Angiotensin II DNA Vaccine

Long-Term Reduction of High Blood Pressure by

Angiotensin II DNA Vaccine in Spontaneously
Hypertensive Rats
Hiroshi Koriyama, Hironori Nakagami, Futoshi Nakagami, Mariana Kiomy Osako,
Mariko Kyutoku, Munehisa Shimamura, Hitomi Kurinami, Tomohiro Katsuya,
Hiromi Rakugi, Ryuichi Morishita
AbstractRecent research on vaccination has extended its scope from infectious diseases to chronic diseases, including
Alzheimer disease, dyslipidemia, and hypertension. The aim of this study was to design DNA vaccines for high blood
pressure and eventually develop human vaccine therapy to treat hypertension. Plasmid vector encoding hepatitis B coreangiotensin II (Ang II) fusion protein was injected into spontaneously hypertensive rats using needleless injection system.
Anti-Ang II antibody was successfully produced in hepatitis B core-Ang II group, and antibody response against Ang II
was sustained for at least 6 months. Systolic blood pressure was consistently lower in hepatitis B core-Ang II group after
immunization, whereas blood pressure reduction was continued for at least 6 months. Perivascular fibrosis in heart tissue
was also significantly decreased in hepatitis B core-Ang II group. Survival rate was significantly improved in hepatitis
B core-Ang II group. This study demonstrated that Ang II DNA vaccine to spontaneously hypertensive rats significantly
lowered high blood pressure for at least 6 months. In addition, Ang II DNA vaccines induced an adequate humoral immune
response while avoiding the activation of self-reactive T cells, assessed by ELISPOT assay. Future development of DNA
vaccine to treat hypertension may provide a new therapeutic option to treat hypertension.(Hypertension. 2015;66:167174. DOI: 10.1161/HYPERTENSIONAHA.114.04534.) Online Data Supplement

Key Words: allergy and immunology

angiotensin II

ntihypertensive drugs, such as calcium channel blockers

and angiotensin II (Ang II) receptor blockers are widely
used in the treatment of hypertension. These medications are
known to effectively lower high blood pressure (BP) with relatively minor side effects. Although current antihypertensive
drugs seem to fulfill the unmet medical needs of hypertensive
patients, there are still serious issues (eg, daily dosage of the
medication and often for life) that may be a significant financial
burden, particularly in developing countries. Therefore, next
generation of the treatments for hypertension that can reduce
or halt the use of antihypertensive drugs and reduce long-term
medical expenses would be ideal. Vaccines against viral and
bacterial pathogens have been established, and are widely
used. Recent progress in therapeutic B-cell vaccines toward
producing neutralizing auto-reactive antibodies against important mediators in common adult diseases, such as Alzheimer
disease, obesity, diabetes mellitus, hypertension, and cancer.1
This study focuses on establishing an effective vaccine to treat
hypertension.

genetic therapy

hypertension

vaccine therapy

Research has targeted the components of the reninangiotensin system (RAS), such as renin, Ang I, Ang II, and Ang
II type 1 receptor (AT1R), for the treatment of hypertension.
Unexpectedly, the initial studies encountered the difficulties
in hypertension vaccines against these targets: renin vaccine
caused autoimmune side effects,2 whereas Ang I vaccine did
not affect BP in a clinical trial.3 Vaccination against Ang II
and AT1R successfully reduced BP,4,5 but some problems
remained that inhibited their translation to clinical use, such
as insufficient reduction in BP to warrant clinical usage.6
Recently, clinical trials of DNA vaccines in humans have
been widely conducted. These trials demonstrated DNA vaccines are able to increase antibody titers and mediate therapeutic effects in several diseases.7,8 In phase I clinical trial,
neutralizing antibody responses to West Nile virus were elicited by DNA vaccination.7 A therapeutic cytomegalovirus
DNA vaccine significantly reduced the occurrence and recurrence of cytomegalovirus viremia and improved the time-toevent for viremia episodes when compared with placebo in

Received September 12, 2014; first decision October 3, 2014; revision accepted April 11, 2015.
From the Division of Vascular Medicine and Epigenetics, Osaka University United Graduate School of Child Development, Suita, Osaka, Japan (H.K.,
H.N., M.K.O., M.S., H.K.); Departments of Clinical Gene Therapy (F.N., M.K., T.K., R.M.) and Geriatric Medicine and Nephrology (F.N., H.R.), Osaka
University Graduate School of Medicine, Suita, Osaka, Japan.
The online-only Data Supplement is available with this article at http://hyper.ahajournals.org/lookup/suppl/doi:10.1161/HYPERTENSIONAHA.
114.04534/-/DC1.
Correspondence to Ryuichi Morishita, Division of Clinical Gene Therapy, Osaka University Graduate School of Medicine, 2-2 Yamada-oka, Suita,
Osaka 565-0871, Japan, E-mail morishita@cgt.med.osaka-u.ac.jp or Hironori Nakagami, Division of Vascular Medicine and Epigenetics, Osaka University
United Graduate School of Child Development, 2-1 Yamada-oka, Suita, Osaka 565-0871, Japan, E-mail nakagami@gts.med.osaka-u.ac.jp
2015 American Heart Association, Inc.
Hypertension is available at http://hyper.ahajournals.org

DOI: 10.1161/HYPERTENSIONAHA.114.04534

Downloaded from http://hyper.ahajournals.org/

by guest on September 8, 2015
167

168HypertensionJuly 2015
phase II clinical trial.8 In this study, we used DNA vaccine
technology to treat hypertension because we hypothesized
that it would be superior to peptide vaccine in the maintenance of target antigen expression and long-lasting immunologic effects. Here, we demonstrated the development of DNA
vaccine that reduced BP for 6 months by targeting Ang II
fusion with hepatitis B core (HBc) protein administered via
the needleless jet injector in a rat model of hypertension.

Anti-BSA
Anti-AngII
Preimmune
Antisera
(4weeks)

Methods

Methods are available in the online-only Data Supplement.

OD (450 nm)

1.0

Construction of DNA Vectors

Evaluation of Ang II DNA Vaccine in SHR

To examine antibody production by plasmacytes, we measured
the amounts of anti-Ang II antibodies produced in response to
vaccination with pcDNA3.1-HBc-Ang II or pcDNA3.1-HBc.
Because Ang II is an 8-amino-acid peptide and too small to
be detected by Western blot, a BSA-Ang II conjugate was
constructed with several (an average of 5) Ang II molecules
conjugated to 1 BSA molecule at its N terminus. As shown in
Figure1A, sera from pcDNA3.1-HBc-Ang IIimmunized rats
bound the BSA-Ang II conjugate, but not BSA. Preimmune
sera did not bind to either the BSA-Ang II conjugate or BSA.
These results indicated that anti-Ang II antibody was successfully produced by immunization.

1.4
1.2

Results

0.8

HBc-AngII

0.6

HBc

0.4

Saline

0.2
0.0
0
2
4
8
16
20
24
Time after the first immunization (weeks)

1.4
1.2

HBc-AngII
HBc

1.0
OD (450 nm)

We selected Ang II as a target antigen to reduce BP in spontaneously hypertensive rats (SHRs), expecting that immunization against Ang II would minimize the inflammatory action
of immune complexes because of the extremely low concentration of circulating Ang II. In addition, as Ang II receptor
blockers are known to cause few severe adverse effects in
clinical practice, we hypothesized that targeting a peptide in
this pathway would have the similar safety profile with little
side effects. To break the immunologic tolerance to Ang II,
we constructed an HBc-Ang II fusion protein plasmid vector;
the immunization of the fusion protein of HBc with any target
peptide can produce high titers of antibody against the target
peptide because of the highly immunogenic nature of the HBc
protein.
Plasmids pcDNA3.1-HBc (control) and pcDNA3.1-HBcAng II containing an immunostimulatory sequence were both
constructed (Figure S1A and S1B in the online-only Data
Supplement), and transfected into HeLa cells. We analyzed
the HBc-Ang II recombinant protein (Figure S1C) synthesized
in cells by performing Western blots on whole cell protein
lysates (Figure S2). One band 24 kDa in size was detected
in the cell lysate of pcDNA3.1-HBc-Ang II-transfected HeLa
cells by probing the immunoblot with anti-Ang II antibody;
this band was also visible in the cell lysates of pcDNA3.1HBc-Ang II- and pcDNA3.1-HBc-transfected HeLa cells
when probing the immunoblot with anti-HBc antibody. These
results indicated that the transcription and translation of the
pcDNA3.1-HBc-Ang II plasmid in HeLa cells produced the
desired target protein.

BSA
BSA-AngII

Saline

0.8
0.6
0.4

0.2
0.0
Ang II

Ang I

Ang 1-7

Ang-N

Figure 1. Anti-angiotensin II (Ang II) antibody was produced

and sustained for 6 months in the hepatitis B core (HBc)-Ang
II group. A, Specificity of anti-Ang II antibodies as determined
by Western blot analysis. Lane 1, BSA; and lane 2, BSA-Ang
II conjugate. B, Anti-Ang II antibodies in rats were assayed by
ELISA. White bar, saline group (n=4); gray bar, HBc group (n=5);
and black bar, HBc-Ang II group (n=5). C, Specificity of antisera.
OD indicates optical density.

We subsequently immunized SHR with either pcDNA3.1HBc-Ang II, pcDNA3.1-HBc or saline by intradermal administration 3 at 2-week intervals. Anti-Ang II antibodies were
detected only in the pcDNA3.1-HBc-Ang IIimmunized
group when compared with inoculation with pcDNA3.1-HBc
or saline. ELISA detected antibodies as early as 2 weeks after
the first administration that lasted for at least 24 weeks until
the last sampling of blood (Figure1B). The production of antiAng II and anti-Ang I antibodies significantly increased after
immunization, whereas the production of anti-Angiotensinogen (Ang-N) and anti-Ang17 antibodies did not significantly
increase (Figure1C). These results indicated that the immunization was specific to Ang I and Ang II.
To confirm the efficacy of vaccination, BP levels were
measured in SHRs by the tail-cuff method. Systolic blood
pressure (SBP) in pcDNA3.1-HBc-Ang IIimmunized rats
was significantly lower when compared with the pcDNA3.1HBc- and saline-immunized groups at 8, 12, 16, 20, and 24

Downloaded from http://hyper.ahajournals.org/ by guest on September 8, 2015

Koriyama et al Angiotensin II DNA Vaccine for Hypertension in Rats 169

Systolic blood pressure (mmHg)

230

220
210
200

190

**

180

*
HBc-AngII

170

HBc

160

Saline

150
0

10

15

20

25

30

Time after the first immunization (weeks)

r = -0.704, P < 0.01

3
OD (450nm)

2
1
0
150

170

190

210

SBP (mmHg)

Immunoreactive
plasma angiotensin II
concentration (pg/ml)

100

p < 0.001

80
60
40
20
0
HBc-AngII

HBc, Saline

Figure 2. Systolic blood pressure (SBP) and plasma angiotensin

II (Ang II) concentration were both reduced by hepatitis B core
(HBc)-Ang II vaccination. A, The effect of vaccination on SBP
in spontaneously hypertensive rats. Data are presented as the
average of each group; error bars indicate the SEM. *P<0.05 vs
HBc and saline groups. **P<0.01 vs HBc group and P<0.05 vs
saline group. , HBc-Ang II group (n=5); , HBc-group (n=5); and
, saline group (n=4). B, Correlation between SBP (mmHg) and
antibody response against Ang II (optical density [OD] at 450 nm)
in HBc-Ang IIimmunized rats. C, Ang II levels in the plasma of
vaccinated rats. Ang II was extracted from plasma sampled 12
weeks after the first immunization of vaccinated rats. Horizontal
bars indicate the averages of the groups; the symbols indicate
individual values.

weeks after the first immunization (Figure2A). As shown

in Figure2B, a significant inverse correlation was observed
between anti-Ang II antibody response and BP (r=0.704;
P<0.01). No significant differences in heart rate were detected
between any treatment groups (data not shown). It is noteworthy that a significant decrease in plasma Ang II concentration
was observed in the pcDNA3.1-HBc-Ang II group (30 pg/
mL, P<0.001) when compared with the pcDNA3.1-HBc and
saline groups (Figure2C). Then, we measured plasma renin
activity, plasma Ang I concentration, and daily urinary excretion of aldosterone. As a result, plasma renin activity tends
to rise in the HBc-Ang II group (Figure S3A). These results

indicate that blockade of Ang II signal by Ang II vaccine may

induce the feedback system to increase the renin/angiotensin
production. Interestingly, plasma Ang I did not change by
Ang II vaccine (Figure S3B). These results also support that
Ang II vaccine mainly neutralizes Ang II in our system. Daily
urinary excretion of aldosterone was significantly decreased
in the HBc-Ang II group (Figure S3C). These results suggest
that the downstream pathway of Ang II in RAS is repressed
by Ang II vaccine.
To examine the effect of HBc-Ang II vaccine on normotensive rats, WKY rats were vaccinated 3 with pcDNA3.1-HBcAng II at 2-week intervals, and SBP was measured at 6 weeks
after the first immunization. As shown in Figure S4, SBP of
WKY rats was not significantly affected by vaccination. We
think that this is because homeostatic control of BP is regulated by not only RAS but also catecholamine, vasopressin, or
the autonomic nervous system.
To investigate whether the decrease in BP is the primary
result of increase Ang-(1-7)-mas axis activation with simultaneous Ang II-AT1R suppression, we conducted the additional
experiments to examine whether the administration of A779
or Olmesartan would affect SBP in the immunized rats. As
shown in Figure S5, administration of A779 (0.8 mg/kg per day
IP) for 7 days did not significantly change SBP in HBc-Ang
IIimmunized rats, and oral administration of Olmesartan (3
mg/kg per day) for 7 days did not decrease SBP in HBc-Ang
IIimmunized rats. Both HBc-Ang II group and Olmesartan
group decreased SBP to the same degree in SHR rats.
Because SHRs exhibited severe organ damage such as fibrosis in various organs, including the kidney and heart because
of high BP and Ang II concentration, we examined hearts and
aortas from SHRs at 24 weeks after immunization for pathological changes. Severe perivascular fibrosis was detected
in hearts from SHRs treated with saline or pcDNA3.1-HBc
using Masson trichrome staining, whereas fibrosis was significantly reduced in SHRs treated with pcDNA3.1-HBc-Ang
II (Figure3A and 3B). At 24 weeks after the first immunization, the area of aortic media in the HBc-Ang II group was
significantly reduced than that in the HBc and saline groups
(Figure3C and 3D). In contrast, we confirmed the safety of
the Ang II DNA vaccine by histochemical analysis of the kidney, heart, liver, and aorta, all of which showed no evidence of
pathological changes and T cell or macrophage infiltrations at
24 weeks after immunization (Figures S6 and S7).
To evaluate long-term safety and efficacy of this vaccine,
we compared survival rates between HBc-Ang II group
and control groups. Because it is reported that disruption
of the Ang II type1 receptor promotes longevity in mice,9
we reimmunized SHR with either pcDNA3.1-HBc-Ang II,
pcNDA3.1-HBc, or saline at 24 weeks after first immunization, as a booster effect (Figure4A). As shown in Figure4B,
the survival rate was significantly improved in the HBc-Ang
II group (log rank P<0.05). The serum from the rat that lived
longest in HBc-Ang II group showed the highest anti-Ang II
antibody response measured by ELISA at 48 weeks after first
immunization (data not shown). We also sampled pleural effusion from the rat that lived longest on the date of death. The
sampled effusion showed high anti-Ang II antibody response
by ELISA (data not shown). These results demonstrated that

Downloaded from http://hyper.ahajournals.org/ by guest on September 8, 2015

170HypertensionJuly 2015
A

saline

HBc

HBc-AngII

Heart MTS

25000

40000

10000

20000
10000

5000
0

0
Saline

30000

15000

Area (Pixel)

Area (Pixel)

20000

HBc

HBc-AngII

saline

HBc

HBc, saline HBc-AngII

HBc-AngII

Aorta EVG stain

Figure 3. Perivascular fibrosis of the heart was significantly reduced in the hepatitis B core (HBc)-angiotensin II (Ang II) group. A,
Photomicrographs of sections of hearts from spontaneously hypertensive rats (SHRs) from the saline, HBc-Ang II and HBc groups,
stained by the Masson trichrome (MT) technique. Scale bar, 100 m. B, Quantitation of the fibrotic area. *P<0.01 vs the HBc-Ang II group.
n=6 per group. C, Photomicrographs of sections of aortas from SHRs from saline, HBc-Ang II and HBc groups, stained by the Elastica
van Gieson (EVG) technique. Scale bar, 500 m. D, Quantitation of the medial (arrow heads) area. *P<0.05 vs the HBc-Ang II group. n=3
per group.

anti-Ang II antibody production could be sustained >1 year

after the last vaccination.

Evaluation of T-cell Activation After Immunization

Our hypothesized mechanism of action for Ang IItargeted
vaccine therapy is illustrated conceptually in Figure S8. We
immunized mice by introducing HBc-Ang II as an antigen.
During immunization, antigen-presenting cells phagocytose
the HBc-Ang II fusion protein and present T-cell epitopes of
this antigen on their major histocompatibility complexes. T
cells bind their cognate epitopes through their T-cell receptors, activating and differentiating into effector T cells (step 1,
shown as 1 in Figure S8). B cells that have a B-cell receptor
specific for Ang II also phagocytose HBc-Ang II and present
corresponding T-cell epitopes of HBc-Ang II on major histocompatibility complex toward T cells. These B cells then

differentiate to plasmacytes and produce antibodies with the

help of activated effector T cells (step 2, shown as 2 in Figure
S8). These steps are required for the efficient production of
antibodies.
To examine the initial immunization step, the activation of T
cells was evaluated by measuring their cytokine production in
rats immunized by pcDNA3.1-HBc or pcDNA3.1-HBc-Ang
II. Splenocytes from rats immunized with either pcDNA3.1HBc-Ang II or pcDNA3.1-HBc produced interferons (IFN)-
and interleukin (IL)-2 (T-helper type 1 cytokines) when
stimulated in vitro with recombinant HBc protein (Figure5A
and 5B), but did not produce IL-10 or IL-4 (Th2 cytokines)
after exposure to the same stimuli (Figure5C and 5D). These
data indicated that HBc-Ang II and HBc contain sufficiently
immunogenic T-cell epitopes to activate T cells. None of the
pcDNA3.1-HBc-Ang IIimmunized rats produced cytokines

Downloaded from http://hyper.ahajournals.org/ by guest on September 8, 2015

Koriyama et al Angiotensin II DNA Vaccine for Hypertension in Rats 171

A
0

10

20

30

40

Immunization

50

70

Post Immunization (weeks)

1.0
0.9

HBc-AngII
(n = 6)
HBc + Saline (n = 6 + 2)

0.8

Survival rate

60

0.7
0.6

P < 0.05

0.5
0.4
0.3
0.2
0.1
0.0
60

65

70

75

80

85

90

95

100

Age (weeks)

Figure 4. The survival time was significantly prolonged in the

hepatitis B core (HBc)-angiotensin II (Ang II) group. A, Time
course of DNA vaccination. Arrows indicate vaccination with
either pcDNA3.1-HBc-Ang II (n=6), pcNDA3.1-HBc (n=6), or
saline (n=2) at 0, 2, 4, and 24 weeks after first immunization.
Vaccination was started at 6 weeks of age of rats. B, Kaplan
Meier curve of time to survival rate, log rank P<0.05 between
HBc-Ang II group and nonimmunization group (HBc and saline).

when stimulated in vitro with either Ang II or Ang-N, indicating that Ang II does not contain the immunogenic T-cell epitope. ELISPOT assays for IFN- and IL-2 were also performed
(Figure5E and 5F), and responses against recombinant HBc
protein were detected in pcDNA3.1-HBc-Ang IIimmunized
rats and pcDNA3.1-HBcimmunized rats; in contrast,
responses against Ang II or Ang-N were not detected.

Discussion
In this study, we demonstrated that DNA vaccine against Ang
II successfully reduced high BP in SHRs, suggesting that it
might be a novel therapy to treat hypertension. BP was continuously decreased for at least 6 months after 3-dose immunization regimen. The long-term BP reduction observed in
this study might be because of the prolonged high-level production of antibodies against Ang II and Ang I by DNA vaccine. Previous reports using the peptide vaccine against Ang
II exhibited 9.0/4.0 mmHg reduction in mean ambulatory
daytime BP from baseline at week 14 in a multicenter, doubleblind, randomized, placebo-controlled phase IIa trial enrolling
72 patients with mild-to-moderate hypertension.10 However,
peptide immunization also seemed to exhibit several limitations, including (1) relatively long BP reduction that was not
sustained to 1 year, and (2) potential side effects, such as
transient, influenza-like symptoms. In the preclinical study,5 a
transient reduction in BP by the peptide vaccine against Ang II
was observed, but this reduction was not sustained 6 months
different from this study using DNA vaccine. Therefore,
DNA vaccine might be superior in sustaining the effects of
vaccination.
The contrasting maintenance of efficacy begets the question: Why is Ang II DNA vaccine superior to the peptide
vaccine to reduce BP? One potential reason might be that
both anti-Ang II and anti-Ang I antibodies were produced
by Ang II DNA vaccine. The production of both anti-Ang I

and anti-Ang II antibodies by DNA vaccine would synergistically act to decrease BP in SHRs. Because tissue Ang II is
known to accelerate fibrosis, this study successfully demonstrated a significant decrease in cardiac perivascular fibrosis in
the HBc-Ang IItreated group. Considering that aldosterone
breakthrough is known to accelerate fibrosis,11 a significant
decrease in circulating Ang II might be even more beneficial
for the prevention of fibrosis.
In contrast, anti-Ang17 antibody was not produced for an
unidentified reason. Presumably, the phenylalanine residue in
Ang II that is absent in Ang17 may be important as a B-cell
epitope (Figure1C). The axis formed by angiotensin-converting enzyme 2/Ang-(17)/Mas represents an endogenous
counter-regulatory pathway within the RAS whose actions
oppose the vasoconstrictor/proliferative arm of the RAS
that is composed of angiotensin-converting enzyme/Ang II/
AT1R.12 The HBc-Ang II DNA vaccine used here is expected
to restrain the RAS effectively without inhibiting the action
of Ang17 because of the lack of anti-Ang17 antibody. In
fact, administration of A779 did not significantly change SBP
in HBc-Ang IIimmunized rats (Figure S5). These results
indicate that the decrease in BP is the primary result of Ang
II-AT1R suppression.
To enhance the therapeutic efficacy of DNA vaccines for
the treatment of hypertension, we used the HBc-Ang II fusion
antigen to produce antibody for a more sustained period of
time. Because HBc self-aggregates into a sphere, Ang II
sequence inserted into the B-cell epitope (aa80-81) of HBc
is presented on the surface of the sphere, and is recognized
by the immune system as a repetitive epitope. In addition
to the capacity of the HBc carrier moiety to provide T cell
help to inserted sequences, the HBc capsid mediates T-cell
independent humoral response to inserted epitopes because of
the high degree of repetitiveness of the epitopes and their spacing.13 The anti-HBc antibody is also known to last longer than
the anti-HBs antibody in humans after infection by HB virus.
These characteristics of DNA vaccine using the HBc system
would contribute to the maintenance of antibody production.
Virus-like particles are highly organized spheres that selfassemble from virus-derived structural antigens. These stable,
versatile subviral particles possess excellent adjuvant properties and are capable of inducing both innate and cognate
immune responses.14 The structural components of some viruslike particles have proven amenable to the insertion or fusion
of foreign antigenic sequences, allowing for the production
of chimeric virus-like particles that expose the foreign antigen on their surface.15 Among virus-like particles, those based
on the HBc protein have been studied intensively and used
in previous clinical trials.1619 It is widely accepted that the
HBc carrier is capable of eliciting high levels of B- and T-cell
immunogenicity to foreign epitopes.16 HBc particles can present on their spherical surface any peptide inserted between
A80-S81, which are located within the major immunodominant region.20
The injection system used for delivery is also important
in vaccine efficacy. Because the chosen method and route of
administration could play key roles in the magnitude and quality of the resultant immune response, DNA vaccines require
an appropriate delivery technology. Dermal delivery will elicit

Downloaded from http://hyper.ahajournals.org/ by guest on September 8, 2015

172HypertensionJuly 2015
A

Figure 5. Splenocytes from hepatitis B core (HBc)-angiotensin II (Ang II)immunized rats exhibit a T-helper type 1 response against
HBc, but not against Ang II or angiotensinogen. AD, Cytokine levels produced by splenocytes cultured after stimulation with 50 g/mL
phytohemagglutinin (PHA), 3 g/mL recombinant HBc, 10 g/mL Ang II or 10 g/mL angiotensinogen (Ang-N). (-), no stimulation. Levels
of interferons (IFN)- (A), interleukin (IL)-2 (B), IL-10 (C), and IL-4 (D) were determined by ELISA on cell culture supernatants. E and F,
Cytokine (IFN- [E] and IL-2 [F])-producing cells were quantified by ELISPOT assays on splenocytes stimulated ex vivo with 50 g/mL
PHA, 3 g/mL HBc, 10 g/mL Ang II, or 10 g/mL Ang-N. The results are expressed as the meanSEM of the numbers of cytokine (IFN-
[E] and IL-2 [F])-producing cells/106 splenocytes. HBc-Ang II group, n=3; HBc group, n=3; and Saline group, n=3.

a humoral response with the production of IgA and IgG1,

whereas intramuscular injection will prime a cellular response
with the activation of cytotoxic T lymphocytes and the production of IgG2a.21 Traditionally, percutaneous injection has
been a popular approach for vaccination owing to its accessibility, size, and cell population consisting of Langerhans
cells, antigen-presenting cells, and migrating lymphocytes.
Although there are several methods to deliver DNA vaccines,
such as gene gun, electroporation, and liposomes, we chose the
needleless jet injection system. This method was reported to
be highly effective at gene transfection of naked plasmid DNA
to the skin in rats at levels similar to those in viral vector systems.22 Indeed, our previous study demonstrated that local gene
expression was 100 higher by the spring-powered jet injector, Shima Jet, when compared with delivery by needle alone.23
When considering the clinical application of immunotherapy for hypertension, the safety of the vaccine is extremely
important. For example, a clinical trial of an amyloid vaccine for Alzheimer disease was halted because of a severe
adverse event.24,25 Therefore, a vaccine against self-antigen
requires an adequate and reversible humoral immune response
from B cells while avoiding the activation of self-reactive T
cells. In this study, the splenocytes in the HBc-Ang II group
stimulated with HBc produced T-helper type 1 cytokines, such

as IFN- and IL-2. In the ELISPOT assay, the production of

IFN- and IL-2 by splenocytes stimulated with HBc was also
observed. However, Th2 cytokines, such as IL-10 and IL-4
were scarcely produced.
These outcomes indicate that these immunization conditions established a T-helper type 1dominant immune
response, a result that is in agreement with other studies on
DNA vaccines. However, the stimulation of splenocytes in
the HBc-Ang II group with Ang II or Ang-N did not lead to
the secretion of any cytokines (IFN-, IL-2, IL-10, or IL-4)
detected by ELISA or ELISPOT assay. These results demonstrated that immunization by pcDNA3.1-HBc-Ang II did not
establish T-cell immune responses against Ang II or Ang-N.
Generally, antibody production requires helper T-cell activation to assist the expansion of B cells; therefore, antigens
generally contain B- and T-cell epitopes. However, the derivation of the sequence to activate T cells (the T cell-epitope)
and to activate B cells (the B-cell epitope) may be different,
similar to the relationship between hapten and carrier, where
the former has the only B-cell epitope and the latter possesses the T-cell epitope. In this scenario, the antigen composed of selfB-cell epitope and non-self T-cell epitope could
potentially induce antiself antibody without inducing antiself
T-cell activation.

Downloaded from http://hyper.ahajournals.org/ by guest on September 8, 2015

Koriyama et al Angiotensin II DNA Vaccine for Hypertension in Rats 173

In this study, we used HBc as a carrier with several non-self
helper T-cell epitopes and succeeded in producing antibody
against Ang II without T-cell activation toward Ang II or AngN. Indeed, no cytokine was secreted in ELISA or ELISPOT
assay, and no pathological symptoms were discovered in the
kidney, liver, or heart. Ang II is assumed not to be a highly
responsive cytotoxic T lymphocyte epitope in SHRs. Overall,
our results revealed that (1) Ang II did not act as a T-cell epitope, (2) T cells were activated by a T-cell epitope in HBc but
not Ang II, and (3) helper T-cell activation by HBc-Ang II was
predominantly skewed toward a T-helper type 1 phenotype.
Theoretically, DNA vaccines raise fewer safety concerns because they can induce both long-lasting cellular and
humoral immune responses, but do not revert to virulence.
Many clinical trials with DNA vaccines have observed lower
incidences of systemic adverse effects, such as redness, transient pain, swelling, fever, and headache in >3000 patients.26
The fact that survival time was extended in the HBc-Ang II
group may also be considered as a strong support for high
safety of this vaccine.

Perspectives
Here, we reported on the first DNA vaccine against hypertension using HBc. DNA vaccination against Ang II in SHRs produced anti-Ang II antibodies and lowered SBP for 6 months
postvaccination without any apparent side effects. Although
there are no US Food and Drug Administration-approved
DNA vaccines for use in humans, this study presents the newest vaccine platform currently under development. Further
research on this DNA vaccine platform, including increase
the longevity of BP reduction, may eventually provide a new
therapeutic option to treat hypertensive patients.

Acknowledgments
We express our gratitude to Hizuki Hamada, Satoe Kitabata, and Yoko
Horiguchi for their continuous support of all of our investigations.

Sources of Funding
This work was partly supported by a Grant-in-Aid for Scientific
Research from Japan Society for the Promotion of Science, the
Adaptive and Seamless Technology Transfer Program (A-step) by
the Japan Science and Technology Agency, and The Osaka Medical
Research Foundation for Intractable Diseases.

Disclosures
The Department of Clinical Gene Therapy was financially supported
by Daiichi-Sankyo, AnGes MG, Novartis, Shionogi, Boeringher, and
Rohto. The Division of Vascular Medicine and Epigenetics was financially supported by Bayel. R. Morishita is a founder and stock
holder of AnGes MG, and was a board member. The other authors
report no conflicts.

References
1. Rhn TA, Bachmann MF. Vaccines against non-communicable diseases.
Curr Opin Immunol. 2010;22:391396. doi: 10.1016/j.coi.2010.02.009.
2. Michel JB, Guettier C, Philippe M, Galen FX, Corvol P, Mnard J. Active
immunization against renin in normotensive marmoset. Proc Natl Acad
Sci U S A. 1987;84:43464350.
3. Brown MJ, Coltart J, Gunewardena K, Ritter JM, Auton TR, Glover JF.
Randomized double-blind placebo-controlled study of an angiotensin
immunotherapeutic vaccine (PMD3117) in hypertensive subjects. Clin
Sci (Lond). 2004;107:167173. doi: 10.1042/CS20030381.

4. Zhu F, Liao YH, Li LD, Cheng M, Wei F, Wei YM, Wang M. Target organ
protection from a novel angiotensin II receptor (AT1) vaccine ATR12181
in spontaneously hypertensive rats. Cell Mol Immunol. 2006;3:107114.
5. Ambhl PM, Tissot AC, Fulurija A, et al. A vaccine for hypertension
based on virus-like particles: preclinical efficacy and phase I safety
and immunogenicity. J Hypertens. 2007;25:6372. doi: 10.1097/
HJH.0b013e32800ff5d6.
6. Do TH, Chen Y, Nguyen VT, Phisitkul S. Vaccines in the management
of hypertension. Expert Opin Biol Ther. 2010;10:10771087. doi:
10.1517/14712598.2010.487060.
7. Ledgerwood JE, Pierson TC, Hubka SA, et al; VRC 303 Study Team. A
West Nile virus DNA vaccine utilizing a modified promoter induces neutralizing antibody in younger and older healthy adults in a phase I clinical
trial. J Infect Dis. 2011;203:13961404. doi: 10.1093/infdis/jir054.
8. Kharfan-Dabaja MA, Boeckh M, Wilck MB, Langston AA, Chu AH,
Wloch MK, Guterwill DF, Smith LR, Rolland AP, Kenney RT. A novel
therapeutic cytomegalovirus DNA vaccine in allogeneic haemopoietic
stem-cell transplantation: a randomised, double-blind, placebo-controlled, phase 2 trial. Lancet Infect Dis. 2012;12:290299. doi: 10.1016/
S1473-3099(11)70344-9.
9. Benigni A, Corna D, Zoja C, Sonzogni A, Latini R, Salio M, Conti S,
Rottoli D, Longaretti L, Cassis P, Morigi M, Coffman TM, Remuzzi G.
Disruption of the Ang II type 1 receptor promotes longevity in mice. J
Clin Invest. 2009;119:524530. doi: 10.1172/JCI36703.
10. Tissot AC, Maurer P, Nussberger J, Sabat R, Pfister T, Ignatenko S, Volk
HD, Stocker H, Mller P, Jennings GT, Wagner F, Bachmann MF. Effect of
immunisation against angiotensin II with CYT006-AngQb on ambulatory
blood pressure: a double-blind, randomised, placebo-controlled phase IIa
study. Lancet. 2008;371:821827. doi: 10.1016/S0140-6736(08)60381-5.
11. Tanabe A, Naruse M, Hara Y, Sato A, Tsuchiya K, Nishikawa T, Imaki
T, Takano K. Aldosterone antagonist facilitates the cardioprotective
effects of angiotensin receptor blockers in hypertensive rats. J Hypertens.
2004;22:10171023.
12. Ferreira AJ, Mura TM, Fraga-Silva RA, Castro CH, Raizada MK, Santos
RA. New cardiovascular and pulmonary therapeutic strategies based on
the Angiotensin-converting enzyme 2/angiotensin-(1-7)/mas receptor
axis. Int J Hypertens. 2012;2012:147825. doi: 10.1155/2012/147825.
13. Fehr T, Skrastina D, Pumpens P, Zinkernagel RM. T cell-independent type
I antibody response against B cell epitopes expressed repetitively on recombinant virus particles. Proc Natl Acad Sci U S A. 1998;95:94779481.

14. Ludwig C, Wagner R. Virus-like particles-universal molecular toolboxes. Curr Opin Biotechnol. 2007;18:537545. doi: 10.1016/j.
copbio.2007.10.013.
15. Grgacic EV, Anderson DA. Virus-like particles: passport to immune recognition. Methods. 2006;40:6065. doi: 10.1016/j.ymeth.2006.07.018.
16. Pumpens P, Grens E. HBV core particles as a carrier for B cell/T cell
epitopes. Intervirology. 2001;44:98114.
17. Nardin EH, Oliveira GA, Calvo-Calle JM, Wetzel K, Maier C, Birkett
AJ, Sarpotdar P, Corado ML, Thornton GB, Schmidt A. Phase I testing
of a malaria vaccine composed of hepatitis B virus core particles expressing Plasmodium falciparum circumsporozoite epitopes. Infect Immun.
2004;72:65196527. doi: 10.1128/IAI.72.11.6519-6527.2004.
18. Oliveira GA, Wetzel K, Calvo-Calle JM, Nussenzweig R, Schmidt A,
Birkett A, Dubovsky F, Tierney E, Gleiter CH, Boehmer G, Luty AJ,
Ramharter M, Thornton GB, Kremsner PG, Nardin EH. Safety and
enhanced immunogenicity of a hepatitis B core particle Plasmodium
falciparum malaria vaccine formulated in adjuvant Montanide ISA
720 in a phase I trial. Infect Immun. 2005;73:35873597. doi: 10.1128/
IAI.73.6.3587-3597.2005.
19. Gregson AL, Oliveira G, Othoro C, Calvo-Calle JM, Thorton GB, Nardin
E, Edelman R. Phase I trial of an alhydrogel adjuvanted hepatitis B core
virus-like particle containing epitopes of Plasmodium falciparum circumsporozoite protein. PLoS One. 2008;3:e1556. doi: 10.1371/journal.
pone.0001556.
20. Xing YP, Huang ZH, Wang SX, Cai J, Li J, Chou TH, Lu S. Novel DNA
vaccine based on hepatitis B virus core gene induces specific immune
responses in Balb/c mice. World J Gastroenterol. 2005;11:45834586.
21. Shedlock DJ, Weiner DB. DNA vaccination: antigen presentation and the
induction of immunity. J Leukoc Biol. 2000;68:793806.
22. Sawamura D, Ina S, Itai K, Meng X, Kon A, Tamai K, Hanada K,
Hashimoto I. In vivo gene introduction into keratinocytes using jet injection. Gene Ther. 1999;6:17851787. doi: 10.1038/sj.gt.3301002.
23. Kunugiza Y, Tomita N, Taniyama Y, Tomita T, Osako MK, Tamai K,
Tanabe T, Kaneda Y, Yoshikawa H, Morishita R. Acceleration of wound
healing by combined gene transfer of hepatocyte growth factor and

Downloaded from http://hyper.ahajournals.org/ by guest on September 8, 2015

174HypertensionJuly 2015
prostacyclin synthase with Shima Jet. Gene Ther. 2006;13:11431152.
doi: 10.1038/sj.gt.3302767.
24. Schenk D. Amyloid-beta immunotherapy for Alzheimers disease: the
end of the beginning. Nat Rev Neurosci. 2002;3:824828. doi: 10.1038/
nrn938.
25. Orgogozo JM, Gilman S, Dartigues JF, Laurent B, Puel M, Kirby LC,
Jouanny P, Dubois B, Eisner L, Flitman S, Michel BF, Boada M, Frank

A, Hock C. Subacute meningoencephalitis in a subset of patients with AD

after Abeta42 immunization. Neurology. 2003;61:4654.
26. Cattamanchi A, Posavad CM, Wald A, Baine Y, Moses J, Higgins TJ,
Ginsberg R, Ciccarelli R, Corey L, Koelle DM. Phase I study of a herpes simplex virus type 2 (HSV-2) DNA vaccine administered to healthy,
HSV-2-seronegative adults by a needle-free injection system. Clin Vaccine
Immunol. 2008;15:16381643. doi: 10.1128/CVI.00167-08.

Novelty and Significance

What Is New?

Antihypertensive drugs are well known to effectively lower high blood

pressure, however, next-generation treatment for hypertension might be
ideal, leading to the reduction in medical expenses. Vaccine has been
recently developed to different pathologies to target self-antigen, such as
Alzheimer disease. In this study, we succeeded to evaluate the efficiency
and safety of the angiotensin II (Ang II) DNA vaccine for hypertensive rat.

What Is Relevant?

Plasmid vector encoding hepatitis B core-Ang II fusion protein was in-

anti-Ang II antibody was successfully produced in hepatitis B core-Ang

II group and sustained at least 6 months. Consistently, SBP was lower
in hepatitis B core-Ang II group after the immunization, and BP reduction
was continued at least 6 months.

Summary
Our findings proposed that future development of DNA vaccine to
hypertension might provide new therapeutic option to treat hypertensive population.

jected to hypertensive rat by needle less injection system. As a result,

Downloaded from http://hyper.ahajournals.org/ by guest on September 8, 2015

Manuscript Number HYPE201404534R3

Online Supplement for

Long-Term Reduction of High Blood Pressure

by Angiotensin II DNA Vaccine in Spontaneously Hypertensive Rats

Hiroshi Koriyama M.D., Ph.D a, Hironori Nakagami M.D., Ph.D a,1, Futoshi Nakagami,
M.D., Ph.D b,c, Mariana Kiomy Osako, Ph.D a, Mariko Kyutoku, Ph.D b, Munehisa
Shimamura M.D., Ph.D a, Hitomi Kurinami M.D., Ph.D a, Tomohiro Katsuya M.D.,
Ph.D b, Hiromi Rakugi M.D., Ph.D c, and Ryuichi Morishita M.D., Ph.D c,1

Division of Vascular Medicine and Epigenetics, Osaka University United Graduate

School of Child Development. 2-1 Yamada-oka, Suita, Osaka, 565-0871, Japan
b

Department of Clinical Gene Therapy, Osaka University Graduate School of Medicine.

2-2 Yamada-oka, Suita, Osaka, 565-0871, Japan
c

Department of Geriatric Medicine and Nephrology, Osaka University Graduate School

of Medicine. 2-2 Yamada-oka, Suita, Osaka, 565-0871, Japan

1

Address correspondence to:

Ryuichi Morishita, M.D., Ph.D. Professor, Division of Clinical Gene Therapy, Osaka
University Graduate School of Medicine, 2-2 Yamada-oka, Suita, Osaka, 565-0871,
Japan. Tel: +81-6-6879-3406, Fax: +81-6-6879-3409, E-mail:
morishita@cgt.med.osaka-u.ac.jp
and
Hironori Nakagami, M.D., Ph.D. Professor, Division of Vascular Medicine and
Epigenetics, Osaka University United Graduate School of Child Development, 2-1
Yamada-oka, Suita, Osaka, 565-0871, Japan. Tel: +81-6-6879-4142, Fax: +81-6-68794142 E-mail: nakagami@gts.med.osaka-u.ac.jp

Methods
Reagents
Anti-Ang II antibody, anti-Ang I antibody, anti-Ang1-7 antibody, anti-Ang-N antibody,
and anti-BSA antibody were purchased from Abcam. Anti- actin antibody was
purchased from Sigma-Aldrich. Olmesartan was purchased from Daiichi-Sankyo (Tokyo,
Japan.).

Vaccine synthesis
The HBc gene was obtained by PCR from the plasmid pPLc3 (BCCMTM/LMBP,
Plasmid Collection, University of Ghent, Belgium). To construct pcDNA3.1-HBc, the
HBc
sequence
was
amplified
by
PCR
using
HBcF
(5gccatggatatcgatccttataaagaattcggagc-3)
and
HBcR
(5ggcctctcactaacattgagattcccgagattgaga-3) as forward and reverse primers, respectively.
The amplified fragment was inserted into the pcDNA3.1/V5-His-TOPO vector
(Invitrogen) by TA cloning according to the manufacturers protocol.
To construct pcDNA3.1-HBc-AngII, PCR was performed three times. First, the 5 half
of the HBc ORF was amplified by PCR using HBcF and H2 (5ggggtggatgtatacgcggtcagtgatagctggatcttccaagttaac-3) primers. Second, the 3 half of the
HBc
ORF
was
amplified
by
PCR
using
H3
(5ccgcgtatacatccacccctttggtgctactagcagggacctggtagtc-3) and HBcR primers. Primer H2
contains the sequence of the spacer Ile-Thr dipeptide and the N-terminal half of Ang II.
Primer H3 contains the sequence of the C-terminal half of Ang II and the tripeptide spacer
Gly-Ala-Thr. Using these two amplified fragments as templates, a third PCR was
performed using primers HBcF and HBcR. The final amplified fragment contained the
Ang II sequence within the immunodominant region (aa 80-81) of HBc; this fragment
was inserted into the pcDNA3.1/V5-His-TOPO vector by TA cloning.
ISS containing four CpG motifs (CpG-A D19, 5-ggtgcatcgatgcagggggg-3; CpG-B
1018, 5-tgactgtgaacgttcgagatga-3; CpG-C C274, 5-tcgtcgaacgttcgagatgat-3 and CpGC C695 5-tcgaacgttcgaacgttcgaacgtt-3) was synthesized by PCR using the following
primers:
CpGF
(5-tttcacgtagtgggtgcatcgatgcagg-3),
CpGR
(5ggtcactacgtgaacgttcgaacgttcg-3)
and
templates:
CpG1
(5ggtgcatcgatgcaggggggtgactgtgaacgttcgagatgatcgtcgaacgttcgagatgattcgaacgttcgaacgttcga
acgtt-3)
and
CpG2
(5aacgttcgaacgttcgaacgttcgaatcatctcgaacgttcgacgatcatctcgaacgttcacagtcacccccctgcatcgatgc

acc-3). The ISS fragment (112 bp) was digested with the restriction endonuclease DraIII
and inserted into the backbone of the pcDNA3.1-HBc-AngII-ISS(-) and pcDNA3.1-HBcISS(-) plasmids.
Each of these constructed vectors was used to transform E. coli TOP10 competent cells
(Invitrogen), and resultant colonies were screened for ampicillin resistance and sequenced
to confirm correct insertions.

Animals and DNA immunization

The experiments were approved by the Ethical Committee for Animal Experiments of
the Osaka University Graduate School of Medicine. Eight-week-old male spontaneously
hypertensive rats (SHRs) were purchased from The Oriental Yeast (Osaka, Japan) and
were housed in a temperature- and light cycle-controlled animal facility with free access
to food and water. These experimental protocols were approved by the Ethical Committee
for animal experiments of the Osaka University Graduate School of Medicine. Rats were
randomly assigned into three groups; each group of rats was anesthetized, and received
DNA immunizations by a needleless injector, the Shima Jet (Shimazu, Japan). The HBcAng II group was vaccinated three times with pcDNA3.1-HBc-AngII, while the HBc
group received pcDNA3.1-HBc and the saline group received saline only, all at 2-week
intervals. Each shot delivered 100 g of DNA, and two shots were delivered to each rat
on shaved back skin at each immunization. Blood samples before immunization and 2, 4,
8, 12, 16, 20 and 24 weeks after the first immunization were collected. Sera were isolated
and stored at -70 C until use.

Measurement of BP and Ang II concentration

Arterial BP was measured at 4, 8, 12, 16, 20 and 24 weeks by the tail-cuff method (BP98A, SOFTRON, Japan). During measurements, the animals were held in a restraining
device. The SBP values are shown as the average of 10 readings for each animal at each
time. Plasma immunoreactive Ang II concentrations , Ang I concentrations, plasma renin
activity, and daily urinary excretion of aldosterone were measured by radioimmunoassay
by an external organization (FALCO Biosystems, Kyoto, Japan). Briefly, plasma Ang II
is measured by competitive ELISA. The protocol is as follows, 1) the ELISA plate is
coated by anti-angiotensin II antibody, 2) add sample plasma(s) to the ELISA plate with
defined radiolabelled angiotensin II, 3) plasma angiotensin II concentration is quantified
by measuring radioactivity bound to plate.

Enzyme-linked immunosorbent assay (ELISA)

Ang II-specific antibody responses were measured by coating ELISA plates with BSAAng II conjugate. Ang II was conjugated with BSA at its N-terminus by suberic acid bis
(PEPTIDE INSTITUTE Inc., Osaka, Japan). BSA-Ang II conjugate was coated onto
ELISA plates at 10 g/ml in carbonate buffer overnight at 4 C. After blocking with 5 %
skim milk solution in phosphate-buffered saline (PBS)/Tween, serum samples from
immunized animals were diluted 1:100 in PBS containing 5 % skim milk and then
incubated for 2 hours on the plate. Detection was performed by goat anti-rat IgG
horseradish peroxidase conjugate (NA935, GE Healthcare, Tokyo, Japan). The specificity
of the signal was confirmed by assaying preimmune serum, which gave the signal
background. The absorbance was read by a microplate reader (Bio-Rad Inc., Japan). AntiAng I and anti-Ang1-7 antibody responses were measured by coating ELISA plates with
BSA-Ang I conjugate and BSA-Ang1-7 conjugate (PEPTIDE INSTITUTE Inc., Osaka,
Japan), respectively. IFN-, IL-2, IL-4, and IL-10 were measured by Quantikine ELISA
kit (R&D systems).

ELISPOT Assay
IFN-- and IL-2-producing T cells were quantified in splenocytes by ex vivo ELISPOT
assay after peptide stimulation for 24 hours. Briefly, sterile 96-well ELISPOT plates
(Millipore, Tokyo, Japan) were coated at 4 C overnight with 50 l mouse IFN- or IL-2
mAb as recommended by the manufacturer (R&D Systems, Tokyo, Japan). After
overnight incubation, wells were blocked with 1.5 % BSA and 5 % sucrose. Freshly
isolated splenocytes from individual immunized rats were seeded in wells (106 cells/well)
and restimulated by 50 g/ml Phytohemaggulutinin (PHA), 3 g/ml recombinant HBc,
10 g/ml Ang II or 10 g/ml Ang-N in RPMI1640 medium. Splenocytes from salineinjected rats and cells in culture medium alone were used as negative controls to
determine background levels. Each cell population was titrated in triplicate. A positive
response was defined as a median number of spot-forming cells (SFCs) in triplicate wells
at least twice that observed in control wells containing medium and at least 50 SFCs per
million splenocytes.

Western Blot Analysis.

BSA and the BSA-AngII conjugate were separated electrophoretically by SDS/PAGE

and blotted onto poly(vinylidene difluoride) membranes (Millipore). The blots were
incubated with sera from rats immunized with the HBc-AngII vaccine, preimmune, antiBSA antibody, or commercially available anti-Ang II antibody. For evaluation of the
expression of plasmid DNA in the transfected Hela cell, the cell lysate was collected in
RIPA lysis buffer (Millipore) and then subjected to SDS/PAGE. After electrophoresis,
the membrane was incubated with anti-Ang II antibody, anti-HBc antibody, or anti-
actin antibody, respectively. After incubation with HRP-conjugated antibodies specific
for rat IgG (GE Healthcare), chemiluminescence signal was detected with a FujiFilm LAS
1000 camera and analyzed with MultiGauge version 3.2 software.

Statistics
All values are expressed as the mean standard errors. Data were compared using twoway analysis of variance (ANOVA) followed by Dunnetts test for pair-wise comparisons
against the control groups and Tukeys test for multiple comparisons. P values less than
0.05 were considered statistically significant. All statistical analyses were performed
using JMP8 software (SAS Institute, Inc., Cary, NC, USA).

B
HBc

Pcmv

HBc-N

Pcmv

HBc-C

AngII

ISS

ISS
pcDNA3.1-HBc-AngII
6215 bp
Amp
SV40 ori

pcDNA3.1-HBc
6176 bp
Amp
SV40 ori
Neo

Neo

pUC

pUC

HBc-N

HBc-C
-I-T-

-G-A-T-

DRVYIHPF
Angiotensin II

Fig. S-1. Construction of DNA vaccines. A, Plasmid map of pcDNA3.1 -HBc.

HBc gene was cloned downstream of CMV promoter. ISS sequence containing
CpG-A D19, CpG-B 1018, CpG-C C274 and CpG-C C695 was also inserted. B,
Plasmid map of pcDNA3.1-HBc-AngII. DNA fragment encoding angiotensin II
and its N- and C-terminal linkers were inserted at the position corresponding to
amino acid 80-81 of HBc. C, Schematic presentation of fusion protein HBcangiotensin II expressed by plasmid pcDNA3.1-HBc-AngII. Angiotensin II was
inserted in HBc protein at aa 80-81 and the N-terminal I-T dipeptide linker and
a C-terminal G-A-T tripeptide were designed in frame to angiotensin II to allow
flexibility in the conformation of angiotensin II when surface-exposed on HBc
particle. The angiotensin II and the linkers were represented by single-letter
codes.

1 2 3

1 2 3

Anti-HBc

Anti-AngII
1 2 3

Anti-b-actin

42 kDa

Fig. S-2. Expression of plasmid DNA. Hela cells were transfected with
plasmids, and expression of HBc-AngII protein (Allowhead) was only
detected in the cell lysate transfected with pcDNA3.1-HBc-AngII by
immunoblot using anti-Angiotensin II antibodies. Expression of HBc-AngII
protein and HBc protein was detected in the immunoblot with anti-HBc
antibody. Lane 1, the untreated cell lysate; lane 2, the cell lysate transfected
with pcDNA3.1-HBc-AngII; and lane 3, the cell lysate transfected with
pcDNA3.1-HBc. *, HBc makes dimers.

B
18

600

P = 0.09

16

Immunoreactive plasma
Ang I concentration (pg/ml)

Plasma renin activity (ng/ml/hr)

14
12
10
8
6
4
2

500
400
300
200
100
0

0
Saline

HBc-AngII

Saline

HBc-AngII

Daily urinary excretion of

aldosterone (ng/day)

14
12

10
8
6
4
2

0
HBc, saline HBc-AngII

Fig. S-3. Plasma renin activity, Plasma Ang I concentration, and Daily urinary
excretion of aldosterone. A, Plasma renin activity of vaccinated rats. Plasma
samples were collected from rats 8 weeks after the first immunization. Saline
group, n=5; HBc-AngII group, n=6. B, Plasma Ang I concentration of vaccinated
rats. Plasma samples were collected from rats 8 weeks after the first immunization.
Saline group, n=2; HBc-AngII group, n=3. C, Daily urinary excretion of
aldosterone. Urine samples were collected from rats 24 weeks after the first
immunization. HBc and Saline group, n=6; HBc-AngII group, n=5. Data are
presented as the average of each group; error bars indicate the standard error of the
mean. *P<0.01 vs. HBc-AngII group.

Systoric blood pressure (mmHg)

160
140
120
100
80
60
40
20
0
0 week

6 weeks

Fig. S-4. The effect of vaccination on systolic BP in WKY rats. Eightweek-old male WKY rats (n=5) were vaccinated three times with
pcDNA3.1-HBc-AngII at 2-week intervals. Systolic BP was measured at 0
and 6 weeks after the first immunization. Data are presented as the average
of each group; error bars indicate the standard error of the mean.

Systolic blood pressure (mmHg)

230
220
210
200

190

180
170
160
150
Saline

HBc-AngII HBc-AngII HBc-AngII Olmesartan

+
+
A779
Olmesartan

Fig. S-5. The effect of A779 or ARB treatment in the HBc-AngII group.
SHRs were vaccinated three times with pcDNA3.1-HBc-AngII at 2-week
intervals (0, 2nd, 4th week). The administration of A779 (0.8 mg/kg/day,
I.P., for 7days) or olmesartan (3 mg/kg/day, P.O., for 7 days) was started at
5th week. Systolic BP was measured at 6th week. Data are presented as the
average of each group; error bars indicate the standard error of the mean.
*P<0.05 vs. saline group. n=4 per group.

Kidney
Saline

HBc

HBc-AngII

Heart

Fig. S-6. Histological conditions of kidney and heart. A, Photomicrographs

of sections of kidney from SHR of the saline group, the pcDNA3.1-HBc-AngII
vaccinated group and the pcDNA3.1-HBc group. Scale bar, 100mm. B,
Photomicrographs of sections of heart from SHR of the saline group, the
pcDNA3.1-HBc-AngII vaccinated group and the pcDNA3.1-HBc group. Scale
bar, 100mm

Liver

Saline

HBc

HBc-AngII

Aorta

Fig. S-7. Histological conditions of liver and aorta. A, Photomicrographs of

sections of liver from SHR of the saline group, the pcDNA3.1-HBc vaccinated
group and the pcDNA3.1-HBc-AngII group. Scale bar, 100mm. B,
Photomicrographs of sections of aorta from SHR of the saline group, the
pcDNA3.1-HBc vaccinated group and the pcDNA3.1-HBc-AngII group. Scale
bar, 100mm.

Fig. S-8. Conceptual map of this experiment. Our working hypothesis of

AngII vaccine therapy was shown as a conceptual figure. We immunized mice
with HBc-AngII as an antigen. As an immunization phase, antigen presenting
cells (APCs) phagocyte HBc-AngII and present T cell epitope of HBc-AngII to
T cells through major histocompatibility complex (MHC), and T cells recognize
it through T cell epitope and activate (differentiate to effector T cells) (step 1). B
cells, which are specific to AngII, phagocyte HBc-AngII and present T cell
epitope of HBc-AngII to T cells through MHC. Then, B cells differentiate to
plasmacytes and produce antibodies with help of activated T cells (effector T
cells) (step 2). These steps are required to produce antibodies efficiently.

Long-Term Reduction of High Blood Pressure by Angiotensin II DNA Vaccine in

Spontaneously Hypertensive Rats
Hiroshi Koriyama, Hironori Nakagami, Futoshi Nakagami, Mariana Kiomy Osako, Mariko
Kyutoku, Munehisa Shimamura, Hitomi Kurinami, Tomohiro Katsuya, Hiromi Rakugi and
Ryuichi Morishita
Hypertension. 2015;66:167-174; originally published online May 26, 2015;
doi: 10.1161/HYPERTENSIONAHA.114.04534
Hypertension is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright 2015 American Heart Association, Inc. All rights reserved.
Print ISSN: 0194-911X. Online ISSN: 1524-4563

The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://hyper.ahajournals.org/content/66/1/167

Data Supplement (unedited) at:

http://hyper.ahajournals.org/content/suppl/2015/05/26/HYPERTENSIONAHA.114.04534.DC1.html

Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Hypertension can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial
Office. Once the online version of the published article for which permission is being requested is located,
click Request Permissions in the middle column of the Web page under Services. Further information about
this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Hypertension is online at:
http://hyper.ahajournals.org//subscriptions/

Downloaded from http://hyper.ahajournals.org/ by guest on September 8, 2015