Principles of Biology I

Bi 214
Laboratory Manual

Portland State University

Fall 2015

Table of Contents
Lab 1: Plant pigments and pH
Lab 2: DNA purification and protein folding
Lab 3: Microscopes, microfossils, and micro-organisms
Lab 4: Cellular respiration
Lab 5: Genetic transformation
Lab 6: Measuring gene expression
Lab 7: DNA, restriction enzymes and gel electrophoresis
Lab 8: Cell division
Lab 9: Bioinformatics and BLAST
Lab 10: Genetics and statistics

Laboratory 1: Plant pigment color as an indicator of pH

I. Objective:
Measure the effect of pH on the molecular structure, and therefore color, of
anthocyanin, a pigment present in plant tissues.
In this lab, you will:
1)
Create a tool for measuring the pH of unknown solutions. The
relationship between anthocyanin color and pH is stable and highly
reproducible, so you will use a set of anthocyanin solutions of varied pH
to generate a standard curve representing anthocycanin color as a function
of pH.
2)
Determine the pH of unknown solutions by examining the spectral
properties of the solution in the presence of anthocyanin, and comparing
with your standard curve. You will use graphs to report and interpret your
results.
KEY CONCEPTS
the molecular structure of anthocyanin is altered by changes in pH, leading to
color changes
the color (spectral properties) of a solution can be measured using a
spectrophotometer
the pH of an unknown solution can be measured through anthocyanin color
change
--also-- practice lab techniques, operate a spectrophotometer, and collect,
graph, and interpret data.
II. Background:

Figure 1. The pH and proton concentration of various substances. Note that the
hydronium ion (H3O+) is used to represent proton concentration, since free protons tend to
interact with water molecules in solution.

Introduction to pH
Water spontaneously separates (ionizes) into two charged molecules, H+ and OH-.
Hydrogen ions in solution are often called protons.
The term pH refers to the proton concentration (H+) in solution. The pH of a
solution is defined as the inverse log of the proton concentration. For example, if the H+
concentration is 10-10 Molar (M), the pH is 10. Therefore the lower the H+ concentration, the
higher the pH.
In water at pH 7 (neutral pH), the concentration of H+ and OH- is the same (10-7
Molar). A substance with a high H+ concentration (greater than 10-7 M), is acidic and
has a pH of less than 7. A substance with a low H+ concentration (less than 10-7 M), is
basic (alkaline) and has a pH of more than 7.
An acid is a substance that releases or causes the release of H+ into solution.
Examples of acids: acetic acid (CH3COOH), sulfuric acid (H2SO4), carbonic acid (H2CO3).
The pH of some common substances are shown in Figure 1.
A base is a substance that can remove H+ from solution, lowering the concentration
of H+. Some (but not all) bases ionize in water to produce hydroxyl ions (OH-). Examples
of bases: sodium hydroxide (NaOH), magnesium hydroxide (Mg(OH)2), and hydrogen
carbonate ion (HCO3-). Mixing an acid with a base can produce a neutral solution by
combining the H+ with the OH- to make water (H2O).
The Chemistry of Pigments
Pigments are substances with color. Pigment color is the result of the pigment
absorbing certain wavelengths of light and reflecting other wavelengths. Among the
pigments responsible for the vibrant colors in plants are water-soluble compounds called
flavonoids, which include the pigments called anthocyanins. The anthocyanins produce blues,
purples, and reds in plant tissues, while other flavonoids produce yellows, oranges and reds.
Other types of yellow-orange pigments found in plants are the carotenoids, distinguished
from the flavonoids by a chemical structure that makes them lipid soluble, not water-soluble.
Flavonoids and carotenes can be present in varying concentrations and different chemical
forms, and may result in shades of red, orange, purple, and magenta in flowers and leaves.
Chemically, the anthocyanins consist of 3 rings with variable numbers of attached
sugars. All anthocyanin molecules consist of two 6 carbon phenol rings and one central ether
ring. One type of anthocyanin, called cyanin, is shown in Figure 2. A carbon atom occupies
each point on the rings, except where the O (oxygen) is shown. Carbon atoms form 4
bonds, but often only 3 bonds are shown at the carbon points. If so, you may infer that a
hydrogen atom occupies that site to satisfy carbons valence of 4.
Many different anthocyanins have been isolated and characterized. They differ
chemically from each other by the type of substitutions that occur on the rings, including
glycosides (sugars), methyl groups (CH3), and hydroxyl groups (OH). The arrangement of
electrons in the anthocyanin rings is unstable, and can change (resonate) within the confines of
the rings. Under the right conditions, the electrons may rearrange sufficiently to cause a
change in the positions of double bonds.
3

cyanin anion
(blue)

cyanin
(violet)

cyanin cation
(red)

Figure 2. Cyanin species and their colors. Based on the picture above, predict how an
increase or decrease in pH would influence cyanin color. Provide a molecular explanation for
this prediction (pay attention to what happens to the double bonds).
The color of an anthocyanin molecule is influenced by the position of double bonds
in the molecule. If there is a shift in the position of double bonds, the color of the
molecule changes. The electrons in specific double bonds absorb the energy of light of
specific wavelengths, but reflect or transmit the other wavelengths. Thus, we see the
wavelengths of light that the pigment molecule do not absorb. If the position of a double
bond changes, the light absorbed changes and, correspondingly, the light transmitted
changes.
What causes double bond shifting? The bond state depends on the pH of the
solution in which the anthocyanins are dissolved. In acidic solutions anthocyanins become
fully protonated (rich with positively charged hydrogens). As the solution becomes less
acidic with the addition of hydroxyls (-OH), the anthocyanins de-protonate (lose hydrogen
ions) and the positions of double bonds shift. Also, anthocyanin side-groups (including
glycosides, methyl groups, and hydroxyls) and cofactors (including metal ions) influence
double bond shifting. For instance, a gardener knows that cyanin color is influenced by
metal ions. In one example, hydrangea flowers turn a deep blue when grown in acidic soil
that is high in aluminum.
Violet
|
400

blue
|
450

green
yellow orange red
|
|
|
|
500
550
600
650

far-red
|
700

Spectrophotometry-Using the properties of

light to analyze solutions
Figure 3. The Visible Light Spectrum (in nanometers)
of molecules
Light is composed
of photons moving in waves. The waves have peaks and valleys (oscillations) with variable
spacing. The wavelength of light (abbreviated as ) is the distance between adjacent peaks of
the wave, and is measured in nanometers (nm = 1 x 10-9 meter). Short-wavelength light is
higher energy than long-wavelength light. For example, ultraviolet light (e.g. 260 nm
wavelength, which damages DNA) has a more energy than infrared light (e.g. 730 nm
wavelength, which feels warm, but doesnt damage DNA).
The wavelengths of light absorbed by a substance depend on the molecular structure
of the substance. These wavelengths can be estimated from the color of a solution
4

containing the substance. For example, if a solution looks blue, then the blue light
(wavelength ~455-500 nm) is transmitted, while other light wavelengths are absorbed. A
more precise absorbance curve for a substance can be measured with a spectrophotometer.
A spectrophotometer allows a user to specify the wavelength of light passed through
a solution. The light that passes through the test solution is measured by a detector, and the
intensity of the detected light is expressed as either % Transmittance (how much of the
light made it through the substance) or Absorbance (a measure of the substances ability to
block light at that wavelength).
Transmittance (T) refers to the fraction of light that passes through a sample, using
the equation:
T = I/Io
(Io = intensity of light entering the sample; I = intensity of light leaving the sample).
Transmittance is expressed as a percentage by multiplying T by 100.
Absorbance (A) (also called optical density, or OD) is a log10 function of T:
A = log10 (1/T) = log10 (Io/I)
Absorbance measurements are expressed as A with a subscript indicating the
wavelength of light used for the measurement, e.g. A260 refers to the absorbance at
wavelength of 260 nanometers (nm).
At 100% transmittance, A = log 1.0 = 0.
At 50% transmittance, A = log (1/0.5) = 0.30.
Your spectrophotometer has two measuring modes, one for transmittance (0 to
100%), and the other for Absorbance ( to 0). Absorbance values are accurate up to about
1.8. Data are usually plotted as absorbance (Y-axis) as a function light wavelength (X-axis).
Blanks
In this experiment, only one component of the solution is being analyzed:
anthocyanins from red cabbage or blueberries. However, the solution in the
spectrophotometer tube contains more than just anthocyanin: it also contains water, acid or
base, and other substances from the cabbage leaves or blueberries. Absorbance readings
represent a sum of absorbance by all of the molecules in the solution, as well as the glass of
the tube containing the solution.
To account for the non-pigment (background) absorbance, first zero the
spectrophotometer. Zeroing is done by inserting the blank tube (containing water or buffer)
and setting the spectrophotometer to zero absorbance with the blank in the light path. This
effectively subtracts the background absorbance from the readings of subsequent pigmentcontaining solutions.
IMPORTANT: The spectrophotometer must be zeroed every time the sample
set is changed. A single blank will be used for the pH series, and each tes t solution will
5

have its own blank. For the test solutions, be sure to zero with test solution that has no
pigment added.
III. Experimental Procedure: Anthocyanin Pigment Analysis
OBJECTIVES
In this lab, you will:
1) Create a tool for measuring the pH of unknown solutions. Since
relationship between anthocyanin color and pH is stable and highly
reproducible, you will use a set of anthocyanin solutions spanning a range
of pH values, to generate standard curves representing how anthocyanin
color (absorbance or %transmittance) varies with pH.
2) Determine the pH of unknown solutions by examining anthocyanin color
over a series of wavelengths, and comparing with the pH standard curves.
You will use graphs to report and interpret your results.
Anthocyanin will be obtained from red cabbage or blueberries by boiling. You will
add the anthocyanin extract to solutions of variable pH, noting the change in pigment color.
Absorbance of different light wavelengths will be measured to create absorbance curves for
anthocyanin solutions of known pH values.
The anthocyanin extract will then be added to test solutions, and absorbance curves
will be determined for each solution. The pH of the test solutions will be estimated by
comparison with the standard absorbance curves.
Your Teaching Assistant will prepare anthocyanin pigment as follows:
Simmer diced cabbage or blueberries for 5 minutes, remove from hotplate and add
about 400 mL of ice to cool (adding a 10 cm sprig of celery, with leaves, to the boiling
cabbage will help keep the smell down, without altering the experimental results).
Strain the solutions into a beaker through several layers of cheesecloth in a large
funnel. The dark purple solution contains the pigment used for pH analysis.
Procedure:
1. Select clean tubes and label them BpH (blank for known pH solutions), 2, 3, 5, 7,
8, BU1 (blank for unknown 1), BU2, U1, and U2.
2. Add 4 mL of blank solution (water or buffer) to BpH tube. Add 3 mL of the pH
solutions into each corresponding tube (pH 2 buffer into the tube labeled 2, and
so on). Add 4 mL of the two unknown solutions to the BU tubes, and 3 mL of
the two unknown solutions to the U tubes.
3. Obtain a supply of cabbage or blueberry extract from your TA. Do not add the
extracts to the three blank tubes!! Pipette 1 mL of the extract into each
numbered tubes and the unknown tubes. Again, do not add the extracts to the
three blank tubes!! Cover the tubes with parafilm and MIX WELL.
4. Open a new Excel spreadsheet for recording data, using Table 1 as a guide.
5. Observe and record the color in each tube. A white piece of paper behind the
tube makes the color easier to see.
6. Read detailed spectrophotometry instructions below before beginning
your measurements!
6

7. Blank your spectrophotometer with the proper blank tube, then record each
tubes absorbance and % transmittance at wavelengths of 400, 435, 470, 500,
535, 570, 600, and 650 nm, as described below.

Figure 4. The Spectronic 200E

How to operate the Spectronic 200E:
1. Turn on the instrument by flipping the switch on the back panel. Follow the
instructions on screen. The system will initialize, and then will show the home menu.
2. Choose Spec200E Modern Interface (highlight with arrow keys, and select with
enter key)
3. Choose the Wavelength Scan application.
4. Press the down arrow to select measurement mode. Press the left/right keys on the
keypad to select either absorbance (ABS) or transmittance (%T).
5. Select wavelength endpoints to be from 380 660 nanometers. Set desired
wavelengths with the knob (for larger increments) and left/right keys (for single
digit increments). Select Go and press the enter key.
6. Wipe off your first blank tube and carefully place it into the tube holder (adjust the
size of the space in the holder if necessary) and close the cover. Press the autozero
button and hold it until the screen displays the message Performing autozero.
Release the button and wait until the autozero is done.
7. Remove the blank tube and place the first sample tube in the holder. Close the cover,
select scan, and enter.
8. Once the scan is done, youll see a line representing absorbance or %T for the
sample. To record the absorbance or %T values for each desired wavelength, move
7

the vertical line to the left or right using the knob (for larger increments) and
left/right keys (for single digit increments). When the desired wavelength is displayed,
write down (or enter in excel) the absorbance or %T value that is
displayed.
9. After all values have been read for absorbance, change the readout to %T, and read
the %T values at each wavelength as described in step 8.
10. After all samples are read for both absorbance and %T, insert the next blank, close
cover, press autozero, and read sample or samples as described in steps 7-9.
*Blank once before the pH series, once before unknown 1, and unknown 2.
Include the following tables generated in Excel in your lab report
The tables printed here are intended as guides. To receive full credit, you must use Excel to
record and graph results. It is strongly recommended that you complete all data entry and
graphs
Table 1: Color and Absorbance of anthocyanin in the extract at various pH values, and
with Unknown samples (U) 1 and 2.
pH

color

A400
(Absorbance
at 400 nm)

A435

A470

A500

A535

A570

A600

A650

Perform pH blank
2
3
5
7
8

Perform Unknown #1 blank

U1

Perform Unknown #2 blank

U2

Table 2: Transmittance (%) of anthocyanin in the extract at various pH values, and with
unknowns 1 and 2.
pH

T400
(Transmittance
at 400 nm)

T435

T470

T500

T535

T570

T600

T650

Perform pH blank
2
3
5
7
8

Perform Unknown #1 blank

U1

Perform Unknown #2 blank

U2

Questions
1. (2 points) Based on your results, what are the approximate pH values for your Unknown
solutions?
Unknown 1:

Unknown 2:

pH = _______

pH = _______

2. (1 point) Did the unknowns match the standard curves perfectly? If not, how did you
come up with an approximate pH?
3. (2 points) Write the chemical reaction for the ionization (dissociation) of water. What is
the concentration of H+ in pure water? What is the pH of pure water? What is the formula
used to calculate the pH of water?
4. (2 points) Which solution has a higher H+ concentration: one with pH 12, or one with
pH 3? What do the numbers 12 and 3 actually signify, in a mathematical sense? Does high
pH correlate with high proton concentration? Why or why not?
5. (1 point) In your own words, describe what happens to an anthocyanin molecule to
explain the color changes that occur at different pHs. What happens to the anthocyanin
molecule when pH decreases, and how does it affect color? How about when pH increases?
9

6. (1 point) Suppose you have a solution that is yellow in color, and you measure
absorbance and also transmittance at a variety of wavelengths. The wavelength of yellow
light is approximately 570 nm. For the yellow solution, would you expect to see peak
absorbance, or peak transmittance at 570 nm? Why?
7. (2 points) Suppose an anthocyanin molecule is added to a solution, and upon addition it
releases a proton into solution. In this case, is the anthocyanin molecule behaving as an acid
or a base, and why?
Writing (4 points):
Using Microsoft Excel, prepare your own tables representing tables 1 and 2 from
above. The tables must have column and row headers easily identified with units. Make
graphs of your data using Excel or another graphing software. One graph should plot
wavelength on the X axis (independent variable) versus absorbance on the Y axis (dependent
variable). The other graph should plot wavelength on the X axis versus %T on the Y axis.
Label the X and Y axes, be sure to give each graph a title, and explain symbols in a legend
box.

10

Lab 2
I.
II.

DNA purification
Protein folding

Part I. Isolation of DNA from cheek cells and strawberries.

Objective: Isolate and observe DNA from eukaryotic cells. Understand the chemical basis
for all of the steps in the protocol, and how these steps help reach the goal of DNA isolated
from all other cellular components.
A humans individuals genetic information (the genome) is contained in the 23 pairs
of chromosomes within the nucleus. Each normal somatic cell nucleus has copies of all 46
chromosomes, so DNA isolated from any cell of the body represents the complete genome
of that individual. The genomic DNA of each individual human is unique, and the DNA
sequence information in the genomic DNA can be used in the identification of individuals,
or in the diagnosis or risk assessments of genetic diseases.
The number of chromosomes an individual has is a unique trait of their species.
Other plants and animals can have vastly different numbers of chromosomes. For example,
the strawberry normally has only 7 pairs of chromosomes (14 altogether). However,
strawberry scientists have bred plants that have an increased chromosome copy number, and
as a result can grow bigger and juicier strawberries. These strains of strawberry can have as
many as eight copies of each chromosome (octaploidy)!
In this exercise youll follow a protocol for purifying DNA from your own inner
cheek cells, commonly used as a source of an individuals somatic cell genomic DNA. Since
the cheek epithelial cells are plentiful and continually shedding, they provide an easy and
abundant source of DNA. You will also isolate plant somatic cell genomic DNA from a
strawberry, since its easy to get your hands on a lot of starting material (compared to the
relatively limited supply of cheek cells), which gives greater DNA yields.
Somatic cell genomic DNA can be used in genetic testing protocols, including
screens for genetic diseases, crime scene suspect investigations, and paternity testing. For
example, companies that promise analysis of your personal genome typically require a few
milliliters of saliva, which contains shed cheek cells as the source of the DNA. The company
will isolate this DNA and complete their genetic analysis using a variety of analytical
techniques, including analysis of Single Nucleotide Polymorphisms (SNPs) that correlate
with gene-linked disease phenotypes. See http://genomesunzipped.org/resources for more
information on this new and sometimes controversial field.
Genomic DNA can be analyzed using far less DNA than will be isolated in this lab
session. A single hair root, flake of skin, spot of blood, or even a single cell can yield enough
DNA for the protocols described above. Specific regions of the genomic DNA can be
amplified using the process of PCR (Polymerase Chain Reaction), and the amplified DNA
can then be processed to access the sequence information contained in that region of DNA.

11

It takes very little genomic DNA for PCR to work, but amplification of DNA
sequences by PCR typically requires a fairly pure source of template DNA. DNA
purification protocols like the one used today are extremely important prior to protocols
such as PCR, since proteins and other contaminants that may inihibit PCR are removed.
At the end of this lab exercise, you should be able to see precipitated genomic DNA
floating around in a test tube. In another lab session (Restriction endonucleases and gel
electrophoresis) youll visualize the DNA in a different way, using gel electrophoresis and a
DNA-staining technique.
Protocol
1) Obtain two eppendorf tubes, label them with your name, and add 1 ml of lysis
buffer to each tube. The lysis buffer contains a mild detergent that disrupts cell
membranes, causing cells to release their contents into the solution.
2) Human DNA:
a. Using a clean brush, scrape cells from the inside of one cheek, collecting
as much goo as possible. Place the brush in the buffer from step 1), and
swish the brush around to dislodge the goo from the brush into the
solution.
b. Using another clean brush, repeat step a) on the other cheek.
3) Plant DNA: scoop a pea-sized piece of strawberry into the second tube
containing lysis buffer.
4) Close both tubes and GENTLY mix the contents by inverting the tube about 510 times.
5) Your TA will add one drop (about 25 microliters; 1 microliter = 1 x 10-6 liter, or
one millionth of a liter) of protease solution to each tube. A protease is an
enzyme that breaks down proteins by breaking the peptide bonds between amino
acids. Close the tube and GENTLY mix again by inverting the tube 5-10 times
6) Place the tube in a 50C water bath for 10 minutes (the protease used in this
protocol works best at this temperature).
7) After the 10 minute incubation, add two drops of salt solution (5 Molar sodium
chloride) to the mixture. Close the tube and GENTLY mix again by inverting 510 times.
The salt added in step 7) contains positively charged sodium ions. These ions are
attracted to the negatively charged phosphate groups on the DNA strands. Under
specific conditions (in the presence of high concentrations of ethanol) the negative
charges on the DNA backbone are neutralized by the sodium ions in the salt.
8) Obtain a clear, round bottom test tube, label it with your name, and pour the
contents of your small plastic tube into it.
9) Hold the tube at a 45 degree angle and SLOWLY add 3 ml of ethanol (95%)
down the side of the tube. Do not mix. You should see an interface between the
DNA extract and the ethanol. Let the tube sit, upright, in a rack for 5 to 20
minutes. You should be able to see the DNA precipitating at the interface
between the DNA extract you prepared and the ethanol you added.
12

The ethanol added in step 9 causes the DNA to precipitate (come out of solution),
by depleting the water available to hydrogen bond with the phosphates in the DNA
(the water concentration is reduced). The salt added in step 7) allows the DNA
strands to precipitate by neutralizing the negatively charged phosphates of the DNA
strands, allowing them to come together (aggregate) and precipitate.
10) Seal the tube with a piece of parafilm. Invert the tube 5 times to mix, and to
allow the DNA to aggregate.
Hold the tube up to the lightif you started with enough cheek cells, you should see
wisps or threads of a white material swirling in the tube your DNA! For the
strawberry sample, you should see a more dramatic display of precipitated DNA.
Youll need to purify the DNA further before analyzing it in the Restriction
endonucleases and gel electrophoresis lab. The following steps will result in DNA
in solution that is ready for electrophoresis.
11) Obtain two new eppendorf tubes and label with your name and cheek or
strawberry. Using a transfer pipet, remove the DNA and 1 ml or less of the
solution from each of your precipitated DNA tubes. Place these in the two
labeled tubes.
12) Close the tubes, then give them to your TA to place in the centrifuge. Your TA
will spin the tubes for 10 minutes at top speed. During the spin, the tubes and
their contents are subjected to extremely high centrifugal forces, causing separation
of insoluble components from the rest of the solution.
13) Remove the tubes from the centrifuge, and examine the bottom of the tubes.
The DNA should have formed pellets at the bottoms of the tubes, and should be
visible.
14) Carefully remove the solution from the tubes using a pipet (you can use the one
from step 12). Take care to not touch or remove the DNA pellet. It is very
important to remove as much of the liquid as possible.
15) Add 1 ml of ethanol (70% vol/vol). Close the tube and mix gently by inverting
the tube several times.
16) Give the tubes to your TA, who will centrifuge them at top speed for 5 minutes.
17) Examine the tubes again, looking for the DNA pellet (it should look like a white
smudge on the side of the tube farthest from the center of the centrifuge. In
some cases the DNA will form a tight bunch, or pellet, at the bottom of the
tube). Remove the ethanol carefully, taking care not to disturb or remove the
DNA pellet. Remove as much of the ethanol as possible.
18) Let the DNA pellets dry by setting the tubes on their sides, with the caps open.
19) After the ethanol has evaporated, add one drop of water (or about 50 microliters)
to the pellet to dissolve the DNA. Push the droplet around the sides of each tube
to dissolve the DNA. The DNA pellet (or smudge) will slowly disappear as it
dissolves.
Make sure the tubes are labeled with your name, and put them in a rack on the TAs
bench. You will analyze the DNA you isolated later, using gel electrophoresis.
13

DNA Questions:
1) (1 point) Suppose you want to analyze a human gene that encodes a protein
produced only in the liver. Would you be able to find that gene in cheek cell
DNA? Explain why or why not.
2) (2 point) Individual DNA molecules are invisible to the naked eye. Why were
you able to see the DNA after adding ethanol? What chemical process led to the
visible masses of DNA? Why would some students have seen more DNA from
their cheek cells at this step compared with other students?
3) (1 point) When cells are broken open, DNA is released from cells into solution.
Name at least two other macromolecules that are also released from the cells,
and the places they are found in the cells.
4) (1 points) Why do you think it is important to separate the DNA from other
cellular components and macromolecules, before using the DNA in analytical
procedures?
5) (2 points) Centrifugation is a common step in many molecular biology
protocols. In your own words, explain how it works, and why it was useful in
todays protocol.
Writing (2 points)
Prepare a narrative paragraph that describes how you performed the DNA extraction
from start to end. Remember, the narrative format intends to tell a story (no bullet points).
Include the appropriate information a fellow scientist would need to recreate your
experiment.

14

Part II Basic rules for protein folding

N

N
C

How do polypeptides assume a three-dimensional shape?

Objective: Fold a polypeptide by satisfying the general rules for protein folding. Understand
the roles for specific types of amino acids in the folding process.
Proteins do most of the work in biological systems, and are a key component in the
evolution of genes (and organisms) by natural selection. Some proteins mediate and control
chemical reactions through enzymatic activity, other proteins control passage of molecules
through membranes, others confer identity to cell surfaces, others give structure to cells and
organisms, and still others control the expression of genetic information contained in nucleic
acid sequences that give rise to proteins.
The amazing variety of function in polypeptides has long been a subject of research
in biology. How has evolution given rise to such variety? How does genetic information
encode the myriad of proteins required for the vast diversity of functions observed in the
biological realm?
Part of this problem has been solved. We know that genetic information is contained
in DNA, and we can determine the genomic DNA sequence of any organism we choose. We
know that RNA copies of genes give rise to polypeptides through decoding by the ribosome,
which polymerizes amino acid monomers in sequences determined by three letter codons in
mRNA. Thus, when we sequence an organisms genome, we can predict with high certainty
the proteins encoded by the genome and the amino acid sequences of those proteins.
The question of precisely how protein primary structure (the sequence of amino
acids) determines three dimensional protein shape is one of the great questions of molecular
biology. We cannot always accurately predict the folding of those proteins unless there are
other proteins with similar sequence, whose structure is known. However, there are basic
rules for protein folding that can be utilized to make predictions about protein structure.
These rules have been applied in predictive computer programs, such as Rosetta
(https://www.rosettacommons.org/). As these programs are refined, they are becoming
more and more accurate at predicting de novo protein structures from amino acid sequence.
Multi-player gaming can also be useful in solving protein folding puzzles, as shown
by the online game Foldit (http://fold.it/portal/). In fact, players of this game have
contributed to solving the structure of retroviral protease, and there are more structures on
the way. Foldit is free and open to all give it a try, and you could help solve another longstanding structural biology problem, or help in the fight against diseases, including the Ebola
virus.
15

Some of the fundamental rules that help guide protein folding are as follows:
o hydrophobic amino acid side-chains tend to be buried in the centers
of proteins, away from water.
o hydrophilic amino acid side-chains tend to be exposed on the
surface of proteins, maximizing hydrogen bonding with water
o hydrophilic amino acid side-chains can be buried if they interact
(through hydrogen bonds) with other hydrophilic side-chains or
other hydrogen bonding partners
o charged amino acids (also called basic or acidic because they
either gain or lose a proton when in solution) can interact with each
other in relatively strong ionic bonds, that are often called salt
bridges
o the sulfur-containing side-chain in the amino acid cysteine can form
very stable disulfide bonds with other cysteines in the polypeptide
(or in other polypeptides)
These rules and others have been derived from theoretical prediction as well as
actual interactions observed in proteins whose structure has been solved (over 80,000
structures so far, see the Protein Data Bank at http://www.rcsb.org/pdb for the latest
numbers).
3D molecular visualization of basic protein folding principles
Visit the following website: http://cbm.msoe.edu/teachRes/jmol/index.html
Choose the link Basic Principles of Chemistry that Drive Protein Folding. The
program Jmol will load, permitting an exploration of the beta-globin protein structure.
Click and drag on the molecule to rotate it. (Optional: clicking on the right mouse button in
the structure field will reveal menus that allow you to change the appearance of the structure.
Note that you must make a selection before any changes will apply).
Follow the instructions in the left panel to explore some of the basic protein folding
rules in a real polypeptide. You do not need to provide answers to the questions in your lab
report.
Proceed to part two of the Basic Principles of Chemistry that Drive Protein
Folding. Select the potassium channel protein. The potassium channel protein is a
membrane protein that spans the phospholipid bilayer, a strongly non-polar environment. What
is unusual about the potassium channel protein, with respect to protein folding
rules? (Be sure to answer this question as part of your lab report, see below).
Feel free to explore the other protein visualization tools at this website. If you are
feeling bold, visit the planets master repository for protein and nucleic acid structures, the
RCSB Protein Data Bank (web address listed above).

16

Model-making: Fold your own protein

As you can see from the rules above, in order to predict the folding of a polypeptide,
you need to know something about the chemistry of amino acid side-chains. In this section
of the lab, you are given a bendy tube (representing a polypeptide backbone) and a supply of
different-colored pins that represent different types of amino acids, as follows:
Blue (2 pins):

basic amino acid -- positively charged in solution, and can

interact with water at the surface of a protein. Can be at the
interior of a protein if interacting with an acidic amino acid in
a bond called a salt bridge.

Red (2 pins):

acidic amino acid -- negatively charged in solution, and can

interact with water at the surface of a protein. Can be at the
interior of a protein if interacting with a basic amino acid in a
bond called a salt bridge.

Plain (6 pins):

hydrophobic amino acid -- tends to be buried in the centers of

proteins, away from water. Weakly interacts with other
hydrophobic amino acids through van der Waals interactions.

Orange (3 pins):

hydrophilic amino acid -- tends to be exposed on the surface

of proteins, maximizing hydrogen bonding with water. Can
be buried at the interior of a protein if it interacts with other
hydrophilic side-chains or other hydrogen bonding partners
through hydrogen bonding.

Green (2 pins):

the amino acid cysteine: interacts with other cysteines, often

at the interior of a protein, through a stable disulfide bond.

Choose a partner, and have your partner randomly place these pins on the foam
tube, with even spacing between the pins. Do the same for your partner. Indicate the
sequence your partner has given your polypeptide below, as part of question 1 (using the
single letter codes B, R, P, O, or G).
Using the folding rules described above, fold the tube so that you can satisfy as many
of the rules as possible. Note: you may reposition the direction that the pins are pointing (i.e.
rotate their position around the tube), but do not change their position in the sequence.
Once you have optimized the folding of your protein, record the data
requested in question 1) below. Also, meet with your Teaching Assistant to show the
folded protein. Be prepared to explain how you used protein folding rules to come up
with the structure.
Choose a partner and compare your folded protein with theirs. Describe the thinking
that you used to fold the protein. Was there a sequence of events that you chose to follow
during folding? Are there any suggestions you might give to your partner to help their
protein fold better? (NO NEED to write this stuff down. Just get a conversation going).
17

Would your protein have a potential function in nature? A 15 amino acid protein is
short, and would in many cases be called a peptide. 15, or even 30 amino acids is not enough
to allow formation of a stable hydrophobic core in most cases. Therefore many short
proteins require disulfide bonds or metal ion binding for stabilization of the fold. Or, they
may not fold at all until they interact with their binding partner (proteins that behave this
way are sometimes called "intrinsically disordered" proteins).
Very small proteins are given their own class in the SCOP (Structural Classification
Of Proteins) hierarchy. Follow this link for a list of the proteins that meet the "small"
description according to SCOP. http://supfam.org/SUPERFAMILY/cgibin/scop.cgi?sunid=56992. Note that some of the small proteins in this group can be found
as domains within larger polypeptides.
Once you have the names of proteins that are small, you can search for structural
examples at the Protein Data Bank (pdb.org) Some of the more dramatic small proteins
include the neurotoxins found in various venoms. Here's one from the funnel web spider:
http://www.rcsb.org/pdb/explore/explore.do?structureId=1qdp. Click on 3D view
under the structure image to open up an interactive 3-dimensional model of the toxin.
Questions
1) (1 point) For each amino acid (pin), indicate whether it was buried or exposed on
the surface, and indicate whether it was interacting (forming bonds) with another
amino acid, and if so which one. Use the table below to record this data, then
generate the table in Excel or Word to turn it in.
Position
in linear
sequence
(primary
structure)

10

11

12

13

14

Pin color

Buried?
Exposed?
Bond?
If yes,
partner #
Does it
satisfy
folding
rules?

18

15

2) (1 point) Get your TA to view your structure and sign off on it. Did any of the
amino acids fail to satisfy the basic rules of protein folding? Can a protein fold
properly even if a few of its amino acids do not satisfy the basic rules?
3) (1 point) You work at a biotech company, and your boss tells you that you have to
make a mutation (mutation simply means to change, from one amino acid to
another) of one or two of the amino acids in your protein in order to make your
protein more stable, and less likely to unfold. Which amino acids (pins) will you
change to satisfy this request? Why would you make those changes? Note: dont
add new pins, just change the color of one or two pins.
4) (1 point) Suppose that the protein you are engineering in question 3 is an enzyme.
You make several mutations in the protein that make the enzyme so stable that, at
normal temperatures, it cannot flex or move at all. How would you predict this to
affect enzyme activity, and why?
5) (2 points) The potassium channel protein is a membrane protein that spans the
phospholipid bilayer, a strongly non-polar environment. What is unusual about the
potassium channel protein with respect to the protein folding rules for soluble
proteins? Why does the potassium channel protein need to operate by different
folding rules?

19

Laboratory 3: Microscopes, microfossils, and living microorganisms

I. Objectives
After this lab you should be able to:
1. Identify and state the function of the primary parts of the compound microscope.
2. Demonstrate the following basic skills of microscopy:
- Clean the microscope objectives
- Focus the microscope
- Determine the magnification and size of the field of view
- Estimate the size of the object in micrometers (m)
- Understand the concept of depth of field
- Understand the concept of polarizing optics
- Clean the microscope objectives
3. Be able to identify, estimate sizes, and draw general types of microfossils from
prepared and wet mount specimens
4. Be able to prepare a wet mount of pond water containing living microscopic
organisms
5. Observe microscopic organisms, estimate sizes, and draw representative
specimens
6. Understand the concept of staining for visualization of cellular detail
II: The Compound Microscope
A. Introduction.
A light microscope is a system of lenses arranged to produce an enlarged, focused
image of a specimen. Thus, this device allows the human eye to clearly resolve objects
otherwise too small to observe.
Resolution (resolving power) refers to the ability to distinguish two points from one
another. The resolving power of the human eye is about 0.1 mm, which means our eyes can
distinguish two points that are 0.1 mm apart. A quality light microscope can improve the
resolving power 400 fold (i.e., to 0.00025 millimeters, mm, or 0.25 micrometers, m).
However, in addition to resolving detail, there must be sufficient magnification for the detail
20

to be comfortably accepted by our eyes and brain. Such magnification is achieved by

combining two or more lenses. The lab microscopes combine objective lenses (4X, 10X,
40X, and 100X) with a 10X ocular (eyepiece) lens, to give total magnifications of 40X, 100X,
400X, and 1000X, respectively, to the viewers eye.
The quality of an image can be improved by staining specimens, or by manipulating
the illumination (using, for example, dark field or phase contrast modes).
Your Teaching Assistant will review the parts of microscopes that you will use in
class (see pictures). When you have become familiar with the parts of the microscope (Figure
1), proceed to section B.
1. The brightness control dial/power switch turns on and regulates the light intensity of
the light source.
2. The base provides firm support for the microscope. Hold the microscope with two
hands (one supporting the base) when transporting it.
3. The stage supports the slide over a hole that admits light from light source.
4. The condenser is a system of lenses directly beneath the opening of the stage. The
condenser is used to focus the light beam from below onto the specimen.
5. The condenser aperture diaphragm, also called the iris diaphragm, is attached below
the condenser. By moving the condenser aperture diaphragm lever, the size of the
opening in the iris diaphragm may be increased or decreased to regulate the amount
of light illuminating the specimen. When you begin viewing a new specimen, start
with the iris diaphragm fully closed. Gradually open it until you reach a light intensity
that permits optimum viewing of the specimen. Be careful here, since too much light
makes many specimens very hard to see.
6. The field lens projects the light source toward the condenser lens system.
7. The objectives each have a different power of magnification. They are attached to a
revolving nosepiece which permits the interchange of scanning (4X), low power
(10X), high power (40X), and oil immersion (100X) objectives. Note that the
objectives differ in length; the scanning objective is the shortest.
8. The eyepieces (oculars) are the upper lens system, and magnify the image formed by
the objectives by 10X. One of the oculars may have a pointer extending from an
edge to the center of the field. To adjust for differences between your eyes, focus for
the right eye first. then focus for the left eye by adjusting the left eyepiece diopter
ring.
9. Focusing knobs. If you have used a hand magnifying glass, you are aware that an
object is in focus only when the lens is held at a specific distance from it. On a
microscope, the adjustment knobs are used to move the lenses up and down. The
course adjustment knob is used to move the objective to approximately the desired
21

distance while the fine adjustment knob raises or lowers the objective very slightly,
permitting exact focusing.
10. The mechanical stage holds the slides (containing the specimens) securely beneath
the objective lens. Adjustment knobs allow the observer to move the slide in four
directions along the plane of the stage with great precision.

Figure 1: Diagram of parts of the Leica DM500 Microscope.

B. Procedures for using the microscope.
You will be assigned a specific microscope at your bench. DO NOT MOVE THE
MICROSCOPE FROM YOUR BENCH.
NOTE: The microscope should be in the proper storage position when arrive for
lab. The stage should be lowered and the 4X objective in place, cord neatly wrapped, and
dust cover (if present) in place. AFTER YOU ARE FINISHED, LEAVE IT THE SAME
WAY. If you have questions, please ask your TA.
ALWAYS CARRY THE MICROSCOPE WITH TWO HANDS.
CLEAN THE OBJECTIVE LENSES WITH SPECIAL LENS PAPER ONLY.
1. Obtain a prepared slide with the letter "e mounted in place. Place the slide, with
the "e on the top, onto the microscope stage. You can also make your own e
slide (using any e in this sentence).
2. Check to make sure the 4X objective is in the viewing (vertical) position. If not,
turn the revolving nosepiece to seat the 4X objective in place. IMPORTANT:
22

DO NOT use the objectives as handles to turn the objectives. Over time,
pushing on the objectives causes alignment problems.
3. Turn on the power switch and adjust the light to medium brightness.
4. Move the substage condenser until it is a few mm below the slide (look from the
side).
5. Start with the iris diaphragm completely closed, then open it slightly (usually
about 1/4 of the way open is enough). Be careful with this step, since opening
the iris diaphragm too far will let in too much light, and will make specimens
very difficult or impossible to see.
6. Use the mechanical stage adjustment knobs to position the e over the light
beam, watching without looking through the oculars at first. When the e is
over the light it will glow, as the light is scattered. Observe how the adjustment
knobs move either forward and backward or side to side.
7. Without looking through the oculars, use the focus knobs to bring the stage up
towards the object. Bring it up as far as possible without letting the objective
touch the slide. To focus, back the slide away from the objective while viewing
through the oculars until the subject comes into focus. For any new slide,
always start with the lowest power (4X) objective, and with the stage
brought close to the objective. Focus by moving the stage away from the
objective. NEVER move the stage toward the objective when initially
focusing: you can damage the slide and the objectives if they are pushed
into each other.
8. Before using the focusing knobs, observe from the side how far each one moves
the stage. Now, using first the coarse and then the fine focus knob, adjust the
scope until the "e comes into sharp focus. Note the orientation of the "e
compared to how you positioned it on the stage.
9. Using the revolving nosepiece, rotate the 10X objective into place. While looking
through the ocular, reposition the "e as necessary with the stage knobs and
focus. You may have to turn the course adjustment knob only slightly and then
fine-tune the focus with the fine focus knob. If your vision in each eye is
different, focus for your right eye only and then twist the left ocular diopter ring
to adjust the focus for your left eye.
10. Using the 40X objective: Your microscope has par focus". That is, when a
specimen is in focus with a lower objective, changing to a higher objective will
present the specimen in near-focus. Therefore (and this is very important) when
moving from the 10X to the 40X magnification you should not make a major focus
adjustmentyou will only need to turn the fine focus knob. Adjusting the course focus
knob when the 40X objective is in place may lead to damage of the microscope
and the slide!!! Always watch from the side to make sure the 40X objective will
clear the edge of the slide when it is being rotated into place.
23

B.1. (1 point) Which direction is the e facing (is it the same direction relative to the way
you positioned it on the stage)? Which objective lenses allow you to see the entire "e" in the
field of view when you look through the oculars, and which do not?
III. Examining specimens (work in groups to accomplish the following tasks more
quickly)
A. Practice using the scope: examine a slide with several colored threads mounted
together.
1. Starting with the 4X objective, position and focus the prepared slide of colored
threads. For any new slide, always start with the lowest power (4X) objective,
and with the stage brought close to the objective. Focus by moving the stage
away from the objective. NEVER move the stage toward the objective when
initially focusing: you can damage the slide and the objectives if they are
pushed into each other.
2. Proceed to focus with the 10X objective and find a point where several threads can
be seen in the same field, and then slowly change the fine adjustment back and forth.
Do the same with the 40X objective.
3. As you do this, different regions of threads and different threads will come into
focus. When one level is distinct, other levels above and below it will be somewhat
blurred. Be sure to use this active focusing method when you are observing
specimens in the lab. The vertical distance that is in focus at a particular point is
called depth of focus or depth of field. What color is the string that is closest to the
lens? Which is furthest away?
B. Measuring microscopic objects.
It is often necessary to determine the size of a biological entity in order to categorize
it. There are different methods by which the size of a microscopic specimen can be
measured. In this section you will learn how to estimate the approximate size of the
specimen you are viewing at different levels of magnification. As you move from a low
power to high power, the field of view decreases considerably. So, before changing from
low to high, it is necessary to center the object first.
Procedure for calculating approximate measurements (this data will be collected in
Table B.9 and is turned in as part of your lab write-up):
1. Obtain a 15 cm (150 mm) plastic ruler that can be used to measure the diameter of the
microscopic field.
2. Rotate the 4X objective into place, and adjust the light intensity and iris diaphragm
appropriately.
3. Place the ruler on the stage across the light hole.
4. Bring the lines of the ruler into focus.
24

5. Measure the diameter of the field in view. Be as accurate as possible Take into
account the thickness of the marks on the ruler. Express your measurement to the
nearest tenth of mm: what is the diameter of the 4X field of view in mm?
a. diameter of field of view in mm: _____________________
6. Convert this to micrometers (symbol is m, and 1 mm = 1000 m; and so 1
micrometer (m) = 1x 10-3 mm = 1 x 10-6 meters.
a. diameter of field of view in m: ______________________
7. Rotate the 10X objective into place. What is the diameter of the 10X field of view in
mm?
a. diameter of field of view in mm: _____________________
b. diameter of field of view in m: ______________________
8. Because the diameter of the 40X field of view is less than one millimeter, it cannot be
directly measured with a ruler.
To calculate the diameter of the 40X field of view:
First, calculate the total magnifications when 10X and 40X objectives are in place.
total magnification = magnification of the eyepiece (10X) x magnification of the
objective lens
a. Total magnification for the 10X objective = _______
b. Total magnification for the 40X objective = _______
Set up an equation to determine the 40X field diameter as follows:
(Total mag for 10X obj) x (Diam 10x) = (Total mag for 40X obj) x (Diam 40x)
-or- M1 x D1 = M2 x D2
therefore,
(Diam 40x) = (Total mag for 10X obj) x (Diam 10x)
(Total mag for 40X obj)
25

A similar relationship applies for the 100X oil immersion field of view.
c. (1 point) Your Calculations:

B.9. (3 points) Fill in the table (your work should be shown above). Recreate this table in
Excel or Word for your report.
Objective
Lens

Objective
Magnification

Ocular
Magnification

Total
Magnification
(obj x ocular)

Field of view
diam, in mm

Field of
View diam,
in m

Field of
view radius
in m

4X
10X
40X
100X

When viewing a specimen, you can estimate its width by how much of it you can see
when you have it in focus under low and high power. For example, if an object occupies
approximately 1/20th of the radius in your field of view when the 40X objective is in place,
divide the radius given for 40X (in m) by 20. You will need to refer back to your table of
measurements for the following study of microfossils and living specimens in the following
exercises.
C. Siliceous microfossils: Diatoms and Radiolaria.
Microfossils are the tiny remains of bacteria, protists, fungi, animals and plants.
Microfossils are one of the most important groups of all fossils. They are extremely useful in
age-dating and paleoenvironmental reconstructions, and are diagnostic for conditions
important to geology and for oil and mining explorations. They can occur in huge numbers,
especially in sedimentary rocks. For example the storied white cliffs of Dover, England are
composed mainly of the remains of planktonic algae called coccolithophores.
Siliceous microfossils are grouped together only because of their microscopic size
and the fact that they have glass-like shells (made of silica). Illustrations of the siliceous
microfossils are available for you to study. After you have looked at the illustrations, you will
prepare your own specimen to study and compare to the published illustrations.
26

Radiolarians have glass-like internal skeletons and projecting (radiating) needle-like

spicules. In life, protoplasm surrounds the internal skeleton and pseudopodia may extend
outward among the spicules. Fossil radiolarian internal shells appear as complex latticed and
hat-like structures with a few spikes, and the needle-like spicules are likely to be broken off.
Diatoms are single-celled protists with rigid cell walls (frustules) composed of
amorphous silica that is finely engraved with minute perforations. The frustules are box-like,
and contain the protoplasm. Frustules display many different morphologies depending on
diatom species and also growth conditions encountered by the diatom. It is possible to
design and produce specific frustule morphologies--these have potential applications in
nanotechnology. For more information on this, see Nature's Nanotechnologists: Unveiling
the Secrets of Diatoms by Jane Bradbury: http://bit.ly/Obl8kn.
Diatomaceous earth is a good source of diatoms and other siliceous fossils. First,
study illustrations of diatoms (available from your TA) to get familiar with the types of
microfossils that you might see. Then, use a pin to put a very small amount (too much and
you will only see blobs) of diatomaceous earth mixed with water on a slide, then cover
with a cover slip. Focus and observe with 4X, then 10X, then 40X. Adjust the light intensity
with the iris diaphragm in order to change the contrast.
With the 40X objective in place, focus carefully and study the engravings and
perforations of the diatoms.
C.1. (2 points) Using a pencil, draw two different siliceous microfossils in as much
detail as possible, and indicate the total magnification used to make the drawing. Note:
the drawing does not have to be at the scale at which it appears in the field of view. It would
be helpful if your drawing is made large enough to include all the details you can see. There
will be illustrations of various fossil foraminifera available in the laboratory for you to look at
and to compare with your specimen.
Draw each of your selected specimens at least 5 cm across, and estimate their
actual size in m. Use the drawing templates below.

IMPORTANT INSTRUCTIONS FOR ALL DRAWINGS: No more than four

drawings per page use the templates given at the end of the lab.

27

D. Sizing things up: comparison of bacteria and eukaryotes.

This section will give you a sense for the relative scale of eukaryotes compared to
prokaryotes, and will also allow you to use the 100X objective, which requires a droplet of oil
between the objective and the coverslip (oil immersion).
With three new slides, make 3 different wet mounts, two of bacterial cultures (nonpathogenic strains of E. coli and Bacillus megaterium), and one of a eukaryote culture (S.
cerevisiae, bakers yeast).
Your Teaching Assistant will set up the slides below; you may attempt it yourself if
you have time.
With each slide, focus at 4X, 10X, and then 40X. When the microscope is properly
focused with the 40X objective, turn the objectives part way to expose the coverslip.
Using the 100X objective: this objective requires oil rather than air between the
objective and the slide. The oil is formulated to have the same refractive index as glass, so no
resolution is lost by light refraction through air. To use this objective, follow these steps:
a. Focus on the specimen as carefully as possible with the 40X objective.
b. Rotate the objectives halfway to the 100X objective.
c. Add a small drop of immersion oil to the slide on the dot made by the light.
d. Rotate the 100X objective into position. Focus using only the fine focus knob. It
should not take much focusing to bring the specimen into view.
e. Carefully clean the oil from the 100X objective using LENS PAPER ONLY.
YOUR TA will apply a single droplet of immersion oil to the coverslip, then rotate
the 100X objective into position. View the sample, adjusting height of the object ONLY
with the FINE FOCUS KNOB.
IMPORTANT: After using oil on the slide, NEVER go back to 40X or 10X
objectives, because the oil will damage those objectives. USING LENS PAPER ONLY,
carefully remove all oil before storing the microscope.
D.1. (3 points) For each slide, record your observations. Estimate the sizes of the
organisms, and describe their mobility. In three illustrations, draw the organisms as they
appear with the 100X objective. Use the drawing templates below. After you are finished
with the 100X objective, wipe the oil off using LENS PAPER ONLY.

28

E. Living Microscopic Organisms

Wet Mounts of Biological Specimens.
Preparing biological specimens for microscopic observation often involves a wet
mount. Wet mounts are prepared by simply placing a drop of liquid sample on a slide, or by
adding a drop of water or stain to a dry sample. The sample is then covered with a thin glass
cover slip. To avoid bubbles, touch one side of the cover slip to the liquid, and then lower
the other side of the cover slip down on the droplet.
Samples of pond water will be available, and should contain various species of
microbes. Examine samples of the pond water (and sediment) for microbes by preparing
two similar slides. Other samples of protozoa may also be available, your TA will notify
you if so.
Using a swab or pipette, place a drop of pond water (make sure it has a little bit of
sediment, too) on one slide. On another slide place a drop of pond water and a drop of
Protoslo (a thickening agent that slows down mobile organisms enough to allow detailed
observations).
Lower cover slip over both samples. Examine each using 4X, 10X, and then 40X
objectives. You should see various unicellular and multi-cellular organisms. Note that it
can be difficult to find some of these organisms in the purchased specimens. When
scanning a real pond water sample, take your sample from near the sediment, which is where
most of the living things congregate. Use a low power objective initially, and scan lots of area
on the slide rapidly.
If you find a particularly interesting creature, be sure to share the view with your
group. Use the iris diaphragm to see contrast in the unstained, living organisms.
E.1. (2 points) On a separate sheet of paper, draw one of the organisms you have
observed. Indicate the total magnification you are using for the drawing. Draw specimen
scaled as it appears in the field of view, and estimate its size in m. Use the drawing
templates below. Estimate the size of at least one substructure of the specimen and
indicate the size with a labeled bracket.
Optional: After observing unstained organisms, add a drop of neutral red stain to the pondwater-only slide as follows:

Remove the slide from the stage.

Apply the stain at the edge of the cover slip, not on top. On the opposite side of the
cover slip draw off some liquid with absorbent paper. Capillary action will draw the
stain under the cover glass.

Allow the slide to sit for about 10 minutes while you continue studying the other
slide (containing Protoslo). After 10 minutes, clean off the excess liquid and view the
pond water. Neutral red is a vital stain, so called because it is relatively non-toxic
29

and is readily taken up by living cells. The stain is red in solutions of pH below 6.8; it
begins to turn yellow as the solution becomes alkaline.
Look for organisms that have taken up the stain and write your observation on the
distribution of the stain in the cells and the pH of the cells and cellular
compartments.

OPTIONAL: F. Foraminifera
Foraminiferans are protists (single-celled eukaryotes) living mainly in oceans. with
shells made of agglutinated and hardened silt and/or crystalline calcium carbonate.
Foraminiferans, often called forams for short, span a tremendous range in sizes, from less
than 0.1 mm (100 m) to over 20 cm. Each foram shell has one or more chambers housing
the protoplasm of the cell.
Forams date to the Cambrian period 540 million years ago, when atmospheric
oxygen levels began to approach todays levels. Through geologic time, foraminifera shell
shape and chemical makeup changed. Because of the reliable relationship between shell
characteristics and geological age, and because of foraminiferan abundance and specificity to
particular environments, forams are the principal microfossils used to age-date rocks and to
interpret geological conditions.
For more information on this fascinating group of organisms, see
http://www.ucmp.berkeley.edu/foram/foramintro.html
Foraminifera viewing
Obtain a prepared slide containing foraminifera. View at 4X, focus, and note the
sand-like appearance of the small objects on the slide. Now switch to 10X, focus, and note
that some of the particles are not sand, but look like tiny shellsthese are the foraminifera
fossils. Center one of the shells in the field of view and switch to 40X. Focus only with the
fine focus knob. Note that in order to clearly see the 3 dimensional shell details, you must
slowly turn the fine focus knob back and forth. This is because, at high power, the depth of
field (the depth that remains in focus at one position of the lens) is very shallow. These
specimens are unstained, but some morphological details can be seen because of their natural
coloration and partial transparency.
The calcium carbonate and porcelain-like chemistry of foram shells give them
crystalline properties. Their crystal structure is anisometric--the basic molecular lattice has
at least two different lengths along the axes of crystal symmetry. Anisometric structures
exhibit birefringence (refraction of light in two slightly different directions) when
light is passed through them. In contrast, isometric crystals have equal axis dimensions,
and do not exhibit birefringence. Sodium chloride (salt) crystals are an example of isometric
crystals.

30

Polarizing filters allow only light oscillating in one plane to be transmitted (rather
than all planes around the vector [direction] of wave propagation). When two polarizing
filters are crossed, each at exactly right angles to their place of transmittance, light cannot
pass through, because of polarizing extinction. However, if a birefringent object is
placed between the two polarizers, it can bend the light, like a prism. Polarizing
extinction does not occur, causing the object to light up on a dark background.
Switch the 10X objective back in place. Put one polarizing filter square over the field
lens (light source) then place one filter square over one of the oculars. Rotate the ocular
filter 180 as you look through the ocular. Notice what happens to the image of the
foraminifera shell, debris, and the background.
F.1. Describe the foraminifera under nonpolarized versus polarized light:
F.2. Using a pencil, draw one different foraminiferan in as much detail as possible,
and indicate the total magnification used to make the drawing. Draw your selected
specimen at least 5 cm across, and estimate its actual size in m. Use the drawing
templates below.

Writing (3 points)
Prepare an introduction paragraph that describes the scientific context of this weeks
lab in microscopy. Using the lab manual and the lecture textbook, cite any scientific research
where appropriate. Your TA will provide with you additional details.

31

Name: ___________________________, Bi214, Day: _________, Time: _________

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X
32

Name: ___________________________, Bi214, Day: _________, Time: _________

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X
33

Name: ___________________________, Bi214, Day: _________, Time: _________

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X
34

Laboratory 4: Cellular respiration

Objectives
You will analyze respiration rates by measuring CO2, one of the end products of
aerobic respiration. You will formulate and then test hypotheses concerning respiration rate
and its dependence on temperature or energy source.

Introduction
Cellular respiration is an essential metabolic process that captures the chemical bond
energy of organic food molecules and uses the captured energy to make ATP. ATP is the
energy currency of the cell and can be spent to drive metabolic processes such as the
synthesis of complex molecules. All organisms utilize glucose or similar sugars for ATP
production.
In aerobic respiration, glucose (C6H12O6)a simple sugar that may be derived from food
such as starch and sucroseis broken down to release energy if oxygen (O2) is available.
The energy released from glucose is used to make ATP via the electron transport chain and
chemiosmosis. The breakdown of glucose in cellular aerobic respiration is represented by the
following equation:
C6H12O6 + 6 O2 6 H2O + 6 CO2 + energy (heat or high energy bonds in ATP)
Note that the equation above is balanced: the number of C, H, and O atoms found
within the starting molecules, C6H12O6 and O2 (the substrates), are equal to the numbers of
C, H, and O atoms in the molecular products, H2O and CO2. Also, the product molecules
(H2O and CO2) are proportional to the amount of starting substrate molecules; e.g. 6
molecules of carbon dioxide for every molecule of glucose. Therefore, in respiration, an
increased production of CO2 indicates that glucose molecules are being broken down at a
more rapid rate.
The chemical equation shown above takes place through a complex series of
reactions. The reactions for the complete oxidation of glucose are associated with several
metabolic processes, including glycolysis, the citric acid cycle, and the electron transport
chain.
Numerous enzymes facilitate these metabolic processes. Enzymes catalyze reactions
by changing the rates at which those reactions proceed. Enzyme-catalyzed reactions are
sensitive to changes in temperature in the cellular environment; they usually catalyze a
specific chemical reaction at a fairly limited optimal temperature range.
Bakers who use yeast to leaven bread understand well the relationship of sugar and
temperature to the quality of their bread. Yeast leavens bread by oxidizing sugar to release
carbon dioxide (CO2), which becomes trapped in the dough and forms small air pockets
that make the bread rise. If the yeast is not fed sufficiently (too little sugar), less CO2 will
35

be produced; similarly if the yeast is not warm enough, the rate of sugar breakdown and the
consequential production of CO2 will be too slow and the bread wont rise.
Organisms have evolved to function optimally within their particular environmental
niche. Whereas bakers yeast and many other organisms may function optimally at a
lukewarm temperature, other organisms are adapted to cold or hot environments.
Thermophiles thrive in hot environments from 60C to above boiling temperatures!
Thermophiles live in hot springs, near (and sometime in) deep-sea hydrothermal vents, and
also in hot compost piles. These organisms have metabolic systems evolved to permit
function at these extreme temperatures.
In the cytoplasm, glucose enters the respiration chain via glycolysis, but carbon
sources other than glucose may also be used in respiration. Usually an organism will use
specific enzymes to convert different carbon sources to glucose, that can then enter
glycolysis, or to an intermediate in the glycolytic pathway. However, these enzymatic
conversions consume time and energy because the specific enzymes for conversion need to
be made before the carbon source may be utilized. In addition, some carbon sources yield
less ATPs than glucose when they are respired. Together these variables can cause a
reduction in the rate of respiration (and growth rate of the cell).
In this experiment, you will be working with the microscopic organism Saccharomyces
cerevisiae (bakers yeast): a eukaryotic, single-celled fungus with an optimum growth
temperature of about 30C. You will grow S. cerevisiae cultures using different temperatures
and carbon sources in order to test hypotheses regarding the effects of temperature and
carbon source on respiration rates.
Organization:
Each lab table will work together, using 2 computers and 2 gas (CO2) sensors
(probes with respiration chambers, see Fig. 1). The CO2 sensors are very sensitive, DO NOT
BREATHE ON THEM, too much CO2 will saturate the sensor and will stop it from
working properly.
One group will examine the effects of temperature on respiration, and the other will
examine the four different carbon sources at a single temperature.
Each group will share their data with the entire class.
Supplies:

Test tube rack with 9 test tubes containing yeast (Saccharomyces cerevisiae)
culture (6 for experiments, 3 for controls [yeast only (no carbon source) at
each temperature])
5% solutions of glucose, lactose, sucrose, and glycerol
10mL graduated cylinder
transfer pipettes with 1 mL hash mark
large beakers
heat bath
thermometers
paper towels
36

marking pen

Generate hypotheses:
A hypothesis is a statement that proposes to explain a phenomenon. A good
hypothesis is one that can be tested with an experiment. For example, you might phrase your
hypothesis like this: Cellular respiration and CO2 production is ______ (higher, lower, or
the same) for cells grown in lactose compared with cells grown in glucose.
You know that cellular respiration generates CO2, so measurement of changes in
CO2 levels should provide an assay for rate of respiration. Using a CO2 sensor, you decide to
investigate two variables likely to affect respiration rates for the eukaryotic model organism
S. cerevisiae: temperature and carbon (energy) source.
You have 4 different carbon sources available for testing: 1) glucose, which can
enter glycolysis directly; 2) sucrose, a disaccharide cleaved by invertase to glucose and
fructose; and 3) lactose, a disaccharide cleaved by beta-galactosidase to glucose and
galactose, and 4) glycerol, an alcohol with a structure that is very different from sugars, and
that requires more steps for catabolism. State a hypothesis that relates cellular respiration
rate to type of carbon source used for growth.
Write the hypothesis below.

You also have three different temperature water baths (4C, 30C, and 50C)
available for growing cultures of S. cerevisiae. State a hypothesis that relates cellular respiration
rate to the temperature used for growth, when glucose is used as the carbon source.
Write the hypothesis below.

Testing your hypotheses:

Incubate your cultures with the appropriate carbon source and at the appropriate
temperature. After each incubation, transfer a small portion of the culture solution to a
respiration chamber/gas sensor connected to the computer. The CO2 sensors are very
sensitive, DO NOT BREATHE ON THEM, too much CO2 and they will not work
properly. The LoggerPro program will automatically record carbon dioxide production over
time and calculate the respiration rate for the sample. Measure and record respiration rates
under the conditions required for testing your hypotheses (dont forget controls!!!!), and plot
a graph representing all of the data. Interpret your results to determine whether they support
or refute your hypotheses.

37

Procedure for temperature tests (for carbon source tests, see below)
1. Set up water baths for the three different test temperatures cold (4C), lukewarm
(30C), and hot (50C).
2. Obtain 6 culture tubes and mark each tube at the top with the variable being tested.
Remember to include appropriate controls ask yourself how you can be sure that
measured CO2 production is the result of carbon source utilization. Add 2.0 ml of
yeast suspension to each tube.
3. Each group has only one CO2 sensor, so you must stagger the set up for each yeast
sample. ***Note that set up begins with the addition of the sugar to the yeast, not
with the start of incubation in the water bath.*** Add 2.0 ml of 5% glucose solution
to one yeast culture tube. Mix well by drawing the solution up and down with the
transfer pipet. Wait 10 minutes before adding glucose to the next yeast culture tube.
4. Immediately after adding the sugar, place the tube into the appropriate water bath
and incubate for 10 minutes. Monitor the temperature to be sure that it stays
constant for the 10 minutes incubation period. Also, place an empty respiration
chamber in the water bath.
5. While the first sample is incubating, prepare the computer for data collection by
opening the LoggerPro program. If the software does not show carbon dioxide on
the y-axis, you must specify that the CO2 gas sensor is being used in Channel 1. Use
the Experiment menu to Set up sensors and choose CO2 gas from the drop-down
menu for Show all interfaces Ch. 1 Choose sensor CO2 gas
sensor). Use the clock icon on the top menu bar to change the sampling time to a
total of 4 minutes with a sampling rate of 6 samples/minute.
6. When incubation is complete, use a transfer pipette to place 1.0 ml of incubated
culture into the bottom of the respiration chamber.
7. Place the CO2 gas sensor probe in the top of the respiration chamber. Gently twist
the rubber stopper on the shaft of the sensor into the chamber opening. Do not let
any water contact the gas sensor.
8. Hit the Collect button on the software menu bar and collect CO2 ppm for 4 minutes.
The respiration chamber must be maintained at the appropriate temperature for the
entire sampling period.
9. To determine the respiration rate, use the mouse to select the part of the line that is
increasing in slope. Click on the Regression button (/R) on the menu bar to perform
a linear regression. Record the slope of the line, m, as the rate of respiration (CO2
ppm/min) and the temperature.
10. Repeat with the remaining yeast samples at all temperatures, but be sure to use a new
respiration chamber and let the CO2 gas sensor return to ambient levels before
38

attaching it to the next sample. Push the Collect button again to start collecting data
for the next sample. There is no need to save your previous data.
Procedure for carbon source tests
1. Set up a lukewarm (30C) water bath and obtain samples of the 4 different carbon
sources.
2. Obtain 5 culture tubes (one for each carbon source, and one control tube), mark
each tube at the top with the variable being tested. Add 2.0 ml yeast solution to each
culture tube.
3. Follow steps 3-9 from the temperature tests above.
4. Repeat with the remaining carbon sources, but be sure to use a new respiration
chamber, and let the CO2 gas sensor return to ambient levels before attaching it to
the next sample. Push the Collect button again to start collecting data for the next
sample. There is no need to save your previous data.
Data analysis:
1. (2 points) Create two tables that express the respiration rate (in ppm CO2/min),
one as a function of carbon source, and one as a function of temperature.
2. (4 points) Plot the data for temperature dependence of respiration rate using
Excel. Also plot the data for carbon source dependence of respiration rates.
Processing the Data (3 points)
1. Share your data with the class by recording on the board the temperatures and carbon
sources you tested, and the rate of respiration you calculated for each.
2. Using the class data, calculate the average for each temperature range and record in a
table.
3. Create a graph of the rate of respiration vs. temperature or carbon source using the class
data. The respiration rate values should be plotted on the y-axis (dependent variable), and
the temperature or carbon source values plotted on the x-axis (independent variable).

39

Lab 4 - Questions
1. (1 point) What was your hypothesis? Does the experimental data support your first
hypothesis regarding carbon sources? Explain your answer and suggest alternative
explanations for your data (which often lead to new, testable hypotheses!)
2. (1 point) Does the experimental data support your second hypothesis regarding
temperature? Explain your answer and suggest alternative explanations for your data.
3. (1 point) From the data, what is the apparent optimum temperature for S. cerevisiae
growth? Is this what you expected to see? Explain.
4. (1 point) How can you be sure that the CO2 levels you recorded were from
respiration? How did your controls address this?

Writing (2 points)
Prepare a paragraph describing the results collect in this weeks lab. This is a
paragraph that objectively reports the results without any interpretation. This may feel
redundant however, the tables and figures can be referenced to throughout the text to
support your statements.

40

Laboratory 5: Genetic transformation & green fluorescent

protein
Objectives:

In this lab you will alter the genetic program of the bacterium Escherichia coli by
adding a gene from the jellyfish Aequorea victoria. Youll be exploring the relationship between
DNA sequence and gene expression, so youll need to understand what a plasmid is, how the
genes are arranged on the plasmids, and how the genes can be turned on and off. Youll also
be using the green fluorescent protein (GFP) as an easy indicator of gene expression. After
this lab, you should be able to give a molecular explanation for how specific genetic
modification can change the phenotype of a living organism.

Genetic transformation and plasmids

When DNA was identified as the carrier of genetic information, it was found that an
organism could be induced to have new characteristics, or phenotypes, by simply adding new
DNA to the organism. The term used for this alteration was transformation, and this term
is still in use to describe experiments in which new DNA is added to a cell.
Initial experiments in transformation were performed by Frederick Griffith and
Oswald Avery in the 1920s through the 1940s, and involved the natural transformation of
non-pathogenic bacteria with virulence genes from pathogenic bacterial donors. The first
deliberately created recombinant DNA was reported by Paul Berg and colleagues in 1972,
and involved a virus (SV40) that was engineered to contain bacterial genes. Following this
experiment, further experiments in genetic engineering were halted until regulations could be
debated and agreed upon by the scientific community and government officials. The
Asilomar Conference on Recombinant DNA took place in 1975, and led to the guidelines
for recombinant DNA research that are currently in effect for government-funded research
in the United States (see http://oba.od.nih.gov/rdna/rdna.html for details).
Organisms that contain foreign genes are described as transgenic, or genetically
modified. Transgenic organisms are now commonplace in biomedical research and
biotechnology, and have also entered the marketplace. For example, many crops containing
genetic modifications are grown throughout the world. In addition, Glo fish, zebra fish that
express different colors of fluorescent proteins, are available for purchase at local pet stores.
In medicine, human genes can be altered through the process of gene therapy. However, the
recipients of gene therapy are not formally referred to as transgenic, since their germ lines
(the cells that give rise to eggs or sperm) are not genetically altered, because of important
ethical considerations.
To move foreign DNA into an organism, a vector is often used. Vectors are pieces
of DNA that contain the foreign gene, as well as sequences that maintain replication in the
host organism, and allow the foreign gene to be expressed properly. Examples of vectors
include non-pathogenic viruses, as well as small circular pieces of DNA called plasmids.
Plasmids are naturally occurring DNA elements that contain sequences allowing replication
in a bacterial cell.
41

In this lab youll use two different plasmids, shown in Figure 1. The plasmid pGFP
was constructed using standard molecular biology techniques that allow cutting and pasting
of DNA fragments. The pGFP plasmid is an example of a recombinant vector, since it
contains foreign DNA: in this case, a gene from a jellyfish that produces a fluorescent
protein.

Figure 1. Two plasmids for Escherichia coli. pUC19 is a very small plasmid with the
gene for beta lactamase, giving resistance to the antibiotic ampicillin. pGFP also
contains the beta lactamase gene, and has the green fluorescent protein gene under
control of the pBAD promoter. The AraC DNA binding protein controls the pBAD
promoter and regulates expression of green fluorescent protein.
Once a recombinant plasmid vector is prepared, it needs to be added to the target
organism. In many cases, it is necessary to treat the target organism in some way to make it
competent, which means it is able to take up DNA from its environment. Bacterial cells can
be made competent either by chemical treatment or through an electrical shock. In this lab,
E. coli will be made competent for DNA uptake by treatment with magnesium ions, which
are thought to damage the cell surface and allow DNA transient access to the cytoplasm.
Transformation is an inefficient process. In a typical bacterial transformation
experiment, less than 1% of the cells take up the foreign DNA, and it can be difficult to find
those cells and separate them from the the cells that did not receive the DNA. To solve this
problem, most vectors contain a selectable marker, which is a gene that the cell needs to
survive. In this lab, the selectable marker is the gene for beta lactamase, an enzyme that
breaks down the antibiotic ampicillin. If an E. coli cell contains the plasmid, it makes beta
lactamase and breaks down the ampicillin, allowing cell survival. Cells that do not have the
plasmid are not so lucky, and are killed by the ampicillin. In short, only those cells that
receive the plasmid will survive when grown on media containing ampicillin.

Expression of a transforming gene

When a foreign gene is introduced into an organism, it will not be expressed unless
specific control DNA sequences are present. The pGFP plasmid expresses the green
fluorescent protein gene, because the pBAD promoter causes RNA polymerase to transcribe
the gene (DNA RNA), and a ribosome binding site (not shown) causes translation of the
GFP mRNA (RNA protein).
42

Its important to understand that the pBAD promoter is itself controlled by the
transcriptional activator AraC (see Figure 2). AraC is a protein that can interact with DNA at
the O2 site as well as at the two I sites, I1 and I2. The interaction mode of AraC is determined
by the presence of the 5 carbon sugar arabinose. When no arabinose is present, two AraC
proteins interacts with O2 and I1, and transcription does not occur. When arabinose is
present, AraC partially re-folds, and now the two AraC proteins interact with I1 and I2. In
this second configuration, RNA polymerase (RNAP) can make RNA, and the gene (off to
the right, and not shown) gets expressed.

AraC

No transcription

Transcription

Figure 2. The pBAD promoter and its control by AraC and arabinose. AraC is a
DNA binding protein whose folding is influenced by the sugar arabinose. The AraC
I1/I2 binding mode allows RNA polymerase to transcribe the gene (in the rightward
direction). Figure reproduced from Schleif (2010) FEMS Micro. Rev. 34, p. 779.

Green fluorescent protein

Research in cell biology has been greatly aided by the introduction of the green
fluorescent protein (GFP), which provides an easily visualized marker for gene expression.
The GFP gene was initially isolated from the jellyfish Aequorea victoria in 1992. The structure
of GFP includes a unique serine/tyrosine/glycine triad that combine to form a fluorescent
chromophore. The intensity and color of fluorescence produced by the chromophore is
influenced by the rest of the GFP protein sequence, and the cloned version of GFP was
altered by mutation to make the protein fluoresce brighter, and produce new colors.
By the year 2000, GFP and related proteins became a very common tool in cell
biology and microscopy. Cellular proteins can be easily tagged with GFP, which allows these
proteins to be visualized by fluorescence microscopy. Many striking images of cellular
structures have been enabled by these protein-GFP fusions. For the purposes of this lab,
GFP provides an easily scored indicator of transgene expression following transformation.

43

KEY CONCEPT
Transformation of a living system with new genes means that the genotype (the
genes present) and often the phenotype (the outwardly measurable characteristics) of the
organism are changed. The phenotype of the transformed organism can tell you how the
transgene is expressed.

Your challenge:
The bacterium Escherichia coli has served as a model organism for working out the
basics of genetic transformation and gene expression over the past several decades. E. coli
can be easily transformed with foreign DNA using a number of methods.
You will chemically treat a culture of E. coli cells to make them competent (ready to
take up foreign DNA). The chemically treated cells will then be mixed with various kinds of
DNA, and you will make predictions of phenotypes based on the forms of DNA you
transform with, and the kind of growth medium the transformed cells are incubated on.
Prior to coming to lab, propose a hypothesis about whether circular or linear DNA
fragments transform cells better. Also, propose a second hypothesis about the
relationship between the expression of the green fluorescent protein and the presence of the
sugar arabinose.
Work in groups of two to compare hypotheses, and to complete the experiments
suggested by these hypotheses.

Materials provided:
I.

A culture of Escherichia coli that is sensitive to the antibiotic ampicillin, and is

not fluorescent. Note: this strain of E. coli is non-pathogenic, meaning it does
not cause disease. However, federal guidelines stipulate that the bacterial
waste produced by this experiment should be disposed of as biohazardous,
so dispose of all used materials in the red containers in the lab. Be sure to
wash hands with soap after finishing in the lab, and wipe down bench
surfaces with antibacterial cleaner after you are finished in the lab.

II.

Agar growth medium that can support bacterial growth, with each of the
following additives (1 of each):
a. The antibiotic ampicillin at 100 micrograms/milliliter (but no
arabinose). This plate is marked with 1 green line on the side.
b. The sugar arabinose at 0.5% (w/v) concentration (but no ampicillin).
This plate is marked with 1 magenta line on the side.
c. Ampicillin at 100 ug/ml, and arabinose at 0.5% (w/v) concentration.
This plate is marked with 3 blue lines on the side.
d. Ampicillin at 100 ug/ml, and arabinose at 0.05 % (w/v)
concentration. This plate is marked with 3 orange lines on the side.

III.

2X TSS solution, which contains 20% (w/v) polyethylene glycol (MW 3350),
10% (v/v) dimethyl sulfoxide (DMSO), and 100 mM MgCl2, at pH 6.5.
44

IV.

V.

Transforming DNA
a. pUC19, circular, 25 nanograms
b. pUC19, linear, 25 nanograms
c. pGFP, circular, 25 nanograms
A lamp that produces long wave ultraviolet (UV) light, in approximately the
365 nanometer range.

Use the following information as you plan and then conduct your experiment:
1) You may want to test several different transformation conditions and controls
on each plate. If so, be sure to mark your plate into sectors to keep straight
which transformation is being streaked on each sector. Only mark the plates on
the bottom surface (the side containing the medium), NOT on the lids (in case
the lids get mixed up).
2) When labeling a plate, be sure to indicate the kind of medium in the plate
(Does it have the antibiotic? Does it have the sugar?), the transformation tested
in each sector, and write your name, your TAs name, and the date on each
plate.
3) To transform the cells, obtain a fresh 1.5 ml capped tube, and label the lid
appropriately. Add the DNA you want to transform with to the tube, or no
DNA if you are doing this control experiment. Next, add 50 microliters of E.
coli cells to the tube. Finally, add 50 microliters of ice-cold, 2X TSS to the tube.
Mix the TSS and the cells and the DNA (if present) by pipetting up and down
a few times. Leave the mixture in the tube and on ice for 10 minutes (a little
longer is also OK).
4) To transfer some of your transformation mixture to the appropriate plate, and
the appropriate sector on the plate, use a sterile, disposable loop. Dip the loop
into the transformation mixture, and youll see a thin film of the mixture
carried in the loop. Touch the loop to the surface of the medium in the plate,
and then carefully swish the loop back and forth over the surface of the chosen
sector until the entire sector is covered with trails from the loop.
5) In your notes, make predictions for each sector. Will anything grow, and if so,
why? If something does grow, will it show expression of the green fluorescent
protein? How will you be able to tell?
6) How will you know if the antibiotic is working as it should (ie. by killing
bacterial cells)?
7) How will you know if the plasmid gets transformed into cells?
8) How will you know if the GFP gene is expressed in the transformed cells?
45

9) After you plate your transformations, your plates will be incubated at room
temperature for a week. In your next lab session, retrieve your plates and
examine the results. Check for fluorescence by using an ultraviolet light source.
Record the number of colonies in each sector, and compare the results from all
the different plates, and all of the different transformations.

A few useful definitions

Genotype: The DNA sequences that an organism contains. Anything that changes
the DNA represents a change in genotype.
Phenotype: The outwardly measurable characteristics of an organism. Changes in
genotype sometimes lead to a change in phenotype, but not always.
Antibiotic: A small molecule that kills or halts the growth of bacteria.
Ampicillin: A specific antibiotic that is related to penicillin. Ampicillin kills bacteria
by inhibiting synthesis of the peptidoglycan cell wall.
Transformation: The introduction of foreign DNA into an organism. The new
DNA changes the genotype, and often the phenotype of the organism.
Competence: The ability of an organism to take up foreign DNA from the
environment. Many bacteria are naturally competent, meaning that they
take up DNA without any pre-treatment. E. coli requires chemical or
electrical treatment to become competent for transformation by foreign
DNA.
Plasmid:

A small, circular piece of DNA naturally found in bacteria. Plasmids

replicate independently of the cells chromosome. They typically contain
genes that confer a selective advantage to the cell.

Promoter: A DNA sequence that allows a gene to be expressed. The promoter

permits transcription of the gene (DNA RNA), and the RNA that is
made is then translated (RNA protein) by a ribosome. The protein
folds, and a change in phenotype is often observed through the
functioning of the protein. The pBAD promoter was identified in E. coli
and is controlled by the action of the sugar arabinose.
Activator of transcription: Promoters are usually subject to some kind of control by
proteins that bind to DNA (DNA binding proteins). The AraC protein
(produced by the araC gene) can activate (increase the function of) the
pBAD promoter.
Arabinose: A five carbon sugar that can be used as a food source by E. coli.
Arabinose can trigger synthesis of genes require for arabinose utilization
by affecting DNA binding by AraC.
46

Inducer:

A small molecule that affects the DNA binding activity of a

transcription factor. Arabinose is an inducer that affects AraC DNA
binding activity.

Questions
1) (2 points) Why is the antibiotic ampicillin important for plasmid transformation?
Whats the antibiotic doing, and what if it isnt there following transformation?
2) (2 points) Which phenotype(s) of E. coli does pUC19 affect? Which phenotype(s)
does pGFP affect? Which controls in your experiment allow you to be certain of
these claims?
3) (2 points) What was your hypothesis regarding the effect of DNA form on
transformation? Is the form of the plasmid DNA important for transformation?
How could you tell?
4) (2 points) What was your hypothesis regrading arabinose? What effect does
arabinose have on cells that contain pUC19? What effect does it have on cells that
contain pGFP? Does the concentration of arabinose have any effect on these
phenotypes?
5) (2 points) Many transgenic organisms have been created that contain the GFP gene.
Based on your observations here, is expression of the green fluorescent protein
harmful to cells? Which observations led you to your answer?
Lab 6 hypothesis and pre-lab Questions (5 points)
To receive full credit for this weeks lab write-up, prepare a hypothesis for the
experimental outcome and answers to questions A through C for the next lab, Lab 6 (see
page 56).

47

Lab 5 Draft Formal Lab Report

The first draft should not be regarded as a rough draft, but as a complete report that
represents your best effort. With a strong draft here, youll receive more useful feedback
from your TA, and will have an easier time producing a polished final draft. The first draft
will be graded as follows. Missing or deficient sections will result in point deductions.
a.
b.
c.
d.
e.

(2 points) Title and Introduction.

(2 points) Hypothesis and predictions.
(2 points) Experimental Procedure.
(2 points) Data/Observations/Results.
(2 points) Conclusions and References.
Formal Lab Report, Draft (10 points)

Scientific studies are reported to the public through the scientific literature, following a
process of peer review and professional editing. A typical scientific report consists of a series
of parts, including:
1) the Title of the study;
2) an Introduction that describes the scientific question being studied, and
how the study addresses it (this section often includes a Hypothesis);
3) a description of the Experimental Procedures used to test the hypothesis;
4) a report of the Results from the experiments;
5) a Conclusions/Discussion section that explains what the results mean
relative to the hypothesis, and any new insights that arise from the study; and
6) a list of References cited in the writing of sections 1) through 5).
All scientific reports follow some version of this conventional format, helping ensure
complete reporting by the scientist, and helping the reader find relevant information in the
report quickly.
Following the format detailed below, write a short, structured report to describe what
you have done. Your report should be no more than 2 pages, single-spaced, 12 point type.
Each section (except the title) should be given the headings indicated below, in boldface
type. Be accurate and complete, but concise.
Title: (0.5 pt)
Your lab report must have a title that is descriptive, clear, and concise.
Introduction: (1.5 pts)
The Introduction section should be one short paragraph in length and include: the
primary question being asked for the experiment, with appropriate background information
already known about the question. Think of answering these questions in this section: What
is your question, why is it a question in biology (what do we lack an understanding of), and
why is the question important?
Hypotheses: (2 pt)
The hypothesis is generally included at the end of the Introduction section, but for this
48

report it should be separate. A hypothesis should be stated as a truism related to the question
posed in the Introduction, a statement of how things work, and NOT as a prediction. Make
the hypothesis present tense.
Experimental procedure: (2 pts)
This section should include: Predictions that arise from your hypothesis, and how you
tested those predictions through experiment in the lab. Include your experimental design and
methods used to test your predictions. Make sure to describe your controls! Questions you
should aim to answer in this section are: What did you do? How did you do it?
Data/observations/results: (2 pts)
This section will contain a summary of your results, including graphs and tables. Be
sure to include: An introductory text description of all data (State general results, and refer
to tables and/or graphs for details) Try to answer the question What did you see/record
during the experiment?, but without discussing what the data means. Be descriptive. Any
table/figure/graph/drawing that you choose to include must contain captions. The tables
and figures you include in your report should all be specifically described in the results
section. Graphs must be a clear representation of your data, with properly labeled axes. An
example of an acceptable graph with a caption is provided below.

Hint: Captions indicate a figure number (to reference in the text of the results section), and a
description (to help to fill in the blanks about what the graph is saying). The question being
answered by a caption is What data is represented in this graph?
Conclusions: (1 pts)
This section explains whether the results support or do not support your hypothesis.
Here is where you explain what the data presented in the results section means. Identify if
your hypothesis was supported or refuted. If the hypothesis was refuted, attempt to explain
why this may be. If there were any procedural errors or potential weaknesses in the
experimental design that may have influenced your data collection, mention them here. Try
to answer the following questions in the section: What does the data mean, is your
hypothesis supported and why, and how do your results address the question posed in the
background section? You should also be able to pose a question to follow up what the
results tell you.
49

References: 1 pt)
This section will contain any references that you have used in writing your report.
You should include the lab manual in your list, as well as any other resource you found
valuable in researching and writing the report. APA format for references is most
appropriate, but MLA format is also acceptable.
Additional Information
Points will be subtracted for messy, unclear or poorly organized lab reports. Points will also
be subtracted for grammar errors, so proofread your work! Reports longer than 2 pages will
be graded on information in first 2 pages only. The draft report for lab 5 is due at the start
of lab 7. Late lab reports will NOT be accepted.

50

Laboratory 6: Measuring gene expression and promoter

strength
Objective:

In this lab you will monitor the expression (transcription and translation) of a
specific gene by measuring the activity of an enzyme. You will also observe how different
DNA promoter sequences affect the activity of RNA polymerase, through the action of a
DNA-binding protein.
As you complete the lab, you will develop a hypothesis, design an experiment to test
that hypothesis, and learn how to transfer accurately small volumes of liquid using a
micropipettor.
To receive full credit, you must prepare answers to questions A through C before this
lab starts. Your TA must sign off on this at the start of this lab.

Introduction

The genetic information contained in a cells DNA sequence does nothing on its
own, and genes need to be expressed in order to function.
Gene expression initiates at DNA sequences called promoters. Promoter DNA
sequence contains information that specifies the starting point for transcription (RNA
synthesis) by the enzyme RNA polymerase. RNA polymerase binds to promoter DNA
sequences and begins the process of RNA synthesis from the DNA template. The process of
transcription initiation is usually controlled very carefully.
Once the full-length RNA (also called a transcript) has been made, RNA
polymerase stops transcription, and the RNA (if it is messenger RNA) is translated by a
ribosome to make a polypeptide, which folds into its proper shape and carries out a specific
function.

Figure 1. The steps in gene expression

The level of expression of any given gene is usually determined by the number of RNA
transcripts made by RNA polymerase over time. Transcription can be controlled by
transcription activators (factors that increase rate of transcription). The catabolite
activator protein (CAP) is an example of a transcription activator.
51

transcription repressors (factors that decrease rate of transcription). The lac

repressor protein is an example of a transcription repressor.
intrinsic core promoter strength -- the DNA sequence of the promoter interacts
directly with RNA polymerase and defines the rate of transcription initiation by
RNA polymerase
or any combination of these three things.

This lab concerns transcription in the bacterium Escherichia coli. In bacteria,

transcription starts at a promoter with, at a minimum, two specific sequences called the 35
and 10 boxes (because they are 35 and 10 base pairs away from the transcription start site).
Following recognition of 35 and 10 by RNA polymerase, transcription starts and an RNA
transcript is made (Figure 2).
c ore promoter
-35
-10
DN A

Figure 2. Promoter DNA binding by bacterial RNA polymerase

In this lab, you will study how DNA sequence can control transcription efficiency
for a bacterial ribosomal RNA promoter (abbreviated rR). rR promoters make ribosomal
RNA (rRNA), which is a major component of the ribosome. Bacterial rR promoters are
exceedingly active, because a lot of rRNA is needed to make the ribosomes needed for
translation (protein synthesis).
The question you will address is: which DNA sequences are important for the
high level of transcription of the rR promoter?

A promoter that makes ribosomal RNA

FIS

FIS

52

Figure 3. The rR promoter. The start site of transcription (indicating the first
nucleotide acting as template for RNA) is labeled +1, and the direction of transcription is
indicated by the bent arrow. A DNA binding protein called FIS (Factor for Inversion
Stimulation, blue circles) interacts with DNA at site A (site A is part of the promoter
DNA). The numbers below the promoter represent distance in base pairs from the
transcription start site (+1).

THE EXPERIMENTAL SET UP

You have just started work in a molecular biology laboratory to study bacterial
promoters, with a specific emphasis on the rR promoter. You are given the following
information about the promoter. RNA polymerase binds to the sequences indicated by 35
and 10 in Figure 3. In nature the rR promoter controls the transcription of rRNA.
However, your lab has access to an rR promoter that has been placed next to the lacZ gene,
which encodes the enzyme -galactosidase, which is easy to measure.
The DNA binding protein FIS was previously found to bind (as a dimer) to site A
of the promoter (in the upstream direction relative to the way RNA polymerase moves on
the DNA). However, you dont know whether the FIS protein affects transcription from the
promoter. It could be an activator of transcription, a repressor of transcription, or it could
have no effect at all on the strength of the rR promoter.

Figure 4. Promoter sequences can be attached to the lacZ gene, allowing -galactosidase
activity to be used as a reporter of promoter activity
Your laboratory supervisor would like you to identify promoter sequences that
control the efficiency (strength) of transcription by RNA polymerase. So that you can
address this question, you are given four different bacterial strains, three of which contain a
variant of the rR promoter driving the expression of the lacZ gene (figures 4 and 5). By
measuring -galactosidase levels produced by these 4 strains, you can get a good estimate of
53

the strength of each promoter variant. This enzymatic assay gives an indirect read-out of
transcription of the rR promoter variants.
The three rR promoter variants are listed in Fig. 5.

Measuring gene expression using a reporter gene

The role of specific promoter sequences in the expression of a gene can be measured
in several ways:
Detecting specific RNA transcripts and measuring changes in transcription levels.
Detecting and measuring the protein product from the translation of the mRNA.
Using a reporter gene whose protein product can be easily and precisely
measured through a simple assay.
The first two methods are technically demanding and beyond the scope of this lab
manual.
Reporter genes, however, are often attached to other genes or DNA sequences, and
used by proxy to monitor expression because they exhibit clearly identifiable and measurable
properties when expressed. A very common reporter gene is the lacZ gene from E. coli,
which encodes the enzyme -galactosidase. This enzyme breaks down lactose, a
disaccharide, by cleaving the disaccharide bond, producing the monosaccharides glucose and
galactose.
-galactosidase enzymatic activity in cells can be measured by breaking open the cells
and adding ONPG (2-nitrophenyl -D-galactopyranoside), which is broken down by galactosidase to make the yellow product o-nitrophenol. The intensity of the yellow color
can be measured using a spectrophotometer, through absorbance at 420 nm. The A420
measurement allows estimation of the amount of -galactosidase (in Miller Units), and
therefore, the amount of transcription coming from the test promoter. The more Miller
Units measured, the more transcription of lacZ has occurred, and thus the more active the
promoter is.

54

E. coli strain A: 88 to +50

lac Z

E. coli strain B: 88 to +50 (deletion) [note: this contains a mutation that prevents FIS
binding to site A]
lac Z

E. coli strain C: 50 to +50

lac Z

E. coli strain D (control): no promoter

lac Z
Figure 5. Each of these rR promoter variants is next to the lacZ gene in E. coli strains A - C.
Strain D contains no promoter, and may be used as a control to measure background galactosidase activity in the absence of a promoter. Strain B contains a variant of 88 to +50
with a mutation in FIS binding site A that does not allow FIS binding. Each variant drives
transcription of the lacZ gene as illustrated in Figure 4. The core promoter (the part of the
promoter where RNA polymerase binds) is indicated by the dotted box.

55

Create a hypothesis (2 points)

A hypothesis is a statement that proposes to explain a phenomenon. A good
hypothesis is one that can be tested with an experiment. For example, you might phrase your
hypothesis like this: The presence of an intact FIS binding site is important for ________
to occur.
Your hypothesis may be tested by performing galactosidase assays using ONPG
(as described in Figure 4 and the accompanying text). Read the section below (Performing
the experiment) for details.
Pre-lab Questions
A. (1 point) You would like to know more about how the rR promoter works.
Given the background information about the DNA binding protein FIS (see
Figure 3 and the accompanying text), write a hypothesis that addresses the effect
of FIS binding sites (and by extension, FIS binding) on transcription activity of
the rR promoter. For reminder, a DNA binding protein may serve as an
activator or repressor of transcription, or it may have no effect at all.
B. (1 point) Given the different promoter variants fused to lacZ (see Figures 4 and
5), outline an experiment that uses the variants to address your hypothesis.
Include a prediction of results for your experiment.
C. (1 point) Strain D contains the lacZ gene without a promoter variant in front of it,
making it a control strain. What will measurement of the galactosidase activity
of this strain tell you? How will this measurement help you determine how
active the rR promoter is in strains A, B, and C?

56

Performing the experiments (work in groups of three)

E. coli strains containing the rR promoter variants are cultured at 30C in a growth
medium (broth). The cultures are grown to saturation (maximum growth density) prior to
class. Your TA will revive each culture by adding 10 ml saturated culture to 40 ml fresh
growth medium at the start of class. The cultures will then be allowed to incubate at 30C
for 30 to 60 minutes. After the cultures have been incubated, they will be placed on ice. Take
your samples from these cultures on ice.
For each strain that you want to test, you will be preparing three tubes: two tubes
(#1 & #2) that undergo a reaction with ONPG and may turn yellow, and one tube (#3) that
only contains diluted cell culture. The two tubes receiving ONPG are identical (replicate)
samples. The tube with just cell culture gives a measurement of the number of cells in that
culture.
You will measure the color or optical density of the solutions you with the
spectrophotometer. Recall from Lab 1: the spectrophotometer needs a blank (a solution that
is nearly identical to the solutions you intend to measure). Because you will be making two
types of solutions (tubes that will contain the ONPG reaction, and a tube that contains the
cells) you need two types of blanks for the spectrophotometer.
For each experiment you are doing, follow this protocol:
1) For each strain that you want to test for galactosidase activity, pipet 3 ml from the
(well-mixed) stock culture, and put it in a labeled test tube, on ice, at your
workstation. These will be your personal (table) stocks for doing the experiments.
Do not cross-contaminate the lab stock cultures.
galactosidase assays. Prepare three tubes for each culture you are testing (use the table
below as a guide).
2) Add 0.2 ml (200 microliters) of well-mixed stock culture to a spectrophotometer
tube (labeled with the strain you are testing) containing 1.8 ml Z-buffer (a buffer that
is suitable for galactosidase to work properly), for a total of 2 ml.
3) Add 60 microliters of chloroform, and 60 microliters of 0.1% SDS to each assay tube
(these components will break open the cells, releasing galactosidase into solution).
Cut a small piece of parafilm to cover the tube. Carefully vortex the tube for exactly
10 seconds, making sure that the solution doesnt spill out of the tube (do a trial run
with water only, just to get a feel for how to do it).

57

Prepare tubes 1, 2, and 3 for each stock culture (for all four cultures, thats 12 tubes).
Prepare one of each Blank tube.
Tubes 1 & 2
Blank Z
3
Blank X
(experimental (blank for
(cell density
(blank for
trials, do for tubes 1 & 2)
measurement
tube 3)
each strain)
for each strain)
Stock culture (E. coli) 200 l
--1.5 ml
--Water ----1.5 ml
1.5 ml
Cell growth medium ------1.5 ml
Z-buffer 1.8 ml
2 ml
----Chloroform 60 l
----60 l
0.1% SDS 60 l
----60 l
To start the color change reaction:
ONPG 400 l

400 l

When color reaction is complete , add:

1 M Na2CO3 1 ml
1 ml

---

---

---

---

4) For this step and the next step, start by doing only strain A -- its color change happens very quickly!
Then repeat steps four and five for strains B, C, and D. Prepare to start timing the reaction.
At time zero, add 400 microliters of ONPG (4 mg/ml) to the tubes containing the
lysed cells and Z-buffer. Mix well (but dont vortex).
5) Wait for yellow color to develop. While waiting, you may be able to attend to steps 6
or 7 below. When the color reaches the color of a yellow legal pad of paper (it helps
to hold a white sheet of paper behind the tube), add 1 ml 1M Na2CO3 to the reaction
and mix. The Na2CO3 addition stops the reaction, and also changes the pH, causing
the yellow color to intensify. Record the time (in minutes) elapsed since time zero,
when ONPG was added. Use the data collection table below for recording the
elapsed time.
Notes: The promoter variant in strain A produces a lot of galactosidase, so the assay
needs to be stopped very quickly, because the yellow color can reach saturation and you will
underestimate the actual galactosidase activity. However, some of the other promoter
variants are not very active (and the background strain is weakest of all). It may take a long
time (30 minutes to 1 hour) for yellow color to develop in these tubes. It is OK to stop them
before they reach yellow legal pad color, after 20 minutes for example.
6) When all ONPG assays have been stopped, blank your spectrophotometer using
the Blank Z tube. Then for tubes 1 and 2 record both the A420 (measures the
amount of yellow color/ONPG cleavage) and the A550 (measures the cell debris in
the reaction for a correction factor). Remember to blank the spec with Blank Z
every time you change the wavelength. DO NOT MIX these tubes before reading
58

them (you dont want to stir up the chloroform). If there is cloudiness from the
chloroform, wait for it to settle.
Record the absorbance (600 nm) of the stock cultures you are using (this tells you the
density, or number, of cells in the culture. The more cells, the more dense the culture is, and
the higher the A600)
7) While waiting for yellow color to develop, blank the spectrophotometer using the
Blank X tube. For each of your stock cultures, measure the A600 (which gives an
estimate of the cell density) as described by making tube 3: add 1.5 ml of the wellmixed stock solution to a spectrophotometer test tube containing 1.5 ml water, mix
well, and measure Absorbance at 600 nm. Record the value for each stock (see the
table below). You only need to do this once for each of your personal stocks (even
though youre doing the galactosidase assays in duplicate). The A600 is a correction
factor that corrects for variable cell density from one strain to another.
Calculations
8) You are now ready to calculate the galactosidase activity for each bacterial strain,
using Millers equation:
Miller Units = 10,000 x (A420 [1.75 x A550]) / (time x A600)
o A420: Absorbance at 420 nm, measures yellow color
o A550 x 1.75: correction factor for cell debris, other particulate matter that may
cause A420 absorbance, but is not cleaved ONPG
o time, in minutes: the more time it takes for the assay to turn yellow, the less
beta-galactosidase is present (fewer Miller Units)
o A600: an estimate of the number of cells that are used in the assay. This helps
to control for differences in cell numbers from one strain to another.
o Note: the Miller Units value should not be less than zero. If you end up with
a number that is negative, it is probably because of measurement error
causing the A550 to be abnormally high, along with the A420 being very low.
(0.5 point) Show your calculations for the Miller units measurement of at least one
experiment. Calculations must be typed.

59

A short discussion of light wavelengths, transmittance, and absorbance

WAIT! you may be thinking. Why are we using light of wavelength 420 nm to
measure the yellow color? 420 nm is on the violet/indigo end of the visible spectrum, far
from yellow wavelengths (570-590 nm)!
Well, consider this:
You want to measure how yellow a clear solution has become. A solution that
appears yellow is absorbing white light, transmitting predominantly the yellow wavelengths
(Fig A). A solution that appears clear is absorbing very little light and transmitting all the
wavelengths of white light (Fig B).
If you were to set your spectrophotometer to a yellow wavelength, you would see
that both solutions are transmitting the yellow wavelength, and so you would not be able to
measure the yellowness of the solution. If you set your spectrophotometer to a different
wavelength (like violet) you would see that only the clear solution is transmitting that
wavelength, while the yellow solution is absorbing it, allowing you to distinguish the
solutions.

60

Data collection (1 point). Recreate this table in Excel.

strain promoter A600 trial
A420
A550
Start
time
1

Stop
time

Total time
(min)

Miller Units

(1 point) Use Excel to make a bar graph that shows values (in Miller Units) for each strain.
Be sure to average the values for the duplicate experiments.

61

Results and questions

1) (1 point) Do the results from your experiment support your hypothesis about the
role of the FIS binding site in the rR promoter? Why or why not? Explain how your
results support your conclusion.
2) (0.5 point) Do you think the DNA binding protein FIS is a transcriptional activator,
a repressor, or neither? Explain why.
3) (1 point) When you measure the A420, you are measuring the absorbance of this
wavelength of light by o-nitrophenol. What does this color change report about beta
galactosidase? Why does this indicate the level of lacZ transcription? Explain how
this measurement can provide a reasonable estimate of promoter activity in the
bacterial strains you were given.

62

Laboratory 7: DNA evidence in forensic investigations-analysis of DNA sequence using restriction endonucleases and
gel electrophoresis
Objective:
The purpose of this lab is to illustrate one way of comparing DNA sequences: by
comparing DNA fragment lengths after digestion with restriction enzymes. This lab also
introduces an important molecular biology lab technique: gel electrophoresis. After
performing these lab excercises you should understand 1) DNA cleavage by restriction
enzymes, 2) agarose gel electrophoresis, and 3) the impact of natural sequence variation in a
population on the validity of DNA fingerprinting results.
DNA fingerprinting
Technicians working in forensic labs are often asked to do DNA profiling or
fingerprinting to analyze evidence in law enforcement cases and other applications. DNA
fingerprinting may require polymerase chain reaction (PCR) amplification (if only tiny
quantities of DNA are available), and often involves restriction fragment length
polymorphism (RFLP) analysis. With RFLP the difference in DNA sequence translates to
different cleavage sites for restriction enzymes, and therefore different fragment patterns
after gel electrophoresis.
One step in human RFLP analysis requires comparison of band patterns produced
by cleavage of DNA samples and DNA fragment separation on an agarose gel (much more
on these topics below). In this lab, DNA band patterns are produced from one sample that
represents DNA taken at a crime scene, and compared with five samples representing DNA
obtained from suspects in the case. This exercise is similar to the more elaborate technique
that is actually performed using complex human DNA samples.
Restriction enzymes
A restriction enzyme scans DNA molecules, weakly binding to the DNA double
helix until it recognizes (strongly binds to) a specific sequence of base pairs. When it finds
its recognition sequence (called a restriction site), the enzyme changes shape and digests
(breaks) the sugar-phosphate backbone of the DNA molecule like molecular scissors.
If a specific restriction site occurs in more than one location on a DNA molecule, a
restriction enzyme will make a cut at each of those sites, resulting in multiple DNA
fragments. Therefore, if a given linear piece of DNA is cut with a restriction enzyme whose
specific recognition sequence is found at two different locations on the DNA molecule, the
result will be three fragments of different lengths. If the given piece of DNA is circular and
is cut with a restriction enzyme whose specific recognition sequence is found at two different
locations on the DNA molecule, the result will be two fragments of different lengths. The
length of each fragment will depend upon the location of restriction sites on the DNA
molecule, and the distance between those sites.
The recognition sequences for two commonly used enzymes, EcoRI and PstI, are
shown below. The place on the DNA backbones where the DNA is actually cut is shown
with a scissors symbol:
63

Like all enzymes, restriction enzymes function best at specific solution conditions
and temperatures. The proper restriction enzyme buffer has been included with the DNA
sample, so that when the DNA and enzymes are mixed, the ideal conditions are created for
the enzymes to function optimally. The reaction buffer for the experiments below consists
of

50 mM (millimolar) Tris (a buffer to maintain pH 8, which permits proper

enzyme function)
100 mM NaCl (a salt concentration that permits action of the restriction
enzyme),
10 mM MgCl2 (the Mg++ cations are required for enzyme catalysis)
1 mM DTT (dithiothreitol, which prevents disulfide bonds from forming,
maintaining enzyme function)

This solution creates ideal conditions for EcoRI and PstI enzymes to function. Both
enzymes function well at 37C (which makes sensethe genes for both enzymes come from
bacteria [Escherichia coli and Providencia stuartii] that are symbionts or pathogens of humans
[constant 37C body temperature]).
DNA that has been cut with restriction enzymes can be separated and observed
using a process known as agarose gel electrophoresis (the term electrophoresis means to
carry with electricity).
Agarose gel electrophoresis
Electrophoresis separates DNA fragments according to their relative size. DNA
fragments are loaded into an agarose gel slab, which is placed into a chamber filled with an
electrically conductive buffer solution. A direct current is passed between wire electrodes at
each end of the chamber. DNA fragments are negatively charged (because of the phosphate
groups on the backbone), and when placed in an electric field will be drawn toward the
positive pole. The matrix of the agarose gel acts as a molecular sieve through which smaller
DNA fragments can move more easily (and therefore more quickly) than larger ones. Over a
period of time smaller fragments will travel farther than larger ones. DNA fragments of the
same size stay together and migrate in single "bands" of DNA.
An analogy for this process is to think of the gel as a classroom in which all the desks
and chairs have been randomly scattered around the room. An individual student can walk
through the maze of furniture quickly and with little difficulty, whereas a string of four
64

students holding hands would need more time and have difficulty working their way through
the maze.
DNA is colorless, so DNA fragments in the gel are not visible during
electrophoresis. A blue loading buffer, containing two blue loading dyes, is added to the
DNA solution. The loading dyes do not stain the DNA but make it easier to load the gels
and monitor the progress of the DNA electrophoresis. The two dyes migrate toward the
positive end of the gel, just like the DNA fragments. The faster dye (bromophenol blue)
co-migrates with DNA fragments of approximately 500 base pairs, while the slower dye
(xylene cyanol) co-migrates with DNA fragments approximately 5000 base pairs in size.
A stain must be used to pinpoint the location of DNA on the gel. When the gel is
immersed in a dilute solution of ethidium bromide (EtBr), or some other stain specific to
DNA, the staining molecules attach preferentially to the DNA molecules trapped in the
agarose gel. To enhance contrast and to easily visualize the DNA bands, excess background
stain can be removed from the gel by destaining the gel with water. EtBr is highly
fluorescent when illuminated with ultraviolet (UV) light, so the DNA can be visualized by
UV illumination. Other stains, such as the Fast Blast you will use in this lab, can be seen in
visible light.
Population genetics and the reliability of DNA fingerprinting
Two major factors affecting the reliability of DNA fingerprinting technology in
forensics are population genetics and genetic statistics. In humans there are thousands of
RFLP loci or DNA segments that can be selected and used for fingerprinting analysis.
Depending on demographic factors such as ethnicity or geographic isolation, some segments
will show more variation than others. Some populations show much less variation in
particular DNA segments than others. The degree of variation will affect the statistical odds
of more than one individual having the same sequence. If 90% of a given population has the
same frequency in its DNA fingerprinting pattern for a certain DNA segment, then very
little information will be attained. However, if the frequency of a DNA pattern turning up in
a population for a particular segment is extremely low, then this segment can serve as a
powerful tool to differentiate individuals in that population.
Different populations have different genotypic patterns because of changes in their
gene pools over time. Therefore, in analyzing how incriminating the DNA evidence is, one
needs to ask the question: Statistically how many people in a population may have the same
pattern as that taken from a crime scene: 1 in 1,000,000? 1 in 10,000? Or, 1 in 10?
Summary of this lab
In this experiment youll make a restriction endonuclease digestion pattern for 1
sample of DNA representing DNA collected from a crime scene. Youll also make patterns
for 5 DNA samples representing suspects in the criminal case. After agarose gel
electrophoresis of the restriction digestions, youll be able to examine the DNA banding
patterns and see if any of the suspects band patterns match that of the DNA found at the
crime scene. This kind of evidence has become a staple in the modern court room.

65

Experimental protocols: Restriction digestion

Work in groups of 3.
Prepare the DNA Samples
1. Note that your TA has a tube containing the restriction enzyme mix, labeled ENZ,
on ice. Your TA will pipet this for your groups stock tube.
2. Label one of each microtube as follows:
a. CS = crime scene
b. S1 = suspect 1
c. S2 = suspect 2
d. S3 = suspect 3
e. S4 = suspect 4
f. S5 = suspect 5
Also label the tubes with your group name.
3. Pipet 10 l (microliters, use the micropipet providedpractice using the pipets with
water until you get the hang of it) of each DNA sample from the stock tubes and
transfer to the corresponding microtubes. Use a separate tip for each DNA sample.
Make sure the sample is transferred to the bottom of the tubes.
4. Pipet 10 l of enzyme mix (ENZ) into the very bottom of each tube. Use a separate
tip for each ENZ sample.
5. Cap the tubes and mix the components by gently flicking the tubes with your finger.
If a microcentrifuge is available, pulse spin in the centrifuge to collect all the liquid in
the bottom of the tube. Otherwise, tap the tube on a table top.
6. Place the tubes in the 37 C incubator and let the reaction proceed for 30 min.
Gel electrophoresis
1. Remove your digested DNA samples from the incubator.
2. Using a separate tip for each sample, add 5 l of loading dye "LD" into each tube.
Cap the tubes and mix by gently flicking the tube with your finger.
3. Your TA will provide you with an agarose gel in a gel-running apparatus. [Note: The
gel may contain ethidium bromide, which is a toxic substance. Do not handle the gel
without gloves (your TA will do all of the gel manipulations while wearing gloves)].
Make sure that the gel box contains gel running buffer (NOT water), which is
required to carry the current necessary for electrophoresis to work.
4. Check that the wells of the agarose gels are near the black (-) electrode and the base
of the gel is near the red (+) electrode (DNA Runs to the Red)
66

5. Obtain your DNA that was isolated from cheek cells in a previous lab (your TA will
have it). Mix 15 microliters of your DNA with 5 microliters of loading dye, and load
this DNA/dye mixture in the first (left-most) wells in the gel. DO NOT ADD
RESTRICTION ENZYME TO THIS TUBE. Make sure to leave 7 wells in the gel
for the restriction digests! Keep track of which lane in the gel contains which DNA
sample.
6. Using a separate tip for each sample, load the indicated volume of each sample into 7
wells of the gel. Take care not to puncture the bottom of the well with the pipet tip.
Lane 1: M, DNA size Marker, 10 l. DNA size marker contains 6 DNA
fragments with the following sizes (in base pairs): 23130, 9416, 6557,
4361, 2322, and 2027. The DNA marker needs dye added before
loading: your TA should do this for you.
Lane 2: CS, 20 l
Lane 3: S1, 20 l
Lane 4: S2, 20 l
Lane 5: S3, 20 l
Lane 6: S4, 20 l
Lane 7: S5, 20 l
7. Connect the gel to the power supply and electrophorese your samples at 125 Volts
for 30 minutes, or until the bromophenol blue (the fastest-moving loading dye) has
run 3/4 of the way down the gel.
8. When the electrophoresis is complete, turn off the power supply and remove
chamber lid. Very carefully remove gel and tray from gel chamber. Slide gel into
staining tray.
9. Wearing gloves, pour just enough DNA stain (either ethidium bromide or fast
blast) into staining tray to barely cover the top of the gel. Stain gel for 10 minutes
with gentle agitation.
10. Carefully transfer gel into a washing container and rinse with warm water (40-55 C)
for 30 seconds. Decant.
11. Destain again by washing twice in warm water for 5 minutes with gentle shaking. To
avoid breakage, do not pour the water directly onto the gel. After destaining it may
take 10 minutes for the bands to appear more solid. Your TA will place gel on light
board to take a photo of your gel.
12. (2 points) Obtain the photo of your gel, or of an example gel provided by your TA.
The gel must be analyzed using the LoggerPro method for gel analysis, as below.
Recreate the resulting table in Excel or Word and include in your lab report.
a. Open the Vernier LoggerPro 3.7 program.
b. In the Main menu select Insert.
c. Select Gel Analysis. Select the file to be analyzed.
d. On the toolbar to the right of the gel select the first icon Set Origin.
67

e. Click anywhere on the photo of the gel.

f. Align the yellow horizontal line with the wells in the gel. If the gel is not
straight, click on the yellow circle on the line and rotate the line until it is
straight with the wells.
g. Select the second button Set Scale. Place the cursor on the bottom left of
the gel and drag across to the other side. A new horizontal line is now
created marking the end of the gel. In the Scale window enter the distance
and units that correspond with distance between the wells and the end of the
gel. The units can be in centimeters or millimeters.
h. Select OK.
i. Select the third button Set Ladder.
j. Move the cursor over to a clear band of the ladder you known the size of and
click. In the pop up window Events With Entry enter the value for the
first lane (e.g. 2,000 bp). Press OK. Notice that a bullet appears on the
band, a table is created on the bottom of page and a graph on the right side.
For increased precision it preferable to select a band that is both sharp and as
low on the gel as possible. Continue entering values for other bands of the
ladder. If some bands are badly smeared they should not be selected.
k. Select the forth button Add Lane. Click on the button Add Lane from
the pop up window. Click on a band to be analyzed within one a sample
lane. A bullet will appear on the band.
l. Each time a band is identified, select Add Lane and select the Add Lane
again. If you just click on the button nothing will happen. Continue with
adding lanes and band labels.
m. The columns at the bottom left of the page can be labeled. Double click on
the Lane # from the table and add the desired change.
n. In the table the size of each selected band will be given in bp. Recreate this
table in Excel or Word and include in your lab report.

68

Lab report questions:

1. (2 points) Did any of the suspect DNA patterns match the crime scene DNA pattern? (if
your gel did not yield results, look at someone elses, or ask the TA for an example gel). Why
do the patterns match? Does this necessarily prove that the suspect with a matching pattern
is guilty of the crime? In your answer, consider population size and random variation within
the population, as well as other caveats for DNA fingerprinting.
2. (1 point) What did your (or anybody elses) cheek cell DNA look like? Why would it be
different from the crime scene or suspects DNA?
3. (1 point) Consider the two samples of DNA shown below - single strands are shown for
simplicity:
Sample #1
CAGTGATCTCGAATTCGCTAGTAACGTT
Sample #2
TCATGAATTCCTGGAATCAGCAAATGCA
If both samples are treated with the restriction enzyme EcoRI [recognition sequence
GAATTC, see introduction for details], indicate the number of fragments and the
size of each fragment (consider the above single strands only) from each sample of
DNA.
Sample # 1
# of fragments:________

Sample # 2
# of fragments:_________

List the sizes of DNA fragments following EcoRI digestion (length in number of
bases) of both samples.
4. (2 points) After DNA samples are loaded into the sample wells, they are forced to
move through the gel matrix.
a) What size fragments (large vs. small) move toward the opposite end of the gel most
quickly? Explain.
b) How does DNA move through the gel during electrophoresis? What physical
characteristic of DNA facilitates this movement?
5) (2 points) The suspect DNA sequences used in this experiment are actually plasmids
(small, circular pieces of DNA that replicate in bacteria). The restriction map of one of the
plasmids used as suspect DNA is shown below. A restriction map refers to the positions
where restriction enzymes will digest a DNA molecule. Several different restriction enzymes
are listed for this plasmid. The number after each restriction enzyme indicates the location of
the restriction site relative to the origin of numbering of the plasmid (this plasmid is
numbered 1 to 5869).
69

a) How many DNA fragments arise when this plasmid is cut with both EcoRI and
PstI? What are the sizes of these fragments?
b) Can you tell which suspect this plasmid corresponds to? Think about the DNA
fragment pattern expected on the gel, given the DNA sizes predicted in a). Compare
to the patterns that you see for each suspect on the gel. Be aware that small DNA
fragments take up less stain, and may be too faint to see in the picture.

Peer Review of FLRs ( 5 points)

Critique the writing of your fellow scientist. Follow the instructions given by
your T.A. and prepare your edits (working in a group is encouraged). Due at the start
of next weeks lab (5 points).

70

Laboratory 8: Cell Division in Plants and Animals

Objective: In this lab section you will use microscopy to visualize cell structures associated
with simple cell division (mitosis), and sexual cell division (meiosis). By the end of the lab
you should be able to look at a cell under the microscope and determine which stage of
mitosis or meiosis it is in, and you should be able to label the relevant structures of the cell.
Cell division brings about the formation of two new cells, each potentially identical
to the single cell that gave rise to them. Growth of plants and animals involves an increase in
volume and cell number. The division of pre-existing cells makes the increase in cell number
possible. Mitosis and meiosis refer to the division of the nucleus and its chromosomes.
Cytokinesis refers to division of the cytoplasm.
I. CELL DIVISION IN PLANTS
In plants, growth by the formation of new cells occurs primarily in meristems, or
regions of actively dividing, undifferentiated cells. A typical plant has several meristems.
These may be continually active or activated only at particular times in the life cycle of the
plant. One such meristem is found at the tips of roots. Root tip meristems continually
provide new cells for growing roots.
Mitosis results in the formation of two nuclei with chromosome number that is
identical to the parent nucleus. Mitosis is usually described by 6 phases.
Interphase
Includes G1, S, and G2 phases
Nucleus: chromosomes not visible.
Nucleolus (ribosome synthesis center in nucleus): visible, darkly stained.
Nuclear membrane present.
Chromosomes: a granular mass, sometimes faintly visible, thin and tenuous.
G1: Gap phase, cell grows, organelles divide
S: DNA replication, chromosomes duplicate to form 2 sister chromatids,
attached to each other at the centromere.
G2: More cell growth, preparation for division.
Prophase
Chromosomes become visible within the nucleus as chromatin (the DNA
and protein that makes up chromosomes) condenses.
Chromosomes: can be seen as thin, coiled threads.
They become shorter and more distinct. Each chromosome contains 2
identical sister chromatids, joined at their centromeres.
Prometaphase
The nuclear envelope breaks down.
Chromosomes connect to the spindle fibers at kinetochore.
Metaphase
71

The spindle develops from each pole toward the equator of the cell. Spindle
fibers attach themselves to the kinetochores located on the centromeres of
each chromosome.
Chromosomes become active and line up in the middle of the cell.

Anaphase
Spindle microtubules shorten and pull the sister chromatids apart. One
chromatid goes to each pole.
The chromatids are now the new chromosomes.
Telophase
Nuclear envelope re-forms.
Chromosomes uncoil, become less visible, returning to interphase
condition.
Nuclear membrane reappears, surrounding each new nucleus.
Nucleolus reappears in nucleus.
Cytokinesis
Cytoplasmic division
May begin before mitosis is complete
Vesicles of Golgi Bodies become concentrated between the two daughter
nuclei. The fusion of the vesicles and the blending of the material in the
vesicles gives rise to a region called the cell plate, a new membrane structure
that extends across the cell between the daughter cells.
Cellulose and other material are synthesized on either side of the cell plate
and the new primary walls are formed.
Microscopic observation of mitosis in plants
All stages of mitosis are visible on the prepared slides of onion root tips (Allium).
Examine these slides carefully and find the following stages and associated structures. Scan
with 4X, 10X, and then 40X objectives for detailed observations. Compare what you see in
prepared slides with the photographs of mitotic phases in your textbook.
I.A. (3 points) Draw one example of each of the stages of cell division in plants (on
separate sheets of paper), and label the following structures: cell wall, nucleus, nuclear
membrane, nucleolus (if seen), chromosomes, spindle, chromatid, centromere, and cell
equator. If a structure is not visible, specifically indicate the position where the feature
should be found. Indicate the total magnification used.
Interphase
Prophase
Metaphase
Anaphase
Telophase
Cytokinesis
72

Mitotic cells in fresh Allium root tips: the chromosome squash

1. Collect two onion root tips and trim so that you have about 2mm of the very end of
the root. Use a dissecting scope to be sure that you collect the tip.
2. Soak the tips in a few drops of 1 M HCl (hydrochloric acid) in a watch glass for
about 15 to 20 minutes. In a separate watch glass, do the same with 2mm sections of
root distant from the tip.
3. Transfer the samples to a few drops of acetocarmine stain for about 15 min
(WARNING: Acetocarmine is corrosive and stains skin and clothes. It does not
come out. Take care in handling it).
4. Transfer one tip to a few drops of water on a slide.
5. Lower a cover slip onto the tip and press it down gently so that the tip squashes out
to about 7 mm in diameter.
6. Look for cells exhibiting mitosis under high power (40X).
7. If this fails for any reason try your other root tip

I.B. (1 point) Briefly describe your observations:

I.C. (0.5 point) Why look for mitotic cells only at root tips?

I.D. (0.5 point) Do the same procedure with root material distant from the tip. What
did you see?

II. CELL DIVISION IN ANIMALS

A major difference between plants and animals is that plants have meristems where
cell divisions continually take place, while animals do not. Instead, cell divisions occur
continually throughout many tissues of an animals body, replacing worn-out or damaged
cells. The location of the exact sites of division is unpredictable. Thus, it is difficult to find
an abundance of division figures at any given time in animals unless embryonic tissues (such
as blastulas) or abnormally proliferating tissues (such as cancer tumors) are studied.
Although mitosis is not localized to specific sites in animals, the process is remarkably
similar to mitosis in plants.
Fertilization of an ovum by a sperm produces a zygote. In animal cells, the zygote
undergoes a special type of cell division (cleavage) in which little increase in cytoplasm
occurs between division, and a ball of small cells is produced (the blastula). Within the
blastula, repeated nuclear and cytoplasmic divisions take place. The whitefish blastula
provides an excellent example for cell division in an animals.
73

Mitosis in animals
Interphase
The nucleus and nucleolus are visible, but chromosome is diffuse. No cell
wall.
Prophase
The first obvious difference between mitosis in plants and animals is found in
prophase: animals have centrioles (associated with their centrosomes, the
microtubule organizing centers in the cytoplasm) while plants do not. As seen
with the electron microscope, centrioles are barrel-shaped structures
consisting of nine radially arranged triplets of microtubules. Although the
centrioles are too small to be resolved with your light microscope, you can
see a star burst pattern of spindle fibers that appear to radiate from the
centrioles. Other microtubules extend between the centrioles, forming the
spindle.
Chromosomes become visible as the chromatin condenses.
Prometaphase
Nuclear envelope breaks down, spindle fibers attach to kinetochores.
Metaphase
Duplicated chromosomes (each consisting of two sister chromatids) line up
on the spindle equator (label this region).
Anaphase.
As in plant cells, anaphase begins with the separation of sister chromatids
into individual (daughter) chromosomes.
Telophase
Telophase is characterized by the arrival of the individual (daughter)
chromosomes at the poles. A nuclear envelope forms around each
daughter nucleus. Note the condition of the spindle and evidence of a
nuclear envelope
Cytokinesis
Different from plants: cell plates are absent in animal cells.
Furrowing occurs: the sides of the cell pinch inward to separate the
daughter cells
Microscopic observation of mitosis in animals
Examine a slide labeled Ascaris Blastula. Scan it with 4X, 10X, and then 40X
objectives for detailed observations. On a separate sheet of paper, draw and label one
example of 5 of the 7 phases of mitosis as described below, with the 40X objective. See
diagrams available in the lab or in your textbook as a guide.
74

IIA. (6 points) Draw the Stages of Cell Division in Animals (use separate sheets of
paper). Label the spindle, chromosomes, cytoplasm, nuclear membrane, and the likely
positions of the centrioles where appropriate in all drawings, and indicate the total
magnification used. Indicate the position of the furrow in cytokinesis. If a structure is not
visible, specifically indicate the position where the feature should be found, and indicate in a
different color pen or pencil.
Interphase
Prophase
Metaphase
Anaphase
Telophase
Cytokinesis
III. CELL DIVISION AND SEXUAL REPRODUCTION
MEIOSIS
Organisms that sexually reproduce grow via mitosis. However, meiosis, a process
that produces male and female 1n (haploid) gametes, also occurs. Gametes from 2
individuals then combine in fertilization to produce a 2n (diploid) zygote, and developing
embryo. This process occurs in some plants, fungi, and all animals.
In sexually reproducing plants, the male gametes pass through a pollen tube that
grows toward the female ovule deep within the flower. Fertilization occurs when the sperm
nuclei fuse with the egg nuclei in the ovule.
The stages of meiosis can be readily seen in prepared slides of the lily anther, the
structure in which the pollen develops. One reason that the lily is a good choice for
observation of meiotic figures is because Lilium spp. have rather large nuclei and
chromosomes. In this part of the laboratory exercise, you will survey a slide of lily anthers to
find and draw at least four different meiotic figures from the following list of stages.
Prophase I
In early prophase I, the chromatin has resolved itself into 2 sets of 12
chromosomes. Thus, there are 24 chromosomes or 12 homologous pairs.
Each chromosome is made up of two chromatids. One chromosome in each
homologous pair comes from the male parent; the other from the female
parent. In late prophase I, the homologous chromosomes form a
synaptonemal complex, in which the two pairs of chromatids exchange
genetic information (crossing over). The rest of meiosis involves distribution
of one chromatid of each to 4 male nuclei. In late prophase, the nuclear
membrane disappears and the spindle begins to develop.
Metaphase I
The 12 paired chromosomes are aligned on the cell equator, equidistant form
the poles of the spindle. The chromosomes are linked via their centromeres
to the spindle fibers.
75

Anaphase I
In this stage, homologous chromosomes move apart from each other toward
opposite poles.
Telophase I
The separated homologous chromosomes arrive at opposite poles and
formation of a nuclear membrane around the deeply stained but indistinct
chromosomes may be seen. Cytokinesis (formation of a cell plate) occurs.
Prophase II
Chromosomes are visible in the nuclei of the two recently divided cells.
Metaphase II
The 12 chromosomes (each composed of 2 chromatids held together by the
centromere) lie on the cell equator.
Anaphase II
The centromeres separate, releasing the chromatids from each other. Now
you can call each of these separated chromatids, chromosomes.
Telophase II
The chromosomes arrive at the poles. Cell plates are formed. The group of
four 1n cells will remain together for a time. Later, they each will undergo
further mitotic divisions to develop into male gametophytes contained within
individual pollen grains.
Microscopic observation of meiosis in plants
III.A. (4 points) Draw 4 different meiotic stages from the lily anther slides. Use separate
sheets of paper, and clearly indicate the stage that is being drawn. Label the nuclei,
chromosomes, spindle, and indicate the total magnification used for the observation. If a
structure is not visible, specifically indicate the position where the feature should be found.

76

Name: ___________________________, Bi214, Day: _________, Time: _________

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X
77

Name: ___________________________, Bi214, Day: _________, Time: _________

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X
78

Name: ___________________________, Bi214, Day: _________, Time: _________

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X
79

Name: ___________________________, Bi214, Day: _________, Time: _________

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X

Fig ____: ____________________________

Total magnification: ________X
80

Laboratory 9: Basic bioinformatics and BLAST

This lab will be posted on D2L.

81

Laboratory 10
I.
Mendelian genetics in maize.
II.
A 17th century Leeuwenhoek-style microscope
Objectives
The purpose of Part I is to predict and then observe the phenotypic ratios resulting
from genetic crosses of maize. You will pose and then test hypotheses concerning allele
inheritance and dominance and recessiveness of traits. Recorded results will be subjected to
statistical analysis to estimate their significance.
The purpose of Part II is to use common materials to make a microscope, to
measure the power of the microscope, and then to use the microscope to examine various
materials.

Part I. Mendelian genetics.

Introduction.
The basic principles of genetics were first set out by Gregor Mendel, following his
studies of the garden pea, Pisum sativum. The traits (phenotypes) that Mendel chose to track
exhibited simple dominance/recessiveness relationships. In addition, their inheritance was
not complicated by chromosomal proximity to other traits being studied, allowing
independent assortment of traits. Since the traits in these breeding experiments behaved in
straightforward ways, it was relatively uncomplicated for Mendel to link phenotypes (visible
manifestations of traits) to genotypes (genetic determinants of traits). This lab aims to
demonstrate similar trait behaviors.
Pea plants produce a relatively small seed set in each pod, so numerous seed pods
must be examined in order to determine the inheritance of seed-based phenotypes such as
color variation, or smooth vs. wrinkled surfaces. In contrast, corn (Zea mays) produces ears
that contain many seeds that are immobilized when dried, making corn seed-based
phenotypes very easy to track in the lab setting.
Domestication of corn probably began around 8 - 10,000 years ago in Mesoamerica
(modern day Mexico). The precise origin of modern strains of corn (also commonly called
maize) is not clear, but they are thought to derive at least in part from the plant teosinte.
Corn genetics have been a subject of intense study throughout the 20th century, largely
because of the economic importance of corn in 2007, the United States produced more
than 13 billion bushels of corn, processed for a variety of uses, including food, animal feed,
biofuels, and bioplastics.
In this lab, you will score corn phenotypes by observing ears of corn whose kernels
(seeds) represent the offspring produced from mating parents with known genotypes. Be
sure to remember that each kernel of corn represents one offspring from the cross, since it
has the potential to develop into an adult plant if it gets planted. Each kernel has its own
phenotype, and this phenotype will provide a clue to its underlying genotype.
82

Data collection.
You will track the action of two corn genes, R and T, through easily scored kernel
phenotypes of color (R) and shape (T). Work in pairs, with one partner reading the
phenotypes, and the other partner recording the results.
Corn kernels vary widely in color because of the presence or absence of pigments.
The kernels of corn you will examine are either purple or yellow, depending on the
production of the pigment anthocyanin in the aleurone layer of the kernel. The R gene
permits the synthesis of anthocyanin in the aleurone and gives a purple kernel. The loss of
this gene (in r/r kernels) gives a colorless aleurone and a yellow kernel.
Write the phenotypes (purple or yellow) for the following genotypes:
R/R: ________________
R/r: ________________
r/r: ________________
Corn kernels also vary in their amylose starch content. The kernels of corn you will
examine are either smooth or wrinkled, depending on the starch levels present in the kernel.
The T gene leads to production of high levels of starch, which causes the kernels to keep
their smooth shape without wrinkling upon drying. When the T gene is not expressed (in t/t
kernels), the kernels contain high levels of sucrose (sweet corn, which we eat as corn on the
cob), and become wrinkled upon drying.
Write the phenotypes (smooth or wrinkled) for the following genotypes:
T/T: ________________
T/t: ________________
t/t: ________________
bench:

Three homozygous parental corn strains are available for observation at the TA
A:
B:
C:

purple, smooth (R/R T/T)

yellow, smooth (r/r T/T)
yellow, wrinkled (r/r t/t)

83

(2 points) Consider a monohybrid cross between parental strains A and B. Predict

the genotypic and phenotypic ratios of the F1 generation (products of the parental cross)
and the F2 generation (products of crossing two F1 individuals). Note: you only need to
consider the R gene in this cross.

F1:

genotypic ratio =

_____________________

F1:

phenotypic ratio =

_____________________

F2:

genotypic ratio =

_____________________

F2:

phenotypic ratio =

_____________________

84

(2 point) Now choose an ear of corn labeled E, which represent the F2 product of
this monohybrid cross. Record the phenotypes for at least 6 rows of kernels below. What is
the actual phenotypic ratio for this monohybrid cross? How well does it match the predicted
phenotypic ratio? (Note: you do not need to do chi-square analysis of these numbers).

(3 points) Now consider a dihybrid cross, between parental strains A and C. Predict
the genotypic and phenotypic ratios of the F1 generation (products of the parental cross)
and the F2 generation (products of crossing two F1 individuals). Show your work below or
on a separate sheet of paper.

85

F1:

genotypic ratio =

_____________________

F1:

phenotypic ratio =

_____________________

F2:

genotypic ratio =

_____________________

F2:

phenotypic ratio =

_____________________

(1 point) Now choose an ear of corn labeled G, which represents the F2 product of
this dihybrid cross. Record the phenotypes for at least 6 rows of kernels below. What is the
actual phenotypic ratio for this dihybrid cross?

86

To determine the significance of the data you collected, perform a chi-square

analysis. This statistical test compares experimentally gathered values to expected values.
Since experimental values will not match the expected exactly in most cases, you need a way
to decide when the variation is so high that the hypothesis is no longer supported. The chisquare analysis will tell you if your data is unlikely to support the predicted outcome.
The formula for this analysis is 2 = (d2/e)
2 = chi-square
= sum of
d = difference between expected and observed values
e = expected value
For the dihybrid cross, you are observing four traits (purple smooth, purple wrinkled,
yellow smooth, and yellow wrinkled), and therefore will sum four (d2/e) values to get the 2
value, using the following table. (Note: N = the total number of kernels scored for ALL
phenotypes).
phenotype

expected (e)
N x (9/16)=
N x (3/16)=
N x (3/16)=
N x (1/16)=

observed

difference (d)

d2/e

chi-square: (d2/e) =
When the 2 value is known, it can be compared to a probability (p) table that
indicates the probability the differences are insignificant (ie. random sampling error, and the
data support the prediction) or significant (ie. the data do not support the prediction). The
number of degrees of freedom (C-1) is the number of phenotypes scored, minus one, and
this determines the line you plug your chi-square value into.
Find the position of your chi-square value on the correct C-1 line, and then see
which p value this corresponds to. If the chi square value matches up to a p of 0.05 or lower,
this means the chance that the difference between the expected and observed numbers is
random would be 5% or lower. In other words, these differences are so great that the data
do not confirm the prediction. Unacceptably low p values may be observed for several
different reasons: too few individuals were counted; the genes are not behaving in a simple
dominance/recessiveness fashion; or the two genes are linked on a chromosome.
87

Chi square values.

Differences from prediction are not significant (Hypothesis is
supported)
p
0.99
0.95
0.80
0.50
0.30
0.20
0.10
C-1
.00016
.0039
.064
.455
1.074
1.642
2.706
1
.0201
.103
.466
1.386
2.408
3.219
4.605
2
.115
.352
1.005
2.366
3.665
4.642
6.251
3

Differences are
significant (Hypothesis
not supported)
0.05

0.02

0.01

3.841

5.412

6.635

5.991

7.824

9.210

7.815

9.837

11.341

(2 points) What is the 2 value for your data from the dihybrid cross? Do your data
support the prediction? If your data did not support the prediction, how would you explain
it: i.e., does this necessarily mean the hypothesis leading to the prediction is invalid?

Part II. The van Leeuwenhoek microscope.

Antony van Leeuwenhoek (1632 - 1723) was a citizen/scientist who lived and
worked in Delft, Holland. Leeuwenhoek distinguished himself scientifically by designing and
using simple microscopes that provided excellent clarity and relatively high magnification,
and gained attention through his accurate and vivid descriptions of the microscopic world
that he spied through these scopes.
One example of his descriptions is reproduced here.
(from http://www.ucmp.berkeley.edu/history/leeuwenhoek.html)
--On September 17, 1683, Leeuwenhoek wrote to the Royal Society about his
observations on the plaque between his own teeth, a little white matter, which is as thick as
if twere batter. He repeated these observations on two ladies (probably his own wife and
daughter), and on two old men who had never cleaned their teeth in their lives. Looking at
these samples with his microscope, Leeuwenhoek reported how in his own mouth: I then
most always saw, with great wonder, that in the said matter there were many very little living
animalcules, very prettily a-moving. The biggest sort. . . had a very strong and swift motion,
and shot through the water (or spittle) like a pike does through the water. The second sort. . .
oft-times spun round like a top. . . and these were far more in number. In the mouth of one
of the old men, Leeuwenhoek found an unbelievably great company of living animalcules,
a-swimming more nimbly than any I had ever seen up to this time. The biggest sort. . . bent
their body into curves in going forwards. . . Moreover, the other animalcules were in such
enormous numbers, that all the water. . . seemed to be alive.
These are among the first observations on living bacteria ever recorded.
--Leeuwenhoeks microscopes were essentially high-powered magnifying glasses, and it
is fairly straightforward to make a reasonable working copy. Alan Shinn (Berkeley, CA)
88

posted a set of directions online in 1996 for making a brass replica of a typical Leeuwenhoek
microscope: http://www.mindspring.com/%7Ealshinn/Leeuwenhoekplans.html.
Recently, Patrick Keeling (University of British Columbia) posted a simplified
protocol, using paper, cardstock, and sticky tack.
(http://www3.botany.ubc.ca/keeling/resomicr1.html). We will use Keelings method in
todays lab.
Build the microscope.
Download and read the Keeling protocol from the following web address:
http://www3.botany.ubc.ca/keeling/PDF/KeelingMicroscope.pdf.Following the
instructions on pages 2-4, prepare 2 or 3 lenses, and choose the one that seems the roundest,
and with the fewest flaws when observed under a dissecting microscope. USE EYE
PROTECTION WHILE WORKING ON THE LENS. Shoot for a lens of about 2 mm in
diameter. When you are finished with the Bunsen burner, be sure to shut it off using the gas
flow knob.
Using the calipers, measure and record the diameter of your lens.
Diameter: ________________ mm
Now assemble the microscope according to the instructions.
Measure the magnifying power of the lens.
Project the laser through the electron microscope grid, following the instructions on page 7
(method 2). Measure and record the width of one box projected on the screen.
Box width (X): ________________ mm
Distance between lens and screen (d): ________________ mm
Calculate D, the size of the projected grid box at 250 mm (the conventional distance used
for calculating lens power). This equation involves adjustment of measured box width (X) by
distance factor (250 mm/d from lens to screen)
X mm x (250 mm/d mm) = D = _______________
(1 point) Now calculate P, lens power:
P = D/A = ________________
(A = actual length of the grid box = 0.204 mm. Grid lines are 0.05 mm thick)
Give your TA two numbers: lens diameter (mm) and resolving power. Your TA will make a
graph of the relationship between size of lens and power. How does size of the lens relate to
its magnifying power?
89

(2 point) Look at the available prepared slides or any other small object (e.g., feather
barbs). Make two drawings of your observations below, or on a separate sheet of paper.
(2 points) Show your TA your assembled microscope, and have him or her sign off
here: __________. You may keep the microscope.

90