Gene 510 (2012) 3238

Contents lists available at SciVerse ScienceDirect

Gene
journal homepage: www.elsevier.com/locate/gene

Methods Paper

Molecular characterization, metal uptake and copper induced transcriptional

activation of efux determinants in copper resistant isolates of Klebsiella pneumoniae
Soumble Zulqar, Abdul Rauf Shakoori
School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore 54590, Pakistan

a r t i c l e

i n f o

Article history:
Accepted 23 August 2012
Available online 30 August 2012
Keywords:
Cus determinants
Copper resistance in Klebsiella pneumoniae
Transcriptional level
Real time PCR

a b s t r a c t
An efux system, comprising cus determinants, plays an important role in pumping out this metal in gram
negative bacteria exposed to high concentration of copper. Cus determinants comprise two operons, one
regulatory (cusRS) and the other structural (cusCFBA). Although the efux system has been described in
quite a few members of Enterobacteriaceae, little is known about this system in Klebsiella spp. We are describing cus determinants in Klebsiella pneumoniae for the rst time and also providing evidence for their
metal-induced expression, both under aerobic and anaerobic conditions. Copper resistant K. pneumoniae,
capable of copper uptake and later efux of excessive copper, was isolated from industrial waste water. Expression of both cusRS and cusCFBA was quantied at transcriptional level through real time PCR. The results
demonstrated that cus determinants were functional under both aerobic and anaerobic conditions. The
mRNA level of both operons increased several fold in the presence of non-lethal as well as sub-lethal copper
concentrations. The increase in cusCFBA transcripts was 74.8 fold 15 min after exposure to 3 mM Cu ++
under aerobic conditions compared to the 16 fold increase in cusRS under the same conditions. Under anaerobic conditions the cusCFBA transcripts increased 32.65 fold and the cusRS ve fold within 15 min
after exposure to 3 mM Cu ++. It is concluded that cus genetic determinants in K. pneumoniae comprise
structural component (cusCFBA) and a regulatory component (cusRS), which show several fold expression
under copper induction both under aerobic and anaerobic conditions. Under aerobic conditions, the structural genes express 4.7 fold more than the regulatory genes, whereas under anaerobic conditions, this expression is 6.5 fold. Finally, time course study revealed a novel pattern of immediate up-regulated
expression followed by decreased and another increased in the transcript level of both operons of cus determinants in the presence of copper.
2012 Elsevier B.V. All rights reserved.

1. Introduction
Copper is an essential transition metal, and owing to its redox
property, it plays a very important role in many biological processes.
The same metal exerts lethal effects when present in higher concentrations. Organisms have evolved some homeostatic and resistance
mechanisms to cope with this problem. These mechanisms include
extra and intracellular sequestration, compartmentalization, reduction of metal into less toxic form and active and passive efux. These
mechanisms have been extensively studied in E. coli, Pseudomonas,
Xanthomonas, Enterococcus and Bacillus etc.
The gram negative bacteria deal with high amounts of copper
either through its accumulation in periplasmic space or export to

Abbreviations: cus determinants, copper sensing genetic determinants; Cus RS, regulatory genes - Response regulator (R )and Sensor kinase (S) of cus operon; Cus CFBA,
structural genes C, F, B, and A of cus operon; Cue, copper efux; MIC, minimum inhibitory
concentration; RT-PCR, Real Time PCR.
Corresponding author. Tel.: +92 42 99230133; fax: +92 42 99230980.
E-mail addresses: arshaksbs@yahoo.com, arshakoori@sbs.pu.edu.pk (A.R. Shakoori).
0378-1119/$ see front matter 2012 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.gene.2012.08.035

exterior of the cells. The genes that perform these functions are either chromosomal or plasmid born. cue (Cu efux) (Outten et al.,
2000) and cus (Cu sensing) (Munson et al., 2000) regulons are chromosomal in origin while pco system (Brown et al., 1995) is a well
known plasmid born machinery that provides additional copper resistance in Enterobacteriaceae.
Cus determinants are important members of a heavy metal efux
(HME) family belonging to RND (resistance-nodulation-cell division)
super family. The tripartite Cus efux system is composed of an inner
membrane protoncation antiporter (CusA), a membrane fusion
protein (CusB) and an outer membrane factor (CusC). Crystal structures of CusA (Long et al., 2010), CusB (Su et al., 2009) and CusC
(Kulathila et al., 2011) have been resolved and are quite helpful in
understanding structural and functional aspects of CBA tripartite system. According to these structures, CusA and CusC are homotrimers in
functional form, while CusB exists as homohexamer. CusA3 interacts
with CusC3 and the resulting CusA3C3 spans across the transenvelope
forming a channel from the inner membrane to the outside of the cell
(Koronakis et al., 2000). The CusA3C3 channel is surrounded by a
CusB6 ring. This CusB6 acts as a stabilizer for CusA3C3 interaction

S. Zulqar, A.R. Shakoori / Gene 510 (2012) 3238

(Akama et al., 2004; Murakami et al., 2002). An additional protein

CusF is present in the periplasm. CusF being a copper chaperon
binds with periplasmic copper and transfers it to the Cus system
for efux (Franke et al., 2003; Loftin et al., 2005; Bagai et al., 2007).
Kim et al. (2011) has proposed two mechanisms of copper binding
to this CBA complex and its subsequent efux to the exterior. In
both cases, CusF binds and transfers periplasmic copper to CusB
resulting in a conformational change in this protein. This event
leads to an open access state of the tripartite system. According to
switch model periplasmic copper binds to CusA and is subsequently
pumped out through CusC. While funnel model involves transfer of
CusB bound copper to CusA and its ultimate efux from the cell.
The proteins CusC, CusF, CusB and CusA are encoded by the genes
that exist in the form of an operon, the cusCFBA operon. cusCFBA
operon is regulated by an upstream adjacent promoter. The same
promoter regulates in opposite direction another operon known as
cusRS operon. This operon constitutes two genes encoding a two
component regulatory system (Munson et al., 2000). One component of this system is a sensor kinase (CusS) that senses copper
and the other is a response regulator (CusR) that binds promoter
and enhances transcription of cus determinants.
Franke et al. (2001) analyzed the copper induced transcription of
cus determinants of E. coli K38 and found that transcription of a
dicistronic cusRS mRNA and a tetracistronic cusCFBA mRNA was induced by copper. A few more reports are available in literature regarding induction of this system in the presence of copper in E. coli
(Outten et al., 2001; Yamamoto and Ishihama, 2005; Thieme et al.,
2008), Shewanella (Toes et al., 2008), Acidothiobacillus (Navarro et
al., 2009) and Pseudomonas (Teitzel et al., 2006). However, the Cus
system has not yet been studied in any Klebsiella species. Klebsiella
is an opportunistic pathogen belonging to family Enterobacteriaceae.
This nonmotile, gram-negative rod is commonly found in aquatic environments receiving industrial wastewaters and has been known
for possessing potential for bioremediation of mercury, cadmium
and some organic compounds.
The copper sensing (cus) genetic determinants of copper resistant Klebsiella pneumoniae, possessing copper processing ability,
were cloned and sequenced. This part of the work is being reported
elsewhere. The present study reports the expression of cus determinants in K. pneumoniae for the rst time. The time dependent proles
of cusRS and cusCFBA expression at transcriptional level are determined in the presence of different copper concentrations under
both aerobic and anaerobic conditions simultaneously.
2. Materials and methods
Samples of efuents and soil were collected from Sheikhupura
and Kot Lakhpat industrial areas and Campus Canal, Lahore. Pure cultures of Cu ++ resistant bacterial strains were obtained in the presence of 200 g/ml (3.17 mM) Cu ++.
2.1. Identication of the bacterial strains
The isolated Cu++ resistant bacterial strains were identied on the
basis of 16S rRNA gene sequence homology with the already known sequences of the same gene. For this the genomic DNA was isolated
according to Rodriguez and Tait (1983), and the 16S rRNA gene
(1.533 kb) was amplied by using primers FGPS4-281 bis and
FGPS1509-153 (Normand, 1995). The competent cells of E. coli DH5
were transformed with the amplied product ligated to pTZ57R/T
(Birnboim and Doly, 1979). The cloned 16S rRNA gene of each bacterial
isolate was sequenced using M13-F, M13-R, P350F, PC535, P785R, RS-1
and RS-3 primers (Lane, 1991; Maillard et al., 2004).
The isolates were identied on the basis of multiple alignment of
16S rRNA gene sequences of four isolated bacterial strains along with
closely homologous gene sequences selected through BLAST analysis

33

(http://blast.ncbi.nlm.nih.gov/Blast.cgi) using online clustalW program available on EMBL-EBI site (http://www.ebi.ac.uk/Tools/

clustalw2/).
2.2. Determination of minimum inhibitory concentration (MIC)
MIC, the lowest concentration of copper that inhibits the visible
growth of bacterial isolate, was determined by allowing them to
grow at 37 C on a LB agar plate supplemented with various concentrations of Cu ++ ions viz., 1, 2, 3, 4, 5 and 6 mM. The concentration
which showed the least growth after 48 h was considered as the MIC.
2.3. Determination of effect of Cu ++
Effect of Cu ++ on the growth of Cu ++ resistant strains was determined by supplementing 100 ml of LB broth (OD600nm 0.50.7) with
1, 2, 3, 4 and 5 mM Cu ++ in separate asks, two hours after inoculation. No Cu ++ was added in one ask, which acted as positive control. Bacterial growth in each culture was determined every hour by
measuring the optical density (OD) of an aliquot (1 ml) at 600nm.
Growth curves were plotted between time and OD. For each strain,
specic growth rate (), dened as the increase in cell mass per
unit time, were determined in the presence of various Cu ++ concentrations using the following mathematical relationship:
Specific growth rate per min logN1 logN0 =t1 mint0 min
where N1 and N0 are ODs at time t1 and t0, respectively, and t1 > t0.
The effect of Cu ++ on growth was also determined in terms of duration of lag phase. The above experiments were replicated three times.
2.4. Determination of Cu ++ uptake ability

Cu++ uptake ability was determined in Cu++ resistant KW strain in the

presence of nonlethal (1 and 2 mM) and sublethal (3 and 4 mM) concentrations of Cu ++. In the control, no Cu ++ (0 mM) was added. Cu ++
was added in the exponentially growing bacterial culture at OD600nm
0.50.7. At intervals of time, the bacterial culture from each ask was
harvested in duplicate. The pellets were washed with 0.89% saline solution and digested with conc. HNO3. Each digested pellet was diluted
with deionized water and the amount of Cu++ was determined
through atomic absorption spectrophotometer (AAS) (Thermo
Unicam-SOLAAR), using a standard curve prepared from serially diluted
solutions of Cu++ made from a stock solution (1 mg/ml, Merck Cat #
OC566115). The Cu ++ concentration (in g) per mg dry cell weight
was calculated according to the following mathematical relationship:

g Cu

=mg dry cell weight R  Vs=Vc=OD600 =Const:

where R is the reading at AAS, Vs is the volume of sample at the time

of reading at AAS, Vc is the volume of cell culture used to make cell
pellet, and Const. is the weight of dry cell pellet per ml cell culture
when OD600nm of the culture is 1.00. For determination of Const.,
200 ml mid-log phase culture was pelleted down at high speed
after taking its OD600 dried at 50 C and weighed. The Const. value
was calculated as follows:
Const: Weightmg=volumeml=OD600:
All the above experiments were replicated thrice.
2.5. Expression analysis of cus determinants
Effect of Cu ++ on the expression of cus determinants at transcriptional level was analyzed under aerobic as well as anaerobic

34

S. Zulqar, A.R. Shakoori / Gene 510 (2012) 3238

conditions. Bacteria were grown aerobically in LB medium, and anaerobically in thioglycolate medium provided in Biomed culture bottles. Overnight culture was diluted in a 1:100 ratio and incubated at
37 C with shaking (100 rpm) for aerobic growth, and without shaking at 37 C for anaerobic growth. In two hours of old culture, Cu ++
was added with a nal concentration of 1 mM (non-lethal) in one set
of experiment and 3 mM (sub-lethal) in another. In the control no
Cu ++ was added. Aliquots (15 ml) of bacterial culture were
harvested in triplicate at 0, 15, 30, 45 and 60 min after Cu ++ addition and then subjected to RNA isolation.

structural i.e. cusCFBA operons of cus determinants) were normalized to the respective relative quantity of the housekeeping gene
(Gyrase A) transcripts. The relative change in expression (n-fold)
was calculated as the relative quantity of the target gene transcripts
under experimental conditions (normalized to Gyrase A), divided by
the relative quantity of the target gene transcripts under control
condition (0 mM Cu ++ under aerobic conditions) (normalized to
Gyrase A).

2.5.1. RNA isolation

Total RNA was isolated according to the modied guanidinium
thiocyanatephenolchloroform extraction method (Chomczynski
and Sacchi (1987). The bacterial culture was harvested through
centrifugation at 6850 x g for 10 min at 4 C, and then resuspended
in 100 l STET buffer (8% sucrose w/v, 5% triton X-100 w/v, 50 mM
EDTA and 50 mM TrisCl pH 8.0) containing 50 g/ml of freshly
prepared lysozyme solution followed by an addition of 10 l of
10% SDS. The mixture was vigorously vortexed and incubated on
ice for 5 min. TRIzol reagent (Fluka BioChemica) was then added
to it and vortexed vigorously again. Total RNA in the aqueous layer
was puried through chloroform extraction and precipitated with
chilled isopropanol. RNA pellet was washed with 75% ethanol and
air dried. Total RNA was dissolved in molecular biology grade
DEPC-treated water by passing the solution a few times through a
pipette tip and incubated at 60 C for 10 min.
To avoid any traces of DNA, total RNA isolated was subjected to deoxyribonuclease treatment. DNase was later on heat inactivated in the
presence of 2.5 mM EDTA. In order to check complete degradation of
genomic DNA, the DNase treated RNAs were used as template for the
amplication of partial 16S rRNA gene using RSAT F and RSAT R
primers. Genomic DNA was used as template in the positive control.
No amplication in DNase treated RNAs indicated a complete degradation of genomic DNA in these samples.

3.1. Copper resistant K. pneumoniae isolates

2.5.2. First strand cDNA synthesis (RT PCR)

First strand cDNA was synthesized from 4 g of total RNA using Revert Aid M-MuLV Reverse Transcriptase (Fermentas cat # EP0442).
The reaction mixture (20 l) contained RNA, 1.0 mM dNTPs, 1x
M-MuLV buffer and 5 M random hexamers. The reaction mixture
was incubated at 65 C for 5 min, 4 C for 3 min, 25 C for 10 min
and 37 C for 2 min. 1 l MMuLV (200 U/l) was added followed by
incubation at 37 C for 50 min. Reaction was terminated through incubation at 95 C for 5 min.
2.5.3. Real time PCR
Real time PCR was performed for both parts of cus determinants
i.e. cusRS and cusCFBA along with a gene Gyrase subunit A, a constitutively expressing gene used as a normalizer. Details of the primers
used for the three genes are given in Table 1. Each PCR reaction
(25 l) (performed in duplicate) contained 12.5 l of 2x Maxima
SYBR Green qPCR Master Mix (Fermentas cat # K0221), 0.3 M
each forward and reverse primer, 2.5 l template (100x diluted
cDNA). Thermal cycling was performed using a two-step cycling protocol. It consisted of 95 C for 10 min, 40 cycles of 95 C for 15 s,
60 C for 1.0 min and plate read and nal extension at 72 C for
1.0 min. Prior to the nal experiment, the PCR for each gene target
was optimized with efciency ranging from 80110. Moreover, to
verify the specicity and identity of the PCR product, melting curve
analysis was also performed between 60 C and 90 C with a reading
after every 0.5 s.
The cycle number at which uorescence crossed a selected
threshold value during exponential amplication was correlated
to a relative quantity through Pfafe method (Pfaf, 2001). The relative quantities of target gene transcripts (regulatory i.e. cusRS and

3. Results

There were four copper resistant strains viz., CC (from Campus

Canal), KS (from soil), KW (from waste water of Kot Lakhpat industrial area) and SW (from waste water of Sheikhupura industrial
area). No Cu ++ resistant bacterial strain was obtained from soil sample of Sheikhupura industrial area. Minimum inhibitory concentration (MIC) of Cu ++ against CC and KW was 6.0 mM and for KS
5.5 mM, while SW was found the least resistant strain with 5.0 mM
MIC.
Molecular identication of the Cu++ resistant bacterial strains
through ribotyping revealed that these four strains were K. pneumoniae,
a common member of family Enterobacteriaceae. The sequences of
16S rRNA gene of K. pneumoniae CC, KS, KW and SW were submitted
to the DNA Data bank of Japan (DDBJ) under the accession numbers
AB642255, AB641121, AB642256 and AB641122, respectively.
3.2. Effect of Cu ++ on the growth of isolates
Determination of lag phase duration and the specic growth rate
in the midlog phase revealed that increasing concentration of
Cu ++ in the medium retarded the growth of bacteria (Figs. 1, 2).
Specic growth rates of K. pneumoniae CC, KS, KW and SW were
1.64 10 3, 7.47 10 4, 1.08 10 3 and 1.20 10 3, respectively,
in the absence of Cu ++. No signicant difference in growth patterns
with increasing Cu ++ concentration was found up to 2 mM in the
case of KW and 3 mM Cu ++ in the medium in the case of CC, KS
and SW designated as nonlethal Cu ++ concentrations for the respective strains. A signicant prolongation in the lag phase was observed in KW in the presence of 3 and 4 mM Cu ++, and in the case
of CC, KS and SW in the presence of 3 mM Cu ++. Thus 3 and 4 mM
for KW and 3 mM for the rest of the strains were considered
sub-lethal Cu ++ concentrations. The presence of 5 mM Cu ++ in
the medium allowed very little growth and proved to be lethal for
all the four Cu ++ resistant strains.
3.3. Cu ++ uptake ability
Fig. 3 shows metal uptake in terms of g Cu ++/mg dry cell weight
by K. pneumoniae KW at intervals of time. In the presence of 1 and
2 mM Cu ++ in the medium, a very negligible amount of Cu ++
(0.46 0.18 and 1.08 0.20 g Cu ++/mg dry cell weight, respectively) was found to be accumulated within the cells. In the presence

Table 1
Primers used in real time RT PCR.
Primer ID

Primer sequence

Target

Amplicon size

5 3
Gyr A-F
Gyr A-R
RSRT-F
RSRT-R
CFBART-F
CFBART-R

TACGCGGTATACGACACCAT
CGATGGAACCAAAGTTACCC
CCTCAACGGCTATCACCTG
ACGATATCCCAACCGTTCAC
CGCAGTGCATATCCTGTTG
AACGAAGGCGTAAGACTGCT

Gyrase subunit A

91 bp

cusRS

90 bp

cusCFBA

124 bp

S. Zulqar, A.R. Shakoori / Gene 510 (2012) 3238

35

Fig. 1. Effect of different concentrations of Cu++ (viz., 1, 2, 3, 4 and 5 mM) on growth of K. pneumoniae isolates viz., CC, KS, KW and SW from different locations in Lahore. Bacterial
culture (100 ml) was supplemented with 1, 2, 3, 4 and 5 mM Cu++, two hours after inoculation in separate asks and incubated at 37 C. No Cu++ was added in the positive control. Growth curves were plotted between optical densities (at 600nm) of samples taken out of the growing culture after every two hours.

of 3 mM Cu ++, the cells started accumulating copper 3 h after addition of Cu ++ in the medium. Amount of Cu ++ uptake remained the
same viz., 22.57 1.21 g Cu ++/mg dry cell weight till the 5th hour
after Cu ++ addition. Then, Cu ++ efux began and the amount of accumulated Cu ++ decreased to 15.73 0.45 g Cu ++/mg dry cell
weight till the 7th hour after Cu ++ addition. Interestingly, the
color of pellet changed from yellowish off white to dark green with
increasing Cu ++ uptake. The basal level (1.40 0.47 g Cu ++/mg
dry cell weight) was achieved within 24 h indicating that the cells
were efcient enough to expel excessive amounts of Cu ++ and
somehow they had developed a balance between Cu ++ inux and
outux. In the presence of 4 mM Cu ++ also, the cells showed significant copper uptake but it started quite late compared to that in
3 mM Cu ++. The accumulation of Cu++ (18.62 0.10 g Cu++/mg
dry cell weight) started 7 h after Cu ++ addition. Pellet obtained this
time was also greenish in color. The value again came to basal level
(1.86 0.05 g Cu ++/mg dry cell weight) within 24 h.

Fig. 2. Specic growth rates of Cu++ resistant strains of K. pneumoniae CC, KS, KW and
SW. The specic growth rates () per minute were determined in mid-log phase in the
presence of 0, 1, 2, 3, 4 and 5 mM Cu++. * represents cultures with prolonged lag
phases.

3.4. Expression analysis of cus determinants

Expression analysis at transcriptional level revealed that basal
expression of cus determinants was enhanced in the presence of
Cu ++ under both aerobic and anaerobic conditions (Fig. 4). In the
presence of 1 mM Cu ++, a slight increase in cusRS transcripts was
observed ranging from 3.66 to 4.77 fold the basal level during 15
60 min after Cu ++ addition. In the presence of 3 mM Cu ++, the
cusRS mRNA level observed was 15.78 times the basal level 15 min
after Cu ++ addition that remained half within the next 15 min
followed by a second boost up to 12.47 times till the 60th min.
Under anaerobic conditions, no remarkable change in mRNA level
was observed in the presence of 1 mM Cu ++, while a slight increase
up to 5.16 times was observed when 3 mM Cu ++ was present in the
medium. However, the same trend of immediate increase, then a decrease and again an increase of cusRS transcripts was observed.

Fig. 3. Cu++ uptake by K. pneumoniae KW in the presence of 0, 1, 2, 3 and 4 mM Cu++

concentrations. No signicant metal uptake was recorded in the presence of 1 and
2 mM Cu++. In the presence of 3 mM copper in the medium, the isolate accumulated
Cu++ up to 22.57 1.21 g/mg dry weight within 3 h. The efux started after 5 h and
reached the basal level within 24 h. In the presence of 4 mM Cu++, however, the isolate accumulated 18.62 0.1 g Cu++/mg dry weight after 7 h. Later the efux system
was activated and the basal level was achieved within 24 h.

36

S. Zulqar, A.R. Shakoori / Gene 510 (2012) 3238

Fig. 4. Relative expression of cus determinants, cusRS operon and cusCFBA operon of
K. pneumoniae KW, both under aerobic and anaerobic conditions. Expression of both
the operons is enhanced in the presence of copper both under aerobic and anaerobic
conditions. The increase of expression is however, much more prominent in the
presence of oxygen than in its absence. The expression of cuRS is increased 15.78
fold, while that of cusCFBA 63.98 fold within 15 min of exposure to 3 mM concentration of copper. The general pattern of expression of operon viz., initial increase, and
then decrease, followed by an increase, is demonstrated by both the operons under
all experimental conditions.

Expression of cusCFBA was also enhanced in the presence of

Cu ++. Under aerobic conditions, a considerable increase (63.98
times the basal level) was observed 15 min after 1 mM Cu ++ addition that decreased to 15.19 times within the next (following)
15 min. A second uplift was observed at the 45th min (33.82
times) that continued to the 60th min (40.08 times). In the presence
of 3 mM Cu ++ the highest expression of cusCFBA was observed. An
increase of 74.80 times was observed in the cusCFBA transcripts
15 min after Cu ++ addition, followed by a decrease (24.85 times)
at the 30th min. The level again increased 45 min (41.93 times)
and 60 min (128.44 times) after Cu ++ addition. In the absence of
oxygen, comparatively lesser increase in expression was observed
with up to 4.94 and 32.65 times in the presence of 1 mM and
3 mM Cu ++, respectively.
Though increase in expression levels of both cusRS and cusCFBA
was observed under both aerobic and anaerobic conditions, however it was found that these determinants were more expressed in the
presence of oxygen.
4. Discussion
Klebsiella forms a major component of microora in stressed
nonclinical environments and has been isolated from soil, vegetation,
water, sewage, animals and human body parts (Seidler, 1981; Bagley,
1985; Podschun et al., 2001; Banu and Menakuru, 2010). We are able

to isolate copper resistant K. pneumoniae KW with a potential of copper uptake up to 23.66 g/mg dry cell weight.
Determination of minimum inhibitory concentration (MIC) revealed that our bacterial isolates possessed high resistance to
Cu ++ ranging from 56 mM. Previous studies from other laboratories have reported bacterial strains of family Enterobacteriaceae resistant to different concentrations of Cu ++. These include E. coli
W3110 grown in LB with MIC of 3.5 mM (Grass and Rensing,
2001) and K. pneumoniae (Choudhury and Kumar, 1998) resistant
up to 10 mM Cu ++. Cooksey and Azad (1992) have reported some
Pseudomonas spp. with MICs ranging from 0.2 to > 3.2 mM Cu ++.
Determination of transcripts level of cus determinants reveals
that increasing concentration of copper upregulates the expression
of cusRS and cusCFBA under both aerobic and anaerobic conditions.
Under aerobic conditions, about 4 times and 16 times more cusRS
transcripts than basal level were measured in the presence of 1
and 3 mM Cu ++, respectively, 15 min after metal addition. A difference of four times more induction (16 verses 4) in the presence of
3 mM Cu ++ compared to 1 mM Cu ++ was observed. Similar kind
of relationship has been reported in copper induced expression of
cusC, cusB, cusF and cusA in Acidothiobacillus ferrooxidans ATCC
23270 (Navarro et al., 2009). Transcripts of cusC, cusB, cusF and
cusA increased 53.8, 45.3, 25.8 and 26.0 fold, respectively in the
presence of 5 mM Cu ++ and 143.9, 332.3, 100.4 and 108.3 fold, respectively in the presence of 25 mM Cu ++. The higher expression
of cus determinants in the presence of higher amounts of Cu ++ is
because at low and medium levels of Cu ++, CopA and CueO are
mainly responsible for efux of cytoplasmic Cu ++ to periplasm
and its conversion to less toxic form, respectively. At this time, periplasm acts as a copper storage compartment. While in the presence
of high amounts of Cu ++ when these two systems are overwhelmed
and the level of copper in the periplasm exceeds some critical
threshold, the cus determinants are activated and bear main responsibility of Cu ++ efux out of the cell (Outten et al., 2001; Thieme et
al., 2008).
The majority of earlier studies investigated concentrationdependent responses only (Munson et al., 2000; Outten et al.,
2000; Franke et al., 2001; Stoyanov et al., 2001). In fewer studies,
copper-induced gene expression was monitored at various time intervals after copper exposure (Yamamoto and Ishihama, 2005;
Thieme et al., 2008). A time dependent prole of Cu ++ induced expression of cus determinants in K. pneumoniae in the present study
revealed some more interesting features. In the presence of 1 mM
Cu ++, the cusRS transcript level monitored 15 min after Cu ++ addition remained almost the same up to 1 h. Again this can be justied
on the basis of the requirement of the determinants for Cu ++ detoxication. In the presence of 1 mM Cu ++, CueO and CopA may be
mainly responsible, while the Cus system only aids them. This system need not be fully expressed and it seems that some balance
between the amount of excess copper and the amount of Cus determinants for its efux is somehow balanced. So the level of expression need not be changed. In the presence of 3 mM Cu ++, the level
of cusRS transcripts remained about half at the 30th min when compared to that at the 15th min. Overall, the results suggest that the response to copper stress was fast and vigorous followed by a quickly
diminished transcription. The same decline was also observed by
Yamamoto and Ishihama (2005). The S1 assay, which they
performed, indicated that transcription of cusC and cusR in E. coli
W3110 was stimulated and the maximum level of induction after
copper addition was followed by a gradual decrease. After 30 min,
the level of cusR and cusC transcripts decreased to half of the maximum level. Thieme et al. (2008) also observed the same trend in
E. coli W3110 through solution-based sandwich hybridization
(SBSH) assay. Transcript level of cusA indicated rst upregulation
reaching a maximum level 15 min after Cu ++ addition followed by
a decreased expression. Moreover, the rapid decline in transcripts

S. Zulqar, A.R. Shakoori / Gene 510 (2012) 3238

level after upregulation suggests that mRNAs of copper detoxication systems are rather unstable. This observation strongly correlates with values reported in the literature for the short average
half-life of bacterial transcripts (Selinger et al., 2003). Surprisingly,
the level again started to increase and relatively more cusRS transcripts were found 45 min after Cu ++ addition. This increase continued and even more transcripts were found at the 60th min.
Probably, a new balance of copper detoxication systems was required for the cytoplasmic and periplasmic copper concentrations.
In the case of cusCFBA, the same expression pattern was observed
as found in cusRS. First a great amount of induction was observed at
the 15th min, followed by a remarkable decrease (about half of the
level at the 15th min) at the 30th min and again a gradual increase
up to the 60th min. However, increase of cusCFBA transcripts in the
presence of Cu ++ was much more than that for cusRS. The cusCFBA
transcripts were about 64 and 75 times the basal level at the 15th
min in the presence of 1 and 3 mM Cu ++, respectively, in comparison to 4 and 16 times more cusRS transcripts at the same time. This
indicated that binding of CusR to bidirectional promoter further enhanced the transcription towards cusCFBA side compared to cusRS
side. The same kind of relationship was observed by Yamamoto
and Ishihama (2005).
To reveal the total scenario of the role of cus determinants in
Cu ++ resistance, expression analysis was also performed in the absence of oxygen, keeping all other experimental conditions the
same. The picture obtained was almost the same including trend of
change in transcript levels with respect to time, more transcripts
in the presence of 3 mM compared to 1 mM Cu ++ and more induction of cusCFBA than cusRS. However, very surprisingly, the relative
amounts of transcripts in the absence of oxygen were lesser as compared to each complementary condition in the presence of oxygen.
The same ndings were observed in the Shewanella strain MB4 by
Toes et al. (2008). The relative copy number of cusA transcript was
lesser when the cells were grown anaerobically compared to that
of aerobically growing cells. It can be due to the increased capacity
of the cells for copper storage under anaerobic conditions. Outten
et al. (2001) showed that E. coli BW25113 cells grown under anaerobic conditions reached a point of maximum copper accumulation
(800 g Cu ++/mg cell weight) in the presence of 50 M copper in
the medium, whereas the same cells were not able to accumulate
such an amount of copper when grown aerobically even in the presence of 500 M copper. These results suggest that the essential copper quota might increase during anaerobic growth. So, an increased
capacity of cells to store copper under anaerobic condition leads to a
lesser need of efux. Thus, cus determinants are less required to export the excess metal out of the cells.
5. Conclusions
Although the efux system has been described in quite a few members of Enterobacteriaceae, little is known about this system in Klebsiella
spp. We are describing cus determinants in K. pneumoniae for the
rst time and also providing evidence for their metal-induced expression, both under aerobic and anaerobic conditions.
The results demonstrated that cus determinants were functional
under both aerobic and anaerobic conditions. The mRNA level of
both operons increased several fold in the presence of non-lethal
as well as sub-lethal copper concentrations. The increase in cusCFBA
transcripts was 74.8 fold 15 min after exposure to 3 mM Cu ++
under aerobic conditions compared to a 16 fold increase in cusRS
under the same conditions. Under anaerobic conditions the cusCFBA
transcripts increased 32.65 fold and the cusRS ve fold within
15 min after exposure to 3 mM Cu ++.
It is concluded that cus genetic determinants in K. pneumoniae
comprise a structural component (cusCFBA) and a regulatory component (cusRS), which show several fold expression under copper

37

induction both under aerobic and anaerobic conditions. Under aerobic conditions, the structural genes express 4.7 fold more than the
regulatory genes, whereas under anaerobic conditions, this expression is 6.5 fold.
Finally, time course study revealed a novel pattern of immediate
up-regulated expression followed by decreased and another increase in the transcript level of both operons of cus determinants
in the presence of copper.

References
Akama, H., et al., 2004. Crystal structure of the membrane fusion protein, MexA, of the
multidrug transporter in Pseudomonas aeruginosa. J. Biol. Chem. 279,
2593925942.
Bagai, I., Liu, W., Rensing, C., Blackburn, N.J., McEvoy, M.M., 2007. Substrate-linked conformational change in the periplasmic component of a Cu(I)/Ag(I) efux system.
J. Biol. Chem. 282, 3569535702.
Bagley, S.T., 1985. Habitat association of Klebsiella species. Infect. Control 6, 5258.
Banu, N., Menakuru, H., 2010. Enumeration of microbial contaminants in sachet water:
a public health challenge. Health 2 (6), 582588.
Birnboim, H.C., Doly, J., 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7 (6), 15131523.
Brown, N.L., Barrett, S.R., Camakaris, J., Lee, B.T.O., Rouch, D.A., 1995. Molecular genetics and transport analysis of the copper-resistance determinant (pco) from
Escherichia coli plasmid pRJ1004. Mol. Microbiol. 17, 11531166.
Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid
guanidinium thiocyanatephenolchloroform extraction. Anal. Biochem. 162 (1),
156159.
Choudhury, P., Kumar, R., 1998. Multidrug- and metal-resistant strains of Klebsiella
pneumoniae isolated from Penaeus monodon of the coastal waters of deltaic
Sundarban. Can. J. Microbiol. 44 (2), 186189.
Cooksey, D.A., Azad, H.R., 1992. Accumulation of copper and other metals by copperresistant plant-pathogenic and saprophytic pseudomonads. Appl. Environ. Microbiol.
58, 274278.
Franke, S., Grass, G., Nies, D.H., 2001. The product of the ybdE gene of the Escherichia
coli chromosome is involved in detoxication of silver ions. Microbiology 147,
965972.
Franke, S., Grass, G., Rensing, C., Nies, D.H., 2003. Molecular analysis of the coppertransporting efux system CusCFBA of Escherichia coli. J. Bacteriol. 185 (13),
38043812.
Grass, G., Rensing, C., 2001. Genes involved in copper homeostasis in Escherichia coli.
J. Bacteriol. 183 (6), 21452147.
Kim, E.-H., Nies, D.H., McEvoy, M.M., Rensing, C., 2011. Switch or funnel: how RND-type
transport systems control periplasmic metal homeostasis. J. Bacteriol. 193, 2382387.
Koronakis, V., Sharff, A., Koronakis, A., Luisi, B., Hughes, C., 2000. Crystal structure of the
bacterial membrane protein TolC central to multidrug efux and protein export.
Nature 405, 914919.
Kulathila, R., Kulathila, R., Indic, M., van den Berg, B., 2011. Crystal structure of
Escherichia coli CusC, the outer membrane component of a heavy metal efux
pump. PLoS One 6, e15610.
Lane, D.J., 1991. 16S/23S rRNA sequencing. In: Stackebrandt, E., Goodfellow, M. (Eds.),
Nucleic Acid Techniques in Bacterial Systematics. John Wiley and Sons, New York,
pp. 115175.
Loftin, I.R., et al., 2005. A novel copper-binding fold for the periplasmic copper resistance protein CusF. Biochemistry 44, 1053310540.
Long, F., et al., 2010. Crystal structures of the CusA efux pump suggest methioninemediated metal transport. Nature 467, 484488.
Maillard, R., et al., 2004. Bartonella chomelii sp. nov., isolated from French domestic cattle (Bos taurus). Int. J. Syst. Evol. Microbiol. 54, 215220.
Munson, G.P., Lam, D.L., Outten, F.W., O'Halloran, T.V., 2000. Identication of a copperresponsive two-component system on the chromosome of Escherichia coli K-12.
J. Bacteriol. 182 (20), 58645871.
Murakami, S., Nakashima, R., Yamashita, E., Yamaguchi, A., 2002. Crystal structure of
bacterial multidrug efux transporter AcrB. Nature 419, 587593.
Navarro, C.A., Orellana, L.H., Mauriaca, C., Jerez, C.A., 2009. Transcriptional and functional studies of acidithiobacillus ferrooxidans genes related to survival in the presence of copper. Appl. Environ. Microbiol. 75 (19), 61026109.
Normand, P., 1995. Utilisation des squences 16S pour le positionnement phyltique
d'un organisme inconnu. Oceanis 21, 3156.
Outten, F.W., Outten, C.E., Hale, J.A., O'Halloran, T.V., 2000. Transcriptional activation of
an Escherichia coli copper efux regulation by the chromosomal MerR homologue,
CueR. J. Biol. Chem. 275, 3102431029.
Outten, F.W., Huffman, D.L., Hale, J.A., O'Halloran, T.V., 2001. The independent cue and
cus systems confer copper tolerance during aerobic and anaerobic growth in
Escherichia coli. J. Biol. Chem. 276 (33), 3067030677.
Pfaf, M.W., 2001. A new mathematical model for relative quantication in real-time
RT-PCR. Nucleic Acids Res. 29 (9), e45.
Podschun, R., Pietsch, S., Hller, C., Ullmann, U., 2001. Incidence of klebsiella species in
surface waters and their expression of virulence factors. Appl. Environ. Microbiol.
67, 33253327.
Rodriguez, R.L., Tait, R.C., 1983. Recombinant DNA Techniques: An Introduction. AddisonWesley Publishing Co., London, pp. 162163.

38

S. Zulqar, A.R. Shakoori / Gene 510 (2012) 3238

Seidler, R.J., 1981. The genus Klebsiella (nonmedical aspects). In: Starr, M.P., Stolp, H.,
Trper, H.G., Balows, A., Schlegel, H.G. (Eds.), The Prokaryotes. Springer-Verlag,
Berlin, Germany, pp. 11661172.
Selinger, D.W., Saxena, R.M., Cheung, K.J., Church, G.M., Rosenow, C., 2003. Global RNA
half-life analysis in Escherichia coli reveals positional patterns of transcript degradation. Genome Res. 13, 216223.
Stoyanov, J.V., Hobman, J.L., Brown, N.L., 2001. CueR (YbbI) of Escherichia coli is a MerR
family regulator controlling expression of the copper exporter CopA. Mol.
Microbiol. 39, 502511.
Su, C.-C., et al., 2009. Crystal structure of the membrane fusion protein CusB from
Escherichia coli. J. Mol. Biol. 393, 342355.

Teitzel, G.M., Geddie, A., De Long, S.K., Jo Kirisits, M., Whiteley, M., Parsek, M.R., 2006.
Survival and growth in the presence of elevated copper: transcriptional proling of
copper-stressed Pseudomonas aeruginosa. J. Bacteriol. 188 (20), 72427256.
Thieme, D., Neubauer, P., Nies, D.H., Grass, G., 2008. Sandwich hybridization assay for
sensitive detection of dynamic changes in mRNA transcript levels in crude
Escherichia coli cell extracts in response to copper ions. Appl. Environ. Microbiol.
74 (24), 74637470.
Toes, A.-C.M., Daleke, M.H., Kuenen, J.G., Muyzer, G., 2008. Expression of copA and cusA
in Shewanella during copper stress. Microbiology 154 (9), 27092718.
Yamamoto, K., Ishihama, A., 2005. Transcriptional response of Escherichia coli to external copper. Mol. Microbiol. 56 (1), 215227.