Sie sind auf Seite 1von 11

RESOLUTION OIV-OENO 414-2011

QUANTITATIVE BESTIMMUNG DER HEFEN BRETTANOMYCES BRUXELLENSIS


MITTELS RTq-PCR (QUANTITATIVE ECHTZEIT-PCR)
DIE GENERALVERSAMMLUNG,
in Anbetracht von Artikel 2 Absatz 2 Ziffer iv des bereinkommens vom 3. April 2001 zur
Grndung der Internationalen Organisation fr Rebe und Wein,
nach Kenntnisnahme der Arbeiten der Sachverstndigengruppe Mikrobiologie und der
Unterkommission Analysemethoden,
auf Vorschlag der Sachverstndigengruppe Mikrobiologie und der Unterkommission
Analysemethoden,
BESCHLIESST, auf Vorschlag der Kommission nologie folgende Methode Typ IV
Methode in Abschnitt 4 der Sammlung internationaler Analysemethoden fr Wein und
Most einzufgen:
Quantitative Bestimmung von Brettanomyces bruxellensis Hefen mittels
RTq-PCR

Typ IV Methode

Warnhinweise
Phenol: Alle Stufen der Handhabung von Phenol sind unter der Abzugshaube und mit
Handschuhen auszufhren. Mit Phenol kontaminierte Rckstnde sind in geeigneten
Behltern aufzufangen.
SYBR Green: die Mutagenitt von SYBR Green ist nicht gleich null, jedoch wesentlich
geringer als die von Ethidiumbromid. Vorsichtsmanahmen sind dennoch zu
bercksichtigen.
1. Anwendungsbereich

Die beschriebene Methode dient der quantitativen Bestimmung von Brettanomyces


bruxellensis Hefen in Fassweinen oder in Flaschenweinen mittels quantitativer Echtzeit
Polymerase-Kettenreaktion
(RTq-PCR). Die Analyse von Weinen whrend der
alkoholischen Grung und von Mosten ist bisher nicht validiert.
2. Definition
Bei den mit dieser Methode quantitativ bestimmten Mikroorganismen handelt es sich um
Brettanomyces bruxellensis-Hefen, die eine Kopie des Zielgens besitzen.

Beglaubigte Ausfhrung
Porto, den 24. Juni 2011
Der Generaldirektor der OIV
Sekretr der Generalversammlung
Federico CASTELLUCCI
OIV 2011
1

3. Prinzip
Das Prinzip besteht darin, einen durch zwei Primer flankierten Zielabschnitt der DNA
(Desoxyribonukleinsure) durch eine wiederholte, enzymatische Reaktion zu
amplifizieren. Das Verfahren erfordert die Aneinanderreihung zahlreicher Zyklen mit drei
Etappen:

- DNA-Denaturierung durch Hitze


- Hybridisierung der Primer
- Polymerisierung mittels Taq- (Thermophilus aquaticus) Polymerase
Anders als die klassische PCR ermglicht die RTq-PCR dank der Verwendung eines
Fluorophors die Quantifizierung der amplifizierten DNA.
Bisher sind zwei artspezifische Regionen als Zielsequenzen verwendet worden. Es
handelt sich um das fr rRNA (ribosomale Ribonukleinsure) codierende Gen 26S und um
das Gen RAD4 [2, 3]. Wie bei der FISH-Methode handelt es sich somit um eine
spezifische, jedoch weitaus wirtschaftlichere Technik fr den Nachweis von
Brettanomyces bruxellensis.
Die Besonderheit der RTq-PCR liegt in der Messung der Fluoreszenz bei jedem
Amplifizierungszyklus, die mit der Amplifizierung der DNA exponentiell zunimmt.
Zahlreiche Fluoreszenztechniken sind fr diese Anwendung entwickelt worden. Vorliegend
wird das Fluorophor SYBR Green verwendet.

Fluorophor SYBR Green

Die Substanz fluoresziert stark, whrend sie sich auf nicht spezifische Weise zwischen
den Nucleotiden in der Doppelstrang-DNA einfgt. Im freien Zustand weist sie dagegen
nur eine schwache Fluoreszenz auf. Dank dieser Technologie kann nach Abschluss der
Amplifizierung eine Schmelzkurve erzeugt werden, um die Spezifizitt der Reaktion zu
besttigen.
Interne Prfung
Zur berprfung der DNA-Extraktion und - der Amplifizierungsschritte wird ein interner
Standard bei der Methode mitgefhrt (Lip4,Yarrowia lipolytica).
4. Reagenzien und Produkte
Alle Verbrauchsmaterialien aus Kunststoff mssen vor der Untersuchung zur Zerstrung
der DNAsen (Desoxyribonukleasen) autoklaviert werden ebenso wie die Pufferlsungen
Tris-HCl, TE (Tris EDTA, Ethylendiamintetraessigsure),
Ammoniumacetat und
ultrareines Wasser (18 M). Alle wssrigen Lsungen werden mit ultrareinem -Wasser
(18 M) hergestellt. Einige Lsungen werden im Autoklav sterilisiert (durch die
Bezeichnung autoklaviert gekennzeichnet). Fr die Herstellung von Lsungen, die nicht
autoklaviert werden, wird vorzugsweise steriles ,ultrareines Wasser (18 M) benutzt. Das
Arbeiten unter sterilen Bedingungen ist danach nicht erforderlich.

PVPP (z.B. ISP Polyclar Super R oder Sigma P6755-100G),


Lsungen bei Raumtemperatur: Puffer Tris-HCl 10 mM pH 8, Lsung I (TrisHCl 10 mM pH 8, EDTA 1 mM, NaCl 100 mM, SDS 1 % (Natriumdodecylsulfat),
Triton X-100 2 %), TE (Tris-HCl 10 mM pH 8, EDTA 1 mM) autoklaviert,
Ammoniumacetat 4M, Ethanol absolut,
Beglaubigte Ausfhrung
Porto, den 24. Juni 2011
Der Generaldirektor der OIV
Sekretr der Generalversammlung
Federico CASTELLUCCI

OIV 2011
2

Sterilisiertes, ultrareines Wasser (18 M) (20 ml) fr jede RTq-PCR-Platte


autoklavieren,
Lsungen bei 4 C : gesttigtes Phenol pH 8: Chloroform: IAA
(Isoamylalkohol:24:25:1) und RNase (Ribonuklease) 1 g/L
Suspension bei -20 C: interne Kontrolle, SYBR Green (z.B. Mix iQ SYBR Green
supermix, Bio-rad 170-8884), Primer 4 M Brett rad3, Brett rad4, YAL-F und YALR.
Wasserbad bei 37 C

Alle Stufen der Handhabung von Phenol mssen unter der Abzugshaube und
mit Handschuhen ausgefhrt werden. Mit Phenol kontaminierte Rckstnde
mssen in geeigneten Behltern aufgefangen werden.
ChemikalienRTq- PCR
4.1 Ammoniumacetat
4.2 Phenol: Chloroform: IAA 24:25:1

4.3 Proteinase K
4.4 SDS
4.5 Tris Base

4.6 BSA MB Grade

Hersteller
98%

CAS-Nr.
631-61-8

Ultra

136112-00-0

1215U/mg Proteine
(16,6 ng/mL)

39450-01-6

99% Ultra

151-21-3

99,8% Ultra

77-86-1

Molecular biology
grade

9048-46-8

4.7 Gesttigtes Phenol pH 8

108-95-2

4.8 PVP 360 kDa


4.9 RNase A

4.10 TE pH 8
4.11 Primer 25 nmol

9003-39-8
70 U/mg in Lsung

9001-99-4

ultra

Tris : 77-86-1
EDTA : 60-00-4
-

5. Gerte

Kunststoff-Verbrauchsartikel: Mikro-Schraubrhrchen, 2 ml, Mikrorhrchen 1,5


und 1,7 ml, Pipettenspitzen wei (10 L), gelb (200 L) und blau (1000 L) fr
Mikropipetten P20, P200, P1000, P5000, 96 Well PCR-Microplatten, optische Folie,
ungepuderte Handschuhe
Glasperlen ( 500 m)
Beglaubigte Ausfhrung
Porto, den 24. Juni 2011
Der Generaldirektor der OIV
Sekretr der Generalversammlung
Federico CASTELLUCCI

OIV 2011
3

Flasche (20 ml) autoklaviert (fr sterilisiertes, ultrareines Wasser [18 M] fr


jede RTq-PCR-Platte)
Zentrifugenrhrchen 15 und 50 ml.
Gerte:
automatische Pipetten (P20, P200, P1000, P5000)
Zentrifuge fr Mikrorhrchen
automatisches Schttelgert zur Zerstrung der Zellen (z.B. GnieDisruptor)
Thermocycler mit Spektrofluometer gekuppelt (optisches Nachweissystem der bei
den real-time PCR-Reaktionen erzeugten Fluoreszenz)
Magnetrhrer
Stoppuhr
Trockenbad, 37 C
Autoklav
Messbecher 100 ml
Messbecher 50 ml
Messbecher 10 ml
Becherglser 100 ml
Becherglser 50 ml
Becherglser 10 ml
1,7-ml-Mikrorhrchen
Magnetrhrstbchen

6. Probenahme (Probenvorbereitung)
6.1 Auszhlung der Proben:
Die Proben werden entweder direkt den zu analysierenden Flaschen oder den zuvor
sterilisierten Entnahmeflaschen entnommen. Mit den getesteten Hefen (darunter K1 und
L2056) wurde keine Strung der Methode festgestellt, wenn die Hefepopulationen kleiner
oder gleich
5106 UFC/ml (Kolonien bildende Einheiten) ist. Darber hinaus keine
Angaben, somit sollten Messungen whrend der alkoholischen Grung von Weinen
vermieden werden.
NB: Erfolgt die Auszhlung der Hefen anhand klassischer mikrobiologischer
Analysemethoden (Wachstum in agarnutritivem Milieu, optische Dichte), werden die
Ergebnisse in UFC/mL (Kolonien bildende Einheiten) ausgedrckt. Wird die Auszhlung
hingegen mit qPCR-Analyse durchgefhrt, sind die Ergebnisse in UG/mL (genetische
Einheiten) angegeben.
6.2 Herstellung des internen Standards
Yarrowia-Kultur in Flssig-YPD (Hefe-Dextrose-Pepton) bei 28 C bis zu einer E600
(Extinktion bei 600 nm) von 1 (etwa 48 Std.) anzchten.
Nach Bestimmung der E600nm eine Lsung von 1,0106 UFC/ml in physiologischer Lsung
Kochsalzlsung (E = 1 E ^= 1,0107 UFC/ml) herstellen. (CFU = Kolonie bildende Einheit)
110 L der Kultur von 1,0106 UFC/ml in ein 1,7 ml-Mikrorhrchen pipettieren und 110 L
40 %iges Glycerol hinzugeben, um eine Population von 5,0105 UFC/ml zu erhalten.
Beglaubigte Ausfhrung
Porto, den 24. Juni 2011
Der Generaldirektor der OIV
Sekretr der Generalversammlung
Federico CASTELLUCCI
OIV 2011
4

Mischen und bei -80 C aufbewahren. Der Inhalt eines Rhrchens reicht fr 5
Weinproben.
Eine parallele Zhlung durchfhren, um den Titer der Suspension zu prfen.
6.3 Herstellung der Lsungen
100 ml Tris-HCl pH 8 10 mM: 0,121 g Tris-Base abwiegen (z.B. Trizma Base) und in
80 ml ultrareinem Wasser (18 M) auflsen. Den pH-Wert mit HCl einstellen. Das
Volumen auf 100 ml auffllen. Autoklavieren.
100 ml TE: 0,121 g Tris-Base wiegen und in 80 ml Wasser lsen. Den pH-Wert mit HCl
einstellen. 37,2 mg EDTA hinzugeben. Den pH-Wert auf 8 einstellen (zur Auflsung von
EDTA), dann auf 100 ml auffllen. Autoklavieren.
100 ml Lsung I: 50 ml TE 2x zubereiten und 10 ml NACl 1M , 10 ml SDS 10 % (unter
leichter Erwrmung lsen) und 2 g Triton X100 hinzugeben, auf 100 ml auffllen.
Ammoniumacetat 4M: 15,4 g Ammoniumacetat qsp (ausreichende Menge fr) 50 ml
in ultrareinem Wasser (18 M) auflsen.
100 ml Phenol / Chloroform / IAA (25 :24 :1) : ausgehend von 50 ml gesttigtem
Phenol mit Puffer TE pH 8 48 ml Chloroform und 2 ml Isoamylalkohol hinzugeben. Bei 4
C aufbewahren.
RNAse A 1g/L: die RNase A 70 U/mg mit ultrareinem Wasser (18 M) zu einer
Lsung verdnnen (z.B. Sigma, R4642-50MG, bei -20 C aufbewahrt). Die Konzentration
der gelagerten RNase ist auf dem Rhrchen und dem Spezifikationsblatt der Charge
angegeben. Die verdnnte Lsung darf bei 4 C hchstens 3 Wochen aufbewahrt werden.
Brett-Primer 4 M: ausgehend von vorrtigen Primer-Lsungen (Lieferantenrhrchen)
zu 100 M, eine Mischung von 4 M Brett rad3 (GTTCACACAATCCCCTCGATCAAC) und 4
M Brett rad4 (TGCCAACTGCCGAATGTTCTC) qs 1 ml mit ultrareinem Wasser (18 M))
herstellen. Kann 1 Jahr bei -20 C aufbewahrt werden.
YAL-Primer 4 M: ausgehend von vorrtigen Primer-Lsungen (Originalpackung des
Herstellers) zu 100 M, eine Mischung von 4 M YAL-F (ACGCATCTGATCCCTACCAAGG)
und 4 M YAL-R (CATCCTGTCGCTCTTCCAGGTT) qs 1 ml mit ultrareinem Wasser (18
M)) zubereiten. Aufbewahrung 1 Jahr bei -20 C.

7. Vorgehensweise
Zu analysierende Probe: Das Reagenzglas oder die Flasche schtteln, um den Inhalt zu
homogenisieren.
Verkorkte Flasche: Den Flaschenhals mit 70 %igem Alkohol desinfizieren und unter der
Flamme mithilfe eines Korkenziehers, der mit 70 %igem Alkohol desinfiziert wurde,
entkorken.
Eine Weinprobe von 15-20 ml in ein steriles 30 ml-Einweg-Reagenzglas aus Kunststoff
umfllen.
Die Arbeitsschritte, bei denen die Untersuchung unterbrochen werden kann,
sind durch * (maximale Unterbrechungsdauer, T) gekennzeichnet.

Beglaubigte Ausfhrung
Porto, den 24. Juni 2011
Der Generaldirektor der OIV
Sekretr der Generalversammlung
Federico CASTELLUCCI
OIV 2011
5

7.1 Aufschluss der Zellen


Die nachfolgenden Schritte zweifach ansetzen
Die Handhabung muss unter einer fr mikrobiologische Sicherheit ausgelegten
Vitrine ausgefhrt werden.
-

1 ml Wein in ein 2 ml-Schraub-Mikrorhrchen aufnehmen


20 L interne Kontrolllsung mit 5,0105 UFC/ml hinzugeben
30 s (Sekunden) lang bei 9300 g zentrifugieren
berstand durch vorsichtiges Wenden beseitigen
das Sediment in 1 ml Tris-HCl 10 mM ph 8 aufnehmen
30 s lang bei 9300 g zentrifugieren und den berstand beseitigen
kurz auf dem Vortex schtteln, um das Sediment in der Restflssigkeit zu
suspendieren *(3 Monate, -20 C).

Ein Reagenzglas wird zur Extraktion der DNA verwendet, das andere wird bei 20 C bis zum Erhalten validierter Resultate aufbewahrt.

7.2 Extraktion der DNA


Ausgehend von frischem oder tiefgefrorenem Sediment. Es sollten nicht mehr
als maximal 24 Proben parallel behandelt werden.
-

PVPP hinzugeben (1 % Endanteil m/v) pro Wgung


0,3 g Glasperlen 200-500 m hinzugeben
200 L der Lsung I hinzugeben
200 L Phenol :Chloroform :IAA (24 :25 :1) hinzugeben
mit dem automatischen Rttelgert (z.B. Genie Disruptor) 4x80s aufbrechen,
(- 20 C), etwa 80 s zwischen jeder Rttelphase khlen
200 L TE hinzugeben
5 min (Minuten) bei 15.700 g zentrifugieren
vorsichtig 400 L der oberen wssrigen Phase in ein 1,7-ml-Mikrorhrchen
aufnehmen. Sollen die beiden Phasen gemischt werden, die Zentrifugation
wiederholen.
1 ml Ethanol absolut hinzugeben, Reagenzglas 4-5 Mal zum Vermischen drehen *
(einige Stunden, Raum-T)

5 min lang bei 15.700 g zentrifugieren und den berstand durch Strzen
beseitigen
das Sediment in 400 L TE und 30 L RNAse zu 1 g/L wiederaufnehmen
die Lsung bei 37 C 5 min lang inkubieren (danach auf 48 C einstellen)
10 L Ammoniumacetat 4M + 1 ml Ethanol absolut hinzugeben; durch Drehen
mischen
5 min bei 15.700 g zentrifugieren
Den berstand abgieen, die letzten Tropfen mit Filterpapier abwischen.
das Sediment (offenes Reagenzglas im Trockenbad bei 48 C, etwa 1 Std.)
trocknen lassen

Beglaubigte Ausfhrung
Porto, den 24. Juni 2011
Der Generaldirektor der OIV
Sekretr der Generalversammlung
Federico CASTELLUCCI
OIV 2011
6

dem Sediment 25 L TE zugeben, auf dem Vortex schtteln und 1 bis 18 Std. bei
4 C ruhen lassen (frdert die Lslichkeit der DNA). Mit automatischem
Rttelgert homogenisieren * (einige Wochen, -20 C)
7.3 RTq-PCR
Fr jede Weinprobe 2 Kavitten mit den Brett rad3/4-Primern und 2 interne
Kontrollmulden mit den YAL-Primern vorsehen. Fr jede Platte als letzte Prfung fr
jedes Primer-Paar eine Negativ-Kontrolle mit TE vorsehen. Ebenfalls eine PositivKontrolle mit dem verfgbaren DNA von Brettanomyces bruxellensis bei -20 C
vornehmen. Zur Vorbereitung der Positiv-Kontrolle gibt man 5L Basislsung (4,5
UG/ml) bis auf ein Reaktionsvolumen von 25 L.
Programm der PCR-Amplifizierung:
Anzahl der
Zyklen
1
40

Zeit (trocken)

Temperatur (C)

180
95
30
95
10
64,6
Die Fusionskurve wird ab 90C bestimmt, wobei die
Temperatur alle 10 Sekunden um 0,5C verringert wird.
Anz. Brett-Kavitten = Anz. YAL-Kavitten = 2 x Anz. Proben + 2

In der untenstehenden Tabelle sind je nach Anzahl der Proben die Anzahl der
Wells und die Menge jedes Bestandteils der Mischung angegeben.

iQ SYBR Green
supermix (L)

Primer-Mischung 4
M (L)

Wasser
18 M
(L)
26,3

65,6

13,1

36,8

91,9

18,4

47,3

118,1

23,6

10

57,8

144,4

28,9

12

68,3

170,6

34,1

14

78,8

196,9

39,4

16

89,3

223,1

44,6

18

99,8

249,4

49,9

20

110,3

275,6

55,1

10

22

120,8

301,9

60,4

11

24

131,3

328,1

65,6

12

26

141,8

354,4

70,9

Probennummer

Nummer der
Kavitt

Beglaubigte Ausfhrung
Porto, den 24. Juni 2011
Der Generaldirektor der OIV
Sekretr der Generalversammlung
Federico CASTELLUCCI
OIV 2011
7

13

28

152,3

380,6

76,1

14

30

162,8

406,9

81,4

15

32

173,3

433,1

86,6

16

34

183,8

459,4

91,9

17

36

194,3

485,6

97,1

18

38

204,8

511,9

102,4

19

40

215,3

538,1

107,6

20

42

225,8

564,4

112,9

21

44

236,3

590,6

118,1

22

46

246,8

616,9

123,4

23

48

257,3

643,1

128,6

Die Brett-Primer 4 M und die YAL-Primer 4 M aus dem Gefrierschrank nehmen.


SYBR Green herausnehmen (4 C bei verwendetem Reagenzglas, andernfalls -20
C).
Eine Brett-Mischung und eine YAL-Mischung gem der untenstehenden Tabelle je
nach Anzahl der Proben herstellen.
Auf den Boden jeder Kavitt 20 L der Mischung pipettieren.
5 L der mit dem automatischen Rttelgert homogenisierten DNA-Lsung oder 5
L Wasser fr die negativen Kontrollen hinzugeben.
Die optische Folie einstellen und die Platte einladen.

7.4 Ergebnisablesung
-

Die Platte herausnehmen und direkt in den Beutel fr die Entsorgung geben
(nicht ffnen)
Die Grundlinie auf 100 setzen
Der Reihe nach ausfhren:
o Negativ-Vergleichsproben, die kein Signal auslsen drfen. Wird ein CtWert (Schwellenwert-Zyklus) < 37 beobachtet, muss der Vorgang
wiederholt werden, wobei alle Lsungen zu ndern sind,
o positive Brettanomyces-Kontrolle: der Ct-Wert muss bei 25 liegen, bei
einer Schmelztemperatur von 82,5 C ( 0,5 C),
o interne YAL-Kontrollen: Wenn ein Ct-Wert erhalten wird, die
Schmelztemperatur (Tm) des Produkts prfen (84 C 0,5 C). Bei NichtKonformitt kann die Abwesenheit des Brettanomyces-Signals nicht
interpretiert werden.
o Proben: Tm des Brettanomyces bruxellensis - Produkts prfen (82 C
0,5 C). Nur wenn Tm akzeptierbar ist, den exponentiellen Verlauf der
Amplifizierung prfen. Dann die Ct-Werte ermitteln und auf der
Eichgeraden eintragen.

Beglaubigte Ausfhrung
Porto, den 24. Juni 2011
Der Generaldirektor der OIV
Sekretr der Generalversammlung
Federico CASTELLUCCI
OIV 2011
8

NB: Der Ct (engl. Cycle Threshold fr Schwellenwert-Zyklus) steht fr die Zeit, die die
Fluoreszenz der Zielsequenz zur Erreichung eines Schwellenwertes bentigt. Es handelt
sich somit um die minimale Anzahl der PCR-Zyklen, an dem die Fluoreszenz erstmalig
signifikant ber die Hintergrund-Fluoreszenz ansteigt..
8. Berechnung des Resultats
14 Weine (3 Weiweine, 2 Rosweine und 9 Rotweine), deren Gehalt an phenolischen
Verbindungen stark variierte) wurden mit fnf Brettanomyces bruxellensis-Stmmen in
Konzentrationen von 3,1105 bis 3 CFU/ml beimpft. Die DNA wurde anschlieend mit
PVPP 1% extrahiert.
Es wurde eine Eichgerade anhand aller Ergebnisse erstellt, die fr die verschiedenen
Weine- und die Standards erzielt wurden.
Die Resultate werden ausgehend von der Eichgeraden in UG/ml (genetische Einheit pro
ml) ausgedrckt.
Log UG = log (2,03)Ct + 12,34

Standardkurve

8,00
7,00

log (UG) = -log (2,03)*Ct + 12,3

logUG

6,00
5,00
4,00
3,00
2,00
I > 1,2log

1,00

I = 1,2log

(Imax =1,6log)

I > 1,2log

0,00
20

22

24

26

28

30

32

34

36

38

Ct

9. Eigenschaften der Methode : laborinterne Validierungsparameter


9.1 Linearitt, Wiederholbarkeit und Reproduzierbarkeit [4]
Die Sechspunkt-Eichkurve wurde im Bereich von 0 bis 2105 CFU (KBE)/ml des Stammes
L0211 in Wein mit vier Wiederholungen vorbereitet. Dieser Populationsbereich wurde
gem den blichen Brettanomyces bruxellensis -Konzentrationen in Wein gewhlt. Das
Verhltnis zwischen dem gemessenen Wert von log GU zum theoretischen Wert von log
GU
wurde
durch
eine
einfache
Regressionsanalyse
beschrieben.
Die
Regressionsparameter, die Steigung und das konstante Glied wurden, wie in
nachfolgender Tabelle zusammengefasst, ermittelt. Das Regressionsmodell wurde mit
Beglaubigte Ausfhrung
Porto, den 24. Juni 2011
Der Generaldirektor der OIV
Sekretr der Generalversammlung
Federico CASTELLUCCI
OIV 2011
9

einem Irrtumsrisiko von =1% angenommen und derhlte


gew Linearittsbereich
validiert, da kein Modellfehler nachzuweisen war.
Die Genauigkeit der Methode wurde mit der bei Anwendung der klassischen
Zellkulturmethode erzielten Genauigkeit verglichen. Drei Laboranten bereiteten die aus
einem Wein extrahierte DNA vor, der mit dem Stamm L0211 in zwei Konzentrationen
(1,9104 KBE/ml (hoch) oder 1,9102 KBE/ml (niedrig)) beimpft wurde. Fr jeden DNAExtrakt wurde die PCR viermal wiederholt. Die Standardabweichung der Wiederholbarkeit
und der Reproduzierbarkeit, Sr und SR, wurden anhand der log GU Werte fr beide
Konzentrationen berechnet (nachfolgende Tabelle). Bei Anwendung der RTq-PCRMethode fielen die Werte fr Sr und SR im unteren Populationsbereich hnlich aus, bei
einer hheren Population hingegen war SR grer als Sr. Beide Standardabweichungen
waren doppelt so hoch wie die mit der klassischen mikrobiologischen Methode erzielten
Werte. Dieser Effekt wurde der erhhten Anzahl an Arbeitsschritten bei der RTq-PCRMethode zugeschrieben.
Tabelle
Validierungsparameter fr die qPCR-Methode zur Auszhlung von Brettanomyces in Wein
Parameter
Regressionsgleichung
Bereich (KBE/mL)
Steigung (SD)
Konstantes Glied (SD)
Regressionsmodell
Modellfehler

Werte
0-2105
0,957 (0,044)
-0,049 (0,142)
Fobs > F (1,18): lineares Modell akzeptiert
Fobs < F (4,18): kein Modellfehler

Genauigkeit
Sr RTq-PCR (niedrig/hoch)
Sr microbio (niedrig/hoch)
SR RTq-PCR (niedrig/hoch)
SR microbio (niedrig/hoch)

0,26/0,25
0,17/0,04
0,29/0,41
0,17/0,04

Richtigkeit
Mittelwert 43 Proben (D)
SR D
bereinstimmungstest W=D/SR D

2,39 (qPCR)/2,25 (microbio)


1,18
0,11 < 3 annehmbare Richtigkeit

Beglaubigte Ausfhrung
Porto, den 24. Juni 2011
Der Generaldirektor der OIV
Sekretr der Generalversammlung
Federico CASTELLUCCI
OIV 2011
10

9.2 Nachweis- und Quantifizierungsgrenzen (LD und LQ) [4]


LD und LQ geben die Empfindlichkeit der Methode an. LD ist die niedrigste Population, die
von der Methode nachgewiesen werden kann; LQ ist die niedrigste Population, die przise
quantifiziert werden kann. Bei der Lebensmittelanalyse werden diese Parameter ber das
Hintergrundrauschen berechnet. Bei der RTq-PCR-Methode ist jedoch kein Rauschen
vorhanden. Deshalb haben wir andere Anstze fr die Abschtzung der Nachweis- und
Quantifizierungsgrenzen gewhlt. Die erste Methode sttzt sich auf die Steigung, das
konstante Glied und den Standardfehler des konstanten Glieds, die von Versuchen zur
Linearittsvalidierung geliefert werden. Mit dieser Methode wurden die Werte fr LD und
LQ mit 3 und 31 GU/ml bestimmt. In einem zweiten Ansatz wurde LD anhand der
Populationsgre ermittelt, wobei bei 10 unabhngigen Messungen ein negatives
Ergebnis erzielt wurde. Die Analyse unserer Datenerhebung an 14 mit 5 Stmmen
beimpften Weinen zeigte, dass 96% der Proben (48/50) mit einer Konzentration von 101
bis 250 KBE/ml positive Signale ergaben, wohingegen 83% (49/59) positiv ausfielen,
wenn die Konzentration im Bereich von 26 bis 100 KBE/ml lag und 65% (44/68) bei einer
Konzentration im Bereich von 5 bis 25 KBE/ml. Die anhand dieser Methode abgeschtzte
Nachweisgrenze wrde demnach im Bereich von 26 bis 100 KBE/ml liegen. Durch die
systematische Wiederholung der einzelnen PCR-Untersuchungen wurde anhand der
Wahrscheinlichkeitsberechnung (1-p)2 ein LD von 5 KBE/ml besttigt. Bei 5 KBE/ml
ergaben 88% der Proben ein positives Ergebnis. Dieser Wert stieg bei 25 KBE/ml auf
97%.
10. Literatur
1. Phister T.G., Mills D.A., 2003. Real-time PCR assay for detection and enumeration of
Dekkera bruxellensis in wine. Applied and Environmental Microbiology, 69: 74307434.
2. Cocolin L., Rantsiou K., Iacumin L., Zironi R., Comi G., 2003. Molecular detection and
identification of Brettanomyces/Dekkera bruxellensis Brettanomyces/Dekkera
anomalus in spoiled wines. Applied and Environmental Microbiology, 70: 1347-1355.
3. Ibeas J.I., Lozano I., Perdigones F., Jimenez J., 1996. Detection of DekkeraBrettanomyces strains in sherry by a nested PCR method. Applied and Environmental
Microbiology, 62: 998-1003.
4. Tessonnire H., Vidal S., Barnavon L., Alexandre H., Remize F., 2008. Design and
performance testing of a real-time PCR assay for sensitive and reliable direct
quantification of Brettanomyces in wine. International Journal of Food Microbiology,
129: 237-243.

Beglaubigte Ausfhrung
Porto, den 24. Juni 2011
Der Generaldirektor der OIV
Sekretr der Generalversammlung
Federico CASTELLUCCI
OIV 2011
11