Veterinary Microbiology 178 (2015) 158162

Contents lists available at ScienceDirect

Veterinary Microbiology
journal homepage: www.elsevier.com/locate/vetmic

Short communication

Genetic characterisation of Porcine circovirus type 2 (PCV2) strains from

feral pigs in the Brazilian Pantanal: An opportunity to reconstruct the
history of PCV2 evolution
Giovanni Franzo a, * ,1, Mart Cortey b,1, Alessandra Marnie Martins Gomes de Castro c ,
Ubiratan Piovezan d, Matias Pablo Juan Szabo e , Michele Drigo a , Joaquim Segals f ,
Leonardo Jos Richtzenhain c
a

University of Padua, Padua, Italy

The Pirbright Institute, Pirbright, Woking, UK
c
Department of Preventive Veterinary Medicine and Animal Health, College of Veterinary Medicine, University of So Paulo, So Paulo, SP, Brazil;
d
Empresa Brasileira de Pesquisa Agropecuria Embrapa Pantanal, Corumb, MS, Brazil
e
Laboratrio de Ixodologia, Faculdade de Medicina Veterinria, Universidade Federal de Uberlndia, MG, Brazil
f
Centre de Recerca en Sanitat Animal (CReSA), UAB-IRTA, Campus de la Universitat Autnoma de Barcelona, Departament de Sanitat i dAnatomia Animals,
Universitat Autnoma de Barcelona, 08193 Bellaterra, Barcelona, Spain
b

A R T I C L E I N F O

A B S T R A C T

Article history:
Received 21 January 2015
Received in revised form 30 April 2015
Accepted 4 May 2015

Since its discovery, Porcine circovirus type 2 has emerged as one of the most relevant swine infectious
diseases, causing relevant economic losses for the pig industry. While four genotypes were identied,
only three (PCV2a, PCV2b and PCV2d) are currently circulating and display a worldwide distribution.
Another genotype, PCV2c, has been described only once in Danish archive samples collected between
1980 and 1990. In addition to commercial pigs, PCV2 has been demonstrated to infect wild boars and
other wild species, which can potentially serve as a reservoir for domestic populations. In this study, eight
sequences obtained from feral pigs in the Pantanal region (Mato Grosso do Sul State, Brazil) were
compared with reference sequences and other Brazilian sequences, and the results revealed remarkable
genetic diversity, with all four genotypes currently recognised being detected (PCV2a, PCV2b, PCV2c and
PCV2d). This nding represents a remarkable discovery, as it is the rst detection of PCV2c since 1990 and
the rst-ever detection of PCV2c in live animals. The peculiar population history and ecological scenario
of feral pigs in the Pantanal coupled with the complex, and still only partially known relationship of feral
pigs with other PCV2 susceptible species (i.e., domestic pigs, wild boars and peccaries), open exciting
questions concerning PCV2 origin and evolution. Overall, the results of the present study led us to form
the following hypothesis: the PCV2 strains found in feral pigs may be the last descent of the strains that
circulated among European pigs in the past, or they may have infected these feral pigs more recently
through a bridge species.
2015 Elsevier B.V. All rights reserved.

Keywords:
Porcine circovirus type 2 (PCV2)
Brazil
Feral pigs
Phylogeny

1. Introduction
Porcine circovirus type 2 (PCV2) belongs to the family
Circoviridae and the genus Circovirus, which includes the smallest
viruses currently known to autonomously replicate in eukaryotic
cells (Delwart and Li, 2012). This group comprises non-enveloped

* Corresponding author at: Department of Animal Medicine, Production an

Health (MAPS), University of Padua, Viale dellUniversit 16, 35020 Legnaro (Padua),
Italy. Tel.: +39 0498272968; fax: +39 0498272973.
E-mail addresses: giovanni.franzo@unipd.it, giovanni.franzo1@gmail.com
(G. Franzo).
1
These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.vetmic.2015.05.003
0378-1135/ 2015 Elsevier B.V. All rights reserved.

viruses, with a single-stranded, ambisense, circular genome of less

than 2000 bp, which infects several avian species, mammals and,
probably, shes (Delwart and Li, 2012). PCV2 is the only member of
the genus that is recognised to be pathogenic in mammals. It has a
genome of 17671768 bp, encoding at least four open reading
frames (ORF1-4).
PCV2 was initially associated with postweaning multisystemic
wasting syndrome (PMWS), which was rst described in Canada in
1996. Currently, several clinical conditions, collectively named P.
circovirus diseases (PCVD), have been associated with PCV2 and
represent a relevant challenge to the swine industry worldwide
(Segals et al., 2013). To date, four genotypes have been recognised
based on phylogenetic analysis (Franzo et al., 2015; Xiao et al.,

G. Franzo et al. / Veterinary Microbiology 178 (2015) 158162

159

present in the Brazilian Pantanal since that time, serving as

replacement species for native wildlife hunting and as potential
seed dispersers (Desbiez et al., 2011). However, when present in
high density, herds of feral pigs cause extensive damage to pastures
and the breeding of domestic and feral animals, and, most
importantly, feral pigs have been found to be potential reservoirs of
several diseases (Desbiez et al., 2011). Therefore, the main
objective of this paper is to characterize the PCV2 strains
circulating among feral pigs in Brazil and to compare them with
the strains described in domestic pigs and wild boars.
2. Material and methods
2.1. Samples
Fig. 1. Map of the southern states of Brazil, indicating the range distribution of feral
pigs and wild boars. Collared peccary (Pecari tajacu) and white-lipped peccary
(Tayassu pecari) are widely distributed in all the areas. Bordering countries: BOL,
Bolivia; PAR, Paraguay; ARG, Argentina; URU, Uruguay. Brazilian states: MT, Mato
Grosso; MS, Mato Grosso do Sul; PR, Paran; RS, Rio Grande do Sul; SC, Santa
Catarina; RJ, Rio de Janeiro; ES, Esprito Santo; BA, Bahia; MG, Minas Gerais; GO,
Gois; DF, Distrito Federal. (Adapted from Deberdt and Scherer, 2007).

2015). PCV2a was the most prevalent genotype until approximately 2003, when PCV2b became the most widespread genotype
(Segals et al., 2013). A third genotype, PCV2c, was described only
in Danish archive samples collected between 1980 and 1990
(Dupont et al., 2008). Recently, a fourth genotype, PCV2d, has been
identied (Guo et al., 2010).
In Brazil, the disease was rst identied in 2000 and
retrospective studies have demonstrated PCV2 circulation since
1988 (Ciacci-Zanella et al., 2009). Several studies have reported a
relevant circulation of PCV2 (PCV2a and PCV2b) in both commercial swine farms (de Castro et al., 2007, 2012; Chiarelli-Neto et al.,
2009; Ciacci-Zanella et al., 2009) and wild boars (Barbosa et al.,
2006; Castro et al., 2012). Recently, Salgado (2014) reported the
rst detection of PCV2d in Brazilian commercial pigs. However, no
data are currently available on the circulation of PCV2 strains in
feral pigs, despite their potential role as a reservoir of several
diseases (Desbiez et al., 2011).
Feral pigs (Sus scrofa L.) are among the most invasive animal
species worldwide, with populations found throughout the world
(Engeman et al., 2013). Brazilian feral pigs in the Pantanal area, a
huge freshwater wetland (estimated area of 138.183 km2), are the
descendants of domestic pigs imported by European colonizers
that became wild after escaping from farms abandoned during the
Paraguay War (18651870) (Desbiez et al., 2011). They have been

This study was conducted in Nhecolndia, a southeast subregion of Pantanal, Mato Grosso do Sul State, Brazil (Fig. 1). This
area is limited by the river Paraguay (West), river Taquari (North)
and Rio Negro river (Southeast). Samples were collected in
2010 from fourteen animals with various body conditions, age
and sex (Table 1). Feral pigs were captured in forest areas or in
water bodies. Captured animals were sedated, tagged and released
afterwards; the procedure was authorised by federal environmental authorities (SISBIO 21416-1, process number CA: 85625338)
2.1.1. DNA extraction and PCV2 detection
DNA was extracted from serum using a phenolchloroform and
proteinase K protocol. Quantication of PCV2 was performed using
SYBR green chemistry and carried out in a StepOne Real Time PCR
system (Applied Biosystems, Canada) under universal conditions
using primers previously described (Yang et al., 2007). Extracted
samples were also tested to b-actin as a polymerase chain reaction
(PCR) control as previously described by Hui et al. (2004) to
identify potential false-negative results due to failures in DNA
extraction or presence of PCR inhibitors.
2.1.2. PCV2 complete genome sequencing
Samples positive for PCV2 PCR were sequenced using the
primers detailed in Table 2. Briey, amplied products were
excised from 1.5% agarose gel and puried with a commercial kit
(Concert; Gibco-BRL). Bidirectional sequencing reactions were
performed using the BigDye Terminator kit (version 3.1; Applied
Biosystems, Norwalk, Connecticut, USA) and were run on
3500 genetic Analyzers (Applied Biosystems, USA). Assembly of
consensus sequences was performed by means of PHRED/PHRAP
and the CAP3 program (http://asparagin.cenargen.embrapa.br/

Table 1
Identication and features of feral pigs from which samples were obtained. Sequence availability is also reported.
Feral pig ID

Age (months)

Weight (Kg)

Sex

Sequence
obtained

ORF2 length

Complete genome
length

Accession
Number

163
164
165
166
167
168
170
171
172
173
174
175
176
177

42
180
48
90
36
72
54
36
36
84
60
2
108
24

62.5
64.5
30
65
31
51
81
39
33
75
54
2
35
16

Female
Male
Female
Male
Male
Female
Male
Male
Male
Male
Female
Male
Female
Male

Yes

Yes
Yes
Yes
Yes

Yes

Yes
Yes

699

1768

KJ094599

699
699
702
699

1768
1768
1768
1767

KJ094600
KJ094601
KJ094602
KJ094603

699

1768

KJ094604

702
702

1766
1766

KJ094605
KJ094606

160

G. Franzo et al. / Veterinary Microbiology 178 (2015) 158162

Table 2
Primers used for amplication and sequencing of full length PCV2 genome.
Primer identication

Sequence (50 -30 )

References

P1
P2
P3
P4
P5
P6
P6-2
P7
P8
P7-2

TAATCCTTCCGAAGACGAGC
CGATCACACAGTCTCAGTAG
CAGAAGCGTGATTGGAAGAC
ATGTAGACCACGTAGGCCTC
AGAAGCTCTTTATCGGAGGA
AAGCGAACCACAGTCAGAAC
CCTTTGAATACTACAGAATAAG
CTAGAATAACAGCACTGGAG
GTTCGTCCTTCCTCATTACC
TATGGCGGGAGGAGTAGTT

An et al., 2007
An et al., 2007
An et al., 2007
An et al., 2007
An et al., 2007
An et al., 2007
Cortey M (unpublished data)
An et al., 2007
An et al., 2007
Cortey M (unpublished data)

phph), with an analysis quality point of 20. All the PCV2 genomes
obtained have been deposited and are available in GenBank
(Table 1).
2.1.3. Sequence analysis
Brazilian strains were classied in different genotypes following the procedures proposed by Franzo et al. (2015). To this
purpose, the ORF2 alignment between Brazilian strains and the
reference ones was performed using the MAFFT method implemented in guidance and condence score evaluated performing
100 bootstrap replicates. The substitution model was selected on
the basis of the Akaike information criterion (AIC) calculated using
JmodelTest2.1.1. Phylogenetic trees were reconstructed using the
neighbor-joining (NJ) and maximum likelihood (ML) methods
implemented in MEGA6 and RAxML and condence for each clade
of an observed tree was evaluated performing 2000 bootstrap
replicates. Additionally, both the ORF2 and complete genome
sequences obtained in the present work were aligned with

8 reference sequences representing the 4 PCV2 genotypes accepted

nowadays, 2 sequences each. Moreover, 49 ORF2 Brazilian sequences and 19 complete genomes obtained from different studies (de
Castro et al., 2007; Chiarelli-Neto et al., 2009; Ciacci-Zanella et al.,
2009; Castro et al., 2012) were added to the database (SupMat I),
obtaining two nal databases comprising 66 and 36 sequences for
ORF2 and complete genome, respectively. Phylogenetic trees have
been reconstructed as previously described. Percentage of identity
between Brazilian sequences was calculated using MEGA6.
2.1.4. Recombination analysis
Presence of recombinant strains was investigated on the
complete genome database using RDP3 (Martin et al., 2010).
RDP, GENCONV MaxChi Bootscan and 3Seq methods were used for
preliminary scan, while all the remaining ones were used for
secondary scan. Settings for each method were adjusted to t the
database features according to RDP3 manual. Only events detected
by more than two methods with a signicance level lower than

Fig. 2. Phylogenetic trees reconstructed using the neighbor joining method with 2000 bootstrap replicates based on ORF2 (a) and complete genome (b) databases. Brazilian
feral pigs sequences are represented by full circles while domestic pigs and wild boar sequences are coded as empty circles and squares, respectively.

G. Franzo et al. / Veterinary Microbiology 178 (2015) 158162

p-value < 0.001 were accepted. Further conrmation was obtained

by visually inspecting the recombination event using both
RDP3 and Simplot.
3. Results
Eleven of the fourteen samples tested were positive for
PCV2 and eight complete genomes of PCV2 were obtained (Table 1).
According to the classication proposed by Franzo et al. (2015),
3 strains (1 6 6, 1 6 5 and 1 6 8) belonged to the genotype PCV2a, two
strains (1 6 7 and 17 2) belonged to the genotype PCV2b, and two
strains (17 6 and 17 7) belonged to the genotype PCV2d (SupFig I
and Fig. 2a). Remarkably, strain 1 6 3 was unequivocally classied
as PCV2c (ORF2 and complete genome p-distance with the other
PCV2c sequences: range 0.71% and 11.3%, respectively). Considering the phylogenetic analysis based on the complete genome
sequence, the topology remained substantially unaltered, with the
single exception of strain 1 6 7, which displayed an intermediate
position between PCV2b and PCV2d genotypes (Fig. 2b). Comparable topologies were obtained with the NJ and ML approaches,
strengthening the robustness of the results.
Recombination analysis conrmed that strain 1 6 7 was a
recombinant (breakpoints approximately in positions 1152 and
1712), and that strains 17 2 (PCV2b) and 17 7 (PCV2d) were
identied as the most probable parental strains of strain 1 6 7, with
the former providing nearly the entire ORF2, except its two ends
(Fig. 3). All the strains analysed in this study displayed a
noteworthy genetic diversity among each other (ORF2 p-distance
range 00.1197; complete genome p-distance range 00.058) and
compared to other Brazilian strains (ORF2 p-distance range
0.01140.1273; complete genome p-distance range 0.0120.056).
4. Discussion
The 2012 census of live pigs in Brazil is one of the highest
worldwide (more than 38 million in 2012, FAOSTAT). Additionally,
other populations belonging to the species S. Scrofa are present in
the country. Wild boar is an exotic species in Brazil that has been
present since 1989, expanding northwards from the Uruguay
border mainly in the state of Rio Grande do Sul (Fig. 1) (Pereira das
Neves, 2007). In parallel, there are several wild boar breeding
farms that are rigorously controlled in the states of Minas Gerais,
So Paulo, Paran, Rio Grande do Sul and Santa Catarina (Barbosa
et al., 2014), although some individuals were released for hunting
purposes or escaped in the past (Britto and Patrocnio, 2006).
PCV2 has been reported to infect wild boars (5489% of
prevalence in Brazil, Barbosa et al., 2014) and it has been
speculated that the wild boar might serve as a PCV2 potential

Fig. 3. Bootscan graph obtained by plotting the bootstrap value for strain
17 6 clustering with strains 17 2 and 17 7. Values have been calculated on a sliding
window of 400 nucleotides moving through the alignment by steps of 20 nucleotides. Recombination breakpoints are represented as dashed lines. ORF2 position is
provided in the upper part of the graph.

161

reservoir. In Brazil, a third population susceptible to PCV2 is feral

pigs, whose presence is restricted to the Pantanal region, in Mato
Grosso do Sul State (Fig. 1). However, no data are currently
available about epidemiology of PCV2 in feral pigs. The present
work investigated the circulation of PCV2 in these animals,
demonstrating an unexpected genetic diversity. Despite the low
number of individuals analysed, all four genotypes currently
recognised (3 PCV2a, 2 PCV2b, 1 PCV2c and 2 PCV2d) were
detected. The relatively high genetic distance between viruses
identied in feral pigs and previously sequenced viruses obtained
from domestic and wild boar in Brazil and worldwide (Fig. 2a,b and
SupFig I) indicates a certain geographic isolation of these feral pig
populations. It is highly likely that PCV2 has circulated for a
prolonged time in the population, which suggests a limited or
negligible inuence of feral pigs in commercial farms. Accordingly,
the transport of live pigs between the Pantanal wetland and
surrounding plateaus has been restricted in the Mato Grosso do Sul
state since 2003 (Agncia Estadual de Defesa Sanitria Animal e
Vegetal, 2003). Interestingly, one recombinant sequence (strain
1 6 7) was reported and appeared to be a recombination of strains
17 2 (PCV2b) and 17 7 (PCV2d), both of which circulate in the same
region of the Pantanal. This evidence suggests that
PCV2 circulation was high enough to support relatively frequent
co-infection and subsequent recombination. The detection in
Brazil of a contemporary PCV2c genotype in feral pigs is of
extraordinary interest because this PCV2 genotype was only
detected in Danish archive samples from 1980s and 1990s (Dupont
et al., 2008) and was considered extinct (Xiao et al., 2015).
The present report poses exciting questions concerning
PCV2 origin and evolution: how and when were feral pigs infected
with PCV2c, and how has PCV2c been maintained in the
population? Furthermore, were PCV2c genotype recently introduced into Brazil or were they present previously? The origin of
this PCV2c virus is unknown. In this study, false positives for PCV2c
caused by laboratory contamination can be excluded due to the
absence of any contact with laboratories possessing the PCV2c
genotype. A plausible explanation is that PCV2c strains descended
from PCV2c strains circulating among European pigs in past
centuries that were imported to Brazil and have survived until now
with unknown prevalence in feral pigs. Although this hypothesis is
not in agreement with the estimation of PCV2s most recent
common ancestor (MRCA) (Firth et al., 2009), the probable
underestimation of ancestor age using a molecular clock based
approach is still a highly debated issue for rapidly evolving viruses
(Holmes, 2003). A similar bias could also be true for PCV2,
especially considering the limited timeframe for which sequences
are available compared to that for the MRCA estimate.
A second hypothesis may advocate for a more recent
introduction of PCV2c from Europe, where the circulation of this
genotype was demonstrated in the last century (Dupont et al.,
2008). Interestingly, a massive import of commercial breeds,
mainly from Europe, occurred in Brazil during the 20th century
(Cavalcanti, 2000). Furthermore, the importation of wild boars was
reported from Europe to South America, including Brazil, between
the 1960s and 1990s. Nevertheless, in both cases, the contact
network among these populations and the feral pigs remains
unclear. In the Pantanal area, the interactions between feral and
commercial domestic pigs are unlikely, even if sporadic indirect
contacts or unidirectional animal introduction from commercial
farms to rural ones cannot be really excluded. Similarly, wild boars
have formed free ranging populations, mainly in the southern area
of Brazil (Fig. 1), but they have still not been recorded inside the
Pantanal wetland and there are no records of crossbreeding
between wild boars and feral pigs (Deberdt and Scherer, 2007).
A potential link, even if still unproven, could be provided by a
fourth animal population: the Peccary (Family Tayassuidae). In

162

G. Franzo et al. / Veterinary Microbiology 178 (2015) 158162

particular the collared peccary (Pecari tajacu) and white-lipped

peccary (Tayassu pecari) have been recently shown to be
susceptible to PCV2 and to display high infection prevalence (de
Castro et al., 2014). These species are commonly present in the
Pantanal (Desbiez et al., 2011) and more generally share their
distribution ranges with domestic pigs (including rural-extensively raised ones), wild boards and feral pigs. Consequently, peccaries
harboring PCV2 may have infected feral pigs. However, the
inadequate data regarding the domestic-rural pig and wild boar
distributions and the PCV2 prevalence and genotype distribution
in peccaries, makes impossible to formulate a denitive hypothesis
with a reasonable degree of condence.
Overall, this study reveals an unexpected PCV2 variability
within the previously neglected population of feral pigs in the
Pantanal (Matto Grosso do Sul Brazil). Above all, this is the rst
report of currently existing PCV2c strains in Suidae species. These
results open new avenues in the reconstruction of PCV2 history
and in the understanding of the role of host and ecological niches
and their interactions.
Acknowledgment
The sequences data of this work was supported by the So
Paulo Research Foundation (FAPESP), So Paulo State, Brazil (grant
2007/57115-3).
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the
online
version,
at
http://dx.doi.org/10.1016/j.
vetmic.2015.05.003.
References
An, D.J., Roh, I.S., Song, D.S., Park, C.K., Park, B.K., 2007. Phylogenetic characterization
of porcine circovirus type 2 in PMWS and PDNS Korean pigs between 1999 and
2006. Virus Res. 129, 115122.
Barbosa, N., Lobato, Z., Freitas, T., Ciacci-Janella, J., Ristow, L., 2006. Prevalence of the
porcine circovirus type 2 (PCV2) in wild boars (Sus scrofa) in Brazil. In:
Proceedings of the 19th IPVS Congress. Copenhagen, Denmark. p 90.
Barbosa, C.N., Martins, N.R.S., Freitas, T.R.P., Lobato, Z.I.P., 2014. Serological survey of
porcine circovirus-2 in captive wild boars (Sus scrofa) from registered farms of
south and south-east regions of Brazil. Transbound. Emer. Dis. doi:http://dx.doi.
org/10.1111/tbed.12247.
Britto, M., Patrocnio, D., 2006. A fauna de espcies exticas no Paran: contexto
nacional e situao atual. In: Campos, J.B., Tossulino, M.G.P., Muller, C.R.C. (Eds.),
Unidades de Conservao, aes para valorizao da biodiversidade. IAP,
Curitiba, pp. 5394 348p.
Castro, A.M., Castro Jr., F.G., Budino, F.E., Baldin, C.M., Silva, S.O., Brandao, P.E.,
Richtzenhain, L.J., 2012. Detection of genetic characterization of Porcine
circovirus 2 (PCV2) in Brazilian wildlife boars. Braz. J. Microbiol. 43, 10221025.
Cavalcanti, S.S., 2000. Suinocultura Dinmica. 2. ed. Contagem: FEP MVZ Editora,
494p.

Chiarelli-Neto, O., Yotoko, K.S., Vidigal, P.M., Silva, F.M., Castro, L.A., Fietto, J.L., Silva
Jr., A., Almeida, M.R., 2009. Classication and putative origins of Brazilian
Porcine circovirus 2 inferred through phylogenetic and phylogeographical
approaches. Virus Res. 140, 5763.
Ciacci-Zanella, J.R., Simon, N.L., Pinto, L.S., Viancelli, A., Fernandes, L.T., Hayashi, M.,
Dellagostin, O.A., Esteves, P.A., 2009. Detection of Porcine circovirus type 2
(PCV2) variants PCV2-1 and PCV2-2 in Brazilian pig population. Res. Vet. Sci. 87,
157160.
de Castro, A.M., Cortez, A., Heinemann, M.B., Brandao, P.E., Richtzenhain, L.J., 2007.
Genetic diversity of Brazilian strains of Porcine circovirus type 2 (PCV-2)
revealed by analysis of the cap gene (ORF-2). Arch. Virol. 152, 14351445.
de Castro, A.M., Cruz, T.F., Salgado, V.R., Kanashiro, T.M., Ferrari, K.L., Araujo Jr, J.P.,
Brandao, P.E., Richtzenhain, L.J., 2012. Detection of Porcine circovirus genotypes
2a and 2b in aborted foetuses from infected swine herds in the state of Sao
Paulo, Brazil. Acta Vet. Scand. 54, 29.
de Castro, A.M., Brombila, T., Bersano, J.G., Soares, H.S., Silva, S.O., Minervino, A.H.,
Ogata, R.A., Gennari, S.M., Richtzenhain, L.J., 2014. Swine infectious agents in
Tayassu pecari and Pecari tajacu tissue samples from Brazil. J. Wildl. Dis. 50, 205
209.
Deberdt, A.J., Scherer, S.B., 2007. O javali asselvajado: ocorrncia e manejo da
espcie no Brasil. Natureza & Conservao 5, 2330.
Delwart, E., Li, L., 2012. Rapidly expanding genetic diversity and host range of the
Circoviridae viral family and other rep encoding small circular ssDNA genomes.
Virus Res. 164, 114121.
Desbiez, A.L., Keuroghlian, A., Piovezan, U., Bodmer, R.E., 2011. Invasive species and
bushmeat hunting contributing to wildlife conservation: the case of feral pigs in
a Neotropical wetland. Oryx 45, 7883.
Dupont, K., Nielsen, E.O., Baekbo, P., Larsen, L.E., 2008. Genomic analysis of
PCV2 isolates from Danish archives and a current PMWS case-control study
supports a shift in genotypes with time. Vet. Microbiol. 128, 5664.
Engeman, R.M., Massei, G., Sage, M., Gentle, M.N., 2013. Monitoring wild pig
populations: a review of methods. Environ. Sci. Pollut. Res. Int. 20, 80778091.
Firth, C., Charleston, M.A., Duffy, S., Shapiro, B., Holmes, E.C., 2009. Insights into the
evolutionary history of an emerging livestock pathogen: Porcine circovirus 2. J.
Virol. 83, 12813.
Franzo, G., Cortey, M., Olvera, A., Novosel, D., Castro, A., Biaginni, P., Segals, J., Drigo,
M., 2015. Revisiting the Taxonomical classication of PCV2: still a real challenge.
Mol Phylogenet. Evol. (submitted).
Guo, J., Lu, Y.H., Wei, W., Huang, L.P., Liu, M., 2010. Porcine circovirus type 2 (PCV2):
Genetic variation and newly emerging genotypes in China. Virol. J. 7, 273.
Hui, R.K.H., Zeng, F., Chan, C.M.N., Yuen, K.Y., Peiris, J.S.M., Leung, F.C.C., 2004.
Reverse transcriptase PCR diagnostic assay for the coronavirus associated with
severe acute respiratory syndrome. J. Clin. Microbiol. 42, 19941999.
Holmes, E.C., 2003. Molecular clocks and the puzzle of RNA virus origins. J. Virol. 77,
38933897.
Martin, D.P., Lemey, P., Lott, M., Moulton, V., Posada, D., Lefeuvre, P., 2010. RDP3: a
exible and fast computer program for analyzing recombination.
Bioinformatics 26, 24622463.
Pereira das Neves, M., 2007. Levantamento Populacional de Javalis Asselvejados no
Estado do Rio Grande do Sul. BAIMA, Internal Report.
Salgado, R.L., 2014. Identication of an emergent porcine circovirus-2 in vaccinated
pigs from a Brazilian farm during a postweaning multisystemic wasting
syndrome outbreak. Genome announc. 2 (2) e00163-14.
Segals, J., Kekarainen, T., Cortey, M., 2013. The natural history of Porcine circovirus
type 2: from an inoffensive virus to a devastating swine disease? Vet. Microbiol.
165, 1320.
Xiao, C.T., Halbur, P.G., Opriessnig, T., 2015. Global molecular genetic analysis of
porcine circovirus type 2 (PCV2) sequences conrms the presence of four main
PCV2 genotypes and reveals a rapid increase of PCV2d. J. Gen. Virol. doi:http://
dx.doi.org/10.1099/vir.0.000100 pii: vir.0.000100.
Yang, Z.Z., Habib, M., Shuai, J.B., Fang, W.H., 2007. Detection of PCV2 DNA by SYBR
Green Ibased quantitative PCR. J. Zhejiang Univ. Sci. B 8, 162169.