vg + Ve + Vge, where Vge is the interactive term.
The general principle that a genetic association needs to be consistently
replicated by one or more well-designed studies in order to be considered valid
[4] presupposes that the environmental contexts in which the phenotypes are
expressed have little influence on the genetic determination of those phenotypes.
In other words, the penetrance of the genotype should be similar in all environments. For monogenic diseases, in which environmental influences are usually low, this is often the case, but there is no a priori reason why it should be
the case for complex diseases such as asthma and allergies, in which exposures
play a critical role.
It is important to stress, however, that in the example illustrated in Fig. 2,
the genetic association would eventually be detected if a sufficient number of
subjects who had some degree of exposure to the environmental factor were
present in the population. In other words, one would expect that a meta-analysis
of all studies of the relation between this particular phenotype and the genotypes
under study would eventually show that the association was present, and would
be able to detect the marginal effect represented by Vg in the above equation. A
different case is illustrated in Fig. 4, where the genotypes have completely
different and even opposite effects at different levels of exposure. At low levels,
Genotype A
Trait
Values
Genotype C
Vp =Vge
Environment
Fig. 4. In situations such as represented here, the allele associated with increased expression of the
phenotype will depend on the degree of exposure. At low levels of exposure, expression of the
phenotype is higher for genotype C; at lower levels of exposure, expression of the phenotype is higher
for genotype A.
713
carriers of genotype C are more likely to have the phenotype under study,
whereas carriers of genotype A are protected. At high levels, genotype A is the
risk factor and genotype C the protective factor. In this case, Vp = Vge. In other
words, there are no marginal effects of either the genotype or the environmental
exposure, and all the effects are interactive. In this situation, the effects of the
environment and genotype are strictly dependent on the context in which they
occur. For example, the exposure is protective for genotype C, but increases the
risk for developing the phenotype for genotype A. It is indifferent for genotype B.
Interactive versus marginal effects in human genetics

Until recently, most examples of geneenvironment interaction had been
studied in plants and invertebrates [3]. The concept of phenotypic plasticity
the development of different phenotypes for the same genotype in different
environmentshas been extensively studied in plants because it has important
consequences for the yields of genetically manipulated crops in different climates
and external conditions. In contrast, the study of geneenvironment interactions
is conspicuously absent from mammal and especially human genetics. For example, a recent search for papers in the American Journal of Human Genetics
using the term geneenvironment yielded only two hits. This finding is understandable partly because exposures are very difficult (and in humans, often impossible) to standardize. But beyond these practical issues, the most important
reason for this absence is that environmentalists and geneticists have addressed
the impact of these two influences on most phenotypes in separate ways, with
each individual considering the others focus of interest as background noise with
respect to the effects being studied.
It is the authors contention that the separate study of genetic and environmental influences has considerably hindered understanding of the role of these
influences in determining most complex diseases. A good example is the current
status of genetic studies of allergies. Hoffjan and colleagues [5] recently published a comprehensive study of the hundreds of polymorphisms in dozens of
genes reportedly associated with asthma or allergies. The results are sobering;
most of these reports have either not been replicated or replication has been
inconsistent. Only for eight genes have the findings of one group in one population been corroborated in three or more different populations, and several of
these genes are involved in the terminal, effector arm of the process leading to the
expression of allergies (eg, IL-13, IL-4 receptor alpha, IL-4). Moreover, no single
gene has been consistently found to be associated with the same phenotype in all
populations studied. Similar conclusions have been reached by reviews of linkage
studies of asthma and allergies [6].
The most frequently invoked explanations for these discrepancies have been
technical [4]: studies are either marred by type I error (many comparisons, overt
or hidden, are made in the first report of an association, thus annulling the value
714
martinez
of the conventional P = .05 value as a threshold for significance) or by type II

error (replicative studies are too small to provide enough power). A more subtle
explanation is the divergent definitions used to study asthma- and allergy-related
phenotypes; assuming that different forms of these diseases will have common
genetic backgrounds (or common environmental backgrounds, for that matter)
underestimates the heterogeneity of the phenotypes under study. Although these
technical objections may be valid in certain cases, they are unlikely to entirely
explain the consistent inconsistency of association studies of complex diseases
such as asthma and allergies.
One problem could be the fact that genegene interactions could be much more
important determinants of risk for complex diseases than previously thought.
Analyzing these interactions goes beyond the scope of this article, and good
examples regarding linkage analysis have been recently reported in yeast [7].
More to the point, Howard and colleagues [8] reported a cogent example of such
interactions regarding asthma for IL-13 and IL-4 receptor alpha. In both cases,
only the study of the interactive effect between genes yielded significant results,
with each gene that was assessed separately being unrelated to the phenotypes
under study. In the case of genegene interactions, as illustrated by Howard and
colleagues, the interactive effects can be observed at any level of the causation
pathway under study, even at the distal extreme of the causation process.
Similar to genegene interactions, considering geneenvironment interactions
may be necessary to detect the effects of certain exposures and germ-line
variations, specifically for those in which the relative value of the interactive term
is high with respect to the marginal Vg and Ve effects. Unfortunately, it is not
possible to determine a priori or from limited empirical data which genetic effect
will be environmentally modified and to what extent. As explained earlier and
graphed in Fig. 3, separate studies performed in environmental conditions that
represent the extreme left part and the extreme right part of Fig. 2 will yield weak
and strong heritability estimates, respectively, and only through combining the
results of both studies (and perhaps others at intermediate levels of exposure) will
the true, complex nature of the geneenvironment interaction become apparent.
It is also difficult to standardize exposures and their measurement in humans, for
ethical and practical reasons. For an extremely mobile species like humans, and
one that cannot be purposely subject to coerced, fixed, and potentially harmful
exposures at pre-established doses and in a randomized way, the true exposure
(ie, one that includes measurement of dose and timing) to any environmental
stimulus is often impossible to estimate with any accuracy.
Perhaps the only exception to this rule is the study of the genetic determinants
of responses to therapeutic interventions. The controlled and random nature of
therapeutic trials offers a unique opportunity to study geneenvironment interactions in humans. These trials provide ample evidence that there is a wide variability in responses to commonly used antiasthma medicines [9], and it has been
suggested that part of this variability is because of genetic variation in the
population. The main focus of pharmacogenetics today is the genes that encode
for protein directly involved in the response system and metabolism of the drugs
715
under study. In the case of asthma and allergies, special attention has been paid
to the genes for the b-2-adrenergic receptor [10] and the leukotriene receptor
system [11].
Geneenvironment interactions in asthma: the case for endotoxin and CD14

Because modern pharmacogenetic studies assume that the genes most likely to
show variations that would modify the response to exposures (in this case, drugs)
are those directly involved in the response system for that drug, the authors
group explored the role of endotoxin-responsive genes in the pathogenesis of
asthma and allergies. During the 1990s, the discovery that certain populations
presumably more heavily exposed to microbial products were less likely to have
allergies [12] suggested the idea (dubbed the hygiene hypothesis) that biologic
products present in the surface of bacteria and other microbes could influence the
type of immune responses mounted against allergens in subjects exposed to those
products [13]. Subsequently, studies in rural communities in central Europe
demonstrated that the likelihood of becoming sensitized against aeroallergens and
of having atopic asthma was inversely proportional to the concentration of
endotoxin present in home dust [14]. At the same time, studies in animal models
showed that exposure to endotoxin before (but not after) sensitization procedures
that usually triggered a Th2-type response abolished those responses [15]. These
results suggested that activation of the endotoxin-receptor system, if it occurred at
the right time during the sensitization process, could prevent the development of
allergic responses.
The potential role of exposure to endotoxin in the development of allergies
provided a paradigm analogous to that pursued in pharmacogenetic studies. The
receptor system for endotoxin has been amply studied because of its crucial role
in the development of innate immune responses. A central component is the tolllike receptor 4 (TLR4), which when engaged, activates the intracellular signaling
mechanism involved in endotoxin responses. For TLR4 to respond to femtomolar doses of ligand, however, endotoxin needs to interact with CD14, a molecule
that is found in membrane-bound (mCD14) and soluble (sCD14) circulating
forms [16]. The authors group reasoned that if genetic variations could alter
the structure of the CD14 molecule or the amount of CD14 available for interaction with endotoxin, the potential for the latter to influence the development
of allergies could be substantially modified. The group thus screened the
CD14 gene for polymorphisms [17] and found none of any significance in the
coding region, but several in the 5V genomic region, and one single nucleotide
polymorphism (SNP) in particular: a C-to-T conversion at position 159 (this
same SNP is also called CD14/ 260, depending on the position from which
the nucleotides are counted). The group reported that this SNP was associated
with the level of circulating sCD14 in a large population sample in Tucson,
Ariz, with homozygotes for the T allele having higher levels than carriers of the
C allele [17]. Homozygotes for the T allele were found to be less likely to be
716
martinez
atopic, as determined by the number of positive skin tests against aeroallergens. This finding was replicated by researchers studying another urban population in the Netherlands [18]. Moreover, studies in different populations
confirmed the authors groups report of increased levels of circulating sCD14
in carriers of the T allele as compared with carriers of the C allele for CD14/ 159
[19], whereas others reported increased expression of mCD14 in the surface of
antigen-presenting cells of TT homozygotes as compared with carriers of other
CD14/ 159 genotypes [20].
Complex studies of the functional consequence of the SNP on CD14 transcription rates and on transcription factor interaction with the CD14/ 159
genomic region were undertaken to determine the molecular basis for the
association between the CD14/ 159 SNP and expression of mCD14 and sCD14
[21]. These studies showed that, in a relevant cell type (MonoMac cells), a
luciferase reporter assay showed that the T allele was associated with higher
transcription rates than the C allele. The effects were reproducible but modest in
size, as could be expected given the small effects in protein expression. Electromobility shift assays (EMSA) showed that these modifications in transcription
rates could potentially be attributed to alterations caused by CD14/ 159 in the
complex interactions between this genomic region and the SP1 and SP3 transcription factors [21].
The results of these studies thus seemed to confirm the authors original
hypothesis that, among individuals presumably exposed to low doses of endotoxin in urban environments, variations in the CD14 gene that could potentially
increase sensitivity to endotoxin by increasing receptor availability could protect
against the development of allergies. However, much like for most other genetic
variations reportedly associated with asthma and allergies, not all well-performed
studies in which the association between CD14 and allergies was tested could
replicate the groups findings [19]. Often no explanation can be found for these
discrepancies, but in the case of CD14, one potential explanation could be that,
unbeknownst to the investigators, the populations they were studying could be
exposed to different levels of endotoxin. For example, if the type of gene
environment interaction present in the case of CD14 was the one illustrated in
Fig. 2, studies in populations at very low levels of exposure could find no
association of CD14/ 159 with allergies, whereas at levels above the minimum,
the T allele could become protective.
The subsequent report by Gern and colleagues [22] of an interaction between
CD14/ 159 and exposure to dogs in the home in determining early-life atopic
dermatitis provided further support for this assumption. In these studies, only
homozygotes for the T allele showed a protective effect against atopic dermatitis
among infant dwellers of homes with dogs. If the same result is expressed from
the point of view of the exposure, only among children living in homes with dogs
was there a protective effect of the CD14/ 159 T allele. Exposure to dogs has
been shown to be associated with increased levels of endotoxin in home dust
[23], and therefore the results may reveal a geneenvironment interaction of the
type illustrated in Fig. 2.
717
Nonlinear interactive effects

All of the earlier results still point to an association between CD14/ 159 and
atopic phenotypes in which protective effects attributable to the T allele of
CD14/ 159 could be detected if sufficient numbers of subjects who were exposed
to more than minimal levels of endotoxin were included in the sample. However,
reports regarding subjects heavily exposed to endotoxin later emerged that
challenged this assumption. Ober and colleagues [24] studied allergic sensitization
among the Hutterites, a rural population living in a communal setting in the
northern United States. They found that, contrary to findings in urban populations,
the C allele of CD14/ 159 was protective against sensitization in these subjects.
Similarly, Amelung and colleagues [25] reported that, among workers in the animal
facilities of the Jackson laboratories, presumably heavily exposed to endotoxin,
the C allele of CD14/ 159 was also protective. These findings were clearly
unexpected, and could have been interpreted as the result of simple random
variation around the null. An alternative explanation, however, was that the effects
being observed in these different populations could follow the type of gene
environment interaction model schematically described in Fig. 4. In that case, one
would expect that, at different levels of exposure, different CD14/ 159 alleles
would show protective effects, and there could also be exposure ranges in which no
association could be found between CD14/ 159 and allergy-related phenotypes.
A study by Zambelli-Weiner and colleagues [26] provided important new
information in support of this second scenario. These authors studied the association between prevalence of asthma and CD14/ 159 in a population of
African descent in the island of Barbados. Contrary to other studies, however,
concentration of endotoxin in house dust was also measured, and the effects
of CD14/ 159 were assessed at different levels of exposure. They found that
the T allele was protective at low levels of exposure to endotoxin, whereas the
C allele was protective at high levels of exposure (Fig. 5). They could not
distinguish between the effects on asthma and those on atopic sensitization
because most subjects who had asthma were atopic. A similar pattern was
observed when the children enrolled in the study of the association between
endotoxin exposure and prevalence of asthma and allergies in rural communities
in central Europe were genotyped for CD14/ 159 [27]. Much like in the study
in Barbados, the T allele of CD14/ 159 was protective against atopy at low
levels, unrelated to it at intermediate levels, and was a risk factor for allergic
sensitization at high levels of exposure. Much like in the study by Gern and
colleagues [22], having a dog in the home was protective among carriers of
the T allele, but this effect seemed to be independent of the concentration of
endotoxin measured in house dust. It is thus likely that having a pet in the home
may have effects on allergic sensitization that are only partially explained by the
concomitant increased exposure to endotoxin.
The results of the studies by Zambelli-Weiner and colleagues [26] and by Eder
and colleagues [27] clearly suggest a nonlinear pattern (of the type illustrated
in Fig. 4) for the interaction between CD14/ 159 and endotoxin exposure in
718
martinez
100
10
OR
For
Asthma
Low Endotoxin
Hi Endotoxin
1
CC
CT
TT
0.1
Fig. 5. Association between CD14/ 159 and atopic asthma in individuals who have high exposure
and low exposure to endotoxin in the island of Barbados. At higher levels of exposure, the T-allele
is a risk factor for asthma, whereas at lower levels of exposure, the C-allele is a risk factor.
CC, homozygotes for C allele; CT, heterozygotes; OR, odds ratio; TT, homozygotes for T allele.
(Data from Zambelli-Weiner A, Ehrlich E, Stockton ML, et al. Evaluation of the CD14/ 260
polymorphism and house dust endotoxin exposure in the Barbados Asthma Genetics Study. J Allergy
Clin Immunol 2005;115(6):12039.)
determining allergy-related phenotypes. The most important consequence of

these findings, from the point of view of genetic epidemiology, is that it is not
possible to study either of these main effects independent of the other. Because
this pattern of geneenvironment interaction has rarely been studied in humans, it
is currently unknown if it is unique to CD14/ 159 or if other genetic variants
show similar types of geneenvironment interactions. However, a recent report
Hoffjan and colleagues [28] strongly suggests that the latter may be true. These
investigators studied the association between polymorphisms in immune genes
and several early-life immune phenotypes related to atopy, and assessed the way
in which these associations were modified by attending day care in early life
an exposure known to protect against the development of atopy [29]. For
polymorphisms in three of these genes (those for the IL-4 receptor alpha, nitric
oxide synthase-3, and high affinity receptor for IgE), opposite alleles showed
association with early-life immune phenotypes depending on whether the child
was or was not exposed to day care. These results thus suggest that, much like for
CD14/ 159, the association between these immune gene polymorphisms and
atopy-related phenotypes cannot be studied independently from the day care
related exposures that modify their effects. It remains to be elucidated what
role these geneenvironment interactions play in the inconsistency between genetic studies of atopy-related phenotypes.
The biology of geneenvironment interactions

Although the earlier results appear compelling, the biologic mechanisms that
underlie the differential effects of genetic variations in different environments
719
Response
Dose of exposure
Fig. 6. Hypothetical biologic scenario that could explain the geneenvironment interaction observed
in Fig. 5. C, C allele; T, T allele.
have not been studied in humans. Recent observations among subjects experimentally exposed to endotoxin may provide a clue (Tricia LeVan, PhD and
colleagues, unpublished data, 2005). These studies show that homozygotes for
the CD14/ 159 T allele had higher basal levels of circulating sCD14 than
carriers of the C allele, but showed no significant change in circulating sCD14
levels 24 hours after being exposed to endotoxin by inhalation. Conversely,
homozygotes for the CD14/ 159 C allele had lower levels of basal sCD14 levels,
but showed significant increases in sCD14 after exposure. These results could be
explained by a hypothetical different shape in the doseresponse curve between
carriers of different CD14/ 159 alleles. At lower levels of exposure, carriers of
the T allele would have higher responses that may reach an early peak (Fig. 6).
Beyond a certain dose of endotoxin, carriers of the C allele would have higher
responses than carriers of the T allele. In this scenario, responsiveness to
endotoxin would still be present in carriers of the C allele at levels of exposure
beyond which responses would have already plateaued among homozygotes for
the CD14/ 159 T allele. Although this hypothetical scenario is plausible, it
requires empiric demonstration.
Summary
The example of the complex interactions between environmental exposures
and polymorphisms in the CD14 gene in predisposing for allergy-related conditions offers a good indication of the complexity of the mechanisms that determine susceptibility to these conditions. Contrary to what has been the rule for
monogenic diseases, the association between genetic variations and polygenic
conditions such as asthma and allergies may not always be unidirectional; that is,
not always will the same alleles be associated with the conditions under study.
Concepts of penetrance of genetic variations that ignore these nonlinear influences (which may affect genegene and geneenvironment interactions) may
720
martinez
hinder a better understanding of the mechanisms of disease involved, and therefore may delay the development of preventive strategies for these common conditions. Discrepancies between well-designed genetic studies of asthma and
allergies, therefore, may be suggesting something fundamental about how these
diseases develop and how it will be possible to abolish them in the future.
References
[1] Duffy DL, Martin NG, Battistutta D, et al. Genetics of asthma and hay fever in Australian twins.
Am Rev Respir Dis 1990;142(6 Pt 1):1351 8.
[2] Remes ST, Castro-Rodriguez JA, Holberg CJ, et al. Dog exposure in infancy decreases
the subsequent risk of frequent wheeze but not of atopy. J Allergy Clin Immunol 2001;108(4):
509 15.
[3] Pigliucci M, Schlichting C. Phenotypic evolution: a reaction norm perspective. Sunderland
(MA)7 Sinauer Associates, Inc.; 1998.
[4] Colhoun HM, McKeigue PM, Davey Smith G. Problems of reporting genetic associations with
complex outcomes. Lancet 2003;361(9360):865 72.
[5] Hoffjan S, Nicolae D, Ober C. Association studies for asthma and atopic diseases: a comprehensive review of the literature. Respir Res 2003;4(1):14.
[6] Los H, Koppelman GH, Postma DS. The importance of genetic influences in asthma. Eur Respir J
1999;14(5):1210 27.
[7] Brem RB, Storey JD, Whittle J, et al. Genetic interactions between polymorphisms that affect
gene expression in yeast. Nature 2005;436(7051):701 3.
[8] Howard TD, Koppelman GH, Xu J, et al. Gene-gene interaction in asthma: IL4RA and IL13
in a Dutch population with asthma. Am J Hum Genet 2002;70(1):230 6.
[9] Malmstrom K, Rodriguez-Gomez G, Guerra J, et al. Oral montelukast, inhaled beclomethasone,
and placebo for chronic asthma. A randomized, controlled trial. Montelukast/Beclomethasone
Study Group. Ann Intern Med 1999;130(6):487 95.
[10] Israel E, Drazen JM, Liggett SB, et al. The effect of polymorphisms of the beta(2)-adrenergic
receptor on the response to regular use of albuterol in asthma. Am J Respir Crit Care Med
2000;162(1):75 80.
[11] Drazen JM, Yandava CN, Dube L, et al. Pharmacogenetic association between ALOX5 promoter genotype and the response to anti-asthma treatment. Nat Genet 1999;22(2):168 70.
[12] Strachan DP. Hay fever, hygiene, and household size. BMJ 1989;299(6710):1259 60.
[13] Martinez FD, Holt PG. Role of microbial burden in aetiology of allergy and asthma. Lancet
1999;354(Suppl 2):SII12 5.
[14] Braun-Fahrlander C, Riedler J, Herz U, et al. Environmental exposure to endotoxin and its
relation to asthma in school-age children. N Engl J Med 2002;347(12):869 77.
[15] Tulic MK, Wale JL, Holt PG, et al. Modification of the inflammatory response to allergen
challenge after exposure to bacterial lipopolysaccharide. Am J Respir Cell Mol Biol 2000;
22(5):604 12.
[16] Ulevitch RJ, Tobias PS. Recognition of endotoxin by cells leading to transmembrane signaling.
Curr Opin Immunol 1994;6(1):125 30.
[17] Baldini M, Lohman IC, Halonen M, et al. A polymorphism in the 5V-flanking region of the
CD 14 gene is associated with circulating soluble CD14 levels and with total serum IgE.
Am J Respir Cell Mol Biol 1999;20(5):976 83.
[18] Koppelman GH, Reijmerink NE, Colin Stine O, et al. Association of a promoter polymorphism
of the CD14 gene and atopy. Am J Respir Crit Care Med 2001;163(4):965 9.
[19] Kabesch M, Hasemann K, Schickinger V, et al. A promoter polymorphism in the CD14 gene is
associated with elevated levels of soluble CD14 but not with IgE or atopic diseases. Allergy
2004;59(5):520 5.
721
[20] Hubacek JA, Rothe G, Pitha J, et al. C( 260)YT polymorphism in the promoter of the
CD14 monocyte receptor gene as a risk factor for myocardial infarction. Circulation 1999;
99(25):3218 20.
[21] LeVan TD, Bloom JW, Bailey TJ, et al. A common single nucleotide polymorphism in the
CD14 promoter decreases the affinity of Sp protein binding and enhances transcriptional activity.
J Immunol 2001;167(10):5838 44.
[22] Gern JE, Reardon CL, Hoffjan S, et al. Effects of dog ownership and genotype on immune
development and atopy in infancy. J Allergy Clin Immunol 2004;113(2):307 14.
[23] Park JH, Spiegelman DL, Gold DR, et al. Predictors of airborne endotoxin in the home. Environ
Health Perspect 2001;109(8):859 64.
[24] Ober C, Tsalenko A, Parry R, et al. A second-generation genomewide screen for asthmasusceptibility alleles in a founder population. Am J Hum Genet 2000;67(5):1154 62.
[25] Amelung PJ, Weisch DG, Xu J, et al. A polymorphism in CD14 is associated with high
IgE levels in a population with laboratory animal allergy. Am J Respir Crit Care Med 2000;
161(3):A927.
[26] Zambelli-Weiner A, Ehrlich E, Stockton ML, et al. Evaluation of the CD14/ 260 polymorphism
and house dust endotoxin exposure in the Barbados Asthma Genetics Study. J Allergy Clin
Immunol 2005;115(6):1203 9.
[27] Eder W, Klimecki W, Yu L, et al. Opposite effects of CD14/ 260 on serum IgE levels in children
raised in different environments. J Allergy Clin Immunol 2005;116:601 7.
[28] Hoffjan S, Nicolae D, Ostrovnaya I, et al. Gene-environment interaction effects on the development of immune responses in the 1st year of life. Am J Hum Genet 2005;76(4):696 704.
[29] Ball TM, Castro-Rodriguez JA, Griffith KA, et al. Siblings, day-care attendance, and the risk
of asthma and wheezing during childhood. N Engl J Med 2000;343:538 43.

25 (2005) 723 742
Asthma Pharmacogenomics
Gregory A. Hawkins, PhDa,T, Scott T. Weiss, MDb,
Eugene R. Bleecker, MDa
a
Center for Human Genomics, Wake Forest University School of Medicine,

Medical Center Boulevard, Winston-Salem, NC 27157, USA
b
Channing Laboratory, Brigham and Womens Hospital and Harvard Medical School,
181 Longwood Avenue, Boston, MA 02115, USA
Asthma affects an estimated 20 million people (~7% of the population) in

the United States and results in more than 5,000 deaths each year from complications [1,2]. The financial impact of asthma in the United States is difficult to
calculate, but it has been estimated that annual direct and indirect costs of asthma
exceed $14 billion, making asthma one of the largest expenses in the United
States health care system. Despite intensive research, the exact causes of asthma
have not been completely elucidated, making treatment of asthma and related
symptoms a challenge. However, we do know that complicated interactions
between environmental, social, and genetic factors are involved in increasing a
persons risk for asthma, and that other factors such as race, ethnicity, age, and
sex add an additional layer of complexity in disease etiology [3].
Because asthma is a heterogeneous disease, differing degrees of airway
inflammation and airway obstruction must be treated by tailoring prescriptions to
each patient, taking into consideration specific phenotypes and disease severity.
Treating asthma can be simple for some patients. There are, however, an estimated 70% to 80% of asthma patients who exhibit variable responses to common
asthma medications [4]. Variations in response can be subtle and may require
simple adjustments in dosage or type of medication. In some cases, however, the
variations in response are more pronounced, sometimes resulting in adverse
reactions that can be life-threatening [47]. Reasons for poor uniformity in drug
response are not usually apparent; in other words, the response differences are
not simply caused by different methods of drug delivery or inconsistent patient
T Corresponding author.
E-mail address: ghawkins@wfubmc.edu (G.A. Hawkins).
doi:10.1016/j.iac.2005.09.004
724
hawkins et al
compliance. Indeed, most of the differences in drug response appear to be innate

to subsets of individuals, indicating that a commonality exists that is probably
genetically based.
Pharmacogenetics and pharmacogenomics are terms used to describe the study
of genetic variants and how these variants relate to interindividual response to
drug therapy. Both terms can be used to describe how genetic variations affect key
pathways for drug metabolism, delivery, excretion, sight of action, and toxicity.
However, pharmacogenetics will usually be used to describe a single gene approach to understanding the effects of genetic variation on drug response, while
pharmacogenomics emphasizes a larger, genome wide approach that considers
not only single gene effects, but also multigene interactions and pathways. In
general, the term pharmacogenomics has been adopted as the primary descriptor
because of the complexity inherent in studying pharmacologic responses and the
vast number of genes involved in defining these responses. Many examples of
varied clinical response to medication based on heritable differences have been
described, and it has been estimated that 20% to 95% of drug effects and efficacy
may be caused by heritable differences [8].
Genetic polymorphisms
Before considering the specifics of asthma pharmacogenomics, it is important to understand gene structure, the methods used to identify genetic variations (generally termed polymorphisms), and the types of genetic variations
useful for pharmacogenomic studies. There are several types of polymorphisms
(Box 1). The majority of polymorphisms are termed single nucleotide polymorphisms (SNPs). SNPs comprise single nucleotide changes in the DNA code
and statistically occur at 1000-bp intervals throughout the genome, although
the density of SNPs in the genome can vary significantly from gene to gene.
SNPs that occur in the coding region of a gene are termed coding SNPs (cSNPs)
and can be either synonymous cSNPs (meaning they do not change the protein
sequence) or nonsynonymous (meaning they change the amino acid in the
representative peptide sequence). Classically, nonsynonymous cSNPs are termed
mutations, while synonymous cSNPs are termed silent mutations. A second type
of polymorphism, called an insertion/deletion (InDel), includes genetic variations
with one or more bases deleted or inserted into the DNA sequence. InDels come
in different variations, and can consist of a unique single nucleotide, a large
segment of nonrepetitive nucleotides, or repetitive elements that are tandemly
repeated and vary in length between individuals. Because InDels are rarer than
SNPs, more difficult to assay, and not as common in the coding regions of genes,
they are not used as frequently in pharmacogenomic studies. The effects of
InDels on gene function, however, can be considerable, especially when involving regions of genes that encode protein sequence or regulate levels of gene
transcription or translation.
asthma pharmacogenomics
725
Box 1. Types of DNA polymorphisms

Single nucleotide polymorphism
Noncoding SNP
GACTCGATTCAG N GACTCGAATCAG
Coding SNP (changes peptide sequence)
GAC CTG ATG GGG N GAC CTG ATG CGG
Asp Leu Met Gly N Asp Leu Met Arg
Insertion/deletion
Single-base InDel
GACTCGATTCAG N GACTCGAATTCAG
Multiple-base InDel
GACTCGATTCAG N GACTCGATATTTCAG
Tandem repeat
GATCACACACACACATT N GATCACACACACACACACATT
The start of any pharmacogenomic study requires a review of the literature

and online polymorphism databases to catalog the polymorphisms in a gene or
genetic region, and to determine the utility of each polymorphism. Research
articles are the most obvious sources, because polymorphisms already studied
in one phenotypic population and functionally defined may have similar properties in an asthma pharmacogenomics study. The largest sources for information about polymorphisms are online databases such as dbSNP and Celera. These
databases contain millions of human polymorphisms, most of which have detailed information including polymorphism location, potential functionality of
polymorphism, polymorphism frequency, validation status, and methods for
assaying polymorphisms. Caution should be taken in using information from
these databases, because much of the information about a polymorphism may
have been derived from studying on specific population, which is only applicable
one ethnic or racial group. In addition, many database polymorphisms have been
identified by comparing DNA clones sequenced during the assembly of the
human genome and many times represent sequence reporting errors and thus do
not exist in the general population. Finally, many genes and genetic regions have
not been fully screened for polymorphisms, and thus it cannot be assumed that all
polymorphisms in a candidate gene or a selected genetic region are known.
When polymorphism information for a candidate gene is unknown or verification of polymorphism content and frequency in a candidate gene is required,
726
hawkins et al
it is common to perform DNA sequence analysis on a predefined region of DNA

in a panel of representative samples from the study population. By sequencing as
few as 50 individuals from a specific population, there is a 95% chance of
detecting polymorphisms with an allele frequency as low as 3%. This detection
threshold is sufficient for identifying polymorphisms suitable for most pharmacogenomics studies in the general population. However, polymorphism with
frequencies below 3% could be well worth identifying, because they could play a
major role in defining interindividual drug response. It is also important to
understand that pharmacogenomic studies typically involve more than one ethnic
or racial population, and that polymorphisms identified in one racial population
(eg, Caucasians) can occur at significantly different frequencies in a second racial
population (eg, African Americans). Therefore, polymorphisms useful in one
population may not be informative in a second population. Likewise, if polymorphisms have been identified from individuals of one affection status group
(eg, only patients who have excellent responses to beta agonist), polymorphisms
associated with or that directly contribute to poor response could be missed.
For these reasons, it is important to assemble a randomly chosen screening panel
that includes subjects from all ethnic or racial groups and affection status.
Pharmacogenomic studies are performed using two strategies: (1) genetic association analysis, or (2) candidate gene analysis (functional association analysis). Genetic association studies capitalize on the nature of polymorphisms to be
inherited in groups and are thus in linkage disequilibrium (LD) with one another.
Polymorphisms in these LD regions can be genotyped and then tested for significant patterns of coinheritance with drug response phenotypes, typically from a
casecontrol study. Once LD regions have been established, haplotypes can be
constructed and assessed for genetic association as well. Haplotypes are sets of
two or more closely linked genetic markers (or alleles) that are present on one
chromosome and tend to be inherited together (Fig. 1). Haplotype analysis can
be very powerful tool to help predict which polymorphisms are most responsible
for genetic association in a strong LD region. Haplotypes can also help distinguish which combinations of polymorphisms, when inherited together, could
predict drug response. Polymorphisms used to measure genetic association
(mostly SNPs) will normally have minor allele frequencies of 5% or more,
although less common SNPs can be assayed if the casecontrol population is
very large or if the rarer polymorphisms (usually known to affect gene function)
HAPLOTYPE
1
2
3
4
5
6
7
8
SNP1
SNP2
SNP3
SNP4
SNP5
SNP6
SNP7
SNP8
SNP9
SNP10
SNP11
T
C
T
T
T
T
T
T
C
C
C
T
T
T
T
T
A
A
A
T
T
A
A
A
C
G
G
C
C
C
C
C
T
C
C
T
T
T
T
T
A
G
G
A
A
G
G
G
C
G
G
C
C
C
C
C
C
C
C
C
C
C
C
T
C
C
C
C
C
A
A
A
C
C
C
C
C
C
G
C
G
G
G
G
C
C
C
C
Fig. 1. Haplotypes structure formed by 11 SNPs.
727
are suspected to contribute to the phenotype. A key strength to a genetic association analysis is that large genomic regions can be studied with very little
knowledge required about the nature of genes in genomic regions being tested.
In essence, genetic association analysis can be the first step to identifying candidate genes.
In contrast to genetic association analysis, candidate gene (or functional
association) analysis requires preselecting genes based on known function or
based on results from a previous genetic association analysis. In some cases,
polymorphisms in candidate genes have already been functionally tested and
are known to affect gene expression or protein synthesis. A candidate gene
study may use only one or two functional polymorphisms in the study (see the
example of ADRb2 in later discussion). In other cases, candidate genes can be
saturated with informative polymorphisms, most of which have little relationship
to gene function. As with genetic association analysis, when more than one
polymorphism is tested, haplotype analysis can be useful to enhance candidate
gene analysis.
Asthma pharmacogenomic studies

Beta agonist therapy
Beta agonists (eg, albuterol, salmeterol, formoterol) are the most frequently
prescribed bronchodilator medication used to treat airway obstruction associated
with asthma. Beta agonists exert their action by binding beta-2 adrenergic
receptors that lie on the surface of smooth muscle cells in the lung. Once engaged
by agonists, the beta-2 adrenergic receptors activate intracellular adenylate cyclase through a Gs-protein coupled receptor mechanism [9], causing an intracellular increase of cyclic adenosine monophosphate (cAMP). The increase in
cAMP concentration activates cAMP-dependent protein kinase, which triggers
relaxation of smooth muscle and reduction in bronchorestriction.
The gene encoding the beta-2 adrenergic receptor (ADRb2) is the most
extensively studied and therefore best example for exploring the basics of asthma
pharmacogenomics. ADRb2 is a small gene (Fig. 2) consisting of a single exon
with a single opening reading frame (highlighted in blue) that encodes the
413amino acid receptor protein. In 1993, Reihsaus and colleagues [10] published the first detailed sequence study of ADRb2, documenting nine genetic
variations within the coding region of ADRb2. Four of these genetic variants,
located at positions +16, +27, +100, and +491, create the nonsynonymous
changes Gly16Arg, Gln27Glu, Val34Met, and Thr164Ile, respectively, in the receptor peptide sequence. Gly16Arg and Gln27Glu, both located in the N-terminus
of the receptor, are very common and occur in every population screened thus far.
Both Gly16Arg and Gln27Glu have been shown to have effects on receptor
regulation when tested in vitro. In a study by Green and colleagues [11], beta-2
adrenergic receptors containing Gly16/Gln27 were downregulated by as much
728
hawkins et al
4 kB
ADR2
Coding Region
-1023 G/A
+523 C/A
-709 C/A
+491 C/T
Thr164Ile
-654 G/A
-468 C/G
-406 C/T
-367 T/C
-47 T/C -20 T/C

Cys19Arg
+46 G/A
(LC region)
Gly16Arg
+79 C/G
Gln27Glu
+252 G/A
+100 G/A
Val34Met
Fig. 2. Polymorphisms in ADR2b.
as 41% when exposed to isoproterenol. In contrast, Arg16/Gln27 receptors

were downregulated by only 26%, while receptors containing Gly16/Glu27
were downregulated by 39%. Arg16/Glu27 receptors, however, failed to exhibit
downregulation, suggesting that the major functional differences in receptor
response are contributed by Gly16 and Arg16. Receptors containing Ile164 are
rare, but functional assays indicate that receptors containing Ile164 have a twoto threefold decrease in agonist binding affinity, resulting in decreased basal
and agonist-stimulated adenylyl cyclase activity. In a recent cardiovascular
study of vasodilation response, individuals that were heterozygous Thr164/Ile164
had a fivefold reduction in beta agonist response versus Thr164/Thr164 homozygous patients [12]. This type of variation in response may also hold true for
Thr164/Ile164 asthmatics on beta agonist therapy. The mutation Val34Met is very
rare, occurring in less than 1% of the general population [10], and appears to
have little affect on receptor function. A fifth mutation at +659 (Ser220Cys) has
also been identified, but to date there have been no functional studies have been
performed on Cys220 receptors.
Polymorphisms in other regions of ADRb2 have also been linked to altered
receptor response [9,1318]. The leader cistron region of ADRb2 contains a
short opening reading frame that produces a 19amino acid peptide called the
beta-2 adrenergic receptor upstream peptide (BUP). A key polymorphism at the
47 position (T N C) in the leader cistron region creates a Cys to Arg change at
amino acid 19 in BUP. Functional studies of the BUP peptide have shown that a
T allele at 47 (Cys19) increases the expression level of beta-2 receptor by
increasing the rate of ADRb2 mRNA translation in vitro without increasing levels
of mRNA synthesis [14]. Variations in protein translation rates can have
significant effects on receptor density in the cell membrane by supplying more
targets for beta agonists, which in turn can modify beta agonist response levels.
Haplotype analysis of ADRb2 indicates that coinheritance of Gln27 mutation with
Cys19 BUP and Glu27 with Arg19 BUP occurs nearly 100% of the time in all races
729
[9]. Coinheritance of Gly16 or Arg16 with either Cys19 BUP or Arg19 BUP,
however, is not as strongly correlated, suggesting that a complex interaction
between Cys19Arg BUP and Gly16Arg mutations could be important in determining levels of beta agonist response.
The in vitro data strongly suggests that ADRb2 polymorphisms, especially
+46 (Gly16Arg) and +79 (Gln27Glu) may play a significant role in predicting
beta-2 receptor function and thus beta agonist response. In one of the earliest tests
of genotype stratified beta agonist response, children from a longitudinal asthma
study that were homozygous for Arg16 (all homozygous Gln27) were 5.3 times
more likely to have a positive response to albuterol treatment (N 15.3% of
Predicted FEV1) when compared with children who were homozygous Gly16
(all homozygous Gln27) [19]. Children heterozygous for Gly16/Arg16 (all homozygous Gln27) were 2.3 times more likely to have a positive response to albuterol
when compared with homozygous Gly16 children. In contrast, when variations
at +79 (Gln27Glu) were studied, there was no significant effect on albuterol
response. In this study, differences in albuterol response were independent of
affection status (asthma versus no asthma), ethnicity, and race, indicating that
variation in response to beta agonist was influenced primarily by changes at
amino acid 16. In an example of how ethnic and racial differences can influence
pharmacogenomics, Choudhry and colleagues [20] investigated the differences in
beta agonist response between two Latino populations: Mexicans and Puerto
Ricans. Puerto Ricans have one of the highest prevalences of asthma among all
ethnic groups, and consequently one of the highest morbidity rates associated
with having the disease. In contrast, Mexicans have a lower incidence of asthma
and thus a lower morbidity rate. When the Gly16/Arg16 was genotyped in both
populations, Puerto Ricans with the Arg16 had a greater response to beta agonist
as measured by changes in FEV1. Arg16 in Mexicans, however, was not associated with improved beta agonist response.
Other researchers have observed positive responses of Arg16 on beta agonist
therapy. There are, however, several reports suggesting negative effects of beta
agonist therapy in individuals homozygous for Arg16 (Arg16/Arg16) receptors.
Studies by Taylor et al [21] and Hancox et al [22] both suggest that Arg16/Arg16
patients experience increases in bronchial hyperresponsiveness and increased
exacerbations with regular beta agonist therapy compared with patients homozygous for Gly16 (Gly16/Gly16). In an Asthma Clinical Research Network study,
patients homozygous for Arg16 and on regular beta agonist treatment were
reported to have a significant decline in am peak flow expiratory rates when
compared with patients homozygous for Gly16 and on regular beta agonist
treatment [23]. More surprising, Arg16/Arg16 patients on beta agonist treatment as
needed reported similar am peak flow expiratory rates as reported for patients
homozygous for Gly16. In a recent placebo-controlled, double-blind study called
the Beta Agonist Response by Genotype study [24], Arg16/Arg16 or Gly16/Gly16
patients were treated with either regular or intermittent beta agonist therapy and
then crossed over. Arg16/Arg16 patients treated with regular beta agonist therapy
had decreased peak flow rates when compared with Arg16/Arg16 patients treated
730
hawkins et al
with placebo. Arg16/Arg16 patients treated with regular beta agonist also experienced an increase in daily asthma symptoms compared with Arg16/Arg16
patients treated as needed with beta agonist. In contrast, Gly16/Gly16 patients had
significant improvement in peak flow rates with regular beta agonist therapy and
less daily asthma symptoms. In addition, significant differences in FEV1 was
measured between Arg16/Arg16 and Gly16/Gly16 patients that were treated with
regular beta agonist therapy versus patients on intermittent therapy. In essence,
individuals with Arg16/Arg16 receptors may have more positive short-term responses to beta agonist, but there is a significant risk of reduced lung function
when Arg16/Arg16 patients are treated with regular beta agonist therapy, which
could pose more risk than benefit to the patient.
In light of the studies outlined above, it is clear that the regulation of beta
agonist response is complex and will not be explained by a single ADRb2 genetic
variant. Drysdale and colleagues [9] explored the possibility of complex gene
regulation by genotyping thirteen ADRb2 polymorphisms in Caucasians, African
Americans, Asians, and Hispanic-Latinos, and identifying haplotypes in the
four ethnic groups. Twelve common haplotypes were observed in four ethnic
populations, with five haplotypes representing more than 95% of haplotypes
in these populations. Drysdale haplotypes 2, 4, and 6 occurred at the highest
frequency in Caucasians (48.3%, 33.0%, and 13.2%, respectively), while haplotypes 1, 4, and 6 were most frequent in African Americans (25%, 29.7%, and
31.3%, respectively). The haplotype frequency in Asians and Hispanic-Latinos
were more similar to African Americans than Caucasians. A comparison of
haplotypes pairs and beta agonist response in 121 Caucasians showed that
individuals homozygous for the 4/4 haplotype pair (Arg16/Arg16 and Gln27/Gln27)
showed a lower response (change in % predicted FEV1) to albuterol compared
with individuals with other haplotypes pairs. Individuals with the 2/2 haplotype
pair (Gly16/Gly16 and Glu27/Glu27) showed a significantly higher response to
albuterol while individuals with the 2/4 haplotype pair (the most common
haplotype pair observed) had agonist responses that fell between the 2/2 and 4/4
haplotype pair responses, as might be expected. However, individuals with the
4/6 haplotype pair (Arg16/Gly16 and Gln27/Gln27) were observed to have the
highest response to albuterol, in contrast to what might be expected if amino acid
content of the receptor alone were considered based on haplotype 2/2 and
4/4 response data. This haplotype response data showing individuals with a
4/4 haplotype pair (Arg16/Arg16) have decreased beta agonist response compared with individuals with a 2/2 haplotype pair (Gly16/Gly16) clearly opposes
data in previous studies comparing beta agonist response to the inheritance of
Arg16/Arg16 or Gly16/Gly16, suggesting that other variants in the gene are as or
more important in predicting beta agonist response.
Although most research has focused on ADRb2 as a modifier of beta agonist
response, there is evidence that ADRb2 may modify asthma risk. ADRb2 is
located on 5q31, a chromosomal region genetically linked to asthma and related
phenotypes [3,2527]. Complementary studies have found association of asthma
phenotypes with ADRb2 polymorphisms [2842]; however, results between stud-
731
ies have not always been consistent, possibly due to stratification effects from
casecontrol study designs. In an important family-based association study by
Silverman and colleagues [38], promoter polymorphism 654 and coding polymorphism +46 (Gly16Arg) were significantly associated qualitatively and
quantitatively with postbronchodilator FEV1, while the polymorphism +523
(Arg175Arg) was associated with bronchodilator response. Haplotype analysis
further supported the single polymorphism association in this study. In essence,
ADRb2 polymorphisms appear to have a dual role in predicting receptor response to beta agonist and properties associated with lung function possibly
independent of beta agonist therapy.
Anticholinergic pathway
Anticholinergics are a second category of medication used to treat airway
bronchoconstriction, primarily in patients who have chronic obstructive pulmonary disease. Anticholinergics are muscarinic receptor antagonists that control
cAMP degradation caused by G-proteincoupled receptor-mediated activation
of adenylate cyclase [43]. Blocking the activity of muscarinic receptors allows
smooth muscle cAMP concentrations to recover, resulting in airway smooth
muscle relaxation and reduction of bronchoconstriction. The airway smooth
muscle contraction activity of muscarinic receptors, therefore, contrasts with
the smooth muscle relaxation function of the beta-2 adrenergic receptor. The
primary targets for anticholinergics are the muscarinic receptor 2 (M2) and
muscarinic receptor 3 (M3) [44,45]. The anticholinergic ipratropium bromide is a
nonselective muscarinic antagonist and blocks both M2 and M3 receptors.
Tiotropium, a newer and more potent, long-lasting muscarinic antagonist, is
selective for the M3 receptor [46]. Recent work by McGraw and colleagues [47]
indicates that regulatory cross-talk may exist between beta-2 receptor and
muscarinic G-coupled receptor regulatory pathways, with implications in individuals who do not respond well to beta-2 receptor agonist (Arg16 homozygotes)
or individuals that become resistant to beta agonist therapy due to tachyphylaxis. Therefore, this class of drug may have an increasingly important role
in asthma therapy in subsets of patients who are less responsive to treatment
with beta-2 agonists.
The genes CHRM2 and CHRM3 encode M2 and M3, respectively. CHRM2 is
located on chromosome 7q35-36 and consists of 3 exons dispersed over an
approximately 148-kB region of DNA. CHRM3 is located on chromosome
1q41-44 and consists of 5 exons dispersed over an approximately 280-kB region
of DNA. There are several studies describing noncoding polymorphisms CHRM2
and CHRM3 [4851]. One genetic study has identified a weak association between a CHRM3 promoter haplotype and skin test reactivity to cockroach antigen
in individuals who have asthma [48]; however, to date there are no studies
describing the effects of CHRM2 or CHRM3 genetic variants on anticholinergic response.
732
hawkins et al
Leukotriene pathway
In spite of what is known about leukotriene synthesis, this pathway has not
been thoroughly studied in comparison with the beta agonist receptor. Cysteinyl
leukotrienes are very potent mediators of bronchoconstriction and airway inflammation [52,53]. Leukotrienes (LTA4, LTB4, LTC4, LTD4, and LTE4) are derived
by a biosynthetic pathway of several enzymes that include 5-lipoxygenase
(5-LOX), 5-lipoxygenase activating protein (FLAP), and leukotriene C4 synthase
(LTC4 synthase) [53,54] and are released by proinflammatory cells, including
neutrophils, eosinophils, and mast cells. Once synthesized, the cysteinyl leukotrienes (LTC4, LTD4, and LTE4) target G-proteincoupled cysteinyl leukotriene
receptors (CysLtr1 and CysLtr2) that lie on the surface of smooth muscle
cells [45,55]. In contrast to beta-2 adrenergic receptors, which are the initiators
of smooth muscle cell relaxation and relief of bronchoconstriction, activation
of cysteinyl leukotriene receptors causes smooth muscle contraction (bronchoconstriction), mucus secretion, and edema [56]. The leukotriene modifiers fall
into two mechanistic categories: (1) inhibitors of 5-LOX activity (Zileuton) and
(2) cysteinyl leukotriene receptor antagonists (Montelukast, Zafirlukast).
The most important enzyme in the cysteinyl leukotriene synthesis pathway
is 5-lipoxygenase (5-LOX or 5-LO). 5-LOX is the first enzyme in the pathway, converting arachidonic acid to the leukotriene precursors hydroperoxyeicosatetraenoic acid and LTA4 [45]. 5-LOX alone, however, is not capable of
converting arachidonic acid to leukotrienes, and must be preactivated by FLAP
(see later discussion). The gene for 5-LOX (ALOX5) is located on chromosome
10q11.2 and is large, consisting of 14 exons and dispersed over an approximately
85-kB region of DNA. No common mutations altering the protein sequence
have been identified in ALOX5. The promoter region of ALOX5 is very complex
and contains several consensus sequences that are targets for DNA transcription factors. Several polymorphisms have been identified in and near these
transcription consensus sites [52,5759]. Each of these polymorphisms create an
insertion or deletion of a tandem repeat region that contains a copy of a Sp1/Egr1
transcription binding sites (consensus DNA sequence GGGCGGG), altering
the number of Sp1/Egr1 consensus sites, and thus the number of targets for
available for Sp1 transcriptional regulation. The most common number of tandem
repeats that occurs in the general population is five; however, repeat lengths as
low as three and as high as seven have been identified. In vitro assays comparing
the number of tandem repeats to ALOX5 expression indicate that having more
or less than the five Sp1/Egr1 consensus sites can significantly alter the levels
of ALOX5 transcriptional level [58,60]. A clinical study comparing response to
the Zieluton derivative ABT-761 or to a placebo to variations in the Sp1/Egr1
region found that patients with the wild-type promoter region (five tandem
repeats) had a 15% improvement in % predicted FEV1 compared with patients
that promoter sequences with repeat sizes greater or less than five [52]. Although
these studies indicate that ALOX5 variants may affect the levels of cysteinyl
leukotriene synthesis and may be important in predicting how some patients may
733
respond to leukotriene modifiers, there is no indication that ALOX5 variants

contribute to or can predict asthma risk.
The protein FLAP is responsible for interacting with and activating 5-LOX.
FLAP is encoded by the gene ALOX5AP, which is located on chromosome 13q12
and consists of 5 exons dispersed over an approximately 31-kB region of DNA.
No common mutations altering the protein sequence have been identified in
ALOX5AP. Two polymorphisms have been identified in the promoter of
ALOX5AP and have been functionally tested using in vitro gene transcription
reporter assays [58]. These polymorphisms have also been tested for association
with asthma risk in a casecontrol population. This study indicates that the
ALOX5AP polymorphisms probably do not have any effects on gene expression
nor contribute to asthma risk. Additional polymorphisms within the ALOX5A
locus have been identified and have been associated with risk of myocardial
infarction (MI) and stoke [61,62], indicating a possible association with atherosclerotic lesions potentially caused by inflammatory processes. Because of this
link with other inflammatory diseases, ALOX5AP is an excellent example of a
pharmacologically important gene that needs addition mutational analysis by
DNA sequencing, especially in patients that may be poor responders to leukotriene modifier therapy.
LTC4 synthase is the critical enzyme in the leukotriene synthesis pathway that
converts LTA4 to LTC4, which is the precursor for the synthesis of LTD4 and
LTE4 [45]. The gene for LTC4 synthase (LTC4S) is located on chromosome 5q35
and consists of 5 exons dispersed over an approximately 2.5-kB region of DNA.
Although no polymorphisms have been identified in the coding region of LTC4S,
two polymorphisms in noncoding regions have been studied [6367]. One
polymorphism located at 444 (A-444C) bases of the ATG start codon of LTC4S
is located in a putative activator protein-2 binding [44]. Although some functional studies indicate that the A-444C polymorphism is associated with changes
in cysteinyl-leukotriene production [68] and may predict clinical response to
Zafirlukast, conflicting studies have found no functional significance for A-444C.
Association tests for A-444C and a second polymorphism located at IVS1-10
C/A for asthma susceptibility and severity have been negative [67]. Aspirin
intolerant asthma (AIA) occurs in approximately 10% of adult asthmatics and
appears to be related to the production of cysteinyl leukotrienes [44]. After taking
aspirin or other cyclo-oxygenase inhibitors, AIA patients have markedly increase secretion of cysteinyl leukotrienes into their urine and into the lungs [69].
Results for association tests for A-444C with AIA are conflicting [70]; however,
increased expression of LTC4S mRNA expression has been measured in AIA
patients [71].
The genes CYSLT1 and CYSLT2 encode cysteinyl-leukotriene receptors 1
and 2, respectively. CYSLT1 is located on the chromosome Xq13 and consists
of 3 exons dispersed over an approximately 55-kD region of DNA. CYSLT2 is
located on chromosome 13q14 and consists of a single exon covering an approximately 2.5-kB region of DNA. Other than general polymorphisms in the
noncoding regions, very little is known about CYSLT1 polymorphisms. Two
734
hawkins et al
CYSLT2 polymorphisms with potential functional effectsone in the promoter

region at 1220 and one in the coding region (601 A/G) causing the mutation
Met201Valhave been associated with asthma susceptibility [72,73]. In addition, the Met201Val mutation was associated with a fivefold less potency of
the cysteinyl leukotriene LTD4 [73], indicating individuals with this mutation
may have altered responses to leukotriene modifiers such as Montelukast
and Zafirlukast.
The corticosteroid pathway

Corticosteroids (eg, prednisone, beclomethasone, triacinolone) are the most
powerful anti-inflammatory agents known and have multiple anti-inflammatory
effects that include downregulating production of proinflammatory cytokines,
chemokines, adhesion molecules, and mediator-synthesizing enzymes, as well
as inhibition of inflammatory cell recruitment and proliferation in the airways
[3,7476]. Corticosteroids exert their action by binding to the cytoplasmic
glucocorticoid receptors (GR), creating structural and conformational changes in
the peptide that activate the receptor. Once activated, the GR diffuses across the
nuclear membrane and binds to glucocorticoid receptor response elements
(GREs) that lie in regulatory regions of genes, causing increases or decreases in
gene expression [77]. Because the corticosteroid pathway is highly regulated
and affects the expression of a vast array of genes, it is the most complex to
analyze in respect to asthma pharmacogenomics.
The primary target of corticosteroids is the glucocorticoid receptor. However,
unlike G-proteincoupled receptors like beta-2 adrenergic receptor, GR is located
in the cell cytoplasm and is only one part of a larger multiprotein complex. In
addition to GR, a minimum of five additional protein components are necessary
to constitute a minimum steroid-binding complex. These additional proteins
include heat shock protein 90 (hsp90 a and b), heat shock protein 70 (hsc70
and hsp70 [1A and 1B]), heat shock protein 40 (hsp40), heat shock protein
organizing protein (hsp70/hsp90-organizing protein, also termed STIP1), and p23
[78,79]. Several minor proteins called immunophilins (FKBP51 and FKBP52)
have also been identified in the GR complex [80]. The exact functions of the
immunophilins are not clear; however, it appears that the immunophilins may
function to modulate GR diffusion across the nuclear membrane. The assembly of
the GR complex is highly regulated and occurs in a series of steps [77,81,82].
Failure of any of these components to function or assemble properly in the GR
complex would have detrimental effects on activation of GR and transport of GR
across the nuclear membrane, and consequently steroid responsiveness.
Most efforts to understand genetic effects on steroid response have concentrated on the glucocorticoid receptor gene NR3C1. NR3C1 maps to chromosome
5q31 [83,84], a chromosomal region associated with asthma susceptibility
[26,8588]. NR3C1 is a complex gene, consisting of twelve exons [8991] that
are differentially spliced to produce three 80-kd isoforms of the receptor: GRa,
735
GRg, and GRb consisting of 777, 778, and 742 amino acids respectively [77,92].
GRa and GRb are formed by alternative splicing between exons 9a and 9b;
however, only the a isoform is capable of forming an active GR dimer [77]. The
exact function of GRb and how it interacts with GRa is still unclear, but it
has been proposed that GRb may act as a dominant negative inhibitor of GRa
transactivation causing steroid insensitivity in cells where GRb is expression
is high or GRa expression is low [83,93]. Indeed, there have been multiple
studies of steroid-resistant patients who have elevated levels of GRb expression
in airway cells [9496]. A study in mice showing that increased expression of the
GRb in mouse hybridoma cells can convert mouse cells to a steroid-insensitive
phenotype seems to confirm this hypothesis [97]. This mouse study was also able
to demonstrate that GRa and GRb are physically associated in the steroidinsensitive mouse cells, resulting in the formation of inactive GR dimers that
cannot be activated by steroids. The third isoform, GRg, is created by the addition
of a single amino acid as a result of variable splicing between exons 3 and
4 [92,98]. Although GRg is expressed at relatively high levels in various tissues
of healthy individuals [92], a recent study of GRg expression in EBV transformed
B cells suggests that GRg probably does not play a significant role in affecting
steroid sensitivity.
There are three forms of exon 1 in NR3C1: 1A, 1B, and 1C, [89,91]. Each
exon is flanked in the 5V region by a gene, and at least five different exon 1
mRNA splice variants have been detected [89]. Exon 1A is the most distant from
the coding region (ATG start codon is in exon 2) [89,91] and is capable of
producing three of the five exon 1 splice variants (1A1, 1A2, and 1A3). Splice
variant 1A3 is the longest transcript and contains a putative interferon regulatory
binding site and a GRE, which has been shown to bind dexamethasone, resulting
in increased expression of exon 1A3 mRNA splice variant [89]. GRb has also
been shown to bind this GRE, with the potential to negatively affect gene
expression. Exons 1B and 1C are located approximately 31 kb downstream of
exon 1A. Based on in vivo expression performed in cancer cell lines, exons 1B
and 1C appear to be responsible for ubiquitous and tissue-specific expression of
NR3C1 [91]. To date, there are no pharmacogenomic studies describing the
effects of differential splicing of exon 1 on steroid response.
There are a number of reports describing polymorphisms in NR3C1. Several
of these genetic variants have been found to affect receptor binding, GR structure, and transcriptional activity have been described [99104], mostly in patients
with rare familial glucocorticosteroid resistance. Only a few, however, have
been tested for effects on steroid response. Only one very rare coding variant,
Asn363Ser, has been repeatedly identified in the general Caucasian population.
Individuals with this genetic variant have been observed to be more sensitive
to exogenously administered corticosteroids [100]. These individuals also tended
to have higher body mass and lower bone density. Of recent interest is a
polymorphism in the 3V untranslated region of the GRb mRNA [105]. This A/G
polymorphism at +1308 bp after the GRb stop codon (+1308 GRb 3VUTR) lies
within the DNA sequence motif AUUUA, a motif known to control mRNA
736
hawkins et al
stability [106]. Expression studies show that the sequence GUUUA increases the
stability of GRb mRNA resulting in increased mRNA expression and GRb
translation. Individuals with this polymorphism would hypothetically produce
more GRb, which could interfere with formation of functional GR dimers or
could increase negative regulatory control of GR gene expression. Based on this
observation, individuals who have asthma and have a G allele at +1308 GRb
3VUTR could be predisposed to increased airway inflammation because of
increased resistance to endogenous cortisol. Furthermore, these individuals may
also have a lower response to exogenously administered corticosteroids.
The corticosteroid pathway is also regulated by systemic cortisol synthesis.
Secretion of endogenous cortisol is stimulated by physical or mental stress and
is suppressed by negative feedback loops. Stress signals cause secretion of
the hypothalamic peptide corticotropin-releasing hormone (CRH). CRH subsequently binds and activates corticotropin-releasing hormone receptor (CRHR1)
in the pituitary gland, causing stimulation of the production of adrenocorticotropic hormone (ACTH). ACTH moves from the pituitary, where it binds to
ACTH receptors (a G-proteincoupled receptor) that lie in the membrane of cells
in the zona fasiculata and reticularis of the adrenal gland. Activation of the ACTH
receptors increases adenyl cyclase activity, causing intercellular levels of cAMP
to increase. The increase of cAMP levels then activates the final enzymatic
pathway controlling biosynthesis of cortisol from cholesterol. When blood
concentrations of cortisol increase above a certain threshold, cortisol inhibits
CRH secretion from the hypothalamus, resulting in a shutdown of the cortisol
synthesis cascade.
Only one significant genetic study of a gene in the cortisol synthesis pathway
has been performed in individuals who have asthma. Tantisira and colleagues
[107] recently investigated whether polymorphisms in CRHR1 are associated
with improved lung function in asthmatics treated with inhaled corticosteroids.
This study found that a polymorphism located at 1310 bp 3V of exon 3 was
associated with an increase in FEV1 between 8% and 10% compared with the
placebo control group in two separate study populations after 8 weeks of corticosteroid therapy. Haplotype association analysis indicated that one common
CRHR1 haplotype (27%) was also associated with improvement in FEV1. The
authors concluded that patients with detrimental CRHR1 genetic variants may
have a limited ability to produce endogenous cortisol and thus may have a more
favorable response to exogenously administered corticosteroids.
With respect to the importance of corticosteroids in the treatment of asthma,
very little is known about the pharmacogenomics of corticosteroid response in
individuals who have asthma. Currently, a multicenter asthma study (the National
Heart, Lung, and Blood Institute sponsored study, Severe Asthma Research
Program [SARP]) may provide one key to understanding some of the variation in
steroid response observed in asthma. One of the primary phenotypes of severe
asthma is a suboptimal response to continuous high-dose inhaled or oral steroids
to control inflammation. Although severe asthma is phenotypically different from
mild asthma, some of the genetics involved in steroid response may be shared by
737
the two asthma subtypes and thus may be revealed in the genetic arm of the
SARP study.
Summary
It is expected that future treatments will be preceded by genetic tests to
prescribe the most effect asthma medication while lowering the risk of adverse
side effects. However, it will not be necessary to describe all the genetic determinants affecting drug response to apply pharmacogenomics to asthma therapy.
Whether pharmacogenomics becomes common practice may not depend on the
availability of tests, but on factors such as affordability, ease of application, and
ease of interpreting the results.
References
[1] National Asthma Education and Prevention Program. Expert panel report 2. Guidelines for the
diagnosis and management of asthma. NIH Publication No. 974051. Bethesda (MD)7 National
Institutes of Health; 1997.
[2] National Asthma Education and Prevention Program. Executive summary of the NAREPP
expert panel report. Guidelines for the diagnosis and management of asthma. Update on
selected topics 2002. NIH Publication No. 025075. Bethesda (MD)7 National Institutes of
Health; 2002.
[3] Ligget SB, Meyers DA, editors. The genetics of asthma. New York7 Marcel Dekker, Inc.; 1996.
[4] Drazen JM, Silverman EK, Lee TH. Heterogeneity of therapeutic responses in asthma. Br Med
Bull 2000;56:1054 70.
[5] Liggett SB. Pharmacogenetic applications of the human genome project. Nat Med 2001;7:
281 3.
[6] Silverman ES, Hjoberg J, Palmer LJ, et al. Application of pharmacogenetics to the therapeutics
of asthma. In: Huston D, editor. Therapeutic targets of airway inflammation. New York7 Marcel
Dekker; 2002. p. 823 38.
[7] Nelson HS, Weiss ST, Bleecker ER, et aland the SMART Study Group. The Salmeterol
Multicenter Asthma Research Trial (SMART): a comparison of unusual pharmacotherapy for
asthma or usual pharmacotherapy plus salmeterol. Chest 2005, in press.
[8] Evans WE, McLeod HL. Pharmacogenomicsdrug disposition, drug targets, and side effects.
N Engl J Med 2003;348:538 49.
[9] Drysdale CM, McGraw DW, Stack CB, et al. Complex promoter and coding region beta
2-adrenergic receptor haplotypes alter receptor expression and predict in vivo responsiveness.
Proc Natl Acad Sci U S A 2000;97:10483 8.
[10] Reihsaus E, Innis M, MacIntyre N, et al. Mutations in the gene encoding for the beta
2-adrenergic receptor in normal and asthmatic subjects. Am J Respir Cell Mol Biol 1993;8:
334 9.
[11] Green SA, Turki J, Innis M, et al. Amino-terminal polymorphisms of the human beta
2-adrenergic receptor impart distinct agonist-promoted regulatory properties. Biochemistry
1994;33:9414 9.
[12] Dishy V, Landau R, Sofowora GG, et al. Beta2-adrenoceptor Thr164Ile polymorphism is
associated with markedly decreased vasodilator and increased vasoconstrictor sensitivity in
vivo. Pharmacogenetics 2004;14:517 22.
738
hawkins et al
[13] Johnatty SE, Abdellatif M, Shimmin L, et al. Beta 2 adrenergic receptor 5V haplotypes influence
promoter activity. Br J Pharmacol 2002;137:1213 6.
[14] McGraw DW, Forbes SL, Kramer LA, et al. Polymorphisms of the 5V leader cistron of
the human beta2-adrenergic receptor regulate receptor expression. J Clin Invest 1998;102:
1927 32.
[15] McGraw DW, Liggett SB. Coding block and 5 leader cistron polymorphisms of the beta2adrenergic receptor. Clin Exp Allergy 1999;29(Suppl 4):43 5.
[16] Parola AL, Kobilka BK. The peptide product of a 5V leader cistron in the beta 2 adrenergic
receptor mRNA inhibits receptor synthesis. J Biol Chem 1994;269:4497 505.
[17] Scott MG, Swan C, Wheatley AP, Hall IP. Identification of novel polymorphisms within
the promoter region of the human beta2 adrenergic receptor gene. Br J Pharmacol 1999;126:
841 4.
[18] Timmermann B, Li GH, Luft FC, et al. Novel DNA sequence differences in the beta2adrenergic receptor gene promoter region. Hum Mutat 1998;11:343 4.
[19] Martinez FD, Graves PE, Baldini M, et al. Association between genetic polymorphisms of
the beta2-adrenoceptor and response to albuterol in children with and without a history of
wheezing. J Clin Invest 1997;100:3184 8.
[20] Choudhry S, Ung N, Avila PC, et al. Pharmacogenetic differences in response to albuterol between Puerto Ricans and Mexicans with asthma. Am J Respir Crit Care Med 2005;171:
563 70.
[21] Taylor DR, Drazen JM, Herbison GP, et al. Asthma exacerbations during long term beta agonist
use: influence of beta(2) adrenoceptor polymorphism. Thorax 2000;55:762 7.
[22] Hancox RJ, Sears MR, Taylor DR. Polymorphism of the beta2-adrenoceptor and the response
to long-term beta2-agonist therapy in asthma. Eur Respir J 1998;11:589 93.
[23] Israel E, Drazen JM, Liggett SB, et al. The effect of polymorphisms of the beta(2)-adrenergic
receptor on the response to regular use of albuterol in asthma. Am J Respir Crit Care Med
2000;162:75 80.
[24] Israel E, Chinchilli VM, Ford JG, et al. Use of regularly scheduled albuterol treatment
in asthma: genotype-stratified, randomised, placebo-controlled cross-over trial. Lancet 2004;
364:1505 12.
[25] Cookson WO. Asthma genetics. Chest 2002;121(Suppl 3):7S 13S.
[26] Panhuysen CI, Meyers DA, Postma DS, et al. The genetics of asthma and atopy. Allergy
1995;50:863 9.
[27] Postma DS, Bleecker ER, Amelung PJ, et al. Genetic susceptibility to asthmabronchial
hyperresponsiveness coinherited with a major gene for atopy. N Engl J Med 1995;333:
894 900.
[28] Damato M, Vitiani LR, Petrelli G, et al. Association of persistent bronchial hyperresponsiveness with beta2-adrenoceptor (ADRB2) haplotypes. A population study. Am J Respir Crit Care
Med 1998;158:1968 73.
[29] Gao JM, Lin YG, Qiu CC, et al. Association of polymorphism of human beta 2-adrenergic
receptor gene and bronchial asthma. Zhongguo Yi Xue Ke Xue Yuan Xue Bao 2002;24:
626 31 [in Chinese].
[30] Hall IP, Wheatley A, Wilding P, et al. Association of Glu 27 beta 2-adrenoceptor polymorphism
with lower airway reactivity in asthmatic subjects. Lancet 1995;345:1213 4.
[31] Hall IP. Beta2-adrenoceptor polymorphisms and asthma. Clin Exp Allergy 1999;29:1151 4.
[32] Holloway JW, Dunbar PR, Riley GA, et al. Association of beta2-adrenergic receptor
polymorphisms with severe asthma. Clin Exp Allergy 2000;30:1097 103.
[33] Hopes E, McDougall C, Christie G, et al. Association of glutamine 27 polymorphism of beta 2
adrenoceptor with reported childhood asthma: population based study. BMJ 1998;316:664.
[34] Joos L, Weir TD, Connett JE, et al. Polymorphisms in the beta2 adrenergic receptor and
bronchodilator response, bronchial hyperresponsiveness, and rate of decline in lung function
in smokers. Thorax 2003;58:703 7.
[35] Ohe M, Munakata M, Hizawa N, et al. Beta 2 adrenergic receptor gene restriction fragment
length polymorphism and bronchial asthma. Thorax 1995;50:353 9.
739
[36] Ramsay CE, Hayden CM, Tiller KJ, et al. Polymorphisms in the beta2-adrenoreceptor gene
are associated with decreased airway responsiveness. Clin Exp Allergy 1999;29:1195 203.
[37] Santillan AA, Camargo Jr CA, Ramirez-Rivera A, et al. Association between beta2adrenoceptor polymorphisms and asthma diagnosis among Mexican adults. J Allergy Clin
Immunol 2003;112:1095 100.
[38] Silverman EK, Kwiatkowski DJ, Sylvia JS, et al. Family-based association analysis of beta2adrenergic receptor polymorphisms in the childhood asthma management program. J Allergy
Clin Immunol 2003;112:870 6.
[39] Taylor DR, Kennedy MA. Genetic variation of the beta(2)-adrenoceptor: its functional and
clinical importance in bronchial asthma. Am J Pharmacogenomics 2001;1:165 74.
[40] Turki J, Pak J, Green SA, et al. Genetic polymorphisms of the beta 2-adrenergic receptor
in nocturnal and nonnocturnal asthma. Evidence that Gly16 correlates with the nocturnal
phenotype. J Clin Invest 1995;95:1635 41.
[41] Turner SW, Khoo SK, Laing IA, et al. beta2 adrenoceptor Arg16Gly polymorphism, airway
responsiveness, lung function and asthma in infants and children. Clin Exp Allergy 2004;34:
1043 8.
[42] Wang Z, Chen C, Niu T, et al. Association of asthma with beta(2)-adrenergic receptor gene
polymorphism and cigarette smoking. Am J Respir Crit Care Med 2001;163:1404 9.
[43] Billington CK, Hall IP, Mundell SJ, et al. Inflammatory and contractile agents sensitize specific
adenylyl cyclase isoforms in human airway smooth muscle. Am J Respir Cell Mol Biol 1999;
21:597 606.
[44] Dewar JC, Hall IP. Personalised prescribing for asthmais pharmacogenetics the answer?
J Pharm Pharmacol 2003;55:279 89.
[45] Fenech A, Hall IP. Pharmacogenetics of asthma. Br J Clin Pharmacol 2002;53:3 15.
[46] Gross NJ. Tiotropium bromide. Chest 2004;126:1946 53.
[47] McGraw DW, Almoosa KF, Paul RJ, et al. Antithetic regulation by beta-adrenergic receptors of
Gq receptor signaling via phospholipase C underlies the airway beta-agonist paradox. J Clin
Invest 2003;112:619 26.
[48] Donfack J, Kogut P, Forsythe S, et al. Sequence variation in the promoter region of the cholinergic receptor muscarinic 3 gene and asthma and atopy. J Allergy Clin Immunol 2003;111:
527 32.
[49] Fenech AG, Ebejer MJ, Felice AE, et al. Mutation screening of the muscarinic M(2) and M(3)
receptor genes in normal and asthmatic subjects. Br J Pharmacol 2001;133:43 8.
[50] Fenech AG, Billington CK, Swan C, et al. Novel polymorphisms influencing transcription
of the human CHRM2 gene in airway smooth muscle. Am J Respir Cell Mol Biol 2004;30:
678 86.
[51] Yamamoto T, Yamashita N, Kuwabara M, et al. Mutation screening of the muscarinic m2 and
m3 receptor genes in asthmatics, outgrow subjects, and normal controls. Ann Genet 2002;45:
109 13.
[52] Drazen JM, Yandava CN, Dube L, et al. Pharmacogenetic association between ALOX5 promoter genotype and the response to anti-asthma treatment. Nat Genet 1999;22:168 70.
[53] Samuelsson B, Haeggstrom JZ, Wetterholm A. Leukotriene biosynthesis. Ann N Y Acad Sci
1991;629:89 99.
[54] Dixon RA, Diehl RE, Opas E, et al. Requirement of a 5-lipoxygenase-activating protein for
leukotriene synthesis. Nature 1990;343:282 4.
[55] Hall IP. Pharmacogenetics of asthma. Eur Respir J 2000;15:449 51.
[56] Drazen JM. Leukotrienes in asthma and rhinitis. In: Busse W, Holgate ST, editors. Asthma
and rhinitis. Oxford (UK)7 Blackford Scientific Publications; 1995. p. 838 50.
[57] Choi JH, Park HS, Oh HB, et al. Leukotriene-related gene polymorphisms in ASA-intolerant
asthma: an association with a haplotype of 5-lipoxygenase. Hum Genet 2004;114:337 44.
[58] Sayers I, Barton S, Rorke S, et al. Promoter polymorphism in the 5-lipoxygenase (ALOX5)
and 5-lipoxygenase-activating protein (ALOX5AP) genes and asthma susceptibility in a Caucasian population. Clin Exp Allergy 2003;33:1103 10.
740
hawkins et al
[59] Samuelsson B, Hoshiko S, Radmark O. Characterization of the promoter of the human

5-lipoxygenase gene. Adv Prostaglandin Thromboxane Leukot Res 1991;21A:1 8.
[60] In KH, Asano K, Beier D, et al. Naturally occurring mutations in the human 5-lipoxygenase
gene promoter that modify transcription factor binding and reporter gene transcription. J Clin
Invest 1997;99:1130 7.
[61] Helgadottir A, Manolescu A, Thorleifsson G, et al. The gene encoding 5-lipoxygenase
activating protein confers risk of myocardial infarction and stroke. Nat Genet 2004;36:233 9.
[62] Helgadottir A, Gretarsdottir S, St Clair D, et al. Association between the gene encoding
5-lipoxygenase-activating protein and stroke replicated in a Scottish population. Am J Hum
Genet 2005;76:505 9.
[63] Sampson AP, Siddiqui S, Buchanan D, et al. Variant LTC(4) synthase allele modifies cysteinyl
leukotriene synthesis in eosinophils and predicts clinical response to zafirlukast. Thorax 2000;
55(Suppl 2):S28 31.
[64] Currie GP, Lima JJ, Sylvester JE, et al. Leukotriene C4 synthase polymorphisms and responsiveness to leukotriene antagonists in asthma. Br J Clin Pharmacol 2003;56:422 6.
[65] Isidoro-Garcia M, Davila I, Moreno E, et al. Analysis of the leukotriene C4 synthase A-444C
promoter polymorphism in a Spanish population. J Allergy Clin Immunol 2005;115:206 7.
[66] Kawagishi Y, Mita H, Taniguchi M, et al. Leukotriene C4 synthase promoter polymorphism
in Japanese patients with aspirin-induced asthma. J Allergy Clin Immunol 2002;109:936 42.
[67] Kedda MA, Shi J, Duffy D, et al. Characterization of two polymorphisms in the leukotriene C4
synthase gene in an Australian population of subjects with mild, moderate, and severe asthma.
[68] Sanak M, Pierzchalska M, Bazan-Socha S, et al. Enhanced expression of the leukotriene C(4)
synthase due to overactive transcription of an allelic variant associated with aspirin-intolerant
asthma. Am J Respir Cell Mol Biol 2000;23:290 6.
[69] Sampson AP, Cowburn AS, Sladek K, et al. Profound overexpression of leukotriene C4
synthase in bronchial biopsies from aspirin-intolerant asthmatic patients. Int Arch Allergy
Immunol 1997;113:355 7.
[70] Van Sambeek R, Stevenson DD, Baldasaro M, et al. 5V flanking region polymorphism of the
gene encoding leukotriene C4 synthase does not correlate with the aspirin-intolerant asthma
phenotype in the United States. J Allergy Clin Immunol 2000;106(1 Pt 1):72 6.
[71] Sanak M, Pierzchalska M, Bazan-Socha S, et al. Enhanced expression of the leukotriene C(4)
synthase due to overactive transcription of an allelic variant associated with aspirin-intolerant
asthma. Am J Respir Cell Mol Biol 2000;23:290 6.
[72] Fukai H, Ogasawara Y, Migita O, et al. Association between a polymorphism in cysteinyl
leukotriene receptor 2 on chromosome 13q14 and atopic asthma. Pharmacogenetics 2004;14:
683 90.
[73] Pillai SG, Cousens DJ, Barnes AA, et al. A coding polymorphism in the CYSLT2 receptor with
reduced affinity to LTD4 is associated with asthma. Pharmacogenetics 2004;14:627 33.
[74] Pelaia G, Vatrella A, Cuda G, et al. Molecular mechanisms of corticosteroid actions in chronic
inflammatory airway diseases. Life Sci 2003;72:1549 61.
[75] Umland SP, Schleimer RP, Johnston SL. Review of the molecular and cellular mechanisms
of action of glucocorticoids for use in asthma. Pulm Pharmacol Ther 2002;15:35 50.
[76] Walsh GM, Sexton DW, Blaylock MG. Corticosteroids, eosinophils and bronchial epithelial cells: new insights into the resolution of inflammation in asthma. J Endocrinol 2003;178:
37 43.
[77] Muller M, Renkawitz R. The glucocorticoid receptor. Biochim Biophys Acta 1991;1088:
171 82.
[78] Dittmar KD, Banach M, Galigniana MD, et al. The role of DnaJ-like proteins in glucocorticoid
receptor.hsp90 heterocomplex assembly by the reconstituted hsp90.p60.hsp70 foldosome complex. J Biol Chem 1998;273:7358 66.
[79] Kosano H, Stensgard B, Charlesworth MC, et al. The assembly of progesterone receptor-hsp90
complexes using purified proteins. J Biol Chem 1998;273:32973 9.
741
[80] Pratt WB, Toft DO. Steroid receptor interactions with heat shock protein and immunophilin
chaperones. Endocr Rev 1997;18:306 60.
[81] DeRijk RH, Schaaf M, de Kloet ER. Glucocorticoid receptor variants: clinical implications.
J Steroid Biochem Mol Biol 2002;81:103 22.
[82] Pratt WB, Silverstein AM, Galigniana MD. A model for the cytoplasmic trafficking of signalling proteins involving the hsp90-binding immunophilins and p50cdc37. Cell Signal 1999;
11:839 51.
[83] Francke U, Foellmer BE. The glucocorticoid receptor gene is in 5q31-q32 [corrected].
Genomics 1989;4:610 2.
[84] Gehring U. The structure of glucocorticoid receptors. J Steroid Biochem Mol Biol 1993;45:
183 90.
[85] Marsh DG, Neely JD, Breazeale DR, et al. Total serum IgE levels and chromosome 5q. Clin
Exp Allergy 1995;25(Suppl 2):79 83.
[86] Martinez FD, Solomon S, Holberg CJ, et al. Linkage of circulating eosinophils to markers on
chromosome 5q. Am J Respir Crit Care Med 1998;158:1739 44.
[87] Palmer LJ, Daniels SE, Rye PJ, et al. Linkage of chromosome 5q and 11q gene markers to
asthma-associated quantitative traits in Australian children. Am J Respir Crit Care Med 1998;
158:1825 30.
[88] Wilkinson J, Holgate ST. Evidence for and against chromosome 5q as a region of interest in
asthma and atopy. Clin Exp Allergy 1996;26:861 4.
[89] Breslin MB, Geng CD, Vedeckis WV. Multiple promoters exist in the human GR gene, one
of which is activated by glucocorticoids. Mol Endocrinol 2001;15:1381 95.
[90] Encio IJ, Detera-Wadleigh SD. The genomic structure of the human glucocorticoid receptor.
J Biol Chem 1991;266:7182 8.
[91] Nunez BS, Vedeckis WV. Characterization of promoter 1B in the human glucocorticoid
receptor gene. Mol Cell Endocrinol 2002;189:191 9.
[92] Rivers C, Levy A, Hancock J, et al. Insertion of an amino acid in the DNA-binding domain of
the glucocorticoid receptor as a result of alternative splicing. J Clin Endocrinol Metab 1999;
84:4283 6.
[93] Leung DY, Bloom JW. Update on glucocorticoid action and resistance. J Allergy Clin Immunol
2003;111:3 22.
[94] Christodoulopoulos P, Leung DY, Elliott MW, et al. Increased number of glucocorticoid
receptor-beta-expressing cells in the airways in fatal asthma. J Allergy Clin Immunol 2000;
106:479 84.
[95] Hamid QA, Wenzel SE, Hauk PJ, et al. Increased glucocorticoid receptor beta in airway cells
of glucocorticoid-insensitive asthma. Am J Respir Crit Care Med 1999;159:1600 4.
[96] Sousa AR, Lane SJ, Cidlowski JA, et al. Glucocorticoid resistance in asthma is associated with
elevated in vivo expression of the glucocorticoid receptor beta-isoform. J Allergy Clin Immunol
2000;105:943 50.
[97] Hauk PJ, Goleva E, Strickland I, et al. Increased glucocorticoid receptor Beta expression
converts mouse hybridoma cells to a corticosteroid-insensitive phenotype. Am J Respir Cell
Mol Biol 2002;27:361 7.
[98] Ray DW, Davis JR, White A, et al. Glucocorticoid receptor structure and function in
glucocorticoid-resistant small cell lung carcinoma cells. Cancer Res 1996;56:3276 80.
[99] Bray PJ, Cotton RG. Variations of the human glucocorticoid receptor gene (NR3C1):
pathological and in vitro mutations and polymorphisms. Hum Mutat 2003;21:557 68.
[100] Huizenga NA, Koper JW, de Lange P, et al. A polymorphism in the glucocorticoid receptor
gene may be associated with and increased sensitivity to glucocorticoids in vivo. J Clin
Endocrinol Metab 1998;83:144 51.
[101] Malchoff DM, Brufsky A, Reardon G, et al. A mutation of the glucocorticoid receptor in
primary cortisol resistance. J Clin Invest 1993;91:1918 25.
[102] Rivers C, Levy A, Hancock J, et al. Insertion of an amino acid in the DNA-binding domain of
the glucocorticoid receptor as a result of alternative splicing. J Clin Endocrinol Metab 1999;
84:4283 6.
742
hawkins et al
[103] Strasser-Wozak EM, Hattmannstorfer R, Hala M, et al. Splice site mutation in the glucocorticoid receptor gene causes resistance to glucocorticoid-induced apoptosis in a human acute
leukemic cell line. Cancer Res 1995;55:348 53.
[104] Vottero A, Kino T, Combe H, et al. A novel, C-terminal dominant negative mutation of the GR
causes familial glucocorticoid resistance through abnormal interactions with p160 steroid
receptor coactivators. J Clin Endocrinol Metab 2002;87:2658 67.
[105] Hawkins GA, Mychaleckyj JC, Zheng SL, et al. Germline sequence variants of the LZTS1 gene
are associated with prostate cancer risk. Cancer Genet Cytogenet 2002;137:1 7.
[106] Schaaf MJ, Cidlowski JA. AUUUA motifs in the 3VUTR of human glucocorticoid receptor
alpha and beta mRNA destabilize mRNA and decrease receptor protein expression. Steroids
2002;67:627 36.
[107] Tantisira KG, Lake S, Silverman ES, et al. Corticosteroid pharmacogenetics: association of
sequence variants in CRHR1 with improved lung function in asthmatics treated with inhaled
corticosteroids. Hum Mol Genet 2004;13:1353 9.

25 (2005) 743 755
New Approaches to Understanding the

Genetics of Asthma
Center for Human Genomics, Wake Forest University School of Medicine, Medical Center Boulevard,
Winston-Salem, NC 27157, USA
Asthma is an inflammatory airways disease caused by an interaction between

susceptibility genes and a diverse group of environmental factors (Fig. 1). It
is now clear that there is no single susceptibility gene that confers major risk,
but more likely a series of genes that increase risk for asthma or other atopic
conditions after exposure to environmental triggers.
Evidence for a familial aggregation of asthma and bronchial hyperresponsiveness (BHR) has been consistently observed in many twin and family studies.
However, in contrast to the consistent findings of genetic susceptibility to the
disease, it has been difficult to identify genes for asthma from either linkage
or association studies, and evidence for a specific gene may not be replicated
in additional populations. A combination of several factors, such as differences
in phenotypic characterization and diagnostic approaches; a significant degree of
genetic heterogeneity where many variants in multiple genes may influence
predisposition to asthma; limitations in selecting sequence variants and specific
candidate genes to study; lack of statistical power to detect sequence variants
with modest effects because of small study population size; and inability to detect
interaction between genes, likely contribute to this difficulty.
There are several new approaches that are now being applied to genetic studies
in common diseases, including: (1) investigating genegene interaction in family
studies to determine interactions between susceptibility genes, (2) using man
mouse homology mapping to compare results from the two species and map
E-mail address: dmeyers@wfubmc.edu

doi:10.1016/j.iac.2005.09.002
744
meyers
Gene 1
Gene 2
Gene 3
Environment
Asthma
Fig. 1. Multilocus interactions. For common diseases, such as asthma and allergy, there are multiple
susceptibility genes that interact with each other and the environment to cause disease and affect
disease severity.
genes, and (3) performing genome-wide single nucleotide polymorphism (SNP)

mapping in association studies to find genes with modest effects.
Genegene interactions
Genegene interaction is expected in a common disease such as asthma where
it is clear that there are multiple susceptibility genes. It is relatively easy to
perform genegene interaction analyses in association studies of cases and controls. For example, there is interaction between polymorphisms in IL4 and IL4Ra,
which increase risk for developing asthma [1]. However, it is more difficult to
perform such studies in families using linkage approaches.
In family studies, evidence from genome-wide screening and linkage analysis
for interactive effects between genes on different chromosomes would facilitate
further gene mapping and positional cloning. In addition, previous genome-wide
screen linkage analyses have not shown consistent results for asthma in different
family populations. Gene-by-gene interactions may contribute to this lack of
reproducibility in genome-wide linkage scans.
Asthma-related phenotypes that have been used in genetic studies include an
asthma diagnosis and medication use; bronchial hyperresponsiveness (BHR);
alterations in pulmonary function and markers of allergic responsiveness, such
as total serum IgE levels; and skin test responsiveness to common allergens. Unfortunately, the newer inflammatory biomarkers such as expired NO and assessment of induced sputum have not been performed in family studies, but are now
being included in asthma case-control studies.
Genome-wide screens for asthma or bronchial hyperresponsiveness have been
performed in multiple family studies, including those by Daniels and colleagues
[2] in Caucasians, Wjst and colleagues [3] in the German population, Dizier and
colleagues [4] in a French population, Ober and colleagues [5] in the inbred
Hutterite population, Yokouchi and colleagues [6] in Japanese families, Laitinen
and colleagues [7] in the Finnish population, Xu and colleagues [8] in three
different United States ethnic populations from the Collaborative Studies on the
Genetics of Asthma, Xu and colleagues [9] in a Chinese population, and our
study with our Dutch collaborators in 200 Dutch families [10]. Several posi-
genetics of asthma
745
tionally cloned genes have resulted from these studies, including ADAM33 on
20p [11], PHF11 on chromosome 13 for total serum IgE levels and asthma [12],
DPP10 on chromosome 2q for asthma [13], GPRA on 7p for asthma related
traits [14], and most recently, HLA-G for asthma susceptibility on chromosome
6p [15].
The results from the ongoing worldwide genetic studies of asthma are exciting, but there are several issues that need to be addressed. First, multiple
genome-wide screens have been performed, but there has not been consistent
replication across studies for many of the linked regions, making it difficult to
choose a chromosomal region for the intensive laboratory effort that is required
for gene identification. Linkage regions tend to be broad and contain many genes
that need evaluation. For example, in the recent paper by Nicolae and colleagues
[15], 19 genes and two pseudogenes were studied by genotyping SNPs every
10 to 20 kb across the linked region. Second, replication studies are very important to determine the relevancy of a postulated gene to the general population.
Replication studies have been performed for some, but not all, of the genes for
asthma susceptibility. These studies require access to multiple well-characterized
asthma populations and controls.
Genetic and environmental factors are important in the development of
asthma. However, it is difficult to obtain accurate environmental data on earlylife exposures (before the onset of asthma), especially in family studies. We have
analyzed exposure to passive smoke as a confounder in two linkage studies with
significant results [10,16]. Positional cloning has been successful in identifying
asthma susceptibility genes without accounting for environmental factors.
Traditional linkage analysis tests for segregation between disease phenotype
and genetic markers on one chromosomal location at a time. This approach fails
to account for the plausible scenario that evidence for linkage (gene effects) at
one location is modified by the evidence for linkage (gene effects) at another
location. Ordered subset analysis (OSA) [17] is a new powerful approach that
may be used to evaluate whether linkage at one location is independent of linkage at another location and provides a framework for testing for statistical
significance for genegene interactions. Similar approaches have already been
used in analysis of mouse data for several common diseases, including hypertension and high-density lipoprotein (HDL) cholesterol.
This new analytical approach has already been implemented in family studies
of prostate cancer to perform pairwise genome-by-genome analyses to detect
genegene interactions. Genegene interaction in genetic linkage studies of
prostate cancer was performed to improve the power to detect genes that increase
susceptibility to the development of prostate cancer. Prostate cancer linkages
were systematically screened by modeling two-locus (pairwise) genegene interactions for all possible pairs of loci across the genome in 188 families ascertained
for prostate cancer [18]. The strongest evidence of an interactive effect was for
loci on chromosomes 10q and 12p. As shown in Fig. 2, the highest log of odds
(LOD) score difference (between the original genome-wide and the genomeby-genome analysis) was 2.63. The evidence for interaction increased after
746
meyers
Fig. 2. Genome-by-genome analysis: mapping of two genes for prostate cancer. Evidence for gene
gene interaction was obtained from a family study of prostate cancer. The highest LOD score was
obtained near the candidate genes PTEN and CDKN1B. (From Xu J, Langefeld CD, Zheng SL, et al.
Interaction effect of PTEN and CDKN1B chromosomal regions on prostate cancer linkage. Hum
Genet 2004;115:258; with permission.)
adding fine mapping markers to each region. Two strong candidate genes reside
in these regions: PTEN on chromosome 10 and CDKN1B on chromosome 12.
These genes have previously been shown to have a strong interactive effect in the
mouse, whereby a knockout of both genes led to early development of prostate
cancer. This study shows the potential power of this new approach. Separately,
neither of these genes was shown to have a strong effect, but only when they
were considered jointly.
747
genetics of asthma
Based on these exciting findings in prostate cancer, this approach may be

useful in other common diseases with a genetic component. Therefore, preliminary analyses have been performed on families ascertained for asthma. In
the previous National Heart, Lung, and Blood Institute (NHLBI) Collaborative
Study of the Genetics of Asthma (CSGA), 266 families were ascertained through
two siblings who had asthma and all family members were characterized and
genotyped [19]. A genome-wide linkage scan for asthma-susceptibility genes was
previously performed in this population [8]. The strongest evidence for linkage
was to chromosome 6p21 in the Caucasian families, chromosome 11q21 in the
African-American families, chromosome 1p32 in the Hispanic families, and
chromosome 14q32 in the total family set of 266 families. At that time, it was
only possible to perform a two-locus analysis for a small number of chromosomal
regions because of computational constraints and lack of statistical methodology
to determine the level of significance. However, support for genegene
interaction as evidenced by an increase in the LOD score when analyzing two
regions jointly was obtained even at that time (Fig. 3). As shown in Fig. 3, the
subset of families who had evidence for linkage to either chromosome 11 or
14 showed evidence for linkage to chromosome 12 (which was not detected in
the single-locus, genome-wide analyses). In addition, the subset of families who
had evidence for linkage to either chromosome 11 or 1 showed evidence for joint
linkage to chromosome 8. The subset of families who had evidence for linkage to
either chromosome 14 or 1 showed evidence for joint linkage to chromosome 15,
and finally, the families who had evidence for linkage to chromosome 1 also
showed evidence for linkage to chromosome 5 (see Fig. 3).
A preliminary genome-by-genome analysis has been performed in these same
African-American and Caucasian families to test for evidence of interaction
between genes in all chromosomal regions [20]. OSA was used to evaluate
whether linkage at one location is independent of linkage at another location [17].
For each possible pair of chromosomal locations (locus a on chromosome A and
b on chromosome B using a 1-cM grid), this method assesses whether linkage
evidence at a on chromosome A is independent of the magnitude of linkage for
12
14
11
15
8
1
5
Fig. 3. Collaborative Study of the Genetics of Asthma: summary of conditional analysis on chromosomes 1, 11, 14. Previous conditional analyses for genegene interaction in asthma before the
development of new analytical methods that now allow for genome-by-genome analyses. For
example, evidence for linkage to chromosome 8 was obtained conditional on linkage to either chromosome 11 or 1.
748
meyers
b on chromosome B. Specifically, families are ranked based on the relative

magnitude of evidence for linkage at location b and cumulative LOD scores are
calculated. The final test statistic is the largest observed cumulative LOD score,
and the significance of this statistic is evaluated using a permutation test. Under
the null hypothesis, the relative magnitudes of the LOD scores at location a are
independent of the rankings based on location b.
The highest LOD difference (equal to the difference between the conditional
pairwise and unconditional single-locus LOD scores) in the Caucasian families
was for chromosome 2 at 60.4 cM conditional on chromosome 14 at 16.7 cM
(LOD = 4.21, P = .005), and for chromosome 15 at 65.4 cM conditional on 5 at
30 cM in the African-American families (LOD = 3.79, P = .0001). The second
highest LOD difference in the Caucasian families was for chromosome 20p
conditional on chromosome 8 (LOD = 4.19, P = .002), and also chromosome 20p
in the African-American families but interacting with a locus on chromosome 6
(LOD = 3.61, P b.005). The linkage to 20p is in the region where the ADAM33
gene has been cloned for asthma [11] and replicated in a CSGA case-control
population [21].
In summary, there are now approaches that may be used to assess evidence
for genegene interaction in family studies and approaches to study unrelated
individuals. In families, this approach may be useful in detecting narrow regions with the strongest evidence for linkage, and facilitating fine mapping and
gene identification.
Manmouse homology mapping

It is hypothesized that there are multiple genes that are important in determining susceptibility to most common diseases. Many of these genes will be
observed in mouse studies for a similar, although not necessarily an identical,
phenotype. Homology mappingcomparing syntenic chromosomal regions in
mouse and manhas proven to be a powerful tool in genetic studies. During
evolution, the mammalian chromosomes broke and rearranged; for example,
217 homologous blocks define the humanmouse homologies [22], which implies that each 20 cM region in the mouse may be broken into three to four
regions homologous to different human chromosomes.
For multiple common diseases, gene mapping studies using genome-wide
screening approaches have been performed in humans and mice. Korstanje and
Paigen [23] observed evidence for homology mapping in several different
common diseases where linkage studies have been performed in mouse and man.
Homology mapping involves comparison of linked regions from both species, as
demonstrated in Fig. 4 [24]. This methodology has proven powerful in mapping
genes for cardiovascular traits such as HDL. As shown in Fig. 4, there are
homologous regions between mouse and man for quantitative trait loci for HDL,
low-density lipoprotein, and triglycerides. The human chromosomes are shown
genetics of asthma
749
Fig. 4. The homologous regions between mouse and man for quantitative trait loci for HDL, lowdensity lipoprotein, and triglycerides are displayed. The human chromosomes are shown with the bars
demonstrating the linked regions from family studies. The symbols show where there is linkage
from mouse studies for homologous regions in man. (From Wang X, Paigen B. Genome-wide search
for new genes controlling plasma lipid concentration in mice and man. Curr Opin Lipidol 2005;16:
12737; with permission.)
with the bars, demonstrating the linked regions from family studies. The symbols
show where there is linkage from mouse studies for homologous regions. This
representation allows identification of regions with the strongest evidence for
linkage from human and mouse studies and may be used decrease the size of the
region of interest, thereby facilitating gene identification.
Using the known homology between the two species provides another
approach for narrowing chromosomal regions of interest and for gene identification. It may not be sufficient to study one species alone because even gene
750
meyers
identification for common traits and diseases in the mouse is not straightforward, and murine models often do not parallel completely the disorder in man.
Linkage analysis in mouse or man results in large linked regions, which contain
many genes that need to evaluated for association with the disease or trait.
Homology mapping is a useful approach that, when combined with other approaches (such as the genegene interaction analyses discussed earlier), may
facilitate gene identification in common diseases such as asthma.
In the mouse, the primary asthma phenotype available is variation in airways
responsiveness (AR). It is clear that there are inherent differences between the
inbred strains to measures of pulmonary function [25] and allergen-induced response [26]. The AR phenotype is not only strain-specific but also can be increased after allergen exposure in passively sensitized mice [27], showing the
relationship to inflammatory changes in the airways. Although BHR in humans is
not the same as asthma, the two phenotypes are strongly correlated. The presence
of BHR is an important component of asthma. In human studies, linkage studies
of BHR and asthma have shown similar results supporting the value of this
phenotype for genetic analysis [10]. For example, the BHR phenotype has been
used to narrow the linkage region in the family studies that resulted in the
positional cloning of ADAM33 [11]. In addition, although these phenotypes in the
mouse differ from the human phenotypes, there is already evidence of homology
for linkage regions detected in studies for asthma in man and BHR in the mouse.
Genome screens in the mouse for measures of AR have shown evidence for
linkage to homologous regions in humans where there is evidence for linkage for
BHR on asthma, including human chromosomes 2q and 5q [2831]. Zang and
colleagues [29] found evidence for five potential linked loci, four of which
correspond to human regions where studies have shown evidence for linkage.
These include murine chromosomes 9, 10, 11, and 27, with homologous regions
to chromosomes 11q, 12q, 5q, and 6p [29]. For the positionally cloned gene
ADAM33, there is evidence for linkage to a syntenic region on mouse chromosome 2 that has been linked to AR [28]. In addition, homologous regions were
seen between mouse and man for the two positionally cloned genes: PHF11 on
human chromosomal 13 [12,29] and DPP10 on chromosome 2q [28,30]. Although AR in the mouse is not a perfect animal model of asthma, the number
of homologous chromosomal regions that have already been observed in both
species demonstrate the potential power of homology mapping for genetic studies
of asthma.
In the mouse, statistical methods have been developed previously to test for
genegene interaction using different models, including a general model of
genome-by-genome analysis and genome-by-genome analysis to test specific
models, such as additive effects from each region or quantitative trait loci (QTL)
[32]. As with the methods for human studies described earlier, these pairwise
genome-wide screen analyses are performed to detect pairs of chromosomal
regions with a high probability of containing interacting loci. Permutation testing and simulation are used to determine statistical significance, making this a
computer-intensive process (although not as computer intensive as it is for human
genetics of asthma
751
family data). Using this analytical pairwise genome-wide approach, evidence for
interacting genetic loci for airway hyperresponsiveness on murine chromosomes
2 and 6 has been observed in analysis of recombinant congenic mice created
by backcrossing A/J mice with C57BL/6J mice [33]. The regions detected correspond to syntenic regions on seven human chromosomes, demonstrating the
usefulness of these approaches in mouse and man.
In summary, the use of known homology between DNA sequences in animal
models and humans is another potentially important technique for gene mapping
in common diseases, including asthma, allergy, and related phenotypes. In
addition, genegene interaction analyses may be performed in multiple species
for similar phenotypes. These techniques should be considered in designing
genetic studies in common diseases to replicate chromosomal regions of linkage
and narrow these regions to facilitate gene identification. In genome analysis,
there are advantages and disadvantages to mouse models of asthma and related
phenotypes. However, examples of homology between linked regions for asthma,
BHR, and related phenotypes have already been observed between mouse and
man, including evidence for genegene interaction.
Genome-wide association studies

The third area of interest is the development of molecular and analytical
methods for genome-wide association studies using hundreds of thousands of
SNPs. These studies are now technically feasible and are beginning to be performed in several common diseases. In general, association studies are performed
by comparing cases that have the disease or phenotype of interest with normal
controls. Qualitative (eg, disease, no disease) and quantitative analyses (eg, level
of lung function, degree of bronchial hyperresponsiveness) may be performed.
Usually these studies are performed for one or several candidate genes that are
studied because of their known biologic function or position in the genome. The
problem with this approach is that there are many candidate genes for most
common diseases and it is difficult to interpret results from studies of individual genes. With the development of high throughput genotyping systems,
analysis of all genes in a relevant pathway has become a feasible approach.
However, there are still the issues that multiple pathways are involved in disease
processes and that genes of unknown function may also be important. Therefore,
the idea of being able to genotype SNPs across the whole genome in case-control
populations to determine the genes with greatest effect is very intriguing.
Dense SNP maps may now be performed for family and case-control studies.
This process involves genotyping hundreds of thousands of SNPs using chip
technology, which is high-throughput and accurate. In some ways, this approach
is not new but more comprehensive when compared with the candidate gene
approach currently used in association studies [34]. Obviously this genome-wide
approach generates large data sets for analyses and has raised several computa-
752
meyers
tional and statistical issues that need to be discussed. These issues include the
density of the SNP map to be used and the size of the population with appropriate phenotype data. A key issue is determination of statistical significance, because multiple testing will occur given the large number of SNPs that will
be genotyped.
Given the presence of linkage disequilibrium (similar to correlation) between
SNPs in a gene or small segment of DNA, it is not necessary to genotype all
SNPs. Instead, approaches are being used to capture the minimum number
of SNPs that will give the relevant information for a gene or region, such as
haplotype-tagging SNPs [35]. In reality, for the investigator choosing to perform
whole genome-wide SNP analysis, the choice of SNPs will have already been
made by the designers of the technology that will be used for genotyping, although they may be able to make some choices concerning SNP density. However, the issues that needed be addressed by the investigator include sample size,
phenotypes, and statistical analyses.
The issue of phenotypic characterization is straightforward but extremely
important. Given the time and expense involved in whole genome-wide analyses,
it is extremely important that the subjects are phenotyped in a careful, accurate, and consistent manner. Ideally, it is important to perform extensive wellstandardized testing on all subjects, such as pulmonary function testing, including
reversibility and hyperresponsiveness testing; collection of questionnaire data and
environmental exposures; and skin-testing to common allergens, and collection of
serum for measurements of total and specific IgE levels. However, as the sample
size needed to obtain sufficient statistical power increases, the ability to perform
such extensive testing often decreases. For diseases such as asthma and allergy
where there are excellent associated phenotypes to analyze, this becomes an
important issue to be considered in study design.
The critical issues that must be dealt with in designing whole genome SNP
association studies are sample size and statistical power. The major concern is
that the level of multiple testing is so large, it will not be possible, even in large
samples, to determine the true associations from all those that will have a
significant P value. There are multiple approaches to consider, but one that has
been proposed by multiple investigators is the use of a multistage design as
discussed at a recent workshop [36]. For example, all SNPs are tested in the first
sample. In the second sample, only the SNPs that were significant in the first
sample are genotyped and analyzed, which greatly decreases the number of
statistical tests that are performed. A third sample may also be tested using only
the subset of SNPs significant in the second sample. This approach allows
determination of which SNPs are truly important for the disease being studied.
However, as discussed at the workshop, this is likely to involve sample sizes
of 2000 subjects in stage 1 and stage 2.
Technology is now available for genome-wide SNP analysis involving genotyping hundreds of thousands of SNPs in a given population, as mentioned in
Box 1. The ability to study the whole genome instead of analyzing a few genes
at a time is intriguing. However, these are expensive studies and it is important
genetics of asthma
753
Box 1. Genome-wide association studies

Powerful approach to systematically screen for

risk-associated polymorphisms
Technology is now available with reproducible and accurate
results with little missing data
Care and extensive phenotyping remain critical
Major limitation is the difficulty of interpreting positive findings
because of the frequency of false positives caused by multiple tests
Multistage designs will be useful in detecting true associations
not to sacrifice the accuracy of the phenotype data because of the genotyping
costs and the large sample size that is needed. Statistical approaches such
as multistage designs are being developed for data analysis and interpretation
of results.
Summary
Several key conditions that are necessary to identify disease susceptibility genes in common diseases such as asthma are now available, including
(1) increasingly comprehensive genomic information on gene location, genomic
structure, and sequence variants, from the Human Genome Project (and from
other species); (2) better understanding of the biologic functions of relevant genes
and inflammatory and immunity pathways important in asthma; (3) newer high
throughput and accurate technologies for DNA sequencing and SNP genotyping;
(4) improved statistical methods for analyzing genetic data from families and
populations; and (5) availability of methods to characterize function of sequence
variants and study biologic responses. Collectively, these conditions will allow
the prioritization of candidate genes based on available knowledge of map
position and biologic relevance; obtain genomic structure of these genes; and
study sequence variants in these genes in populations to facilitate the identification of genes that are important in the development and expression (severity)
of asthma and associated phenotypes. Although, it is still a labor-intensive and
expensive project to identify susceptibility genes in common diseases such as
asthma, the new techniques that are now being used will greatly facilitate
gene mapping.
The techniques discussed in this article include genome-by-genome analysis in
family data, such as those listed in Box 2. This analysis has already been shown
to be a powerful tool in mapping genes for another common disease (prostate
cancer) with interesting preliminary results for asthma. Second, the use of man
754
meyers
Box 2. Summary and future directions

New statistical tools are now available to study gene-by-gene

interactions in family studies.
Application of mouseman homology is an additional and
powerful tool in gene mapping.
Technology continues to progress rapidly; whole genomewide SNP analysis is now a reality.
The goal is the development of gene panels for genetic risk for
disease susceptibility and severity, and response to therapy.
mouse homology mapping that has proven very useful in cardiovascular studies
is beginning to be applied to asthma and related phenotypes. Finally, with new
available technology, genome-wide screens using very dense SNP maps are now
a reality and a significant new development in family linkage and case-control
association studies. In summary, these new approaches should be considered in
designing studies to detect genes that are important in asthma and allergy.
References
[1] Howard TD, Koppelman GH, Xu J, et al. Gene-gene interaction in asthma: IL4RA and IL13 in a
Dutch population. Am J Hum Genet 2002;70:230 6.
[2] Daniels SE, Bhattacharrya S, James A, et al. A genome-wide search for quantitative loci
[3] Wjst M, Fischer G, Immervoll T, et al. A genome-wide search for linkage to asthma German
Asthma Genetics Group. Genomics 1999;58:1 8.
[4] Dizier MH, Besse-Schmittler C, Guilloud-Bataille M, et al. Genome screen for asthma and
related phenotypes in the French EGEA study. Am J Respir Crit Care Med 2000;162(5):1812 8.
[5] Ober C, Tsalenko A, Parry R, et al. A second-generation genomewide screen for asthma
susceptibility alleles in a founder population. Am J Hum Genet 2000;67(5):1154 62.
childhood asthma to chromosome 5q31-q33 near the interleukin 12B locus by a genome-wide
[7] Laitinen T, Daly MJ, Rioux JD, et al. A susceptibility locus for asthma-related traits on
chromosome 7 revealed by genome-wide scan in a founder population. Nat Genet 2001;28(1):
87 91.
[8] Xu J, Meyers DA, Ober C, et al, The Collaborative Study on the Genetics of Asthma.
Genomewide screen and identification of gene-gene interactions for asthma-susceptibility loci
in three US populations: collaborative study on the genetics of asthma. Am J Hum Genet 2001;
68:1437 46.
[9] Xu X, Fang Z, Wang B, et al. A genomewide search for quantitative-trait loci underlying asthma.
Am J Hum Genet 2001;69(6):1271 7.
[10] Meyers DA, Postma DS, Stine OC, et al. Genome screen for asthma and bronchial hyperresponsiveness: Interactions with passive smoke exposure. J Allergy Clin Immunol 2005;115:
1169 75.
genetics of asthma
755
[11] Van Eerdewegh P, Little RD, Dupois J, et al. Association of the ADAM33 gene with asthma and
bronchial hyperresponsiveness. Nature 2002;418:426 30.
chromosome 13q14 that influences immunoglobulin E levels and asthma. Nat Genet 2003;
34:181 6.
asthma related traits. Science 2004;304:300 4.
HLA-G as an asthma susceptibility gene on chromosome 6p21. Am J Hum Genet 2005;76:349 57.
[16] Colilla S, Nicolae D, Pluzhnikov A, et al. Evidence for gene-environment interactions in a
linkage study of asthma and smoking exposure. J All Clin Immunol 2003;111:840 6.
[17] Hauser ER, Watanabe RM, Duren WL, et al. Ordered subset analysis in genetic linkage mapping
of complex traits. Genet Epidemiol 2004;10:1002 5.
[18] Xu J, Langefeld CD, Zheng SL, et al. Interaction effect of PTEN and CDKN1B chromosomal
regions on prostate cancer linkage. Hum Genet 2004;115:255 62.
[19] Lester LA, Rich SS, Blumenthal MN, et al. Ethnic differences in asthma and associated
phenotypes: collaborative study on the genetics of asthma. J Allergy Clin Immunol 2001;108(3):
357 62.
[20] Meyers D, Lange LA, Xu J, et al. Gene-by-gene interaction effects on asthma: results of a
genome-wide ordered subset linkage analysis [abstract]. Am J Hum Genet 2004.
[21] Howard TD, Postma DS, Moore WC, et al. Association of a disintegrin and metalloprotease
(ADAM 33) with asthma in ethnically-diverse populations. J Allergy Clin Immunol 2003;
112:717 22.
[22] Jackson Laboratory. Mouse Genome Sequencing Consortium, 2002. Available at: www.informatics.
jax.org/reports/homologymap/mouse_human.shtml. Accessed February 2, 2005.
[23] Korstanje R, Paigen B. From QTL to gene: the harvest begins. Nat Genet 2002;31:235 6.
[24] Wang X, Paigen B. Genome-wide search for new genes controlling plasma lipid concentration
in mice and man. Curr Opin Lipidol 2005;16:127 37.
[25] Reinhard C, Eder G, Fuchs H, et al. Inbred strain variation in lung function. Mamm Genome
2002;13:429 37.
[26] Whitehead GS, Walker JKL, Berman KG, et al. Allergen-induced airway disease is mouse strain
dependent. Am J Physiol Lung Cell Mol Physiol 2002;285:L32 42.
[27] Wills-Karp M, Ewart SL. The genetics of allergen-induced airway hyperresponsiveness in mice.
Am J Respir Crit Care Med 1997;156:S89 96.
[28] De Santis GT, Merchant M, Beier DR, et al. Quantitative locus analysis of airway
hyperresponsiveness in A/J and C57BL/6J mice. Nat Genet 1995;11(2):150 4.
[29] Zhang Y, Lefort J, Kearsey V, et al. A genome-wide screen for asthma-associated quantitative
trait loci in a mouse model of allergic asthma. Hum Mol Genet 1999;8(4):601 5.
[30] Ewart SL, Kuperman D, Schadt E, et al. Quantitative trait loci controlling allergen-induced
airway hyperresponsiveness in inbred mice. Am J Respir Cell Mol Biol 2000;23:537 45.
[31] McIntire JJ, Umetsu SE, Macaubas C, et al. Immunology: hepatitis A virus link to atopic disease.
Nature 2003;425(6958):576 8.
[32] Sen S, Churchill GA. A statistical framework for quantitative trait mapping. Genetics 2001;159:
371 87.
[33] Ackerman KG, Huang H, Grasemann H, et al. Interaction genetic loci cause airway
hyperresponsiveness. Physiol Genomics 2005;21(1):105 11.
[34] Wang WYS, Barratt BJ, Clayton DG, et al. Genome-wide association studies: theoretical and
practical concerns. Nat Reviews 2005;6:109 18.
[35] Johnson CG. Haplotype tagging SNPs for the identification of common disease genes. Nat Genet
2001;29:233 7.
[36] Thomas DC, Haile RW, Duggan D. Recent developments in genomewide association scans:
a workshop summary and review. Am J Hum Genet 2005;77:337 45.

Genetics in Asthma and Allergy

Hochgeladen von

Dokumentinformationen

Copyright

Verfügbare Formate

Dieses Dokument teilen

Dokument teilen oder einbetten

Freigabeoptionen

Stufen Sie dieses Dokument als nützlich ein?

Sind diese Inhalte unangemessen?

Copyright:

Verfügbare Formate

Genetics in Asthma and Allergy

Hochgeladen von

Copyright:

Verfügbare Formate

Immunol Allergy Clin N Am