Sie sind auf Seite 1von 53

FACULTAD DE MEDICINA HUMANA

DEPARTAMENTO ACADMICO DE CIENCIAS BSICAS

Gua de prcticas
BIOLOGA CELULAR Y MOLECULAR
2014-II
Responsable

Blgo Lezama Vigo, Hlmer, MSc

Profesores

Blgo. Nolasco Crdenas, Oscar, MSc. (Coordinador)


Blgo. Jer Apaza, Csar (Coordinador prcticas)
Blgo. Murrugarra Bringas, Victoria (Coordinador tutoras).
Blgo. Alata Linares, Vicky, Mg
Blgo. Velarde Vlchez, Mnica
Blgo. Quintana Cceda, Milagros, MSc.
Blgo. Cervantes Snchez, Wilmer
QF. Barreto Yaya, Danilo
Q.F. Ramrez Rojas, Luisa.
Md. Lapa Salinas, Yolanda, Mg
Md. Amanzo Lpez, Csar (Coordinador seminarios)
Md. Mena Navarro, Cecilia
Blgo. Snchez Dvila, Johanna, MSc.
Blgo. Vicente Vicente, Nlida, Dr.
Md. Gutirrez Aures, Ysabel
Blgo. Fujita Alarcn, Ricardo, Dr.

APELLIDOS, NOMBRES:_________________________________________
GRUPO:___________ DIA:____________ PROFESOR:______________

INTRODUCCIN

La biologa es la ciencia de la vida que estudia la estructura y funcin de los organismos vivos y sus
componentes. Las aplicaciones de la investigacin bsica en biologa molecular son numerosas, desde la
tecnologa para trasplantar corazones, manipular genes, disear frmacos contra microorganismos
patgenos hasta actividades como incrementar la produccin mundial de alimentos.
La gua de prcticas del curso de Biologa Celular y Molecular tiene como objetivo entrenar al
estudiante en los procedimientos de laboratorio y desarrollar su pensamiento cientfico, de manera que lo
lleve a comprender los trminos bsicos de la Biologa Molecular.
El estudiante debe emplear esta gua en cada prctica de laboratorio y estar informado sobre la
prctica que se llevar a cabo en cada sesin, anticipadamente.
La gua se ha dividido en tres partes de acuerdo a cada evaluacin parcial. La primera parte
comprende la clula y componentes celulares. La segunda parte incluye procesos celulares como
respiracin, permeabilidad, divisin celular y la visualizacin de organelas. En la tercera parte se analizara
el proceso de meiosis, comprensin del cdigo gentico y tcnicas de manipulacin de cidos nucleicos.
El alumno debe cumplir con los objetivos planteados al final de cada prctica. As mismo debe
presentar su gua de prctica terminada la misma, con las actividades requeridas en la sesin de prctica,
debidamente desarrolladas.

PROGRAMACIN DE CONTENIDO

CONTENIDO

Organizacin de grupos de prctica

Bioseguridad. Microscopa tcnicas de manipulacin y


enfoque de muestras

Tcnicas de coloracin y observacin de clulas Procariotas

Observacin de clulas Eucariotas

Demostracin experimental del fenmeno de difusin.


Permeabilidad celular

Observacin de movimientos celulares: Ciclosis. Observacin


de organelas celulares. Mitocondria, Cloroplasto, Vacuolas

Actividad enzimtica

EXAMENES PARCIALES

Fermentacin

10

REPASO

11

Mitosis

12

Fecundacin

13

Extraccin de DNA. Electroforesis

14

Cdigo gentico y traduccin de protenas

15

Estudio de rasgos genticos en el hombre

16

EXAMENES FINALES

PRCTICA N 1 (SEMANA 2)
BIOSEGURIDAD Y MICROSCOPIA
PRIMERA PARTE: BIOSEGURIDAD
El trabajo en el Laboratorio requiere de la observacin de una serie de normas de seguridad que
eviten posibles accidentes debido al desconocimiento de lo que se est haciendo o a una posible
negligencia de los alumnos que estn en un momento dado, trabajando en el Laboratorio.
A continuacin se enumeran una serie de medidas e indicaciones de seguridad que deben tomarse
durante las prcticas de laboratorio.

NORMAS PERSONALES
1. Lea con atencin, antes de cada prctica, las indicaciones de su gua. Siga todas las instrucciones a
menos que el profesor realice alguna modificacin.
2. Cada grupo de prcticas se responsabilizar de su zona de trabajo y de su material. Se trabajar con
cuidado y de manera organizada. As mismo se mantendr cada mesa de trabajo limpia, seca y
ordenada.
3. Es obligatorio la utilizacin de mandil que le cubra brazos, piernas y torso. Est prohibido el uso de
sandalias, pantalones y faldas cortos en el laboratorio. La persona inapropiadamente vestida para
trabajar en el laboratorio no podr ingresar.
4. No se debe llevar las manos a la boca ni a la cara pues pueden estar contaminadas.
5. Toda persona con cabello largo, deber sujetarlo y recogerlo, nunca debe de estar libre.
6. Est terminantemente prohibido fumar, tomar bebidas y comer en el laboratorio.
7. En caso de derrame, accidente o dao avise inmediatamente al profesor.
8. Al trmino de cada prctica limpiar el rea de trabajo y lavar los materiales utilizados con agua de
cao. Lavarse las manos meticulosamente con agua y jabn. Finalmente cerciorarse que las llaves
de gas y agua estn cerradas.

REACTIVOS QUIMICOS
1. Usar lentes de seguridad cuando trabaje con reactivos qumicos peligrosos que puedan salpicar o
derramarse.
2. Antes de utilizar un compuesto, asegurarse bien de su necesidad, fijarse bien en el rtulo.
3. Como regla general, no coger ningn producto qumico. El profesor o profesora te lo proporcionar.
4. Nunca devuelva los sobrantes de los productos a los frascos de origen sin consultar con el profesor.
5. Es muy importante que cuando los productos qumicos de desecho se viertan en la pila de desage,
estn debidamente neutralizados, debe dejarse que circule por la misma, abundante agua.
6. No tocar con las manos y menos con la boca, los productos qumicos.
7. No pipetear con la boca. Utilizar una bombilla de succin.

8. Los cidos requieren un cuidado especial. Cuando queramos diluirlos, siempre echaremos el cido
sobre agua.
9. Los productos inflamables (gases, alcohol, ter, etc.) deben estar lejos de fuentes de calor. Si hay
que calentar tubos con estos productos, se har al bao Mara, nunca directamente a la llama.
10. Manipule con precaucin los solventes voltiles e inflamables como el ter, acetona y metanol.
Nunca evapore estos solventes en una hornilla al abierto. Utilice siempre un sistema de
condensacin eficiente.
11. Si por accidente cae o se vierte sobre ti cualquier cido o producto corrosivo, lvate inmediatamente
con mucha agua y avisa al profesor.
12. Al preparar cualquier disolucin se colocar en un frasco limpio y rotulado convenientemente.
13. Si fuera necesario durante la practica encender un mechero, encienda el fuego en el laboratorio solo
si no existen solventes inflamables en la vecindad. La persona que encienda el fuego debe primero
verificar que no exista otra persona que este trabajando con solventes inflamables en el laboratorio.

MATERIAL DE VIDRIO

1 Use material de vidrio limpio y no rajado.


2 El vidrio caliente no se diferencia a simple vista del vidrio fro. Para evitar quemaduras use guantes o
trapos.
3 Si tienes que calentar a la llama el contenido de un tubo de ensayo, observa cuidadosamente estas
dos normas:
-Ten extremo cuidado y cercirate que la boca del tubo de ensayo no apunte a ningn compaero.
Puede hervir el lquido y salir disparado, por lo que podras ocasionar un accidente.
-Calienta por la pared lateral del tubo de ensayo, nunca por el fondo; agita suavemente (mira la
figura).

EQUIPOS ELCTRICOS
1 Manipule cualquier equipo elctrico con las manos secas y asegrese que el rea de trabajo tambin
este seca.
2 Ningn cordn elctrico debe colgar fuera de la mesa de trabajo.
3 Cuando desconecte algn equipo del tomacorriente, jlelo por el enchufe y no por el cordn.

UTILIZACION DE BALANZAS

1 Cuando se determinan masas de productos qumicos con balanza, se colocar papel sobre los platos
de la misma y si el producto fuera corrosivo, se utilizar una luna de reloj.
2 Se debe evitar cualquier perturbacin que conduzca a un error, como vibraciones debidas a golpes,
aparatos en funcionamiento, soplar sobre los platos de la balanza, etc.

MANIPULACIN DE ESPECMENES
1 Manipule los microorganismos crecidos en una placa petri o tubo de cultivo con cuidado extremo.
Siempre utilice tcnicas de esterilidad (a la llama del mechero, guantes, palillos estriles, etc.).
2 Nunca llevar a la boca plantas o partes de ellas como semillas, frutos y hojas.

NIVELES DE RIESGO BIOLOGICO EN UN LABORATORIO


Clasificacin de microorganismos por grupos de riesgo para el trabajo de laboratorio:
Grupo de riesgo 1 (riesgo individual y poblacional escaso o nulo)
Microorganismos que tienen pocas probabilidades de provocar enfermedades en el ser humano o los
animales.
Grupo de riesgo 2 (riesgo individual moderado, riesgo poblacional bajo)
Agentes patgenos que pueden provocar enfermedades humanas o animales pero que tienen pocas
probabilidades de entraar un riesgo grave para el personal de laboratorio, la poblacin, el ganado o el
medio ambiente. La exposicin en el laboratorio puede provocar una infeccin grave, pero existen
medidas preventivas y teraputicas eficaces y el riesgo de propagacin es limitado.
Grupo de riesgo 3 (riesgo individual elevado, riesgo poblacional bajo)
Agentes patgenos que suelen provocar enfermedades humanas o animales graves, pero que de
ordinario no se propagan de un individuo a otro. Existen medidas preventivas y teraputicas eficaces.
Grupo de riesgo 4 (riesgo individual y poblacional elevado)
Agentes patgenos que suelen provocar enfermedades graves en el ser humano o los animales y que se
transmiten fcilmente de un individuo a otro, directa o indirectamente. Normalmente no existen medidas
preventivas y teraputicas eficaces.

BARRERAS DE CONTENCION
Los laboratorios presentan diversas barreras de contencin que previenen el escape y dispersin
de agentes biolgicos de riesgo.
Barrera primaria: Es aquella que protege al personal y al ambiente inmediato del agente de riesgo
(vestimenta de uso exclusivo, cabina de bioseguridad y equipos provistos de dispositivos de seguridad).
Barrera secundaria: Es aquella que protege el ambiente externo contra los agentes de riesgo (diseo del
laboratorio e implementacin de equipos de seguridad de acuerdo al nivel de Bioseguridad).
Barrera microbiolgica: Es un dispositivo o sistema que evita o limita la migracin de microorganismos
entre los espacios situados a ambos lados del mismo y permite controlar la concentracin de
microorganismos en el ambiente, dentro de lmites prefijados. Tiene como objetivo proteger al operador o
al operador y al proceso.
Barrera microbiolgica parcial: Es un dispositivo o sistema que limita la migracin de microorganismos
entre los ambientes situados a ambos lados del mismo. En este tipo de barrera se recomiendan Prefiltros,
Filtros HEPA (Filtros de alta eficiencia para el control de partculas en suspensin) as como cabinas de
bioseguridad clase I o II, lo cual depender del tipo de trabajo que se efecta en un determinado
laboratorio.
Barrera microbiolgica absoluta: Es un dispositivo o sistema hermtico, a prueba de filtraciones de aire
o gas, que evita en forma total la migracin de microorganismos entre el ambiente confinado por la
barrera y el ambiente exterior de la misma. La barrera microbiolgica absoluta puede confinar al producto
o proceso, dejando al operador fuera de la misma o viceversa. En este caso se recomienda una cabina
de bioseguridad de tipo III.

Barrera qumica: Son dispositivos o sistemas que protegen al operador del contacto con substancias
irritantes, nocivas, txicas, corrosivas, lquidos inflamables, sustancias productoras de fuego, agentes
oxidantes y sustancias explosivas. En este caso se recomiendan una cabina de seguridad qumica.
Barrera fsica: Son dispositivos o sistemas de proteccin individual o colectiva que protegen contra las
radiaciones ionizantes, no ionizantes, ruidos, carga calrica, quemaduras y vibraciones excesivas.

NIVELES DE BIOSEGURIDAD
De acuerdo con el nivel de riesgo, el tipo de laboratorio, la barrera de contencin requerida, los
procedimientos y tcnicas a usar, se han establecido los siguientes niveles de Bioseguridad.
Nivel de Bioseguridad I: Es aquel que corresponde a las actividades desarrolladas en un laboratorio
bsico, por personal adiestrado en los procedimientos que se ejecutan en l. En este nivel se trabaja con
agentes clasificados en el Grupo de riesgo I por presentar un peligro mnimo para el personal del
laboratorio y para el ambiente. En el nivel de Bioseguridad I no se requiere equipo especial ni un diseo
especfico de las instalaciones. El personal de estos laboratorios es generalmente supervisado por un
cientfico con entrenamiento en microbiologa.
Nivel de Bioseguridad II: Es aquel que corresponde a las actividades desarrolladas en un laboratorio
bsico, por personal adiestrado en el manejo de agentes de riesgo del grupo II. Es similar al nivel I y en l
se manejan agentes de peligro moderado hacia el personal y el ambiente, pero difiere del nivel I en las
siguientes caractersticas:
1. El personal de laboratorio tiene entrenamiento especfico en el manejo de agentes patgenos.
2. El acceso al laboratorio es restringido cuando se est realizando algn trabajo.
3. Se toman precauciones extremas con instrumentos punzo cortantes contaminados.
4. Ciertos procedimientos en los cuales pueden salpicar los agentes o aerosoles se llevan a cabo en
cabinas de trabajo microbiolgico.
Nivel de Bioseguridad III: Es aquel que corresponde a las actividades desarrolladas en el laboratorio de
contencin. El personal debe contar con adiestramiento especfico para el manejo de agentes de alto
riesgo clasificados en el grupo de riesgo III. En el laboratorio se realiza trabajo con agentes que pueden
causar un dao serio y potencialmente mortal como resultado de la inhalacin o exposicin a los mismos.
El laboratorio cuenta con un diseo y caractersticas especiales tendientes a proteger al operador y al
ambiente. Todos los materiales son manipulados utilizando vestimenta y equipo de proteccin siguiendo
protocolos rigurosos. Los laboratorios se mantienen con una presin de aire negativa, lo cual ayuda a
impedir que los agentes nocivos escapen al ambiente.
Nivel de Bioseguridad IV: Es aquel que corresponde a las actividades desarrolladas en el laboratorio de
contencin mxima. Este nivel es el que se utiliza para trabajar con agentes biolgicos clasificados en el
grupo de riesgo IV por representar un alto riesgo individual de contagio y que adems son un riesgo para
la vida. Los agentes nuevos que presentan caractersticas antignicas, patognicas u otras similares a
agentes de nivel III y IV son confinados a nivel IV hasta que exista suficiente informacin cientfica para
establecer a cual grupo de riesgo pertenecen.
El personal que trabaja en los laboratorios de nivel IV tiene entrenamiento especfico y extensivo en el
manejo de agentes infecciosos, y cuenta con entrenamiento para trabajar en el ambiente estril y
controlado. El laboratorio cuenta con un diseo y caractersticas especiales tendientes a proteger al
operador y al ambiente. Todos los materiales son manipulados utilizando vestimenta y equipo de
proteccin de caractersticas superiores a las exigidas para el trabajo en un laboratorio de nivel III. Los
trajes estn diseados para cubrir la totalidad del cuerpo, presentan un sistema de respiracin individual
asociado y una leve sobrepresin interna para evitar as la entrada accidental de partculas infecciosas.
Los laboratorios se mantienen con una presin de aire negativa , lo cual ayuda a impedir que los

agentes nocivos escapen al ambiente.

TIPOS DE LABORATORIOS
En relacin con el grado de riesgo los laboratorios combinan las caractersticas de diseo,
construccin, medios de contencin, equipo, prcticas y procedimientos de operacin necesarios para
trabajar con agentes patgenos de los distintos grupos de riesgo. De esta manera los laboratorios se
clasifican en 3 categoras:
Laboratorio bsico: Dividido en dos grupos, el de nivel de bioseguridad 1;y el de nivel de bioseguridad 2;
Laboratorio de contencin: con nivel de bioseguridad 3, y
Laboratorio de contencin mxima: con nivel de bioseguridad 4.

TRABAJO GUIADO
1.-Complete los nombres de los distintos smbolos que se presentan a continuacin.
SEALES DE ADVERTENCIA

SEALES DE PROHIBICION

SEALES DE OBLIGATORIEDAD

1.- complete el recuadro :


NIVEL DE
BIOSEGURIDAD

FECHA

ACTITUDINAL

CARACTERISTICAS

MATERIAL

TIPO
DELABORATORIO

PARTICIPACIN

EJEMPLOS DE
PATOGENOS

FIRMA/ SELLO
PROFESOR

SEGUNDA PARTE:
MICROSCOPA Y ENFOQUE DE MUESTRAS

I.

FUNDAMENTO

La invencin del microscopio se atribuye a Johannes y Zacharias Jansen (1590) y el


descubrimiento de la estructura celular de los organismos a Robert Hooke (1665). Posteriormente, en
1683 y con un microscopio muy rudimentario Leeuwenhoek descubri un universo enmarcado slo por
decenas de micrmetros. Desde aquel entonces, el perfeccionamiento continuo al microscopio ha
permitido a la Ciencia profundizar cada vez ms en el conocimiento de la ultraestructura celular y de las
relaciones intercelulares.
MICROSCOPIO COMPUESTO
El microscopio es un instrumento ptico que se compone de una serie de lentes para conseguir
imgenes aumentadas de objetos diminutos que por su extrema pequeez no son visibles al ojo humano.
El microscopio compuesto est constituido de un SISTEMA OPTICO destinado a obtener una
imagen aumentada del objeto, un SISTEMA MECANICO que sostiene los distintos elementos pticos y
los objetos que se van a examinar y un SISTEMA DE ILUMINACIN.

CARACTERISTICAS DEL MICROSCOPIO


Dado que la imagen del microscopio no es real sino virtual, se han determinado algunos trminos
de medida microscpica:
En cualquier microscopio el poder de resolucin define su rendimiento ptico, porque es su
capacidad para ver como separados dos puntos que realmente lo estn pero que nuestro ojo slo puede
ver como una entidad nica (es decir es su capacidad de entregar imgenes bien ntidas).
El mximo poder de resolucin del microscopio ptico es de 0,2 micrmetros (0,2 m), debido a
que la longitud de onda de la luz utilizada (400-700 m) es un factor limitante. El ojo humano tiene un
poder de resolucin de aproximadamente 100 micrmetros.
El lmite de resolucin puede definirse como la distancia mnima que debe existir entre dos puntos
para que se puedan distinguir como separados. El lmite de resolucin se puede calcular a partir de la
siguiente ecuacin:
K
L.R. = ---------------

= constante = 0.61

A.N
= longitud de onda de luz AN = apertura numrica de cada lente
objetivo es su capacidad para captar la mxima cantidad de la luz
difractada por el objeto. Depende del ndice de refraccin del medio.
Recuerda: A menor lmite de resolucin mayor ser el poder de resolucin
Resolucin y magnificacin Mximas
Instrumento ptico
Resolucin
Magnificacin
Ojo humano
0,1 mm
Microscopio ptico
0,2 u
2500
Microscopio electrnico
0,1 nm
1000 000

10

II. OBJETIVOS

Reconocer las partes del microscopio ptico.


-Conocer su utilizacin para la observacin de distintas muestras biolgicas.

III. MATERIALES Y MTODOS


En el laboratorio encontrars:
- Microscopio compuesto
- Aceite de inmersin
- muestras fijadas

IV. PROCEDIMIENTO.
Se reconocern las partes de un microscopio ptico. Sealar las partes del mismo en el dibujo adjunto.
1. SISTEMA OPTICO. El sistema ptico est constituido por:
Objetivos: sistema de lentes convergentes que acta como una lente que se encuentran montados en el
revolver. Lo usual es que cada microscopio tenga cuatro objetivos de diferentes aumentos ( 4x,
10x, 40x, 100x) los que se clasifican en:
Objetivos en seco: en los que el aire se interpone entre la lente y la preparacin.
Objetivos de inmersin: en el cual un lquido (aceite) se interpone entre la lente y la preparacin.
Ocular: El ocular es una lente convergente que recoge la imagen intermedia producida por el objetivo y
forma una nueva imagen virtual, derecha, y amplificada un cierto nmero de veces (X veces,
segn se indica en el propio ocular). Los aumentos ms comunes son 10X y 16X.
2.-SISTEMA DE ILUMINACIN.
Condensador: Sistemas de lentes convergentes que concentra el haz de luz sobre la preparacin.
Diafragma: Sirve para regular la cantidad de luz que llega a la preparacin.
Fuente de luz: Puede ser natural o artificial (ampolleta).
Portafiltro: Opcional, sirve para colocar filtro de distintos colores para mejorar el contraste.

3.-SISTEMA MECANICO
Tubo ptico: Cilndrico ahuecado destinado a llevar el ocular en su extremo superior y los objetivos
montados en el revlver en su extremo inferior. La longitud del tubo debe ser siempre precisa.
Revlver: Pieza metlica situada en la parte inferior del tubo que por rotacin sita los diferentes
objetivos en posicin de trabajo.
Platina: Superficie plana con una perforacin central para permitir el paso de la luz hacia preparacin.
Posee un carro que sostiene la preparacin y que puede desplazarla hacia delante y hacia el
lado izquierdo o hacia el lado derecho.
Tornillo Macromtrico: Mecanismo de enfoque de avance rpido.

11

Tornillo Micromtrico: Mecanismo de enfoque con precisin o ajuste fino.


Base o Pie: Estructura slida y pesada que sostiene y da estabilidad a todo el instrumento.
Columna: Vstago vertical que se articula con la base y con el tubo del microscopio y lleva el mecanismo
de movimiento del mismo.

NOTA IMPORTANTE. Presta mucha atencin al manejo del microscopio que tienes a tu cargo. Debes
hacerlo cuidadosamente porque son aparatos muy delicados y dejars a consigna tu documento de
identificacin.

MANEJO DEL MICROSCOPIO PTICO


1 Colocar el objetivo de menor aumento en posicin de empleo y bajar la platina completamente.
2 Colocar la preparacin sobre la platina sujetndola con las pinzas metlicas.
3 Comenzar la observacin con objetivo de menor aumento. Si la preparacin es de bacterias emplear el
objetivo de mayor aumento (objetivo de inmersin, ver punto 6).
4 Para realizar el enfoque:
a. Acercar al mximo la lente del objetivo a la preparacin, empleando el tornillo macromtrico. Esto
debe hacerse mirando directamente y no a travs del ocular, ya que se corre el riesgo de incrustar el
objetivo en la preparacin pudindose daar alguno de ellos o ambos.
b. Mirando, ahora s, a travs de los oculares, ir separando lentamente el objetivo de la preparacin
con el macromtrico y, cuando se observe algo ntido la muestra, girar el micromtrico hasta obtener
un enfoque fino.
5. Pasar al siguiente objetivo. La imagen debera estar ya casi enfocada y suele ser suficiente con mover
un poco el micromtrico para lograr el enfoque fino.
6 El empleo del objetivo de inmersin es siempre utilizando aceite de inmersin.

12

TRABAJO GUIADO
1.- Indique todas las partes del microscopio

2.- MENCIONE LOS TIPOS DE MICROSCOPIOS QUE CONOCE

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

13

FIRMA/ SELLO
PROFESOR

PRACTICA N 2 (SEMANA 3)
PRIMERA PARTE: TECNICAS DE COLORACION. PREPARACION DE MUESTRAS
I. FUNDAMENTOS
La coloracin implica la penetracin del colorante por fenmeno osmtico y su fijacin se debe a
fenmenos de absorcin de partculas o iones. Qumicamente la coloracin es la unin de las molculas
del colorante con los elementos constituyentes de la clula. Algunas regiones celulares tienen pH alcalino
y se tien con los colorantes cidos; otros tienen pH cido y se tien con colorantes bsicos. Sin embargo
es necesario sealar que tanto el ncleo como el citoplasma tienen caractersticas anftericas de manera
que se pueden teir, el ncleo con algunos colorantes cidos y el citoplasma con algunos colorantes
bsicos.
El mecanismo de coloracin de las muestras biolgicas pueden ser afectados por:
Pureza del colorante
Concentracin del colorante
pH de la solucin del colorante
Temperatura del medio ambiente
Sustancias adicionales (mordientes)
Tiempo de coloracin.
Los preparados microscpicos, constituyen una serie de preparados rutinarios de laboratorios
que tienen por objeto identificar en forma rpida el contenido de un determinado tipo de muestra, con la
con la finalidad de resolver algn problema de inters particular. Los preparados microscpicos ms
frecuentes en Biologa son:
- Preparados en fresco
- Preparados en seco
Los preparados en Fresco son preparaciones microscpicas acuosas, que se caracterizan por
que la sustancia examen, no est adherida de un modo fijo a la superficie de la lmina portaobjeto y por
lo tanto, al ser manipulada sta en diferentes posiciones se corre el riesgo de perder u estropear el
preparado.
Los preparados en seco son aquellos que sufren un procesamiento previo (extensin, fijacin y
coloracin), y se caracterizan porque la sustancia examen se halla adherida a la superficie de la lmina
portaobjeto y por lo tanto, al ser manipulada sta en diferentes posiciones no se estropea o pierde la
muestra.
Es importante ejercitar al estudiante en el manejo y aplicacin de estos factores que inciden
bsicamente en la complementacin del aprendizaje del estudio de estructuras celulares, identificacin
de tejidos y microorganismo.
II. OBJETIVO.
1. Diferenciar y explicar el fundamento de las distintas coloraciones
2. Realizar coloraciones con muestras biolgicas
III. MATERIALES
Encontrars en el laboratorio.
- Microscopio ptico
- Goteros
- Mechero

- Pipetas pasteur
- Agua destilada
- Azul de metileno

Material de estudio:
- Agua estancada o agua de florero de al menos una semana de conservada
- Muestra de epitelio bucal extradas con hisopos

14

IV. PROCEDIMIENTO
PREPARADOS EN FRESCO
1. Colocar una gota de agua estancada o agua de florero en un portaobletos
2. colocar una laminilla cubreobjetos
3. Observa al microscopio
PREPARADOS EN SECO
1. Colocar la muestra de epitelio bucal extrada con los hisopos en un portaobjetos
2. Fijar por desecacin o suavemente a la flama del mechero
3. Realizar la coloracin con azul de metileno por 3 minutos
4. Retirar el exceso de colorante y secar al medio ambiente
5. Observa al microscopio
1.- Dibuje lo observado en las muestras preparadas en la prctica.
2.- Diferencie entre el preparado en fresco de un preparado en seco

Muestra:_________
Coloracin:_______
Aumento:________

Muestra:_________
Coloracin:_______
Aumento:________

PARTE 2: OBSERVACIN Y RECONOCIMIENTO DE CLULAS


PROCARIOTES,
I. FUNDAMENTO
La principal caracterstica de la clula procariota es que carece de
ncleo celular. Las bacterias, los organismos procariotes ms
representativos, comprenden por una parte, especies de
importancia mdica puesto que producen una serie de infecciones
y padecimientos en el hombre y en los animales pero, por otra
parte, una gran mayora representa beneficios para la agricultura,
la industria y la salud humana y animal.
Para observar este tipo de clulas se utiliza la Tincin Gram,
tcnica diseada por el mdico dans Hans Christian Gram. Esta
consiste en poner en contacto las clulas bacterianas con
colorantes bsicos como violeta de genciana, utilizando la solucin

15

de lugol como mordiente. Esto forma un compuesto yodado que se fija fuertemente en determinadas
bacterias. Segn la coloracin que adquieran, las bacterias se clasifican en:
GRAM POSITIVAS: se tien fuertemente con violeta de genciana y adquieren una coloracin violeta.
GRAM NEGATIVAS: se tien muy superficialmente por lo que fcilmente se decoloran con solventes
orgnicos. Se utiliza adicionalmente la safranina o fucsina, que se emplea como colorante de contraste,
adquiriendo una coloracin rosada.
La diferente tincin de bacterias se debe a la composicin diferencial de sus paredes bacterianas. Las
bacterias Gram positivas poseen una pared celular con mureina y cido teitoico. En cambio, las Gram
negativas tienen una pared mucho ms compleja que contiene, adems del peptidoglucano, una
asociacin de protenas lpidos y lipopolisacridos
Adems de la coloracin esta tcnica nos permite distinguir en las bacterias: a) morfologa: cocos,
bacilos, espirilos, cocobacilos, vibrios, etc) b) agrupacin: pares, cadenas ttradas, racimos, sarcina
A: forma de caa o bacilos
B: Redondos en lneas: estreptococos
C: redondos en cmulos: estafilococos
D: Redondos en pares: diplococos
E: Forma de espirales: espirilos
F: En forma de coma: vibrios

II. OBJETIVOS

Reconocer los distintos tipos de bacterias segn se tian o no con la Tincin Gram.

III. MATERIALES
Encontrars en el laboratorio:
Microscopio ptico - Alcohol acetona
Soluciones para la tincin: - Fucsina o safranina
- Violeta de genciana
- Aceite de inmersin
- Lugol
- Mechero de alcohol
Material de estudio:
- Yogurt
- Vinagre casero (NO comercial)
- Muestra de sarro dental extrada con mondadientes

IV. PROCEDIMIENTO
La tincin Gram se realizar sobre las muestras de yogur, sarro dentario y vinagre (no industrial) que los
alumnos traern.
Bacterias del yogurt
El yogur es un producto lcteo producido por la fermentacin natural de la leche. A escala industrial se
realiza la fermentacin aadiendo a la leche dosis del 3-4% de una asociacin de dos cepas bacterianas:
el Streptococcus termophilus, poco productor de cido, pero muy aromtico, y el Lactobacillus bulgaricus,
muy acidificante. En esta preparacin se podrn, por tanto, observar dos morfologas bacterianas
distintas (cocos y bacilos) y un tipo de agrupacin (estreptococos, cocos en cadenas arrosariadas).
Adems, el tamao del lactobacilo (unos 30m de longitud) facilita la observacin aunque no se tenga
mucha prctica con el enfoque del microscopio.

16

Bacterias del vinagre


El vinagre es una solucin acuosa rica en cido actico resultante de la fermentacin espontnea del
vino o de bebidas alcohlicas de baja graduacin. La acetificacin del vino es producida por bacterias
aerbicas del cido actico, principalmente Acetobacter aceti, aunque tambin Gluconobacter. Se trata de
bacilos rectos con flagelos polares.
Bacterias del sarro dental
El sarro dental es un depsito consistente y adherente localizado sobre el esmalte de los dientes. Est
constituido principalmente por restos proteicos, sales minerales y bacterias junto con sus productos
metablicos. La flora bacteriana de la cavidad bucal es muy variable dependiendo de las condiciones que
se den en el momento de hacer la preparacin, pero suelen abundar bacterias saprfitas, pudindose
observar gran variedad de morfologas: espiroquetas, cocobacilos, diplococos y bacilos.
Realizar los siguientes pasos para la tincin Gram de cada una de las 3 muestras indicadas.
1
2
3
4
5
6
7
8
9

Realizar una extensin de la muestra de cultivo bacteriano sobre un portaobjetos


Secar ante un mechero.
Cubrir el preparado con violeta de genciana por 1 minuto.
Enjuagar la lmina con agua destilada
Aadir lugol por 1 minuto.
Lavar con agua destilada y decolorar con alcohol acetona.
Aadir fucsina o safranina y dejar que acte por 1 minuto.
Lavar con agua corriente, secar
Coloque una gota de aceite de inmersin encima de la lmina cubreobjetos y observar al
microscopio con el objetivo de inmersin.

PARTE PRACTICA
1.- completar el grafico

17

2.-Dibuje todas las muestras observadas en la prctica.


Seale y mencione los tipos de bacterias observadas, por su clasificacin segn la tincin y su morfologa

BACTERIAS DE YOGURT

BACTERIAS DEL VINAGRE

Coloracin:_______
Aumento:________

Coloracin:_______
Aumento:________

BACTERIAS DEL SARRO DENTAL

Coloracin:_______
Aumento:________

FECHA

ACTITUDINAL

Coloracin:_______
Aumento:________

MATERIAL

PARTICIPACIN

18

FIRMA/ SELLO
PROFESOR

PRACTICA N3 (SEMANA 4)
OBSERVACIN DE CLULAS EUCARIOTES

I. FUNDAMENTO
En 1939, en base a observaciones realizadas por los cientficos alemanes Schleiden y Schwan,
se plasm la teora celular, la cual produjo un cambio radical en las ciencias biolgicas. Esta teora
postula que los cuerpos de todos los animales y vegetales estn formados de clulas y que solo pueden
aparecer nuevas clulas por divisin de las clulas preexistentes. De ah que los organismos por muy
sencillos que sean estn constituidos por unidades vivas denominadas clulas.
La clula eucariota es ms compleja que la clula procariota y contiene, a diferencia de esta
ltima, ncleo celular. Los organismos ms simples (protozoarios) estn constituidos de una sola clula
eucariota mientras que los ms complejos o multicelulares estn formados por un gran nmero de clulas
eucariota que se hallan organizadas en tejidos, rganos y sistemas.
II. OBJETIVOS
Observar y caracterizar clulas eucariotas de tipo vegetal (epidermis de cebolla ).
Observar y caracterizar clulas eucariotas de tipo animal (epitelio bucal, tejido adiposo y sangre).
III. MATERIALES
Encontrars en el laboratorio
Microscopio ptico
Lugol
Mechero de Alcohol
Lanceta estril
Formol
Wright
Lminas portaobjeto y cubreobjeto

Cubeta de tincin
Frasco lavador
Alcohol absoluto
Hematoxilina
Eosina
Sudan III
Gotero

Material de estudio:
Catafilo de Cebolla
Hisopos
Tocino
Agua estancada de 15 das guardada en frasco oscuro con trocitos de lechuga
Levadura de pan
Gotas de sangre obtenidas por puncin con lanceta hematolgica en un dedo
Materiales de diseccin: tijera, pinza, estilete. Bistur u hoja de afeitar
IV. PROCEDIMIENTO
4.1. Observacin de clulas vegetales (Clulas epiteliales de Allium cepa)
Las clulas de la epidermis de las hojas internas del bulbo de la cebolla, son de forma alargada y
bastante grande. La pared celular celulsica se destaca muy clara teida por el colorante. Los ncleos
son grandes y muy visibles. En el citoplasma se distinguen algunas vacuolas grandes dbilmente
coloreadas.
1 Separe una de las capas del bulbo de la cebolla. Con ayuda de una pinza desprenda la membrana
epidrmica que cubre la parte interna de la cebolla (catafilo) y extindala en el portaobjetos.
2 Utilizando una hoja de afeitar obtenga una porcin de medio centmetro cuadrado, cbrala con una
gota de lugol, coloque cuidadosamente el cubreobjeto y observe en el microscopio.
3 Reconozca las partes de la clula vegetal.

19

4.2. Observacin de organismos unicelulares


1
2
3
4

Coloque una gota de agua estancada sobre un porta objeto y cubran con una laminilla.
Observe con el objetivo de menor aumento.
Ajuste el diafragma para incrementar el contraste.
Observe la forma, tamao y movimiento de los organismos unicelulares (ver figura adjunta).

4.3. Observacin de levaduras del pan


1 Diluya un trocito de levadura de pan (Saccharomyces cerevisiae) con agua destilada, en un tubo
de ensayo.
2 Observe con el objetivo de mayor aumento.
3 Ajuste el diafragma para incrementar el contraste.
4 Observe la forma y tamao de estos organismos.

4.4. Observacin de clulas animales (Epitelio bucal)


El azul de metileno tie intensamente el ncleo y con menos color el citoplasma de las clulas. ste
suele ser algo granuloso.
1
2
3
4
5
6

Con un hisopo limpio extraiga suavemente la mucosidad de la cavidad bucal.


Deposite la mucosidad extrada en el centro de una lmina portaobjetos y extindalo con un frotis.
Agregue unas gotas de AZUL de metileno y espere 3 minutos.
Elimine el exceso de colorante utilizando agua y coloque un cubreobjetos.
Observe la muestra a menor aumento y localice: clulas asociadas y dobladas.
Luego visualice a mayor aumento y reconozca los componentes celulares.

5.5. Observacin de clulas animales (Tejido adiposo)


El Sudan III es un compuesto que tie lpidos de color rojo intenso. En el tejido adiposo, que contiene
gran cantidad de grasas, se observarn los adipocitos teidos por el Sudan III.
1
2
3
4
5

Con ayuda de un bistur, cortar una fina capa de grasa de tocino


Colocarla en un portaobjetos y cubrirla con unas gotas de formol. Dejar actuar 4 minutos.
Lavar la muestra con agua y cubrirla con unas gotas de Sudn III. Dejar actuar unos 5 minutos.
Volver a lavar la preparacin con agua, cubrirla con un cubreobjetos
Observar al microscopio.

4.6. Observacin de clulas animales (Sangre)


Al microscopio las clulas sanguneas se vern predominantemente los glbulos rojos, hemates o
eritrocitos teidos de color rojo por la eosina. No tienen ncleo y son ms delgados por el centro que por
los bordes. Los glbulos blancos o leucocitos se identifican fcilmente por la presencia de ncleo, teido
de morado por la hematoxilina. Hay varias clases de
leucocitos:
Linfocitos: de tamao aproximado al de los glbulos
rojos, tienen un solo ncleo que ocupa casi todo el glbulo.
Monocitos: son los leucocitos mayores, poco frecuentes
normalmente, ncleo grande, redondo, son los ms mviles
y su funcin principal es la fagocitosis.
Polimorfonucleares: ncleo fragmentado o arrosariado.
Pueden ser eosinfilos, neutrfilos y basfilos.
Los eosinfilos, con granulaciones abundantes de color
rojizo y el ncleo teido de color azul marino. Estos glbulos
aumentan su nmero en caso de parasitosis o procesos
alrgicos.
Los basfilos presentan un ncleo teido de rojo y las granulaciones del citoplasma de color muy oscuro.
Las plaquetas no son visibles ya que precisan una tcnica especial de tincin.

20

Efecta los siguientes pasos para ambas coloraciones, Wright y Hematoxilina-Eosina:


1
2
3

Con ayuda de una lanceta desechable, realice una puncin del pulpejo del dedo anular de la mano
izquierda, previa desinfeccin con algodn y alcohol.
Tome una gota de sangre y haga un frotis fino sobre el portaobjeto
Colocar el frotis extendido ya seco, sobre una base plana en posicin totalmente horizontal.

Para la coloracin de Wright:


1 Coloree con unas gotas de colorante Wright, inmediatamente agregar sobre el colorante el mismo
nmero de gotas de agua destilada y mezclar rpidamente, soplando suavemente hasta que se
forme una capa plateada.
2 Dejar reposar la mezcla por 8 - 10 minutos, observando la intensidad de color.
3 Lave con agua corriente y dejar secar al medio ambiente, si es posible con la lamina en forma
vertical.
4 Observe al microscopio. Utilice el objetivo de 100X para la observacin de las clulas y ncleos.
5 Diferencie las diferentes formas de ncleo en los neutrfilos, basfilos, eosinfilos, monocitos y
linfocitos.
6 Dibuje cada forma de ncleo.
Para la coloracin de Hematoxilina-Eosina:
1 Colocar el frotis de sangre sobre la cubeta de tincin y aadir unas gotas de alcohol absoluto y
dejar que el alcohol se evapore para fijar la preparacin.
2 Cubrir con unas gotas de hematoxilina y dejar actuar durante 15 minutos. Evitar la desecacin del
colorante agregando ms lquido.
3 Lavar la preparacin y aadir unas gotas de eosina dejndola actuar 1 minuto.
4 Volver a lavar hasta que no queden restos de colorante.
5 Dejar secar aireando el porta o bien al calor muy lento de la llama del mechero.
6 Observar al microscopio. Utilice el objetivo de 100X para la observacin de las clulas y ncleos.

DESARROLLO
1.- Por qu los eritrocitos se tien con Eosina y los Leucocitos con Hematoxilina?
______________________________________________________________________
______________________________________________________________________
______________________________

2.-Para qu sirve el FORMOL en la coloracin de adipositos?


______________________________________________________________________
____________________________________

3.-Cul es el proceso de fijacin para la observacin de las clulas de la sangre ?


______________________________________________________________________
____________________________________

21

4 - Dibuje las distintas muestras observadas en la prctica:

Muestra:_________
Coloracin:_______
Aumento:________

Muestra:_________
Coloracin:_______
Aumento:________

Muestra:_________
Coloracin:_______
Aumento:________

Muestra:_________
Coloracin:_______
Aumento:________

Muestra:_________
Coloracin:_______
Aumento:________

Muestra:_________
Coloracin:_______
Aumento:________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

22

FIRMA/ SELLO
PROFESOR

PRACTICA N 4 (SEMANA 5)
PERMEABILIDAD CELULAR
I. FUNDAMENTO
La membrana celular permite el transporte de sustancias de manera selectiva. Muchas sustancias,
adems del agua, entran a la clula y salen de ella por efecto de los gradientes de concentracin, aunque
slo unas cuantas (CO2 y O2) puedan hacerlo tan fcilmente como el agua. Si una membrana celular se
deja atravesar por una sustancia, se dice que es permeable a dicha sustancia.

El volumen celular cambia cuando el agua penetra o sale de la clula por un proceso denominado
osmosis.
En trminos osmticos las soluciones o medios separados por una membrana se pueden clasificar
como hipertnicas, isotnicas e hipotnicas; se dice que un medio es hipertnico, cuando la concentracin
del soluto en la solucin es mayor en relacin con otro medio de solucin. Por ejemplo, si tenemos dos
soluciones, la solucin 1 con agua destilada y la solucin 2 con una solucin de azcar al 10%, se dice
que la solucin 2 de azcar es hipertnica en relacin a la solucin 1. Por el contrario, la solucin 1 es
hipotnica en relacin a la solucin 2 azucarada, es decir que la concentracin del soluto es menor en
relacin con el otro medio. Y una solucin isotnica, se cuando la concentracin de soluto es igual a la
concentracin de soluto de la otra solucin.

II. OBJETIVO.
2.1 Observar y describir los fenmenos de difusin y smosis y su importancia en el intercambio de
sustancias en la clula.

23

III. MATERIALES
Encontrars en el laboratorio.
- Microscopio ptico
- Agua destilada
- Tubos de ensayo
- Algodn
- Gradillas
- Marcador de vidrio
- Solucin hipotnica NaCl 0.065 M
- Ligadura
- Solucin hipertnica NaCl al 2%
- Alcohol corriente
- Solucin isotnica de NaCl al 0.9% (suero fisiolgico)
- Azul de metileno
- Tres Beaker y tres placas petri
Material de estudio:
- Tres huevos que han permanecido sumergidos por 3 das en vinagre
- Gotas de sangre obtenidas por puncin con lanceta hematolgica en un dedo
IV. PROCEDIMIENTO

Parte A
1 En tres tubos de ensayo numerados coloque:
-1 ml. de solucin hipotnica NaCl 0.01 %
-1 ml. de solucin isotnica de NaCl al 0.9% (suero fisiolgico)
-1 ml. de solucin de hipertnica NaCl al 2%.
2 Realizar una puncin con la lanceta hematolgica en un dedo previamente desinfectado con alcohol.
3 Dejar caer 1 a 2 gotas de sangre en cada uno de los tubos.
4 Agite los tubos y dejar en reposo durante 2 3 minutos.
5 Con un gotero coloque en una lmina portaobjeto una gota de cada uno de los tres tubos.
6 Luego examine en el microscopio su aspecto. Observar qu efecto ha tenido las distintas soluciones
sobre la morfologa del eritrocito y explicar por qu.

Parte B
1. Colocar los tres huevos en un vaso de precipitacin de 1 litro y verter el vinagre hasta cubrir
completamente los huevos. Debe realizarse este proceso 3 das antes de la prctica.
2. Al momento de la prctica lavar con mucho cuidado con agua de cao.
3. Frotar cuidadosamente con los dedos para sacar la cscara. Realizar este proceso hasta tener casi un
tercio del huevo libre de cscara.
4. Coloquen agua de cao en uno de los vasos de precipitacin de 100ml y ubiquen all uno de los
huevos. El agua debe cubrir al huevo.
5. En otro vaso de precipitacin colocar un huevo en la mezcla muy concentrada de sal en agua y colocar
all otro de los huevos.
6. Llenar el tercer vaso con agua destilada y poner all el tercer huevo.
7. en cada frasco se adicion unas gotas de azul de metileno
8. Dejar por una hora y observar membrana y el contenido interno del huevo.
NOTA: En todos los vasos de precipitacin, los huevos deben quedar sumergidos en el lquido.

24

DESARROLLO
1. Mencione y dibuje las diferencias encontradas en cada uno de los huevos sometidos a cada proceso.
TABLA: Observacin de resultados
Solucin de Sal

Agua de cao

Agua destilada

Esquema o
dibujo

Descripcin

Conclusin:

2. Dibujar todas muestras observadas en la prctica

Muestra:_________
Coloracin:_______
Aumento:________

Muestra:_________
Coloracin:_______
Aumento:________

Muestra:_________
Coloracin:_______
Aumento:________
CONCLUSIONES:

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

25

FIRMA/ SELLO
PROFESOR

PRACTICA N 5 (SEMANA 6)
PRIMERA PARTE: OBSERVACIN DE MOVIMIENTO
CELULAR. CICLOSIS
I. FUNDAMENTO
El citoplasma celular esta formado por el hialoplasma y el morfoplasma. El hialoplasma es un medio
acuoso, con un 85% de agua en el cual esta disuelta gran cantidad de molculas formando una solucin
coloidal; prtidos (AA, enzimas, protenas estructurales), lpidos, glcidos (polisacridos, metabolitos),
cidos nucleicos (nucletidos, nuclesidos, ADN, ARN, ARNt, ARNr) sales e iones.
El hialoplasma es un medio dinmico, ya que puede pasar del estado de sol a gel acumulando
molculas que establecen enlaces entre si y aumentando la viscosidad; pueden invertirse el proceso de
gel a sol diluyndose o separando las molculas, esto permite la creacin de corrientes internas o Ciclosis
y algunas clulas pueden emitir prolongaciones del citoplasma o SEUDOPODOS como rganos de
desplazamiento.

II. OBJETIVOS
2.1. Explicar los movimientos citoplasmticos
III. MATERIALES
Encontraras en el laboratorio
- Microscopio compuesto
Material de estudio:
- Hoja de Elodea
IV. PROCEDIMIENTO
4.1. Movimientos Citoplasmticos: Ciclosis
1. Colocar una hoja de Elodea sobre una lamina portaobjetos
2. Agregar una gota de agua y colocar la laminilla
3. A menor y mayor aumento observar las clulas e identificar los cloroplastos
4. Con abundante luz observar el desplazamiento del citoplasma conjuntamente con los
Cloroplastos

Observaciones:

Que elementos citoplasmticos participan en el


movimiento Celular citoplasmtico?

26

SEGUNDA PARTE:
CITOPLASMATICA

OBSERVACIN

DE

ORGANELAS

INCLUSIONES

I. FUNDAMENTO
Todas las funciones intracelulares (sntesis de protenas, replicacin de DNA y rutas metablicas
en general) son realizadas gracias una compleja organizacin de las organelas. Una clula eucariota
tpica contiene organelas membranosas (retculo endoplasmtico, aparato de golgi, peroxisomas,
mitocondrias, etc.) y organelas no membranosas (ribosomas, proteosomas, etc.). Todas ellas efectan
una funcin puntual en la clula que le permite su supervivencia y replicacin.
La supervivencia de la clula depende, entre otros factores, de la obtencin de energa neta.
Dicho proceso est a cargo de las mitocondrias y/o de los cloroplastos. Las mitocondrias se encuentran
en mayor nmero en clulas animales pero tambin pueden presentarse en clulas vegetales, mientras
que los cloroplastos son exclusivos de clulas vegetales y algunas bacterias fotosintticas. Las
mitocondrias oxidan molculas orgnicas utilizando oxgeno del aire como aceptor de electrones y forman
ATP. Los cloroplastos capturan energa de la luz y la transforman en ATP mediante el proceso
denominado fotosntesis.

II. OBJETIVOS
2.1Observar y diferenciar orgnulos de clulas vegetales: cromoplastos y cloroplastos. Reconocer y diferenciar mitocondrias.

III. MATERIALES
Encontrars en el laboratorio:
- Microscopio ptico
- Verde de Janus
- Agua destilada
- Lugol
- Gotero
Materiales de estudio:
- Pulpa de Tomate
- Hojas de Elodea
- Muestra de clulas epiteliales humanas tomadas con un hisopo
IV. PROCEDIMIENTO
4.1. Observacin de cromoplastos en clulas de pulpa de tomate
La pulpa del tomate nos muestra las clulas generalmente bastante sueltas unas de otras. En el
citoplasma se percibe una serie de grnulos rojizos-anaranjados que son los cromoplastos. El ncleo
puede llegar a observarse por su tpico aspecto y tamao. Es frecuente la presencia de grnulos de
almidn de forma arrionada. En las clulas menos alteradas por la compresin se ven grandes
vacuolas incoloras.
1 Cortar con el bistur un pequeo trozo de uno o dos milmetros de grosor, de la parte pulposa del
tomate.
2 Llevarlo sobre un portaobjeto, sin poner agua.
3 Poner el cubre-objeto y comprimir suavemente la preparacin.
4 Observar al microscopio

27

4.2. Observacin de cloroplastos en clulas de Elodea


1
2
3

En un portaobjetos coloque una porcin pequea de hoja de Elodea y agregue una gota de agua.
Cubrir la muestra con una lmina portaobjetos.
Aprecie la forma de los cloroplastos y el movimiento de estos.

4.3. Observacin de mitocondrias en clulas epiteliales humanas


1
2
3
4
5

Preparar un frotis de epitelio bucal con un hisopo.


Secar al medio ambiente.
Agregar unas gotas de Verde de Janus y dejar reposar por 3 minutos.
Elimine el exceso del colorante con agua destilada.
Observe al microscopio y describa la forma de las mitocondrias en la clula.

PARTE PRACTICA
1. Dibuje y coloree las distintas muestras observadas en la prctica. Mencionando el aumento total.

Muestra:_________
Coloracin:_______
Aumento:________

Muestra:_________
Coloracin:_______
Aumento:________

Muestra:_________
Coloracin:_______

Muestra:_________
Coloracin:_______

Aumento:________

Aumento:________

DESARROLLO:
Diferencie una organela de una inclusin citoplasmtica:

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN
28

FIRMA/ SELLO
PROFESOR

PRACTICA N 6 (SEMANA 7)
ACTIVIDAD ENZIMTICA
PRIMERA PARTE: CATALASA
I. FUNDAMENTO
Las enzimas son protenas cuya funcin es acelerar (catalizar) reacciones qumicas que ocurren
dentro de la clula y que en ausencia de ellas no se llevaran a cabo o de lo contrario tomaran
muchsimo tiempo. Como se aprecia en la siguiente figura, las enzimas son especficas para sus
sustratos, los cuales quedan unidos complementariamente al sitio de unin de la enzima donde son
modificados enzimticamente, liberndose al final de la reaccin los productos respectivos.

La catalasa es una enzima que se encuentra en las clulas de los tejidos animales y vegetales. La
funcin de esta enzima en los tejidos es necesaria porque durante el metabolismo celular, se forma una
molcula txica que es el perxido de hidrgeno, H2O2 (agua oxigenada). Esta enzima, la catalasa, lo
descompone en agua y oxgeno, por lo que se soluciona el problema. La reaccin de la catalasa sobre el
H2O2, es la siguiente:

II. OBJETIVO.
2.1 Detectar la presencia de la enzima catalasa en un tejido animal.

III. MATERIALES
Encontrars en el laboratorio
- Gradillas
- Pipetas-tubos de ensayo
Material de estudio
- Hgado de pollo
- Agua oxigenada

IV. MTODOS

1
2
3
4

Colocar en dos tubos de ensayo unos trocitos de hgado en diferentes cantidades.


Aadir 3 mililitros de agua oxigenada.
Se observar un intenso burbujeo debido al desprendimiento de oxgeno.
Discutir la formacin de burbujas en distintas mesas, relacionndolo con la concentracin de catalasa.
29

SEGUNDA PARTE: HIDROLISIS DE LA AMILASA


I.

FUNDAMENTO

Mediante esta experiencia vamos a ver la actividad de otra enzima, la amilasa o ptialina, presente
en la saliva. Esta enzima acta sobre el polisacrido almidn, hidrolizando el enlace O-glicosdico, por lo
que el almidn se terminar por transformar en unidades de glucosa. Es importante que recuerdes las
reacciones caractersticas de glcidos para comprender esta experiencia.
II.

OBJETIVOS. Comprobar que slo bajo ciertas condiciones las enzimas funcionan
ptimamente catalizando una reaccin enzimtica con su sustrato.

III.

MATERIALES

Encontrars en el laboratorio.
- tubos de ensayo
-gradillas
-solucin diluida de almidn y sacarosa

- Bao mara
- Vaso de precipitados
- Lugol

IV. MTODOS
1.
2.
3.
4.

Poner en una gradilla cuatro tubos de ensayo, numerados del 1 al 4.


Proceder a llenar los tubos como lo indica la figura.
Agregar 3 gotas de lugol a cada tubo
Aparecern diferencias entre los 4 tubos dependiendo de si hay o no almidn en el medio.
Recuerda: reaccin positiva de reconocimiento de almidon es una coloracin violeta, hay almidn.
Reaccin negativa, no cambia color, no hay almidn.
En la actividad enzimtica, el almidn se degrada por lo que la coloracin con lugol es de menor
intensidad.

Nota: Para ayudarte y formar ms saliva, piensa en un limn o en algo que te apetezca mucho comer...
As favoreces que se forme ms saliva.

DESARROLLO
1.-En qu parte de las clulas encontramos la enzima catalasa y cul es la funcin de dicha enzima?.
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
2.- Qu factores, adems de la temperatura, podran afectar la actividad de una enzima?.
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
3.- Cmo se clasifican las enzimas?.
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________
____________________________________________________________________________________

30

. Dibuje las reacciones observadas en la prctica.

ACTIVIDAD DE CATALASA
Anote sus observaciones y Relacione la actividad con la
concentracin de la enzima

________________________
________________________
________________________

ACTIVIDAD DE AMILASA
Anote sus observaciones y Defina control de reaccin y temperatura ptima

________________________
__________________________
__________________________
__________________________
__________________________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

31

FIRMA/ SELLO
PROFESOR

PRACTICA N 7 (SEMANA 9)
METABOLISMO ANAEROBIO: FERMENTACIN
ALCOHLICA

I. FUNDAMENTO
La respiracin celular es el proceso mediante el cual se oxidan molculas energticas (glucosa,
principalmente), empleando al oxgeno como aceptor final de electrones, y obteniendo gran cantidad de
energa para la realizacin de las funciones celulares bsicas.
La fermentacin, por el contrario, es un proceso anaerbio que implica la ruptura de alimentos por
un proceso de degradacin qumica que no requiere oxgeno. Los alimentos no son degradados
completamente hasta CO2 y H2O (como ocurre en la respiracin), sino hasta compuestos intermedios
tales como cido lctico (fermentacin lctica) o alcohol (fermentacin alcohlica). Esta ruptura
incompleta de los alimentos significa que menos energa es disponible durante la fermentacin que el
liberado durante la respiracin.
Ambos procesos pueden tomar lugar en las clulas a la vez. Adems, los primeros pasos en la
ruptura de la glucosa en la respiracin, son anaerbicos.
Anaerbica
Glucosa

cido lctico
Aerbica

Glucosa

CO2 + H2O

Ciertas bacterias y hongos derivan todo sino parte de su energa de la fermentacin y los
productos finales son frecuentemente el alcohol y CO 2, el proceso en este caso es denominado
fermentacin alcohlica. Las levaduras y bacterias, las cuales conducen a la fermentacin son capaces
de emplear sus sistemas enzimticos para liberar energa anaerbicamente a partir de carbohidratos,
particularmente almidn y azcar.

32

II. OBJETIVOS
2.1
2.2
2.3

Comprobar que ante la presencia de oxgeno, el azcar es oxidado hasta CO 2 y agua.


Comprobar que en ausencia de oxgeno, el azcar es convertido en etanol y CO 2 por las
levaduras, mediante el proceso de fermentacin alcohlica.
Comparar cualitativamente un proceso fermentativo vs. Respiracin.

III. MATERIALES
Encontrars en el laboratorio
-Tubos de ensayos
-Reactivo de Fehling A y B
- Gradillas
- Bao Maria
- Probetas -Algodn
-Tiras de medidas de pH -Dicromato de potasio
-Soluciones al 2% de fructosa, glucosa, almidn y sacarosa
-Acido sulfrico diluido
Material de estudio:
- Levadura
- Globos No. 5 para generar la aneerobiosis
IV. MTODOS
Fermentacin alcohlica
1. Preparar los tubos como lo indica la tabla:
REACTIVO

Agua Destilada

....

....

....

.....

Sol. de levadura

5mL

5mL

5mL

Solucin de Glucosa

5mL

5
....

6
....

5mL

5mL

Sol. Sacarosa

5mL

Sol. Almidn

5mL

Sol. Fructosa

5mL

Sol. Glucosa

5mL

2. La muestra con glucosa sola nos servir para realizar la reaccin de Fehling y comprobar que es
glucosa por su poder reductor.
3. Para colocar la levadura en el tubo, previamente se tiene que disolver la levadura
(Sacharomyces cerevisae) en un poco de agua.
4. Llenar los tubos cuidando que no queden burbujas de aire, para conseguir un ambiente de
anaerobiosis. Colocar un globo en la boca de los tubos para que el sistema quede cerrado
hermticamente.
5. Llevar todos los tubos a 37C por 30 min.
6. Anotar la formacin de CO 2 para cada tubo (La fermentacin se evidenciar por la presencia de
burbujas en el tubo y el globo hinchando, debido a la produccin de CO 2.
7. Detectar la presencia de glucosa aplicando reactivo de Fehling A y B, llevando a Bao Maria por
8 minutos
8. Medir el pH del medio.
9. Opcionalmente, el profesor del grupo detectar cuidadosamente la presencia de etanol en las
muestras. Hay que tener mucho cuidado porque hay que manipular cido sulfrico y puede ser
peligroso el manejarlo. Se tomarn 2 ml. de la solucin del tubo hermticamente cerrado y la
ponemos en otro tubo de ensayo. Aadimos unos cristalitos de dicromato potsico y a
continuacin 2 ml. de acido sulfrico diluido. Al calentar al bao Mara debe formarse un
compuesto aromtico caracterstico, y se pone de manifiesto porque cambia de color de
amarillento a verdoso. Es una reaccin que nos indica que existe etanol.
10. Observar, comparar y discutir los resultados de los experimentos planteados.

33

DESARROLLO
1.- Complete el dibujo y la tabla.

CO2
glucosa
pH
etanol
Observaciones y/o Conclusiones:
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

34

FIRMA/ SELLO
PROFESOR

PRACTICA N 8 (SEMANA 11)


DIVISIN CELULAR: MITOSIS
I. FUNDAMENTO
El ciclo celular es un proceso que consiste en la replicacin de material gentico y formacin de
clulas hijas. Compromete dos etapas: La primera llamada interfase, donde no ocurre divisin celular
propiamente dicha y la segunda de divisin celular (ver figura). Dependiendo del tipo de clulas donde se
lleve a cabo, la divisin celular toma el nombre de Mitosis (si ocurre en clulas somticas) o Meiosis (si
ocurre en clulas germinales).
La mitosis implica cuatro etapas: Profase, Metafase, Anafase y Telofase.
En las dos primeras ocurre la condensacin y ordenamiento de los
cromosomas y en las dos ltimas se lleva a cabo la distribucin de los
cromosomas. El resultado final son dos clulas hijas diploides (2n).

II. OBJETIVOS
Reconocer las distintas fases del ciclo celular en clulas somticas de raz de cebolla.

III. MATERIALES
Encontrars en el laboratorio
- Placa Petri
- Pinza de madera
- Mechero de alcohol
- Etanol

- Orcena actica
- Microscopio
- Acido Actico

Material de estudio:
pices frescos de races de cebolla
35

IV. PROCEDIMIENTO
Con 8 das de anticipacin a la prctica preparar el cultivo de cebolla de la siguiente manera: En
un vaso con agua, de preferencia de borde oscuro, colocar una cebolla mediana de tal manera que haga
contacto la parte terminal de la cebolla con el agua y dejar en lugar semioscuro.

Preparacin de la Muestra
1
2

3
4
5
6

Disponer de gran nmero de races de cebolla, haciendo cortes de la parte terminal


(aproximadamente de 0.5cm.) y depositar en una placa Petri.
Colorear con orcena por 10 minutos: contiene orcena A que interrumpe el proceso si se est dando
en ese momento y reblandece la unin de las clulas muertas, as como orcena B que tie la
cromatina o material hereditario.
Luego calentar la muestra slo hasta que emane vapores por 2 veces consecutivas con intervalos de
enfriamiento.
Trasladar las races a diferentes portaobjetos, separar solo el pice (parte terminal de la raz) y
agregar una gotita de orcena y cubrir con el cubreobjeto.
Apretar la muestra suavemente con la yema de los dedos.
Secar el exceso de colorante con papel secante y llevar al microscopio para su observacin a menor
y mayor aumento.

Interfase

Profase Temprana

Anafase Tarda

Profase Tarda

Telofase Temprana

Metafase

Telofase Tarda

36

Anafase Temprana

Citocinesis

DESARROLLO
1.- Dibuje las muestras observadas.

Muestra:_________
Coloracin:_______
Aumento:________

Muestra:_________
Coloracin:_______
Aumento:________

Muestra:_________
Coloracin:_______
Aumento:________

Muestra:_________
Coloracin:_______
Aumento:________

Muestra:_________
Coloracin:_______
Aumento:________

FECHA

ACTITUDINAL

Muestra:_________
Coloracin:_______
Aumento:________

MATERIAL

PARTICIPACIN

37

FIRMA/ SELLO
PROFESOR

PRCTICA N9 (SEMANA 12)


FECUNDACIN
I. FUNDAMENTO
La fecundacin es el proceso de unin del vulo y el espermatozoide, y en virtud de la cual se
origina el cigoto o clula huevo. La fecundacin en la especie humana es interna, pues se lleva a cabo
en el interior del aparato reproductor de la hembra, concretamente en las trompas de Falopio.

En esta prctica se observar el proceso de fecundacin entre un gameto masculino


(espermatozoides) y un gameto femenino (ovulo), de erizo de mar. Se podrn observar los gametos o
Clulas reproductoras masculina y femenina, cuyo ncleo slo contiene uno de cada par de cromosomas
homologos en una clula somtica.
El vulo es una clula redonda de gran tamao. Posee un ncleo donde se alojan los
cromosomas portadores de la informacin gentica materna, y un citoplasma que posee sustancias
nutritivas para alimentar al embrin en sus primeras etapas, en el caso de que ocurra la fecundacin.
El espermatozoide, o gameto masculino, es una clula pequea con capacidad de movimiento
para poder alcanzar al vulo.

Segn donde se encuentren el espermatozoide y el vulo, existen dos tipos de fecundacin:


a) Fecundacin EXTERNA, cuando tanto el macho como la hembra liberan sus gametos al medio
externo, que es el agua, de manera que los espermatozoides nadan en el agua hasta encontrar a los
vulos. Es lo tpico de todos los animales invertebrados acuticos, y en los vertebrados se da en los
peces y en los anfibios.
b) Fecundacin INTERNA, cuando el macho deposita sus espermatozoides en el interior de la hembra, y
se mueven por el organismo de la hembra hasta encontrar al vulo. En el erizo de mar no hay
dimorfismo sexual de modo que externamente no se les puede diferenciar a las hembras de los
machos. Las gnadas femeninas son de color rojo vinoso y las gnadas masculinas son de color
amarillo grisceo. En ambos casos se encuentran en las zonas interambulacrales (celoma) ubicado

38

en el interior del hemisferio superior. A travs de las glndulas genitales (5), las gnadas se
comunican al exterior mediante el poro genital, por donde son derramados los huevos. La
fecundacin es externa porque los gametos se encuentran fuera de la cavidad genital y el vulo se
fecunda externamente.

II. OBJETIVOS
- Identificar gametos masculinos y femeninos en erizo de mar.
- Evidenciar el proceso de la fecundacin.

III. MATERIALES
Encontrars en el laboratorio
- Microscopio
- Pipeta
Traer el alumno
- Cubreobjetos
- Materiales de diseccin: tijera, pinza,estilete.

- Placa Petri
- Bagueta
- Portaobjetos
- Goteros

Material de estudio:
- Erizos de mar VIVOS en baldes con tapa y con agua de mar

IV. PROCEDIMIENTO
4.1. Obtencin de vulos y Espermatozoides
1. Usando el material de diseccin, cortar las pas del erizo a nivel del ecuador todo el contorno radial e
introducir la punta de la tijera para perforar y cortar transversalmente el caparazn por la zona
cortical, obteniendo 2 mitades: el aboral y el ventral; en el aboral (lado superior) en las placas
interradiales (5) del celoma es donde se encuentra las gnadas en sus respectivas masas genitales
de color crema para los MACHOS y rojo vinoso para las HEMBRAS.
2. Luego echar las gnadas en un petri con agua de mar y con la ayuda de una bagueta se trozan los
ovarios para liberar los vulos. En otro cristalizador, se hacen exactamente lo mismo con los
testculos

39

4.2.

Montaje y observacin de gametos

1. Colocar en un portaobjeto, una gota de la muestra con vulos y observar su forma y color
2. Colocar en un portaobjeto, una gota de la muestra con espermatozoides y observar su forma, tamao,
flagelo, etc.
3. Despus de observar esta preparacin coloque una gota del colorante cristal violeta sobre los
gametos masculinos y observe nuevamente
4. Observar a mayor aumento ambos gametos.
4.3 Fecundacin
1. De las muestras obtenidas, coloque en un portaobjeto una gota con vulos y otra con
espermatozoides y mezclar.
2. Observar a mayor y menor aumento
3. Observar con detenimiento los cambios que sufre el vulo una vez fecundado.

DESARROLLO
1. Dibuje y coloree las distintas muestras observadas en la prctica. Mencionando el aumento total.

Muestra:_________
Coloracin:_______
Aumento:________

Muestra:_________
Coloracin:_______
Aumento:________

Muestra:_________
Coloracin:_______

Muestra:_________
Coloracin:_______

Aumento:________

FECHA

ACTITUDINAL

Aumento:________

MATERIAL

PARTICIPACIN

40

FIRMA/ SELLO
PROFESOR

PRACTICA N 10 (SEMANA 13)

PRIMERA PARTE: EXTRACCIN DE ADN

I. FUNDAMENTO
El ADN es un polmero de desoxiribonucletidos, que en eucariotes es el componente de la
cromatina o material gentico. En la cromatina el ADN se encuentra asociado a protenas conocidas
como nucleoprotenas de tipo histonas, protaminas y en menor proporcin con protenas de tipo cidas.
Para extraer el ADN sin arrastrar sus protenas asociadas se podra emplear soluciones cidas. Sin
embargo, stas soluciones podran daar la estructura de la hebra, de modo que se prefiere emplear
solventes orgnicos como cloroformo, el cual extrae protenas dejando insoluble al ADN.

La extraccin de ADN de una muestra celular se basa en el hecho de que los iones salinos son
atrados hacia las cargas negativas del ADN, permitiendo su disolucin y posterior extraccin de la
clula. Se empieza por lisar (romper) las clulas mediante un detergente, vacindose su contenido
molecular en una disolucin tampn en la que se disuelve el ADN. En ese momento, el tampn contiene
ADN y todo un surtido de restos moleculares: ARN, carbohidratos, protenas y otras sustancias en menor
proporcin.
Las protenas asociadas al ADN, de gran longitud, se habrn fraccionado en cadenas ms
pequeas y separadas de l por accin del detergente. Slo queda, por tanto, extraer el ADN de esa
mezcla de tampn y detergente.
La secuencia general de extraccin es la siguiente:
1 Liberacin del ADN en forma soluble por medio de la destruccin de los sistemas membranosos de
los tejidos (membrana celular y nuclear).
2 Separacin de los complejos de nucleoprotena por denaturacin de la parte proteica.
3 Separacin del ADN de las otras macromolculas por solubilidad diferencial.
4 Precipitacin del ADN por insolubilidad en alcohol y bajas temperaturas.
II. OBJETIVOS
1 El objetivo fundamental de esta prctica es utilizar unas sencillas tcnicas para poder extraer el ADN
de un tejido animal y por el aspecto que presenta, confirmar su estructura fibrilar.
41

2 A partir de la longitud enorme de las fibras tambin se confirma que en el ncleo el ADN se encuentra
replegado.
III. MATERIALES
Encontrars en el laboratorio:
- 2 Tubos de prueba de 20 ml
- Baguetas
- Etanol helado
- 5 Pipetas de 10ml
- Gasa esteril

- Vaso de precipitacin de 500ml.


- 1 embudo
- Bao Mara
- Mortero con piln
- Hielo

- Medio de homogenizacin:
- Lauril Sulfato de Sodio (SDS) 50 g
- Cloruro de Sodio 8. 770 g
- Citrato de Sodio 4.110 g
- EDTA 0.292 g
Material de estudio:
Choros frescos o Hgado fresco de pollo
IV. PROCEDIMIENTO
Para la extraccin DE ADN del manto de choro, con etanol, seguiremos los siguientes pasos.
4.1. Homogenizacin del Tejido
El mtodo para desintegrar el tejido debe estar adaptado a las caractersticas de ste. Para
grandes volmenes de tejidos blandos, suelen usarse licuadoras esencialmente iguales a las licuadoras
domsticas. Para volmenes menores, en general es suficiente un MORTERO y un piln.
Tejidos ms resistentes, como por ejemplo hueso o diente, necesitan tratamientos mecnicos
especiales. Aquellos tejidos con clulas cuya pared celular es resistente, como por ejemplo vegetales,
hongos o bacterias, requieren tambin condiciones drsticas. Uno de los mtodos ms utilizados
consiste en congelar la muestra en nitrgeno lquido y, mantenindola congelada, pulverizarla con un
mortero. As, adems de desintegrar la muestra, se logra que sta se mantenga a muy baja temperatura
durante el tratamiento, con lo cual se evita la accin de enzimas endgenas que pudieran degradar el
material de inters.
En esta prctica se emplear un mtodo de ruptura con mortero (sin congelamiento). La principal
ventaja de este mtodo es que se adapta bastante bien a tejidos muy diversos. Asimismo, dado que se
opera a temperatura ambiente, las ribonucleasas celulares pueden degradar parcialmente las molculas
de ARN. Para ayudar a la solubilizacin de los componentes celulares, a la ruptura de membranas y de
complejos proticos, la solucin de lisis contendr un detergente inico (dodecilsulfato de sodio, SDS).
Este detergente dispersa los componentes de las membranas y desnaturaliza las protenas.
La solucin de lisis contiene adems el agente quelante de cationes divalentes, EDTA. Esto
2+
impide la accin de las ADNasas (dependientes de Mg ), aunque no tiene efectos sobre la mayor parte
de las ribonucleasas.
Seguir los siguientes pasos:
1 Las clulas se homogenizarn en un mortero empleando el medio de homogenizacin. ES
OBLIGATORIO el uso de guantes en todo momento para evitar la contaminacin de la muestra con
DNAasa proveniente del sudor de las manos que pueda degradar nuestras muestras de ADN.
2 Se lisarn las clulas agregando 10 ml de la solucin de homogenizacin por cada gramo de tejido
con que se inici el proceso. Los componentes como el SDS, permitir por una parte la separacin de
las protenas asociadas a la cromatina y por otra parte la ruptura de membranas. El NaCl produce el
estallido de los ncleos para liberar as las fibras de cromatina. El EDTA es un agente quelante que

42

inactiva a las DNAasas.


3 Incubar la mezcla en un Bao Mara a 60C por 15 minutos exactos. El calor ablandar el tejido
permitiendo que los componentes de la solucin homogenizadora ingrese a la clula. Adems, esta
temperatura denatura muchas enzimas que interfieren con el procedimiento.
4 Filtrar el homogenizado empleando la gasa esteril
5 Enfriar rpidamente la preparacin filtrada en una cubeta con hielo, por 10 minutos a fin de detener
cualquier proceso degradativo del ADN.
4.2. Precipitacin del ADN
La precipitacin de los cidos nucleicos permite su purificacin y concentracin. Se basa en la
simultnea neutralizacin de las cargas negativas y deshidratacin de la molcula, lo cual posibilita su
agregacin y precipitacin.
La precipitacin es un fenmeno reversible (mediante la resuspensin en soluciones acuosas) y
no debe ser confundido ni con la desnaturalizacin (potencialmente reversible) ni con la degradacin
(irreversible) de los mismos.
Efectuar los siguientes pasos:
1 Lentamente, agregar etanol helado por el borde interno del recipiente hasta que comience a aparecer
una consistencia blanca que significa que el ADN ha precipitado.
2 Suavemente, a medida que se agrega el etanol helado, girar enrollando a la vez con una bagueta de
vidrio.
3 Reconoce 3 fases en tu solucin: la del alcohol (que flota en agua), la de tu tejido triturado (abajo del
todo) y la interfase entre los 2 que contiene ADN precipitado.
4 Poco a poco haciendo estos movimientos en una sola direccin, se lograr apreciar el ADN en la
bagueta, asemejando una madeja de un hilo sumamente fino o como copos de algodn.
Nota importante. El producto filamentoso obtenido de esta extraccin no es ADN puro ya que,
entremezclado con l, hay fragmentos de ARN. Una extraccin especifica se realiza aadiendo enzimas
que fragmentan las molculas de ARN (protocolos de PURIFICACIN de ADN).

SEGUNTA PARTE: ELECTROFORESIS


I. FUNDAMENTO
El problema de realizar separaciones de biomolculas grandes es enfrentado frecuentemente en
las ciencias de la vida, tanto para anlisis cuali- como cuantitativos de mezclas o de preparaciones
individuales. En la mayora de casos es deseable causar el mnimo de dao a las molculas de manera
que sus propiedades no cambien de manera significativa. Los mtodos actuales para la separacin de
biomolculas descansan por lo tanto en procesos fsicos que causan el mnimo de desnaturalizacin, lo
cual resulta en la mxima retencin de cualquier actividad biolgica. Un gran grupo de mtodos de
separacin estn basados en algunas propiedades qumicas o biolgicas, o en interacciones de la
molcula que se investiga, y algunas otras estn basadas en diferencias en pesos moleculares o cargas
netas, o a veces una combinacin de las dos propiedades. Los mtodos electroforticos pueden disear
se para explotar cualquiera de los dos, o ambos parmetros, aunque las diferencias en tamao son las
principales en el caso de las separaciones de cidos nucleicos.
La electroforesis en geles de agarosa es una tcnica comn en los laboratorios de Biologa
Molecular. El proceso consiste en la aplicacin de una diferencia de voltaje a una muestra de ADN que
se encuentra inmersa en un gel de agarosa, y esta a su vez en baada por un buffer determinado. La
generacin de polos opuestos provoca la migracin del ADN del polo cargado negativamente (Ctodo) al
polo cargado positivamente (Anodo), debido a que el ADN tiene una carga neta negativa.
Los geles de agarosa son el medio ms popular para separaciones electroforticas de cidos
nucleicos de mediano y gran tamao. Las concentraciones ms tpicas de agarosa van de 0.3 hasta 2.5
%, y esta concentracin depende de los tamaos de los cidos nucleicos a separar. Aunque los geles de
43

agarosa carecen de fuerza mecnica (especialmente los ms diluidos), la manipulacin se facilita por el
uso de geles horizontales, los cuales pueden ser soportados por lmina de vidrio o de plstico
El gel resultante es fotografiado en un aparato llamado transiluminador, presencia de bromuro de
etidio, para poner en evidencia los fragmentos de ADN en el gel. En la presente prctica analizaremos la
fotografa de un gel de agarosa y observaremos las distintas bandas de ADN que en l aparecen,
discutiendo la razn por las que unas aparecen ms arriba que otras. Realizaremos un anlisis como el
que se hace en ensayos de diagnstico molecular y de clonacin.
II. OBJETIVOS
-Comprobar la movilidad del ADN en un gel de agarosa
-Analizar la utilidad de esta tcnica en ensayos de biologa molecular aplicada

III. MATERIALES Y MTODOS


Analizaremos la siguiente Lmina de un gel de agarosa y discutiremos cul es el significado y la
interpretacin de esas bandas en el gel.

DESARROLLO
1.- Dibuje sus resultados

2.-Discuta y resuelva los siguientes enunciados


M

44

En el gel aparecen 3 carriles o calles, cada uno con una muestra distinta (M, 1 y 2). Los pocillos son
hechos en el gel para introducir ah la muestra de ADN.
1 qu hay en el primer carril?
____________________________________________________________________________________
2 en la muestra 1, qu tamao aproximado tienen las bandas de ADN?
_______________________________________________________________________________
3 por qu aparece RNA en algunas nuestras y por qu aparece tan abajo, comparado al ADN?
_______________________________________________________________________________
4 qu significado tiene que algunas bandas sean ms gruesas que otras?
_______________________________________________________________________________
5 qu hubiera esperado encontrar si corra un gel con su ADN recin extrado? Dibujelo.
______________________________________________________
______________________________________________________
______________________________________________________
______________________________________________________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIN

45

FIRMA/ SELLO
PROFESOR

PRACTICA N 11 (SEMANA 14)


CDIGO GENTICO Y TRADUCCIN DE PROTENAS

I. FUNDAMENTO
El proceso de traduccin, es decir, sntesis de novo de protenas, ocurre en el citoplasma y en el
retculo endoplasmatico realizada por los ribosomas (en humanos). La sntesis de una protena requiere
que previamente el ARNm de ese gen haya sido transcrito en el ncleo y exportado al citoplasma. Aqu
el ARNm, que contiene la informacin gentica necesaria para codificar la protena, se asociar a los
ribosomas del RER y con la intervencin de una compleja maquinaria proteica as como de los ARNt
especficos para cada aminocido, se llevar a cabo la traduccin.

El ARNm porta los codones, tripletes de nucletidos, que codifican para un aminocido. Mientras
que los ARNt portan los anticodones, que le indican qu aminocido van a portar y llevar hasta el
complejo ARNm-ribosomas-enzimas. El cdigo gentico es la combinacin de tripletes que tienen la
informacin necesaria para codificar un aminocido. Existen 64 codones en el cdigo gentico, que
codifican para los 20 aminocidos que forman las protenas y que adems contiene 1 codn de inicio de
la traduccin y 3 codones de finalizacin de la misma.
En esta prctica analizaremos la degeneracin del cdigo gentico, discutiremos por qu no es
realmente universal y realizaremos la traduccin de algunos genes en sus respectivas secuencias de
aminocidos.
II. OBJETIVOS
- Reconocer los codones y anticodones posibles para los aminocidos que forman las protenas.
- Analizar posibles mutaciones en los codones que alteren la secuencia de una protena y con ello su
funcin.

46

III. MATERIALES
- Lmina de la tabla del Cdigo Gentico
- Lmina de la tabla de las alteraciones del Cdigo Gentico en mitocondrias y otros organismos.

47

IV. MTODOS
4.1. Antes de solucionar los problemas planteados, determine:
a. nmero de codones de inicio ____________________________
b. nmero de codones de finalizacin _______________________
c. aminocidos codificados por 1 slo codn __________________
d. aminocidos codificados por 2 codones ____________________
e. aminocidos codificados por ms de 3 codones ____________________________
f. qu cambios se han producido en el cdigo gentico de mitocondrias en humanos?
____________________________________________________________________________________
____________________________________________________________________________________
g. Lista de aminocidos esenciales y no esenciales
____________________________________________________________________________________
____________________________________________________________________________________

4.2. Discuta con su profesor y responda:


Por qu algunos aminocidos son codificados por 1 slo codn mientras que otros son codificados por
2 o ms codones?
____________________________________________________________________________________
____________________________________________________________________________________
4.3- Complete:

4.3. Los siguientes problemas debern ser solucionados en clase con ayuda del profesor:
Primer problema: Transcripcin y traduccin
Se tiene la siguiente secuencia de ADN (cadena codante) que es parte del gen de
transferrina.
5 ATGGCATCCTACGATCAGTATCCTATACGC 3 (EL GEN CONTINA)
Determine:
1. la secuencia no codante del respectivo trozo del gen
___________________________________________________________________________________
2. la secuencia del ARNm respectivo, transcrito a partir del trozo de dicho gen
___________________________________________________________________________________

48

3. Utilizando la tabla del cdigo gentico, deduzca la secuencia de aminocidos que codificar dicha
cadena (considerando que se incub el ADN en un extracto crudo de clulas de reticulocitos de
conejo que contena los respectivo ARNt, enzimas, ATP, GTP, etc.)
___________________________________________________________________________________
___________________________________________________________________________________
Segundo problema. Mutaciones en la secuencia de nucletidos
La secuencia de ADN del gen de transferrina, del problema 1, ha sufrido mutaciones por el efecto
de radiaciones UV. Se secuenci el gen mutado y la secuencia obtenida fue la siguiente:
5 ATGGCATCGTACGAACAGTAGCCTATACGC 3 ..(EL GEN CONTINA)
Determine:
1. la secuencia del ARNm respectivo, transcrito a partir del trozo de dicho gen
____________________________________________________________________________________
2. la secuencia de aminocidos que, tras esas mutaciones, se codifica
____________________________________________________________________________________
3. qu mutaciones han sido conservativas y cuales no.
____________________________________________________________________________________
Tercer problema. Traduccin en mitocondrias
Se cuenta con parte de la secuencia del gen de la protena de Fe-S, que participa en la cadena
transportadora de electrones en la mitocondria, y que es codificada dentro de la misma. La secuencia es
de la cadena de ADN codante:
. 5 CCGTGAGAACTCGAAGCTCCGGACATAGCT 3
Determine:
1. la secuencia de aminocidos codificada en la mitocondria, a partir de dicha cadena nucleotdica
__________________________________________________________________
2. cul seran los aminocidos cambiados si dicho gen se codificara en el citoplasma?
__________________________________________________________________

49

PRACTICA N 12 (SEMANA 15)


ESTUDIO DE RASGOS GENTICOS EN EL
HOMBRE

I. FUNDAMENTO
Las caractersticas de un organismo son el resultado de la herencia y de la interaccin de los
genes. Los principios de la gentica establecidos por Mendel y Morgan y otros investigadores se aplican
a todos los organismos vivientes, incluido el hombre.
De la misma manera que en otros, algunos rasgos humanos son determinados por genes
dominantes y otros por genes recesivos. Lo rasgos dominantes generalmente se encuentran con mayor
frecuencia que los que se deben a genes recesivos. En la transmisin de la mayora de los caracteres
hereditarios, estn involucrados varios genes, pero a menudo la variacin de un solo gen, produce la
variacin de una sola caracterstica lo que da lugar a dos formas distintas de expresin.
Algunos genes (y su manifestacin) estn ligados al sexo, es decir que la caracterstica respectiva
slo se expresa en uno de los sexos. Frecuentemente el masculino (hemofilia por ejemplo). En este caso
el gen en cuestin se encuentra localizado en el cromosoma X (el cromosoma Y se considera
genticamente vaco). En otros casos la manifestacin genotpica es influenciada por el otro sexo (p.e.
calvicie, es dominante en el varn y recesivo en la mujer).
En este caso los genes respectivos estn localizados en un cromosoma autosmico, pero su
expresin esta condicionada a la accin secundaria de genes ubicados en el cromosoma X.

II. OBJETIVOS
1. Determinar el fenotipo (expresin de las caractersticas) y su probable genotipo (Informacin gentica
en el cromosoma respectivo) tanto como sea posible.
2. Estimar la distribucin de los genes dominantes y recesivos para cada rasgo gentico observado en el
grupo.

III. MATERIAL
Debers traer de casa.
-Espejo
-Lupa

IV. PROCEDIMIENTO
1. Con la ayuda de un espejo o de un compaero determine un fenotipo para cada uno de los rasgos
genticos descritos a continuacin. Haga sus anotaciones en su cuaderno de trabajo.
2. Cuando se trata de una caracterstica dominante, no es posible determinar con certeza el genotipo,
pues pueden estar presentes dos genes dominantes para esta caracterstica (homocigosis) o un gen
dominante y uno recesivo (heterocigosis). En consecuencia utilizaremos un guin (-) para representar
el alelo desconocido. En cuanto al carcter recesivo, no hay dificultad en establecer el genotipo, los
dos genes alelomrficos son recesivos. Anote su genotipo en la hoja de trabajo.

50

3. Tabule en la hoja de trabajo el nmero de alumnos con cada rasgo gentico estudiado DONDE SE
INCLUYA: rasgo estudiado, genes involucrados, dominancia o recesin, estado del gen expresado
(homocigoto o heterocigoto), etc.

RASGOS GENETICOS A SER ESTUDIADOS


INDEPENDIENTES DEL SEXO
1. Enrollar la lengua: algunas personas tienen la aptitud de enrollar la lengua en forma de U. Esto es
causado por un gen dominante (E). La gente que no posee este gen slo puede curvar la lengua
ligeramente hacia abajo.
2. Lbulos separados: un gen dominante (L) determina que los lbulos de la oreja estn separados, es
decir que no estn adheridos directamente a la cabeza. En otras personas los lbulos de las orejas
estn adheridos directamente al costado de la cabeza.
3. Pico de viuda: algunas personas muestran la caracterstica de que la lnea de pelo baja hasta un
punto definido en la mitad de la frente. Esto se conoce como pico de viuda, este rasgo resulta de un
gen dominante (V). El gen recesivo determina la caracterstica de una lnea contina en el pelo.
4. Meique doblado hacia adentro: Un gen dominante (B) hace que la ltima falange del meique se
flexione hacia el dedo anular. Descanse ambas manos tendidas sobre la mesa, relaje los msculos y
observe si su meique est flexionado o recto.
5. Iris pigmentado: Cuando una persona es homocigota para cierto gen recesivo (p) no hay pigmento en
la parte anterior de los ojos y en cambio se muestra una capa azul detrs del iris. Esto determina que
los ojos sean azules. Un alelo dominante de este gen (P) hace que el pigmento se deposite en la
capa anterior del iris y enmascara el color azul en grado variable. Otros genes determinan la
naturaleza y densidad exactas de este pigmento, originando los ojos pardos, violeta, verde y otros
colores. Nota: Algunas veces la capa detrs del iris es gris y esto deber considerarse como no
pigmentado.
6. Pelo de la falange media: algunas personas tienen pelo en la segunda falange de la mano mientras
otras personas no. La ausencia completa del pelo en todo, se debe a un gen recesivo (m) y su
presencia se debe a su alelo dominante (M). Parece que hay un nmero variable de estos alelos que
determinan si el pelo debe crecer en uno, dos, tres o cuatro dedos. Este pelo puede ser muy fino y
ser necesario usar una lupa y mirar cuidadosamente en todos los dedos, antes de decidir si est
ausente en alguno de los dedos.
7. Msculo palmar largo: Cuando una persona es homocigota para cierto gen recesivo (l), presenta un
msculo palmar largo, el cual puede ser detectado examinando los tendones que corren en la cara
interna del antebrazo (altura de la mueca) cierre el puo fuertemente y doble la mano hacia delante.
Palpe los tendones. Si hay tres, usted tiene el msculo palmar largo. Si solo hay dos (el medial ms
grande no existe) usted no tiene este msculo. Examine ambas muecas pues a veces est presente
en un brazo y no en el otro, a causa de las variaciones en la expresin de los genes. Si lo encuentra
en uno o ambos brazos, posee dos genes recesivos. Si no est presente en ambas muecas tiene el
gen dominante (L).
8. Forma del cabello: la forma natural del cabello de una persona puede ser lacia, ondulada o crespa,
con variantes intermedias. El mecanismo por el cual se origina la forma del cabello es algo complejo,
pero puede asumirse que los responsables de esta caracterstica son un par de genes con
dominancia incompleta. Asumiendo que la forma de su cabello no ha sido modificada por tratamiento
artificial, anote el genotipo respectivo segn el siguiente cdigo:
CC= cabello crespo
Cc= cabello ondulado
cc= cabello lacio.
9. Pulgar desarticulable: algunas personas tienen la habilidad de desarticular las falanges de sus dedos
pulgares, a causa de que los ligamentos de esta articulacin son sumamente flojos, caracterstica que

51

es dominante sobre ligamentos firmes. Esta circunstancia permite retirar el dedo pulgar hacia atrs
sacndolo de su articulacin. Ensaye la posibilidad de desarticular el pulgar de cualquiera de sus
manos SIN ayuda de la otra mano e identifique su genotipo respectivo as: JJ o Jj = pulgar
desarticulable jj = pulgar no desarticulable.
10. Color del cabello: el color del cabello es determinado por la interaccin de un gran nmero de
factores; sin embargo, si consideramos solo las mayores categoras de color capilar, estas pueden
explicarse por la interaccin de dos pares de genes (herencia dihibrida): (D_) pigmento pardo
presente, (dd) pigmento pardo ausente, (rr) pigmento rojo presente. De acuerdo con la ley de la
distribucin independiente, un individuo cualquiera puede tener alguna de las siguientes
combinaciones de genes y color:
DDRR, DDRr, DdRR : cabello oscuro (negro)
DdRr, Ddrr, DDrr : cabello castao u oscuro con tintes rojizos
ddRr : cabello rubio
Dr. : cabello claro (color arena)

INFLUENCIADOS POR EL SEXO


11. Segundo dedo ms corto que el cuarto: mantenga sus dedos juntos y ponga sus manos sobre una
hoja de papel, de modo que sus dedos descansen en ngulo recto con una lnea horizontal, que
usted ha trazado antes sobre el papel. Mueva su mano hacia arriba o hacia abajo hasta que el
extremo del cuarto dedo (anular) toque escasamente la lnea. Mire su segundo dedo (Indice) y vea si
toca la lnea.si no lo hace el segundo dedo es ms corto que el cuarto. Se cree que este segundo
dedo ms corto es el resultado de un gen influenciado por el sexo del individuo. Segn esto el gen es
dominante en lo varones y recesivo en las mujeres. Sc para el gen correspondiente al segundo dedo
corto Sl para el gen correspondiente para el segundo dedo largo.
12. Voz para el canto: el tono de la voz para el canto es determinado por un solo par de alelos V y v que
muestran dominancia incompleta y estn influenciados por el sexo. Clasifique su voz par el canto
segn el siguiente cuadro:
Genotipos

Fenotipos
Varn

VV
Vv
vv

Mujer

Bajo
Bartono
Tenor

Contraalto
Meso soprano
Soprano

13. Calvicie: esta es otra caracterstica influenciada por el sexo y es controlada tambin por un par de
alelos. Aunque esta caracterstica no suele manifestarse antes de los 30 aos, sus posibilidades
personales de calvicie pueden presumirse por la presencia o ausencia de esta caracterstica entre los
miembros mayores de su familia tanto por la lnea materna o paterna. Establezca su probable
genotipo guindose por el siguiente cuadro:
Genotipos

HH
Hh
hh

Fenotipos
Varn

Mujer

calvo
calvo
normal

calva
normal
normal

52

LIGADOS AL SEXO
14. Ceguera para el color (daltonismo): tipo ms comn de daltonismo es heredado como carcter
recesivo ligado al sexo. Puesto que el gen es portado solamente por el cromosoma X es necesario
indicar el cromosoma al especificar el genotipo. Son posible genotipos y fenotipos:
Fenotipos
Normal

Genotipos
Mujer
N n
X X

Daltnico

XX

DESARROLLO
NOMBRE:______________________________
GRUPO:___________ MESA:___________ FECHA:_________
PROFESOR:_____________________________

1.- Anote su genotipo y fenotipo de cada caracterstica evaluada.

53

Varn
N
X Y
n

XY