Bioresource Technology 192 (2015) 507513

Contents lists available at ScienceDirect

Bioresource Technology
journal homepage: www.elsevier.com/locate/biortech

Impact of high external circulation ratio on the performance of anaerobic

reactor treating coal gasication wastewater under thermophilic
condition
Shengyong Jia, Hongjun Han , Haifeng Zhuang, Baolin Hou, Kun Li
State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150090, China

h i g h l i g h t s
 External circulation anaerobic reactor was investigated to treat CGW.
 External circulation ratio (R) played signicant roles on pollutants removals.
 Increasing R signicantly improved the biodegradability of CGW.
 R inuenced anaerobic granular sludge and particle size distribution.
 Pollutants removals were related to the main bacterial community shift at each R.

a r t i c l e

i n f o

Article history:
Received 21 April 2015
Received in revised form 26 May 2015
Accepted 27 May 2015
Available online 10 June 2015
Keywords:
Coal gasication wastewater
External circulation
Anaerobic reactor
High-throughput sequencing
Biodegradability improvement

a b s t r a c t
A laboratory-scale external circulation anaerobic reactor (ECAR) was developed to treat actual coal gasication wastewater. The external circulation ratio (R) was selected as the main operating variable for
analysis. From the results, with the hydraulic retention time of 50 h, pH > 8.0 and R of 3, the COD, total
phenols, volatile phenol and NH+4-N removal efciencies were remarkably increased to 10 2%,
22 5%, 18 1%, and 1 2%, respectively. Besides, increasing R resulted in more transformation from
bound extracellular polymeric substances (EPS) to free EPS in the liquid and the particle size distribution
of anaerobic granular sludge accumulated in the middle size range of 1.02.5 mm. Results showed the
genus Saccharofermentans dominanted in the ECAR and the bacterial community shift was observed at
different external circulation ratio, inuencing the pollutants removal profoundly.
2015 Elsevier Ltd. All rights reserved.

1. Introduction
Due to increasing awareness on environmental issues and tight
environmental regulations, treatment of industrial wastewater has
been the key aspect of research on wastewater treatment (Asadi
et al., 2012). Coal gasication wastewater (CGW) represents unpredictable toxicological and eco-toxicological effects for the diversied high concentrated constituents, such as phenolic compounds,
ammonia, heterocyclic and polycyclic aromatic hydrocarbons, long
chain hydrocarbons, thiocyanate (SCN ) and cyanide (Wang et al.,
2011), and if disposed of without adequate treatment can cause
serious environmental pollution. In addition to the toxicity, this

Corresponding author at: School of Municipal and Environmental Engineering,

Harbin Institute of Technology, Harbin 150090, China. Tel.: +86 451 87649777; fax:
+86 451 86283082.
E-mail address: han13946003379@163.com (H. Han).
http://dx.doi.org/10.1016/j.biortech.2015.05.106
0960-8524/ 2015 Elsevier Ltd. All rights reserved.

wastewater is characterized by the extremely low biodegradability, resulting in great difculty to the biological treatment.
Anaerobic process is an attractive option for the treatment of
high-strength wastewater (Chan et al., 2009) and variations of
innovative processes have been investigated to treat CGW.
Two-continuous up-ow anaerobic sludge bed (UASB) reactors
have been investigated to treat CGW, which represented signicantly improved biodegradability (Wang et al., 2011). Powdered
activated carbon was added to weaken the inhibition of phenolic
compounds to the CGW treatment in a UASB reactor (Wang and
Han, 2012). Oxygen-limited aeration was conducted in an anaerobic expanded-bed granular activated carbon reactor and this recovery strategy could be helpful to relieve the inhibitory effect of
phenolic compounds and restore metabolic activity of anaerobic
bacteria (Wang et al., 2014). In addition, bio-augmented anaerobic
process has also been investigated by methanol addition to
improve the biodegradability for CGW (Wang et al., 2010).

508

S. Jia et al. / Bioresource Technology 192 (2015) 507513

However, the major obstacles of these processes were big footprint (two stages UASB) and high agent consumption (powdered
activated carbon and methanol). In order to resolve these problems, external circulation anaerobic reactor (ECAR) was developed
on the basis of UASB reactor to further relieve the inhibition of
toxic and refractory compounds to the bacterial activity and
improve the biodegradability. Particularly, the external circulation
was dened as the approach that efuent of sludge water from the
UASB reactor was used to recycle outside. It was suggested that
external circulation could speed the upow velocity (Vup) in the
reactor at a specic HRT, decrease the burden of solidliquid separation of three-phase separator, enhance the contact between
CGW and anaerobic granular sludge (AGS), and improve the effectiveness of treatment (Yu and Lu, 2014). Moreover, to some extent,
the inuent loading has been gradually decreased as the external
circulation ratio increased. Additionally, thermophilic condition
should be paid more attention using ECAR, due to the residual heat
from the steaming ammonia process, resulting in high temperature
in the range of 4050 C in CGW.
Up to date, very few works have evaluated the effect of high
external circulation ratio (P1, external circulation ow rate:inuent ow rate) on the anaerobic CGW treatment. Hence the present
study was undertaken to explore the effect of external circulation
ratio on COD, total phenols (TPh), volatile phenol (VP) and NH+4-N
removal and biodegradation improvement for CGW. Before these,
the optimum hydraulic retention time (HRT) and pH range were
investigated. Besides, the inuence of external circulation ratio
on the extracellular polymeric substances (EPS), particle size distribution (PSD) of AGS, specic TPh utilization rate (STPh-UR), specic VP utilization rate (SVP-UR) and specic methanogenic activity
(SMA) were discussed. Additionally, according to the
high-throughput sequencing technology, relationships between
main bacterial community and pollutants removal at each external
circulation ratio were explored.
2. Methods
2.1. Experimental setup, inoculums and CGW characteristics
The ECAR was made of plexiglas with the working volume of
34.5 L and operated around 4550 C. The inoculated anaerobic
activated sludge was taken from the UASB tank treating CGW from
the wastewater treatment plant (UASB oxygen limited aeration
processthree stages anoxic/oxic processozone oxidation processbiological aerated lter) and the suspended solids in the
ECAR were about 10 g/L.
The CGW used in this study mainly included (in mg/L): COD of
32003500, BOD of 700850, TPh of 750850, VP of 350550,
NH+4-N of 250300, volatile acids of 1018, sulde of 3060,
SCN of 55110, CN of 17 and total alkalinity of 1316 mM/L,
pH of 8.09.5.
2.2. Experimental procedures
The inuent and recirculation were obtained by peristaltic
pumps (BT100 2 J, Longer pump, China). The continuous experiment has been divided into 3 stages and the parameters of HRT,
pH and external circulation ratio were investigated in stage I (days
1120), II (days 121210) and III (days 211450), respectively.
Dilute sulfuric acid was used to adjust the pH of inuent CGW.
The continuous operational strategy was outlined in Table 1.
In order to evaluate the inuence of external circulation ratio on
the AGS, the concentrations of EPS in terms of protein and polysaccharide were determined every 5 days, which thought to be
detached from the surface of AGS. Besides, the PSD of AGS was also

Table 1
Operational parameters of continuous experiments.
Stage

Period (d)

HRT (h)

pH

130
3160
6190
91120

30
40
50
60

>8.0
>8.0
>8.0
>8.0

1
1
1
1

II

121150
151180
181210

50
50
50

>8.0
6.57.5
6.57.5

1
1
1

III

211270
271330
331390
391450

50
50
50
50

>8.0
>8.0
>8.0
>8.0

1
2
3
4

HRT, hydraulic retention time; R was dened as the ratio of the recirculation ow
rate to that of the inuent ow rate.

determined on the last day of each period in stage III. The concentrations of COD, BOD, TPh, VP and NH+4-N were analyzed every
2 days. STPh-UR, SVP-UR and SMA were analyzed every 5 days.
Additionally, in order to represent the data more objectively, all
the parameters described in above were determined in triplicate;
furthermore, the data in stages I and II (Fig. 1) and STPh-UR,
SVP-UR, SMA and EPS in stages III (Table 2 and Fig. 3a) were represented as mean values the standard error; while the COD, BOD,
TPh, VP, NH+4-N and PSD in stages III were represented as mean values (Figs. 2 and 3b).
Four anaerobic activated sludge samples were collected from
the bioreactor on the last day at each external circulation ratio
(day 270, 330, 390 and day 450) for the bacterial community
analysis.

2.3. Analytical methods

COD, BOD, TPh, VP and NH+4-N were measured according to
Standard Methods (section 5220 D, 5210 B, 5530 D, 6420 B and
4500 G, respectively) (AHPA, 1998). DO and pH values were determined daily with a hybrid meter (30 d, HACH, USA). EPS were used
in the protein and polysaccharide assays (Taimur Khan et al.,
2013). The measurements of PSD of AGS were conducted using a
laser particle size analyzer (Mastersizer 2000, Malvern, UK).
Biogas production was determined by a gasow meter and
methane content was analyzed using a 3 M NaOH solution.
Triplicate activated sludge samples at each external circulation
ratio were collected and stored at 80 C before use. Genomic DNA
of the 4 sludge samples was extracted using the method of Ma
et al. (2015), the DNA concentration was determined using a
NanoDrop (NanoDrop Technologies Inc., Wilmington, DE, USA).
The extracted DNA was amplied by using a set of primers with
341F primer (CCTACACGACGCTCTTCCGATCTNCCTACGGGNGGCW
GCAG) and 805R primer (GACTGGAGTTCCTTGGCACCCGAGAATTC
CAGACTACHVGGGTAT CTAATCC) targeting the V3V4 region of
bacterial 16S rRNA gene. The PCR conditions were set as follows:
initial denaturation at 94 C for 3 min, followed by 5 cycles of
denaturation at 94 C for 30 s, annealing at 45 C for 20 s, and
extension at 65 C for 30 s; and then 20 cycles of denaturation at
94 C for 20 s, annealing at 55 C for 20 s, and extension at 72 C
for 30 s and then nal extension at 72 C for 5 min.
The PCR products were determined by pyrosequencing using
Miseq Illumina by Sangon Biotech (Shanghai, China) Co., Ltd. To
obtain the effective sequencing data, raw pyrosequencing results
were processed by the method of Zhang et al. (2015).
The resulting high quality sequences were processed to generate operational taxonomic units (OTUs) by CD-HIT at the 97%
sequence similarity threshold. The taxonomic assignment was

509

S. Jia et al. / Bioresource Technology 192 (2015) 507513

(a)
25

Removal efficiency (%)

20
15
10
5

NH4 -N

0
-5

TPh

COD

-10

VP

30 h
40 h
50 h
60 h

-15
-20
-25

BOD/COD

Pollutants

-30
-35

1.0
0.9
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0.0
-0.1
-0.2
-0.3
-0.4
-0.5
-0.6
-0.7
-0.8
-0.9
-1.0

BOD/COD

30

20

Removal efficiency (%)

15
10
5
+

NH4 -N

COD

TPh

-5
-10

pH>8.0
7.5>pH>6.5

VP

BOD/COD

Pollutants

-15
-20

1.0
0.9
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0.0
-0.1
-0.2
-0.3
-0.4
-0.5
-0.6
-0.7
-0.8
-0.9
-1.0

BOD/COD

(b)

Fig. 1. Removal of COD, TPh, VP and NH+4-N and BOD/COD ratio variations with the increasing HRT (a) and pH adjustment (b). (Values represent the mean values in each
period in stages I and II, error bars represent standard deviation of triplicate tests.)

Table 2
Specic TPh utilization rate (STPh-UR), specic VP utilization rate (SVP-UR) and
specic methanogenic activity (SMA) tests at different external circulation ratio.

STPh-UR
mgTPh/(g VSS d)

SVP-UR
mgVP/(g VSS d)

SMA
mgCOD-CH4/(g VSS d)

1
2
3
4

103 16a
67 12
135 29
105 8

72 14
34 14
53 12
41 4

85 11
100 16
118 15
109 12

Values represent the mean values the standard error in each period in stage

III.

performed with the RDP classier with a condence cutoff of 0.5.

The average data were calculated for each sample before analyzing
the unique and shared OTUs/genera.
3. Results and discussion
3.1. HRT and pH
It has been suggested that the parameter of HRT represented
signicant inuence on the hydraulic conditions and reaction time
among different reactants within the reactor (Rosman et al., 2014).
Effects of HRT on COD, TPh, VP and NH+4-N removal and BOD/COD
improvement are shown in Fig. 1a. With the increasing HRT from
30 to 60 h, result showed COD removal up to 15% and BOD/COD
higher than 0.55, which relied on the prolonged reaction time

and abundant increase in bacterial density and accumulation of

rod-shaped bacteria dispersed on the AGS surface (Figure not
shown), these were consistent with previous studies (Prakash
and Gupta, 2000; Ramakrishnan and Gupta, 2008). It was found
that VP removal stayed in a high and stable level at HRT of 50
and 60 h, giving the average efciencies of 20%. However, sudden
decreases of TPh removal occurred at the HRT of 60 h, resulting
in values as low as 9%, which claried too high HRT played the
adverse effect on TPh removal.
Result showed negative NH+4-N removal in ECAR, probably due
to lower NH+4-N degradation rate than generation rate for the presence of organic nitrogen and SCN in the inuent, since the former
was transformed into NH+4-N and the latter into NH+4-N, CO2 and
SO24 during the hydrolysis process (Vzquez et al., 2006). While
a sudden improved NH+4-N removal occurred when the HRT was
increased from 30 to 50 h, probably owing to the prolong time
for the degradation.
For the high alkalinity of the actual CGW, inuence of pH should
be noticed. As shown in Fig. 1b, it is clearly shown that the overall
performance with higher pH (>8.0) was better than in range of 6.5
7.5, the reasons might be that the anaerobic bacteria have acclimated the high pH condition representing high activity; however,
with neutral pH, some bacterial activity was inhibited. Liang et al.
(2013) has demonstrated that all the pH (2.510.5) in the anaerobic systems moved towards the neutral direction, but in this study,
the efuent pH increased to be higher than inuent due to the
complex oxidation-reduction processes.

510

S. Jia et al. / Bioresource Technology 192 (2015) 507513

10

2000
1500
5

1000
500

B O D (m g/L )

2500

1.0

2000

0.8

1500

0.6

BOD
BOD/COD

1000
500

R =1

0.4

R=3

R=2

0.2

R=4

V P (m g/L)

2500

R em oval efficiency (% )

C O D (m g/L )

3000

B O D /C O D

15

(b)

30

500

25

400

20

300

15

200

10

100

R=2

R=1

R=4

R=3

0.0

1000

600

R em oval efficiency (% )

(c)

(a)
3500

(d)

35

350

30

300

10

900
800

300

10

200

150

-5

100

200

R em oval efficiency (% )

15

400

20

500

250

N H4 -N (m g/L )

T Ph (m g/L )

600

R em oval efficiency (% )

5
25

700

-10

100

R=1
270

Influent

330

Time(d)
Effluent

50

R=4

R=3

R=2

360

450

Fig. 2. Removal of (a) COD, (b) TPh, (c) VP and (d)

NH+4-N

-15
210

270

Influent

Removal efficiency

R=4

R=3

R=2

R=1

0
210

330

Tim e (d)
Effluent

360

450

Removal efficiency

and BOD/COD ratio variations with the increasing external circulation ratio (R).

Relying on the above results, the optimal parameters were HRT

of 50 h and pH of higher than 8.0. Notwithstanding the ECAR performance was improved, the overall pollutants removal and
BOD/COD ratio remained low. Therefore, further investigation
related to external circulation was carried out.
3.2. External circulation ratio
3.2.1. Pollutants removal
As shown in Fig. 2a, COD removal dramatically uctuated at different external circulation ratio, while the gradually increasing
BOD/COD ratios were observed, ranging from 0.50 to 0.77, however, the steady level of BOD/COD ratios was found at R of 4, probably due to the increase of recalcitrance in the reactor. Sharp
decrease of COD removal occurred when external circulation ratio
increased to 2, probably due to the sudden speeding Vup which
changed the living environment and the AGS structure, but the
removal recovered soon along with operation time. Similar TPh
and VP removal were found; efciencies decreased from 15 3%
and 22 4% to 12 2% and 8 2%, respectively. It was speculated
that increasing external circulation ratio played a more efcient
role in biodegradability improvement than COD removal.
Further increased external circulation ratio improved the TPh
removal owing to the diluted inuent, which decreased the loading
rate and reduced the adverse effect of toxic substances on the
biodegradation. However, contrast to R of 1, VP removal was inhibited at R of 3 and 4, for the reasons that more polyhydric phenols
were degraded to phenol as part of VP. R of 4 played a negative
effect on pollutants removal, causing the efciencies of COD, TPh
and VP in the low and stable ranges of 4 1%, 17 2% and
13 2%, respectively, due to the inhibition of too much metabolic
product to the anaerobic digestion. Particularly, compared with
inuent, the phenolic compounds in efuent increased 11 kinds,

in which the 2,4,6-trimethyl phenol, 2,3,6-trimethyl phenol and

2-ethyl-5-methyl phenol and other alkylphenols were more refractory to biodegrade.
Obviously, the organic matter should be the main sources of
NH+4-N increment and external recirculation could add additional
NH+4-N to the reactor. However, in this study, NH+4-N removal efciencies represented slight increment, values ranging from 9 1%
to 3 1% in the plausible steady period and this could be explained
by the recovery of NH+4-N degradation bacteria. In addition, during
the whole stage III, the NO2 -N and NO3 -N were lower than 1 and
3 mg/L, respectively, thus they were not shown in Fig. 2.
3.2.2. Anaerobic granular sludge
In addition to the dilution effect, enhanced pollutants removal
was also achieved through the inuence of external circulation
ratio on the AGS formation, changing the structure (Costa et al.,
2007). AGS represented specic three-layered structures, and outer
layer constituent such as EPS was usually considered to protect the
inner microorganisms against the harsh external environmental
conditions (Mu et al., 2012). Additionally, the process of AGS
buildup comprised two steps: the attachment of biomass and the
growth of biomass, therefore, lower external circulation ratio in
the start-up stage (R of 1) would facilitate the biomass attachment.
Among the hydrodynamic parameters, Vup is the signicant
aspect that should be studied seriously. Increasing external circulation ratio could speed up the Vup in a specic HRT and it was
reported that high Vup could favor mass transfer among phases
and increase interaction between substrate and activated sludge
(Dos Reis and Silva, 2011). In addition, increasing external circulation ratio enhanced the collision probability and friction strength
among AGS, promoting the compactness process. However, too
high external circulation ratio showed adverse effect, probably
due to disruption to the AGS structure by excessive hydraulic shear

511

S. Jia et al. / Bioresource Technology 192 (2015) 507513

(a)
20

Protein/Polysaccharide (mg/L)

Protein
Polysaccharide
15

10

(b)

Percent of AGS per size class (%)

100

2.5-3.0mm
2.0-2.5mm
1.5-2.0mm
1.0-1.5mm
0.5-1.0mm
0-0.5mm

80

60

40

20

0
1

R
Fig. 3. Protein and polysaccharide variations (a) and particle size distribution of the anaerobic granular sludge (AGS) (b) with the increasing external circulation ratio (R).
(Values represent averages standard deviation at each period in stage III.)

stress, thereby decreasing the pollutants removal when external

circulation ratio increased to 4. Additionally, too high external circulation ratio caused more toxic and harmful metabolic substances
recycling to the reactor, and this was an important reason which
could not be neglected.
As shown in Fig. 3a, concentrations of proteins and polysaccharides increased from 2 and 8 mg/L (R of 1) to 12 and 17 mg/L (R of
4), respectively, revealing more transformation from bound EPS on
the AGS surface to free EPS in the liquid owing to enhanced friction
strength. Besides, increasing external circulation ratio signicantly
affected the PSD of the AGS (Fig. 3b), thereby inuencing the bioreactor performance. Slight variation was observed for the PSD of
2.53.0 mm when external circulation ratio increased from 1 to
2, ranging from 10% to 9%, while it decreased to 2% when the external circulation ratio further increased to 4; in addition, the PSD of
2.02.5 mm at R of 4 was 15% lower than R of 3, these results indicated the disruption of AGS varied as external circulation ratio
increased. From Fig. 3b, it was speculated that the middle size
AGS (1.02.5 mm) dominanted the main part, PSD percent increase
from 72% to 82%, relying on the acceleration of biomass growth to
promote the AGS formation, while bigger and smaller particle size
(2.53.0 and 01.0 mm) acutely decreased due to the strong
collision.
3.2.3. Variations of STPh-UR, SVP-UR and SMA
Table 2 presents the variations of STPh-UR, SVP-UR and SMA
with increasing external circulation ratio. As observed, the
STPh-UR was 103 16 mgTPh/(g VSS d) at R of 1 and increased to
135 29 mgTPh/(g VSS d) at R of 3. Noticeably, the STPh-UR at R

of 2 was the lowest due to the sudden hydraulic condition change

(external circulation ratio ranging from 1 to 2), however, decreasing STPh-UR did not dramatically affect the methanogens activity,
slight SMA increment has been observed, even the methanogens
were expected to be more sensitive to the phenolic compounds.
While R of 4 decreased STPh-UR to 105 8 mgTPh/(g VSS d) in
relation with the inhibitory effect of metabolic product in the circulation liquid (mainly the accumulation of alkylphenols). It was
observed that SVP-UR with higher external circulation ratios were
in a low and stable level, decreasing about 30% at R of 4, compared
with R of 1. Higher SMA values were recorded at R of 3 with values
of 118 15 mg COD-CH4/(g VSS d), displaying the highest values
for the reactor, yet lower than the study of Wang et al. (2011).
This might be due to the thermophilic temperature condition in
this study, resulting in higher ammonia toxicity to methanogens
(Gallert and Winter, 1997). To some extent, STPh-UR would inuence SMA. Generally, TPh in terms of the polyhydric phenol in
CGW were inhibitory to methanogenic bacteria (Wang et al.,
2011), but as the external circulation ratio increased, decrease of
TPh removal was observed which did not signicantly affect the
SMA, revealing the high methanogenic activity after long time
operation.
3.2.4. Bacterial community shift
Pyrosequencing of 16S rRNA gene revealed slight biodiversity
variations in ECAR along with the increasing external circulation
ratio (data not shown but the biodiversity indices of OTUs and
Shannons diversity index were approximately same). However,
results showed that external circulation ratio signicantly affected

512

S. Jia et al. / Bioresource Technology 192 (2015) 507513

the abundance of the most genera present in the bioreactor. As

shown in Fig. 4, among the genera, Saccharofermentans,
Comamonas,
Bradyrhizobium,
Oligotropha,
Vulcanibacillus,
Brachymonas, Diaphorobacter and Thauera were the eight predominant genera (abundance > 2% in any sample) in the bioreactor,
with the increasing external circulation ratio. Particularly, genus
Saccharofermentans had increased abundance at R of 4, reaching
25.85%, which was 2.5 times R of 1. This genus has been reported
as a novelty genus isolated from anaerobic sludge treating brewery
wastewater, a representative of this genus, Saccharofermentans
acetigenes produces acetate, lactate, fumarate, and trace amounts
of molecular hydrogen from several sugars (Chen et al., 2010).
Additionally, this genus has also been detected in a
biogas-generating microbial community utilizing agricultural
wastes (Ziganshina et al., 2014). Up to date, this is the rst time
that the Saccharofermentans was detected as predominant genus
in anaerobic bioreactor treating the CGW. Oligotropha carboxidovorans is the sole species represented by the genus Oligotropha, characterized by the ability to grow with carbon monoxide as a sole
source of carbon and energy under denitrifying conditions
(Meyer et al., 1993). Genus Desulfacinum was isolated from an oil
eld, representing biodegradability of the long chain hydrocarbons
(Beeder et al., 1995). And Deuviicoccus has been investigated to
determine the metabolic pathways involved in the anaerobic formation of polyhydroxyalkanoates and carbon storage polymers,
which was important for the proliferation of microorganisms in
enhanced biological phosphorus removal processes (Burow et al.,
2009). It has been suggested that genus Apia represented high
ability to degrade dioxane in the drainage area of a chemical factory (Sei et al., 2013). Huang et al. (2014) showed that
Novosphingobium was identied as potential tetracycline resistant

bacteria in the sludge cultured with different concentrations of

tetracycline. Bacterial genus Sphingomonas, which has been suggested to be one of the major polycyclic aromatic hydrocarbons
(PAHs) degraders in the environment, was observed in this bioreactor, additionally, bacterial genera Comamonas was able to
degrade PAHs (Muangchinda et al., 2014; Zhang et al., 2011).
In this study, pyrosequencing demonstrated that a total of 7
genera of potential denitriers were detectable in the four sludge
samples, including Comamonas, Bradyrhizobium, Thauera,
Hyphomicrobium, Paracoccus, Mesorhizobium and Pseudolabrys
(Miao et al., 2015), among which, except for Hyphomicrobium, continuously increasing trend in abundance was observed along with
the increasing external circulation ratio. LHaridon et al. (2006)
showed that Vulcanibacillus could use nitrate as the sole electron
acceptor, which was reduced to nitrite and not further reduced
to ammonia or N2. Recently, Gonzlez-Martnez et al. (2013)
showed that genus Diaphorobacter was in close relation with
partial-SHARON process and dominanted the bacterial biodiversity. Furthermore, the total abundance of these genera increased
from 30.59% (R of 1) to 40.65% (R of 4) (average values), this may
explain the improved NH+4-N biodegradation along with the
increasing external circulation ratio, but the specic metabolic
pathways needed further investigation.
To ascertain if the anaerobic ammonium oxidation contributed
for NH+4-N removal, the bacteria were identied according to previous literature (Li et al., 2009), and result showed 1.16% of the gene
afliated to order Planctomycetales, in which, bacteria were closely
related to the anaerobic ammonium oxidation, however, typical
anammox bacterium Candidatus Brocadia anammoxidans,
Candidatus Kuenenia stuttgartiensis and Nitrosomonas eutropha
were not detected in this study, therefore the anaerobic

Rudaea
Beijerinckia
Petrimonas
Sphingomonas
Meniscus
Planctomyces
Levilinea
Syntrophus
Aquicella
Methylocystis
Parachlamydia
Syntrophomonas
Sphingopyxis
Longilinea
Novosphingobium
Syntrophorhabdus
Desulfacinum
Alkaliflexus
Defluviicoccus
Rhodoplanes
Afipia
-0.5000
Pseudolabrys
Mesorhizobium
Paracoccus
-1.000
Neochlamydia
Hyphomicrobium
Thauera
-1.500
Diaphorobacter
Brachymonas
Vulcanibacillus
Oligotropha
-2.000
Bradyrhizobium
Comamonas
Saccharofermentans
-2.500
lg( Relative Abundance )

Fig. 4. Abundance of the major bacterial genera (>0.5% in any sample) in the anaerobic activated sludge samples of the bioreactor with different external circulation ratio (R).

S. Jia et al. / Bioresource Technology 192 (2015) 507513

ammonium oxidation process might not take place in the bioreactor (Kuenen, 2008).
The genera of Methanosaeta, Methanobacterium and Methanospirillum (not shown in Fig. 4) were detected in low abundance
at R of 4, for 0.25%, 0.02% and 0.04% (average values), respectively,
and these were of Methanomicrobiales order with the ability to produce methane (Demirel and Scherer, 2008). Low abundance
revealed low performance of the methanogenic bacteria, mainly
due to the toxicity of high concentrations ammonia (Demirel and
Scherer, 2008), thereby resulting in low specic methanogenic
activity. In addition, it was found that the TPh and VP removal efciencies both decreased when external circulation ratio increased
from 3 to 4 (Fig. 2b and c), therefore, aggravated inhibition by
the recycling phenolic compounds to methanogenic bacteria reproduction could be another reason for the low methane production
which could not be neglected.
4. Conclusions
The study showed external circulation ratio played signicant
effects on the ECAR performance with HRT of 50 h and pH higher
than 8.0. At R of 3, COD, TPh, VP and NH+4-N removal efciencies
reached 10 2%, 22 5%, 18 1%, and
1 2%, respectively,
besides, BOD/COD ratios stayed in a high and stable range of
0.640.74, revealing enhanced biodegradability. As external circulation ratio increased, the free EPS increased and PSD of AGS accumulated in the middle size range, and variations of STPh-UR,
SVP-UR and SMA were observed. Additionally, results demonstrated the pollutants removal was in close relation with the main
bacterial community shift.
Acknowledgement
This work was supported by State Key Laboratory of Urban
Water Resource and Environment, Harbin Institute of Technology
(No. 2015DX02).
References
AHPA, 1998. Standard methods for the examination of water and wastewater, 20th
ed. American Public Health Association, American Water Works Association,
Water Environment Federation, Washington, DC.
Asadi, A., Zinatizadeh, A.A.L., Sumathi, S., 2012. Simultaneous removal of carbon and
nutrients from an industrial estate wastewater in a single up-ow aerobic/
anoxic sludge bed (UAASB) bioreactor. Water Res. 46, 45874598.
Beeder, J., Torsvik, T., Lien, T., 1995. Thermodesulforhabdus norvegicus gen. nov., sp.
nov., a novel thermophilic sulfate-reducing bacterium from oil eld water. Arch.
Microbiol. 164, 331336.
Burow, L.C., Mabbett, A.N., Borrs, L., Blackall, L.L., 2009. Anaerobic central
metabolic pathways active during polyhydroxyalkanoate production in
uncultured cluster 1 Deuviicoccus enriched in activated sludge
communities. Fems. Microbiol. Lett. 298, 7984.
Chan, Y.J., Chong, M.F., Law, C.L., Hassell, D.G., 2009. A review on anaerobicaerobic
treatment of industrial and municipal wastewater. Chem. Eng. J. 155, 118.
Chen, S., Niu, L., Zhang, Y., 2010. Saccharofermentans acetigenes gen. nov., sp. nov.,
an anaerobic bacterium isolated from sludge treating brewery wastewater. Int.
J. Syst. Evol. Micr. 60, 27352738.
Costa, J.C., Abreu, A.A., Ferreira, E.C., Alves, M.M., 2007. Quantitative image analysis
as a diagnostic tool for monitoring structural changes of anaerobic granular
sludge during detergent shock loads. Biotechnol. Bioeng. 98, 6068.
Demirel, B., Scherer, P., 2008. The roles of acetotrophic and hydrogenotrophic
methanogens during anaerobic conversion of biomass to methane: a review.
Rev. Environ. Sci. Bio/Technol 7, 173190.
Dos Reis, C.M., Silva, E.L., 2011. Effect of upow velocity and hydraulic retention
time in anaerobic uidized-bed reactors used for hydrogen production. Chem.
Eng. J. 172, 2836.
Gallert, C., Winter, J., 1997. Mesophilic and thermophilic anaerobic digestion of
source-sorted organic wastes: effect of ammonia on glucose degradation and
methane production. Appl. Microbiol. Biot. 48, 405410.
Gonzlez-Martnez, A., Caldern, K., Albuquerque, A., Hontoria, E., Gonzlez-Lpez,
J., Guisado, I.M., Osorio, F., 2013. Biological and technical study of a partial-

513

SHARON reactor at laboratory scale: effect of hydraulic retention time. Bioproc.

Biosyst. Eng. 36, 173184.
Huang, K.L., Tang, J.Y., Zhang, X.X., Xu, K., Ren, H.Q., 2014. A comprehensive insight
into tetracycline resistant bacteria and antibiotic resistance genes in activated
sludge using next-generation sequencing. Int. J. Mol. Sci. 15, 1008310100.
Kuenen, J.G., 2008. Anammox bacteria: from discovery to application. Nat. Rev.
Microbiol. 6, 320326.
LHaridon, S., Miroshnichenko, M.L., Kostrikina, N.A., Tindall, B.J., Spring, S.,
Schumann, P., Stackebrandt, E., Bonch-Osmolovskaya, E.A., Jeanthon, C., 2006.
Vulcanibacillus modesticaldus gen. nov., sp. nov., a strictly anaerobic, nitratereducing bacterium from deep-sea hydrothermal vents. Int. J. Syst. Evol. Micr.
56, 10471053.
Li, X.R., Du, B., Fu, H.X., Wang, R.F., Shi, J.H., Wang, Y., Jetten, M.S.M., Quan, Z.X.,
2009. The bacterial diversity in an anaerobic ammonium-oxidizing (anammox)
reactor community. Syst. Appl. Microbiol. 32, 278289.
Liang, F., Xiao, Y., Zhao, F., 2013. Effect of pH on sulfate removal from wastewater
using a bioelectrochemical system. Chem. Eng. J. 218, 147153.
Ma, Q., Qu, Y.Y., Shen, W.L., Zhang, Z.J., Wang, J.W., Liu, Z.R., Li, D.X., Li, H.J., Zhou, J.T.,
2015. Bacterial community compositions of coking wastewater treatment
plants in steel industry revealed by Illumina high-throughput sequencing.
Bioresour. Technol. 179, 436443.
Meyer, O., Stackebrandt, E., Auling, G., 1993. Reclassication of Ubiquinone Q-10
Containing Carboxidotrophic Bacteria: Transfer of [Pseudomonas]
carboxydovorans OM5T to Oligotropha, gen. nov., as Oligotropha
carboxidovorans, comb. nov., Transfer of [Alcaligenes] carboxydus DSM
1086T to Carbophilus, gen. nov., as Carbophilus carboxidus, comb. nov.,
Transfer of [Pseudomonas] compransoris DSM 1231T to Zavarzinia, gen.
nov., as Zavarzinia compransoris, comb. nov., and Amended Descriptions of the
New Genera. Syst. Appl. Microbiol. 16, 390395.
Miao, Y., Liao, R.H., Zhang, X.X., Wang, Y., Wang, Z., Shi, P., Liu, B., Li, A.M., 2015.
Metagenomic insights into Cr(VI) effect on microbial communities and
functional genes of an expanded granular sludge bed reactor treating highnitrate wastewater. Water Res. 76, 4352.
Mu, H., Zheng, X., Chen, Y.G., Chen, H., Liu, K., 2012. Response of anaerobic granular
sludge to a shock load of zinc oxide nanoparticles during biological wastewater
treatment. Environ. Sci. Technol. 46, 59976003.
Muangchinda, C., Chavanich, S., Viyakarn, V., Watanabe, K., Imura, S., Vangnai, A.S.,
Pinyakong, O., 2014. Abundance and diversity of functional genes involved in
the degradation of aromatic hydrocarbons in Antarctic soils and sediments
around Syowa Station. Environ. Sci. Pollut. R. 22, 47254735.
Prakash, S.M., Gupta, S.K., 2000. Biodegradation of tetrachloroethylene in upow
anaerobic sludge blanket reactor. Bioresour. Technol. 72, 4754.
Ramakrishnan, A., Gupta, S.K., 2008. Effect of hydraulic retention time on the
biodegradation of complex phenolic mixture from simulated coal wastewater in
hybrid UASB reactors. J. Hazard. Mater. 153, 843851.
Rosman, N.H., Nor Anuar, A., Chelliapan, S., Md Din, M.F., Ujang, Z., 2014.
Characteristics and performance of aerobic granular sludge treating rubber
wastewater at different hydraulic retention time. Bioresour. Technol. 161, 155
161.
Sei, K., Miyagaki, K., Kakinoki, T., Fukugasako, K., Inoue, D., Ike, M., 2013. Isolation
and characterization of bacterial strains that have high ability to degrade 1,4dioxane as a sole carbon and energy source. Biodegradation 24, 665674.
Taimur Khan, M.M., Takizawa, S., Lewandowski, Z., Habibur Rahman, M., Komatsu,
K., Nelson, S.E., Kurisu, F., Camper, A.K., Katayama, H., Ohgaki, S., 2013.
Combined effects of EPS and HRT enhanced biofouling on a submerged and
hybrid PAC-MF membrane bioreactor. Water Res. 47, 747757.
Vzquez, I., Rodrguez, J., Maran, E., Castrilln, L., Fernndez, Y., 2006.
Simultaneous removal of phenol, ammonium and thiocyanate from coke
wastewater by aerobic biodegradation. J. Hazard. Mater. 137, 17731780.
Wang, W., Han, H.J., 2012. Recovery strategies for tackling the impact of phenolic
compounds in a UASB reactor treating coal gasication wastewater. Bioresour.
Technol. 103, 95100.
Wang, W., Han, H.J., Yuan, M., Li, H.Q., 2010. Enhanced anaerobic biodegradability of
real coal gasication wastewater with methanol addition. J. Environ. Sci. 22,
18681874.
Wang, W., Han, H.J., Yuan, M., Li, H.Q., Fang, F., Wang, K., 2011. Treatment of coal
gasication wastewater by a two-continuous UASB system with step-feed for
COD and phenols removal. Bioresour. Technol. 102, 54545460.
Wang, W., Zhang, J., Wang, S., Shen, J., Pan, S.L., 2014. Oxygen-limited aeration for
relieving the impact of phenolic compounds in anaerobic treatment of coal
gasication wastewater. Int. Biodeter. Biodegr. 95 (Part A), 110116.
Yu, Y., Lu, X., 2014. Start-up performance and granular sludge features of an
improved external circulating anaerobic reactor for algae-laden water
treatment. Saudi J. Biol. Sci. http://dx.doi.org/10.1016/j.sjbs.2014.09.011.
Zhang, J.X., Zhang, Y.B., Quan, X., Chen, S., 2015. Enhancement of anaerobic
acidogenesis by integrating an electrochemical system into an acidogenic
reactor: effect of hydraulic retention times (HRT) and role of bacteria and
acidophilic methanogenic Archaea. Bioresour. Technol. 179, 4349.
Zhang, S.Y., Wan, R., Wang, Q.F., Xie, S.G., 2011. Identication of anthracene
degraders in leachate-contaminated aquifer using stable isotope probing. Int.
Biodeter. Biodegr. 65, 12241228.
Ziganshina, E.E., Bagmanova, A.R., Khilyas, I.V., Ziganshin, A.M., 2014. Assessment of
a biogas-generating microbial community in a pilot-scale anaerobic reactor. J.
Biosci. Bioeng. 117, 730736.