Delineation of xenobiotic substrate sites in

rat glutathione S-transferase M1-1

JENNIFER L. HEARNE AND ROBERTA F. COLMAN
Department of Chemistry and Biochemistry, University of Delaware, Newark, Delaware 19716, USA
(RECEIVED June 14, 2005; FINAL REVISION July 15, 2005; ACCEPTED July 17, 2005)

Abstract
Glutathione S-transferases catalyze the conjugation of glutathione with endogenous and exogenous
xenobiotics. Hu and Colman (1995) proposed that there are two distinct substrate sites in rat GST
M1-1, a 1-chloro-2,4-dintrobenzene (CDNB) substrate site located in the vicinity of tyrosine-115, and
a monobromobimane (mBBr) substrate site. To determine whether the mBBr substrate site is distinguishable from the CDNB substrate site, we tested S-(hydroxyethyl)bimane, a nonreactive derivative
of mBBr, for its ability to compete kinetically with the substrates. We find that S-(hydroxyethyl)bimane is a competitive inhibitor (KI = 0.36 mM) when mBBr is used as substrate, but not when CDNB
is used as substrate, demonstrating that these two sites are distinct. Using site-directed mutagenesis,
we have localized the mBBr substrate site to an area midway through a-helix 4 (residues 90114) and
have identified residues that are important in the enzymatic reaction. Substitution of alanine at
positions along a-helix 4 reveals that mutations at positions 103, 104, and 109 exhibit a greater
perturbation of the enzymatic reaction with mBBr than with CDNB as substrate. Various other
substitutions at positions 103 and 104 reveal that a hydrophobic residue is necessary at each of these
positions to maintain optimal affinity of the enzyme for mBBr and preserve the secondary structure of
the enzyme. Substitutions at position 109 indicate that this residue is important in the enzymes
affinity for mBBr but has a minimal effect on Vmax. These results demonstrate that the promiscuity
of rat GST M1-1 is in part due to at least two distinct substrate sites.
Keywords: glutathione S-transferase M1-1; monobromobimane; substrate site; site-directed mutagenesis

Glutathione S-transferases (EC 2.5.1.18) constitute a

family of enzymes involved in Phase II detoxification
of endogenous and exogenous xenobiotics (Jakoby and

Reprint request to: Roberta F. Colman, Department of Chemistry

and Biochemistry, University of Delaware, Newark, DE 19716, USA;
e-mail: rfcolman@chem.udel.edu; fax: (302) 831-6335.
Abbreviations: GST, glutathione S-transferase; GSH, glutathione;
CDNB, 1-chloro-2,4-dinitrobenzene; mBBr, monobromobimane, 4-bromomethyl-3,6,7-trimethyl-1,5-diazabicyclo-[3.3.0]octa-3,6-diene-2,8-dione; Tris,
Tris(hydroxymethyl)aminomethane; LB, Luria-Bertani; EDTA, disodium
ethylenediamine tetraacetate; DMF, N,N-dimethylformamide; IPTG, isopropyl-b-D-thiogalactoside; CD, circular dichroism; TFA, trifluoroacetic acid; BTP, 1,3-Bis[tris(hydroxymethyl)methylamino]propane;
ESI-MS, electrospray ionization mass spectrometry; rpm, revolutions
per minute.
Article and publication are at http://www.proteinscience.org/cgi/
doi/10.1110/ps.051651905.

2526

PS0516519

Habig 1980). These enzymes detoxify xenobiotics by

catalyzing the nucleophilic addition of the thiolate of
glutathione (GSH) to substrates bearing an electrophilic
functional group. The conjugate is rendered more watersoluble, which is advantageous for excretion, usually
as part of the mercapturic pathway (Mannervik and
Danielson 1988; Boyer 1989; Pickett and Lu 1989;
Coles and Ketterer 1990; Armstrong 1991). Physiologically, GSTs have been implicated in the protection
against carcinogenesis as well as in drug resistance
(Soberman and Austen 1989; Waxman 1990).
The GSTs are classified into three superfamilies: (1)
dimeric soluble enzymes; (2) membrane-associated proteins involved in eicosanoid and GSH metabolism; and
(3) bacterial plasmid-encoded, fosfomycin-resistant enzymes (Armstrong 1998). The dimeric soluble GSTs are

Protein Science (2005), 14:25262536. Published by Cold Spring Harbor Laboratory Press. Copyright
2005 The Protein Society

Hearne and Colman

Article RA

Delineation of substrate sites in rat GST M1-1

class of GSTs. A preliminary version of this work has

been presented (Hearne and Colman 2004).

further subdivided into at least eight classes based on their

physical properties, sequence identity, and substrate specificity (Mannervik et al. 1985; Meyer et al. 1991; Pemble
et al. 1996; Board et al. 1997, 2000; Rossjohn et al. 1998;
Pettigrew et al. 2001). GSTs are ubiquitous in mammalian
tissues but are particularly abundant in hepatic tissue,
comprising ,4% of the cytosolic hepatocyte protein content (Eaton and Bammler 1999). Isozymes within a class
exhibit at least 60% sequence identity, while the identity
between classes is less than 30%, despite the generally
conserved tertiary structure (Sheenan et al. 2001).
GST M1-1 belongs to the m class of GSTs and has
been crystallized as a dimer with a molecular mass of
,51.5 kDa (Ji et al. 1992, 1993). Each monomer has one
complete active site consisting of a GSH site and one or
more hydrophobic substrate sites.
In 1995, Hu and Colman demonstrated that mBBr
was a substrate for rat GST M1-1 in the presence of
GSH. Their work also showed that mBBr acts as an
affinity label of rat GST M1-1 in the presence of the
GSH derivative, S-methylglutathione, modifying Cys
114 and Tyr 115 (Hu and Colman 1995). Affinity labeling of Tyr 115 occurred parallel with the loss of activity
as monitored by the CDNB assay, while labeling of Cys
114 was slower. Since the modified enzyme retained full
catalytic activity toward the substrate mBBr, yet exhibited only 9% residual activity toward the substrate
CDNB, it was proposed that there are two sites for
mBBr in GST M1-1: an affinity-labeled site that is identical or overlapping with the CDNB substrate site, and a
mBBr substrate site. Although a location for the mBBr
substrate site was proposed based on molecular modeling, it was not evaluated experimentally.
This study is focused on determining whether the
mBBr substrate site is distinguishable from the CDNB
substrate site and identifying amino acid residues
involved in the mBBr substrate site. The identification
of a second xenobiotic substrate site in GST M1-1 would
help to account for the broad substrate specificity of this

Results
Evaluation of S-(hydroxyethyl)bimane as an inhibitor
of the catalytic reactions of GST M1-1
To determine whether the mBBr substrate site is distinguishable from the CDNB substrate site, a nonreactive
mBBr derivative was synthesized and then tested for
its ability to compete kinetically with the substrates,
CDNB and mBBr. Measurement of the wild-type
enzymes kinetic parameters in the presence of S(hydroxyethyl)bimane reveals it is a competitive inhibitor with respect to the substrate mBBr: Over the 14
mM concentration range of S-(hydroxyethyl)bimane, it
has no effect on the Vmax but increases the Km of the
wild-type enzyme for mBBr, yielding an average KI value
of 0.36 mM (Table 1). In contrast, when tested in the
enzyme-catalyzed reaction of CDNB, S-(hydroxyethyl)bimane has no effect on the Km or Vmax for CDNB of the
wild-type enzyme (Table 1). Therefore, the mBBr substrate site is a distinct xenobiotic substrate site, independent of the CDNB substrate site.

Expression and purification

The plasmids encoding wild-type or mutant rat GST
M1-1 were expressed in JM105 Escherichia coli cells
and purified using chromatography on S-hexylglutathione agarose, as discussed in Materials and Methods. In each case, N-terminal sequencing indicated the
presence of one protein with the sequence PMILGYWNVRGL, which is unique to rat GST M1-1.
Enzyme yield varied with the mutation; typically, 15
mg/L cell culture of wild-type enzyme and 312 mg/L
cell culture of mutant enzyme were obtained.

Table 1. S-(hydroxyethyl)bimane is a competitive inhibitor of the mBBr reaction,

but not of the CDNB reaction, catalyzed by GST M11
mBBr
S-(hydroxyethyl)
bimane (mM)
0
1
2
4

Km
(mM)
0.5
2.4
4.0
4.2

6
6
6
6

0.1
0.3
0.7
1.1

CDNB

Vmax
(mmol/min/mg)
3.3
3.6
3.3
3.7

6
6
6
6

0.3
0.1
0.2
0.2

Km
(mM)

Vmax
(mmol/min/mg)

18.7 6 2.1

26.9 6 1.8
26.3 6 3.4

26.4 6 2.7

25.7 6 0.3
28.2 6 0.8

The Km values were determined under saturating conditions, and the Vmax values were determined by an
extrapolation of the Km kinetic data to infinite concentrations of monobromobimane (mBBr) or 1-chloro2,4-dinitrobenzene (CDNB) using SigmaPlot for data analysis.

www.proteinscience.org

2527

Hearne and Colman

Molecular mass determination

Crystal structures of rat GST M1-1 reveal the enzyme
as a dimer (Ji et al. 1992, 1993). In this study, sedimentation equilibrium experiments, conducted with 0.06
mg/mL of GST M1-1 in 0.1 M potassium phosphate
buffer (pH 6.5) containing 1 mM EDTA indicate the
enzyme is predominantly present as a dimer in this
solution. The weight average molecular mass of the
wild-type and each mutant enzyme (Table 2), was determined by use of the analytical ultracentrifuge. Each of
the mutant enzymes has a molecular mass comparable
to that of wild-type GST M1-1, demonstrating that the
normal subunit interaction has not been affected by
these mutations.
Alanine scanning
Amino acid residues along a-helix 4 of rat GST M1-1
were individually replaced by alanine to localize
the region in which mBBr binds. The wild-type enzyme
exhibits a VCDNB
max of 26.4 6 2.7 mmol substrate/min/mg
enzyme and KCDNB
of 18.7 6 2.1 mM for the conjugam
tion of CDNB and GSH. As for the mBBr and GSH
conjugation reaction, the enzyme exhibits a VmBBr
max of
3.3 6 0.3 mmol substrate/min/mg enzyme and KmBBr
of
m
0.5 6 0.1 mM. The enzyme exhibits for mBBr as substrate a Vmax that is only 1/8 that of the CDNB reaction; however, the affinity of this enzyme for mBBr
is 37-fold greater than for CDNB. The criteria used
to recognize amino acid residues involved in the mBBr
substrate site were a change in Vmax and/or Km for the
mutant enzyme for mBBr (either increased or
decreased) relative to the corresponding values for
wild-type GST M1-1. Furthermore, we sought mutations in which the effect on the Vmax and/or Km for

Table 2. Weight average molecular mass of the wild-type and

each GST M11 mutant enzyme as determined by sedimentation
equilibrium experiments using an analytical ultracentrifuge
Enzymea
WTb
V103A
V103L
V103T
V103D
V103M
M104A
M104E
M104K

Weight average
molecular mass (kDa)
46.0
46.6
47.4
46.0
48.3
47.4
42.2
45.0
50.4

6
6
6
6
6
6
6
6
6

0.3
0.3
0.5
0.4
0.1
0.2
1.1
0.3
0.2

Enzyme
M104W
M108A
Q109A
Q109E
Q109L
I111A
M112A
C114A
Y115F

Weight average
molecular mass (kDa)
44.2
46.6
49.1
45.6
47.3
42.0
47.6
47.8
46.6

6
6
6
6
6
6
6
6
6

0.6
0.3
0.5
0.3
0.1
0.1
0.1
0.1
0.5

a
In all cases, the enzyme (0.06 mg/mL) was in 0.1 M potassium phosphate buffer pH 6.5 containing 1 mM EDTA at 108C.
b
WT, wild-type.

2528

Protein Science, vol. 14

Figure 1. A comparison of the alanine mutant enzymes kinetic parameters. The CDNB kinetic parameters are represented by black vertical
bars, and the mBBr kinetic parameters are represented by gray vertical
bars. (A) Ratio of mutant GST M1-1 Vmax to wild-type GST M1-1
Vmax. (B) Ratio of mutant GST M1-1 Km to wild-type GST M1-1 Km.

mBBr as the substrate was greater than the effect on

the Vmax and/or Km for CDNB as the substrate. Figure 1 shows that substitutions at positions 103, 104,
and 109 perturb the mBBr reaction more than the
CDNB reaction, as evidenced by a fourfold increase
in KmBBr
for V103A and an increase of ninefold for
m
both M104A and Q109A (Fig. 1B). The Vmax-mutant/
Vmax-wild type also increases for the V103A and M104A
mutant enzymes, with the effect on mBBr being greater
than that on CDNB (Fig. 1A). These three residues
warranted further investigation by substitution of
amino acid residues of various sizes and functionalities
to determine their effect on the enzymes affinity for
mBBr and catalysis of the mBBr reaction. The M108A
mutant enzyme exhibits small effects on the kinetic
parameters; the effects are greater on CDNB than on
mBBr as substrate. The I111A and M112A mutant
enzymes exhibit a minimal effect on the mBBr kinetic
parameters, suggesting that the mBBr site does not
extend along a-helix 4 as far as position 111 and is
located closer to the start of a-helix 4. The circular
dichroism (CD) spectra of the alanine mutant enzymes
(data not shown) reveal that the changes in the kinetic
parameters are not due to major perturbations in secondary structure.

Delineation of substrate sites in rat GST M1-1

Evaluation of Met 104

Methionine 104 was mutated to alanine (M104A), tryptophan (M104W), glutamate (M104E), and lysine (M104K).
The ratios of the mutant enzyme kinetic parameters to the
wild-type enzyme kinetic parameters are shown in Figure 2
for the M104A and M104W mutant enzymes. Replacement
of methionine by either alanine or tryptophan causes a
,12-fold increase in Vmax for the mBBr reaction (Fig. 2A)
with little change in secondary structure, as indicated by
CD spectroscopy (data not shown). These results implicate
position 104 as a contributor to the mBBr substrate site.
A charged residue substituted at position 104 decreases the affinity of the enzyme for mBBr, as observed by the greatest increases in KmBBr
for the M104E
m
mutant enzyme (,50-fold), followed by the M104K
mutant enzyme (,21-fold). The KCDNB
increase was
m
not as appreciable, increasing approximately sevenfold
for both of the mutant enzymes. The M104E mutant enzymes VmBBr
max value increases 23-fold, while the
increase in VCDNB
is only threefold. Interestingly, for
max
the M104K mutant enzyme, the Vmax value for both
substrates did not change. The largest changes in secondary structure, as determined by CD spectroscopy
(data not shown), are observed for these two mutant enzymes, M104E and M104K, although they are changed in

Figure 3. A comparison of the Q109 mutant enzymes kinetic parameters. The CDNB kinetic parameters are represented by black vertical
bars, and the mBBr kinetic parameters are represented by gray vertical
bars. (A) Ratio of mutant GST M1-1 Vmax to wild-type GST M1-1
Vmax. (B) Ratio of mutant GST M1-1 Km to wild-type GST M1-1 Km.
Please note that the magnitude of the Y-axis is different from that of
Figures 1 and 2.

an opposite manner; the magnitude of the molar ellipticity at

220 nm is greater for the M104K mutant enzyme (-18,100)
but is lower for the M104E mutant enzyme (-8580), as
compared with the wild-type enzyme (-12,700). Thus, the
charged mutations perturb the secondary structure and this
perturbation probably contributes to the elevated KmBBr
m
values.
Evaluation of Gln 109

Figure 2. A comparison of the M104 mutant enzymes kinetic parameters. The CDNB kinetic parameters are represented by black vertical
bars, and the mBBr kinetic parameters are represented by gray vertical
bars. (A) Ratio of mutant GST M1-1 Vmax to wild-type GST M1-1
Vmax. (B) Ratio of mutant GST M1-1 Km to wild-type GST M1-1 Km.
Please note that the magnitude of the Y-axis is different from that of
Figure 1.

Glutamine 109 was mutated to alanine (Q109A), glutamate (Q109E), and leucine (Q109L), with the resultant
changes in kinetic parameters shown in Figure 3. The
size and polarity of the amino acid residue substituted
for glutamine is important in the enzymes affinity for
mBBr, as evidenced by the eight- to ninefold increases in
the KmBBr
values for the Q109A and Q109L mutant
m
enzymes (Fig. 3B). Lack of hydrogen bonding potential
and decreased polarity is apparently responsible for the
large increase in the KmBBr
. In contrast, the KCDNB
is
m
m
minimally altered in these three mutant enzymes. The
CD spectra (data not shown) of the Q109 mutant enzymes reveal that the changes in kinetic parameters are
not due to a perturbation of secondary structure.
www.proteinscience.org

2529

Hearne and Colman

Evaluation of Val 103

Valine 103 was mutated to alanine (V103A), leucine
(V103L), threonine (V103T), methionine (V103M), and
aspartate (V103D). The ratios of the mutant enzyme kinetic parameters to the wild-type enzyme kinetic parameters are shown in Figure 4 for those mutant enzymes
that are not structurally compromised (i.e., excludes
V103D). The V103A, V103L, V103T, and V103M
mutant enzymes exhibit elevated mBBr kinetic parameters, while the kinetic parameters for CDNB are not
appreciably changed. The largest increase in the mBBr
kinetic parameters is for the V103M mutant enzyme.
The biophysical properties of these four V103 mutant
enzymes are similar to those of the wild-type enzyme. In
contrast, the V103D mutant enzyme exhibits a negative
molar ellipticity at 220 nm (-15,800) of greater magnitude than that of the wild-type enzyme (-12,700). The
V103D mutant enzyme exhibits an increased Km value
for both substrates (23-fold for mBBr and 13-fold
for CDNB), while the Vmax is not appreciably changed
for either substrate. The elevated Km values of the
V103D mutant enzyme for both CDNB and mBBr can
be attributed in part to the perturbation in its secondary
structure.

Figure 5. A comparison of the C114A and Y115F mutant enzymes

kinetic parameters. The CDNB kinetic parameters are represented by
black vertical bars, and the mBBr kinetic parameters are represented by
gray vertical bars. (A) Ratio of mutant GST M1-1 Vmax to wild-type
GST M1-1 Vmax. (B) Ratio of mutant GST M1-1 Km to wild-type GST
M1-1 Km. Please note that the magnitude of the Y-axis is different from
those of Figures 14.

Site-directed mutagenesis of Cys 114 and Tyr 115

Figure 4. A comparison of the V103 mutant enzymes kinetic parameters. The CDNB kinetic parameters are represented by black vertical
bars, and the mBBr kinetic parameters are represented by gray vertical
bars. (A) Ratio of mutant GST M1-1 Vmax to wild-type GST M1-1
Vmax. (B) Ratio of mutant GST M1-1 Km to wild-type GST M1-1 Km.
Please note that the magnitude of the Y-axis is different from those of
Figures 13.

2530

Protein Science, vol. 14

The previous study by Hu and Colman (1995) demonstrated that affinity labeling of Cys 114 and Tyr 115 of
GST M1-1 led to extensive loss of enzymatic activity
toward the substrate CDNB without loss of enzymatic
activity toward the substrate mBBr. To evaluate further
the relative importance of these two amino acid residues
toward the substrates CDNB and mBBr, we constructed
the mutant enzymes C114A and Y115F. If either of these
amino acid residues were essential in either of the substrate sites, an appreciable change in Km would be
expected (Fig. 5B). The Km changes for CDNB and
mBBr are about the same and both are only 0.7 to 1.4
times that of the wild-type enzyme values. These results,
together with the earlier affinity labeling study (Hu and
Colman 1995), suggest that Cys 114 and Tyr 115 are in
the vicinity of the CDNB substrate binding site,
although they are not directly involved in binding. The
effect of these mutations is most prominently seen in the
VmBBr
value for the Y115F mutant enzyme, which
max
increases sixfold (Fig. 5A). The CD spectra for these
mutant enzymes are similar to that of the wild-type enzyme (data not shown).

Delineation of substrate sites in rat GST M1-1

Discussion
This study demonstrates the existence of at least two
independent hydrophobic substrate sites in rat GST
M1-1. With S-(hydroxyethyl)bimane acting as a competitive inhibitor of mBBr, but not of CDNB, we have
shown that the mBBr substrate site is independent of
the CDNB substrate site.
Alanine scanning of a-helix 4 enabled us to identify
Val 103, Met 104, and Gln 109 as participants in the
mBBr substrate site, which were worthy of more extensive examination. Kinetic analysis shows that Met 108,
Ile 111, and Met 112 are not involved in the mBBr
substrate site since there was minimal perturbation of
the kinetic parameters of the mBBr reaction; thus, these
residues did not warrant further investigation. The
M108A mutant enzyme only slightly affects the CDNB
kinetic parameters as indicated by a small elevation in
Km and Vmax. The large size and hydrophobic character
of the amino acid at position 108 is more important for
the enzymes activity with and affinity for CDNB than
for mBBr. Substitution of alanine at position 111 has
only a minimal effect on the enzymes affinity for the
hydrophobic substrate. Ile 111 does not physically contribute to the reaction of GST M1-1 with either substrate, although it has been shown to be important in
determining the stereoselectivity of the hydrophobic substrate for m class GSTs (Shan and Armstrong 1994). The
M112A mutant enzyme displays kinetic parameters for
both hydrophobic substrates that are similar to those of
wild-type GST M1-1, an indication that this residue is
not involved in reactions at either site. In contrast,
amino acid residue replacements at positions 103, 104,
and 109 exhibit a much greater perturbation of the
mBBr kinetic parameters than of the corresponding
CDNB values, indicating that these residues are localized in the mBBr substrate site, where they are important in the enzymes affinity for mBBr.
Amino acid residues numbered lower than 103 in the
primary sequence were not probed because of their
potential interaction with residues known to be involved
in subunitsubunit interactions (Combet et al. 2000;
Pettigrew and Colman 2001). The remaining amino
acid residues along a-helix 4 (Asp 105, Asn 106, Arg
107, and Leu 110) were not probed for various reasons.
Asp 105 and Arg 107 have been proposed to be involved
in GSH binding and activation, respectively (Adang et
al. 1990; Wilce and Parker 1994). Mutation of these
residues would most likely result in an enzyme with a
greatly decreased affinity for GSH, thereby complicating
interpretation of the enzymes affinity for the xenobiotic
substrates. Asn 106 and Leu 110 were not investigated
because they were on the opposite face of a-helix 4 with
distances too far from the mBBr molecule for interaction.

It was evident after mutating the residues around Leu 110

that it was most likely not participating in the mBBr substrate site since those amino acid residues numbered higher
in the primary sequence had only a minimal effect on the
mBBr kinetic parameters.
The model proposed by Hu and Colman (1995) was
only an approximation. We have now adjusted the
docked mBBr molecule within the GST structure and
refined its orientation in accordance with the results and
analysis of the mutant enzymes kinetic parameters. As
shown in Figure 6A, the mBBr molecule has been
docked at the mBBr substrate site in accordance with
the results of our kinetic studies and is shown positioned
for reaction, with the bromomethyl group of mBBr
located 4.09 A from the sulfur of S-methyglutathione.
The large size and hydrophobic character of Met 104
(Fig. 6A) make it a likely candidate to participate in the
mBBr substrate site. Substitutions at position 104 have a
small effect on the CDNB kinetic parameters; the effects
are much greater on the mBBr kinetic parameters. The
methyl groups of mBBr are only 3.54.3 A away from
Met 104 (Fig. 6A), enabling hydrophobic interactions
between the mBBr molecule and the substituted amino
acid residue at position 104. In silico modeling of the
M104A (Fig. 6B) and M104W (Fig. 6C) mutant enzymes
shows that there is a decrease in the hydrophobic interactions between the amino acid residue at position 104
and the mBBr molecule. The M104A and M104W
mutant enzymes have approximately the same effect on
the kinetic parameters; although tryptophan is a much
larger and more hydrophobic amino acid residue than
alanine, the indole ring of tryptophan is not positioned
to promote hydrophobic interaction with mBBr. The
M104E mutation eliminates the hydrophobic interactions and has a greater effect on the mBBr kinetics
than do the M104A or M104W mutations. The decreased hydrophobic interactions, as well as the perturbation of the secondary structure of the M104E mutant
. The
enzyme, are associated with an increased KmBBr
m
enzymes (M104A, M104E, M104W) decreased affinity
for mBBr and the opening up of the mBBr substrate site
correlate with the increased values of VmBBr
max . In contrast,
the M104K mutation, which preserves some of the hydrophobic interactions between the amino acid residue at
position 104 and the mBBr molecule, has a minimal affect
on VmBBr
max . In silico modeling shows that the position of
lysine is similar to that of the methionine in the wild-type
enzyme. The large size of the lysine residue does not allow
for the opening of the site. The increase in Km may be due
to an unfavorable charge interaction with Arg 107 (3.39
A) or the perturbation in secondary structure.
The nitrogen of Gln 109 of Subunit B has the potential
to hydrogen bond with the carbonyl groups of mBBr
(bound to Subunit A). Although they are too far apart
www.proteinscience.org

2531

Hearne and Colman

Figure 6. (A) Model of GST M1-1 with the monobromobimane molecule docked in the experimentally defined monobromobimane substrate site. The mBBr molecule is colored by atom (red for oxygen, blue for nitrogen). Amino acid residues (A) V103,
(A) M104, (B) Q109, and (A) Y115 (seen on edge) as well as the S-methylglutathione molecule (yellow) are colored in a solid
color. The amino acid residues shown are: Val 103 (green), Met 104 (red), Gln 109 (purple), and Tyr 115 (gray). Subunit A is
shown as a cyan ribbon with a-helix 4 accentuated in royal blue. Subunit B is shown as a pink ribbon with a-helix 4 accentuated
in gray. (B) In silico model of the M104A mutant enzyme. (C) In silico model of the M104W mutant enzyme.

(4.5 A) for direct hydrogen bonding (Fig. 6A), this interaction is likely facilitated through a water molecule
(w206) (Ji et al. 1993). It is notable that Gln 109 is
contributed by the opposite subunit (Subunit B) of the
dimer to mBBr bound to subunit A.1

1
Gln 109, belonging to the same subunit as the one to which mBBr
binds, is 12.1 A away from the mBBr molecule. Gln 109 is 3.2 A from
Lys 133, presenting the possibility of hydrogen bonding between these
two residues. However, it is not clear if this interaction is a requirement for the optimal positioning of a-helix 4.

2532

Protein Science, vol. 14

Fig. 6 live 4/c

Replacement of glutamine 109 with alanine or leucine

not only eliminates the hydrogen bonding potential and
polar interactions but also decreases the size of the amino
acid residue side chain. In silico modeling shows that
these mutations result in the bromomethyl carbon of
mBBr shifting away from the sulfur of S-methylglutathione toward the amino acid residue at position 109.
In the model of the Q109A mutant enzyme, the carbonyl
groups of mBBr are within hydrogen bonding distance
(2.99 A) of the peptide backbone at position 109 of Subunit B. Replacing glutamine with alanine or leucine also

Delineation of substrate sites in rat GST M1-1

causes the affinity of the enzyme for mBBr to decrease

eight- to ninefold, without affecting the Vmax. These
results suggest that the polarity of the amino acid residue
at this position, not the size of the residue, is important
for the enzymes affinity for mBBr. To test this hypothesis, Gln 109 was replaced by the polar glutamate amino
acid residue. The mBBr kinetic parameters of the Q109E
mutant enzyme resemble those of the wild-type GST M11. It is clear that Gln 109 plays a notable role in maintaining the enzymes affinity for mBBr.
The effects of the Val 103 mutations are reflected in the
changes of the mBBr kinetic parameters. Replacing Val 103
(Fig. 6A) generally did not affect the CDNB kinetic parameters: The V103D mutant enzyme is the exception, with
. This increase may be an indirect effect
an increased KCDNB
m
of the perturbation in the secondary structure as shown by
CD spectroscopy or the greatly decreased affinity of the
enzyme for GSH (,45-fold),2 which contrasts with the
observations for all of the other mutant enzymes. The
other V103 mutant enzymes do not show such a large
change in affinity for GSH (data not shown). Of these
mutant enzymes, V103M exhibits the largest increase in
mBBr kinetic parameters. The crystal structure of wildtype GST M1-1 reveals that Val 103 is oriented so that its
methyl groups are a minimum of 10.1 A from the mBBr
molecule, indicating that Val 103 is almost certainly a
second-sphere amino acid residue in the mBBr substrate
site. Therefore, the increase in KmBBr
of the V103M mutant
m
enzyme is probably due to the methionine residue crowding
first-sphere amino acid residues involved in the mBBr substrate site. This crowding is not enough to perturb the
global secondary structure as reflected in the CD spectra,
but it may modify the structure locally. While the increase
in KmBBr
for the V103A mutant enzyme is presumably due
m
to the loss of hydrophobic interactions with amino acid
residues nearby, the increase in KmBBr
for the V103L and
m
V103M mutant enzymes is probably due to the adverse size
of the substituted amino acid residue. Although threonine
is approximately the same size as valine, a hydrophobic
residue is favored at this position, hence the increase
in KmBBr
for the V103T mutant enzyme. The increase in
m
VmBBr
max for the Val 103 mutant enzymes is likely a reflection
of the enzymes decreased affinities for mBBr. Of the
mutant enzymes studied, an increase in Km is generally
accompanied by an increase in Vmax for the mBBr reaction.
This increase in Vmax is probably a result of the enzymes
less than optimal affinities for the hydrophobic substrate,
which is reflected in enhanced product release.
The results of site-directed mutagenesis of Cys 114 and
Tyr 115 confirm that these two amino acid residues are not
direct participants in either the mBBr substrate site or the
2
The KCDNB
of the V103D mutant enzyme was determined under
m
saturating GSH conditions (20 mM).

CDNB substrate site (Fig. 6A). These residues may mediate

product release from the enzymes active site (Fig. 6A,
Y115). The Y115F mutant enzyme, known to remain active
with respect to the CDNB assay (Johnson et al. 1993), lacks
the hydroxyl functional group of tyrosine. The loss of this
hydroxyl group eliminates the hydrogen bonds between Tyr
115 and the main chain amide nitrogen of Ser 209, as well as
the side chain hydroxyl of Ser 209, interactions that are
known to block the channel to the CDNB substrate site
and limit segmental motion of the protein during catalysis
(Johnson et al. 1993). This loss of hydrogen bonding allows
for an enhanced rate of product (GS-DNB) release from the
active site (Johnson et al. 1993). The observed increase in the
VCDNB
and VmBBr
max
max for the Y115F mutant enzyme occurs
concurrently with the loss of hydrogen bonding. As in the
CDNB catalytic reaction, in the monobromobimane reaction the loss of hydrogen bonding likely increases the rate of
the physical step of product dissociation, suggesting that it
may be the rate-determining step in the mBBr catalytic
reaction. We assume that the kinetic mechanism for GST
M1-1 using mBBr as the hydrophobic substrate is similar to
the kinetic mechanism obeyed by GST M1-1 in catalyzing
nucleophilic aromatic substitution reactions in which the
addition of the substrates to the enzyme is random (Armstrong 1991). However, when the physiological state of a cell
is considered, the addition of the substrates is ordered with
GSH binding first (Pickett and Lu 1989; Armstrong 1991),
because the concentration of GSH in a cell (15 mM) is
much higher than the concentration of the xenobiotic compound in the cell (Armstrong 1991). These mutant enzymes
demonstrate that the loss of interaction of Cys 114 and Tyr
115 with the substrate CDNB cannot be the basis of inactivation of the enzyme in the mBBr affinity labeling experiments; rather, the loss of activity can be attributed to the
bulky affinity label blocking CDNB from entering the substrate site. It has been proposed that Cys 114 and Tyr 115
(Fig. 6A) are located at or in the close vicinity of the CDNB
substrate site (Liu et al. 1993; Ploemen et al. 1994).
The a, p, and m classes of rat GST have previously
been investigated for catalytic activity with mBBr and
GSH as co-substrates (Hu and Colman 1995; Hu et al.
1997; Ralat and Colman 2003). These three classes catalyze the conjugation of mBBr and GSH, and have also
been probed using the affinity label mBBr (Hu and Colman 1995; Hu et al. 1997; Ralat and Colman 2004).
mBBr was found to be an affinity label of the m class
of GSTs (Hu and Colman 1995; Hu et al. 1997); in that
case it was proposed that the substrates CDNB and
mBBr occupy two distinct sites in GST M1-1 during
the catalytic reaction (Hu and Colman 1995), and this
proposal is consistent with the results of our present
study. In 1997, Hu, Borleske, and Colman found that
mBBr is an affinity label of GST A1-1; in that study
it was found that CDNB and mBBr share the same subwww.proteinscience.org

2533

Hearne and Colman

strate site in GST A1-1, since the modification of Cys 17

and Cys 111 parallel the loss of enzymatic activity
toward both CDNB and mBBr. The p class has previously been shown to have distinctive substrate sites for
CDNB and mBBr (Ralat and Colman 2003, 2004). Here,
we demonstrate experimentally that GST M1-1 has at
least two distinct xenobiotic substrate sites.
This, as well as other reports, support the fact that more
than one xenobiotic substrate site exists in many classes of
soluble mammalian GSTs (Bhargava et al. 1978; Vander
Jagt et al. 1985; Barycki and Colman 1993; Hu and Colman 1995; Hu et al. 1997; Ralat and Colman 2003, 2004).
Identification of a second independent xenobiotic substrate site is biologically relevant since this family of
enzymes plays a key role in Phase II detoxification. A
second independent substrate site allows for specific inhibition of the enzyme at one site without affecting the
catalytic capability of the enzyme at the other site, providing additional protection to an organism from endogenous or exogenous xenobiotics. The identification of this
site supports the proposal that the promiscuity of the
enzyme is due to multiple xenobiotic substrate sites.

Materials and methods

Materials
GSH, S-hexylglutathione immobilized on cross-linked 4% agarose beads, CDNB, and ampicillin were purchased from Sigma
Chemical Company. mBBr was purchased from Molecular
Probes. The oligonucleotides for mutagenesis and the primers
for DNA sequencing were purchased from Biosynthesis, Inc.
The Quikchange XL Site-Directed Mutagenesis Kit was obtained
from Stratagene, and the QIAprep Spin Miniprep Kit was supplied by QIAGEN. All other reagents were purchased from
Fisher and were of reagent grade.

Synthesis of S-(hydroxyethyl)bimane
mBBr and b-mercaptoethanol were mixed in a ratio of 1:15.5
equivalents in a solution of 100 mM BTP (pH 8.5) containing
50% acetonitrile. The reaction was allowed to proceed under
nitrogen for 20 min; the vessel was then sealed and the solution
stirred for an additional hour. A sample was applied to a Hewlett
Packard 1100 RP-HPLC (5 mm, 4.6 mmID, 250 mmL, Vydac C18)
employing a linear gradient from 0% to 43% solvent B over 43 min
(where solvent A is 0.1% TFA in water, and solvent B is 90%
acetonitrile, 10% water, and 0.1% TFA). The spectrum, monitored at 220 nm and 390 nm, revealed one dominant peak at 20%
solvent B. The peak was collected for ESI-MS. The reaction mixture containing the product was diluted 1:3 in water and applied to
a RP-HPLC equipped with a Waters 2487 dual absorbance detector, Waters 600 pump, and a Linseis L250E recorder (10 mm, 22
mm ID, 250 mm L, Vydac C18), employing a linear gradient from
0% to 100% solvent B. The product eluted at 20% solvent B was
monitored at wavelengths of 340 nm and 220 nm. The TFA was
exchanged with 0.1 N HCl by solubilizing the product in 0.1 N

2534

Protein Science, vol. 14

HCl, then lyophilizing to dryness. This was repeated three times to

ensure exchange. S-(hydroxyethyl)bimane (molecular weight
268.33), ESI:291.3 (molecular weight of sodium adduct).

Plasmid and mutagenesis

The complete DNA encoding rat (Rattus norvegicus) GST M11, as well as the 3-untranslated region of rat GST M1-1,
inserted into a pBR322 vector via the NdeI and EcoRI restriction sites, was a generous gift from Ming F. Tam at the Institute
of Molecular Biology, Academia Sinica, Nankang, Taipei. This
plasmid was used with the permission of Dr. M. Rosenberg of
Smith Kline Beecham, by whom the expression vector pMG27N
(of which this is a derivative) was developed. Site-directed mutagenesis was performed using the Stratagene Quikchange XL
Site-Directed Mutagenesis Kit. The mutation codon was chosen
based on the percent frequency of occurrence in E. coli as well as
the fewest number of base changes. The following oligonucleotides and their complementary sequences were used to incorporate the point mutations into the DNA, according to the
Stratagene Quikchange XL Site-Directed Mutagenesis kit
instruction manual. The mutated amino acid residue and number are marked in bold and the replacement codon is underlined:
V103A, GGAGAACCAGGCCATGGACAACCG; V103D,
GGAGAACCAGGATATGGACAACCG; V103L, GGAGA
ACCA GCTGATGGACAACCG; V103M, GGAGAACCAG
ATG ATGGACAACCG; V103T, GGAGAACCAGACCATG
GAC AACCG; M104A, GGAGAACCAGGTCGCGGA CAA
CCG; M104E, GGAGAACCAGGTCGAAGACAACCG;
M104K, GGAGAACCAGGTCAAAGACAACCG; M104W,
GGAGAACCAGGTCTGGGACAACCG; M108A, GGACA
ACCGCGCGCAGCTCATCATGC; Q109A, GGACAACCG
CATGGCGCTCATCATG; Q109E, GGACAACCGCATGG
AACTCATCATG; Q109L, GGACAACCGCATGCTGCTCA
TCATG; I111A, CCGCATGCAGCTCGCCATGCTTTGT
TAC; M112A, GCAGCTCATCGCGCTTTGTTAC; C114A,
CATCATGCTTGCTTACAACCCCGAC; Y115F, CATCAT
GCTTTGTTTCAACCCC GAC.
DNA extraction and purification was completed using the
QIAprep Spin Miniprep Kit. DNA sequencing confirmed sitedirected codon mutation incorporation. Sequencing was performed at the University of Delaware Biology Core Facility using
a Long Readir 4200 DNA Sequencer (LiCor, Inc.) or the University of Delaware Center for Agricultural Biotechnology using an
ABI Prism model 377 DNA sequencer (PE Biosystems) or an
Applied Biosystems 3130 XL Genetic Analyzer. The forward sequencing primer is 5-ATGCCTATGATACTGGGATA-3 and
the reverse primer is 5-CATTGGGCCAACTTCGAAAA-3.
Mutated DNA was transformed into competent JM105 E. coli
cells for expression (Sambrook et al. 1989).

Protein purification
Rat GST M1-1, both wild-type and mutant enzymes, were
expressed in JM105 E. coli cells. The cells were grown at 378C
in LB containing 270 mM ampicillin until A600nm was 0.40.6, at
which time the cells were induced with a final concentration of 1
mM IPTG. The cells were grown for 24 h at 258C , after which
they were harvested by centrifugation at 10,444g for 25 min at
48C. The resulting pellets were frozen at -808C. The cell pellet
from 6 L of culture was defrosted in a 258C water bath and
resuspended in 50 mL of 10 mM Tris-HCl buffer (pH 7.8) at

Delineation of substrate sites in rat GST M1-1

258C. The cells were ruptured by 6 min of sonication (three 2min intervals of sonication, separated by 30-sec intervals) at 20
kHz and 475 W with a sonicator from Ultrasonic, Inc. The cell
suspension was kept on ice during sonication.
After sonication, the suspension was centrifuged at 10,886g
for 25 min at 48C. The supernatant was decanted and loaded
onto a 0.7 20-cm column packed with 10 mL of S-hexylglutathione immobilized on cross-linked 4% agarose beads, for
purification. All column purification procedures were performed
at 48C. Succinctly, the column was equilibrated with 1 L of 10
mM Tris-HCl buffer (pH 7.8), and the enzyme suspension was
loaded onto the column. The column was first eluted with 1 L of
10 mM Tris-HCl buffer (pH 7.8) followed by 0.25 L of 10 mM
Tris-HCl buffer (pH 7.8) containing 0.2 M NaCl to wash the
nonspecifically bound proteins from the column. GST M1-1 was
eluted with 0.2 L of 10 mM Tris-HCl buffer (pH 7.8) containing
2.5 mM S-hexylglutathione and 0.2 M NaCl. The enzyme was
dialyzed and concentrated in 0.1 M potassium phosphate (pH
6.5) containing 1 mM EDTA by use of Amicon Ultra Centrifugal Filter Devices (Millipore Corp.), which were spun at 2611g
for 15 min at 48C. Enzyme concentration was determined using
a Hewlett Packard 8453 UV-VIS spectrophotometer and the
extinction coefficient at 270 nm (De = 37,700 M-1 cm-1).
Enzyme purity was assessed by N-terminal sequencing (Applied
Biosystems Procise Sequencing System).

Molecular mass determination

The weight average molecular mass of each enzyme was determined using a Beckman Optima XL-A or Beckman Coulter XLI analytical ultracentrifuge. Sedimentation equilibrium experiments were performed at speeds of 15,000 rpm, 17,000 rpm, and
20,000 rpm running at 108C using an An-60 Ti rotor (XL-A) or
an An-50 Ti rotor (XL-I). Enzyme samples (0.06 mg/mL) were in
0.1 M potassium phosphate buffer (pH 6.5) containing 1 mM
EDTA. Stepwise radial scans at 235 nm and 270 nm were
performed, after equilibrium was reached, using a step size of
0.001 cm (Vargo et al. 2004). The resulting data were fit using the
software package IgorPro (Wavemetrics, Inc.) as previously
described (Schneider et al. 1997; Kretsinger and Schneider 2003).

CD spectroscopy
CD spectroscopy was performed on a Jasco J-710 spectropolarimeter as previously described (Vargo and Colman 2004).
Concisely, the ellipticity of the enzyme sample (,0.15 mg/mL
in 0.1 M potassium phosphate buffer at pH 6.5 containing 1
mM EDTA) was measured as a function of wavelength
between 200 nm and 250 nm at 0.1-nm increments. The average
of five measurements was recorded as the spectrum. Each
sample spectrum was corrected for the contribution from 0.1
M potassium phosphate buffer (pH 6.5) containing 1 mM
EDTA.

Enzymatic assays
The conjugation of CDNB (1 mM) and GSH (2.5 mM) in 0.1
M potassium phosphate buffer (pH 6.5) containing 1 mM
EDTA and 2.5% ethanol was monitored at 340 nm (De = 9.6
mM-1 cm-1) using a Hewlett Packard 8453 UV-VIS spectrophotometer (Habig et al. 1974). The conjugation of mBBr
(30 mM) and GSH (600 mM) in 0.1 M potassium phosphate

buffer (pH 6.5) containing 1 mM EDTA and 20% DMF was

monitored using a Perkin-Elmer MPF-3 fluorescence spectrophotometer (emission at 480 nm, excitation at 395 nm) (Hulbert
and Yakubu 1983). The activity of the enzymes is expressed
as specific activity (mmol substrate per minute per milligram
enzyme). The specific activity is corrected for the rate of the
spontaneous nonenzymatic conjugation reaction between the
hydrophobic substrate and GSH. For all rate determinations
the reactions were maintained at 258C.
To determine the KCDNB
,m
a range of CDNB concentrations
was used (5 mM1 mM), while the GSH concentration was
fixed at 2.5 mM. For those mutant enzymes that exhibited a
high KCDNB
value relative to 1 mM, the CDNB concentration
m
range was extended to 3 mM. Determination of the KGSH
for
m
the CDNBGSH conjugation reaction was accomplished using
a range of GSH concentrations (generally 10 mM2.5 mM),
while the CDNB concentration was kept constant at 1 mM.
For the enzyme with an unusually high KGSH
value, the range
m
of GSH concentrations was extended to 20 mM. To determine
the KmBBr
,m a range of mBBr concentrations was used (0.25 mM
60 mM), while the GSH concentration was constant at 600 mM.
For those mutant enzymes that exhibited a high KmBBr
value
m
relative to 30 mM, the mBBr concentration was held constant
at 90 mM in determining the KGSH
for the mBBrGSH conm
jugation reaction, generally using a GSH concentration range
of 5 mM2400 mM. To determine the kinetic parameters of the
hydrophobic substrates in the presence of S-(hydroxyethyl)bimane, a nonreactive mBBr derivative, a final concentration of
1, 2, or 4 mM of S-(hydroxyethyl)bimane was included in the
enzymatic assays mentioned above. For all kinetic parameter
determinations, the temperature was maintained at 258C and
the conditions were generally saturating for the invariable
substrate. The data were fitted to the Michaelis-Menten rectangular hyperbola using SigmaPlot. The Vmax and standard
error were calculated from an extrapolation of the data.

Molecular modeling
Molecular modeling was conducted using the Insight II (1997)
software package from Molecular Simulations, Inc., on a Silicon Graphics Indigo 2 workstation. The atomic coordinates
for the rat GST M1-1 isozyme were obtained from the Brookhaven Protein Databank, PDB entry 1GST (Ji et al. 1993).
The mBBr molecule was manually docked into the mBBr substrate site based on the results of the kinetic studies. Consideration of the distance between the thiol of S-methylglutathione
and the bromomethyl group of mBBr was instrumental in the
correct placement of the manually docked mBBr molecule.
Optimal positioning of the mBBr molecule was achieved by
three-dimensional rotation and translation of the molecule.
The mutant enzymes were modeled by replacing the individual
amino acids at positions 103, 104, and 109 with the amino acids
corresponding to the mutations made at each position. In all
cases, the enzymesubstrate complex was energy minimized by
the Discover module of Biosym to optimize the global enzyme
substrate structure (Steepest Gradient, 100 Iterations, 0.001
Derivative). The intermolecular energy was monitored for
rational values and distances.

Acknowledgments
This work was funded by NIH R01-CA66561 (R.F.C). The
Beckman Optima XL-I analytical ultracentrifuge used in this

www.proteinscience.org

2535

Hearne and Colman

study was obtained and supported by NIH 2P20 RR016472.

We thank Dr. Ming Tam and Dr. M. Rosenberg for the
plasmid and its use, Dr. Joel Schneider for the use of the XLA analytical ultracentrifuge and the data analysis software, Dr.
Yu-Chu Huang for obtaining the N-terminal sequences, and
Dr. Melissa A. Vargo for useful discussions. We also thank
Lisa A. Haines for her help with the synthesis of S-(hydroxyethyl)bimane.

References
Adang, A.E.P., Brussee, J., Gen, A.V.D., and Mulder, G.J. 1990. The
glutathione-binding site in glutathione S-transferases. Biochem. J. 269:
4754.
Armstrong, R.N. 1991. Glutathione S-transferases: Reaction mechanism,
structure, and function. Chem. Res. Toxicol. 4: 131140.
. 1998. Mechanistic imperative for the evolution of glutathione
transferases. Curr. Opin. Chem. Biol. 2: 618623.
Barycki, J.J. and Colman, R.F. 1993. Affinity labeling of glutathione Stransferase, isozyme 4-4, by 4-(fluorosulfonyl)benzoic acid reveals Tyr
115 to be an important determinant of xenobiotic substrate specificity.
Biochemistry 32: 1300213011.
Bhargava, M.M., Listowsky, I., and Arias, I.M. 1978. Studies on subunit
structure and evidence that ligandin is a heterodimer. J. Biol. Chem.
253: 41164119.
Board, P.G., Baker, R.T., Chelvanayagam, G., and Jermiin, L.S. 1997.
Zeta, a novel class of glutathione transferases in a range of species from
plants to humans. Biochem. J. 328: 929935.
Board, P.G., Coggan, M., Chelvanayagam, G., Easteal, S., Jermiin, L.S.,
Schulte, G.K., Danley, D.E., Hoth, L.R., Griffor, M.C., Kamath,
A.V., et al. 2000. Identification, characterization, and crystal structure
of the v class glutathione transferases. J. Biol. Chem. 275: 24798
24806.
Boyer, T.D. 1989. The glutathione S-transferases: An update. Hepatology
9: 486496.
Coles, B. and Ketterer, B. 1990. The role of glutathione and glutathione
transferases in chemical carcinogenesis. Crit. Rev. Biochem. Mol. Biol.
25: 4770.
Combet, C., Blanchet, C., Geourjon, C., and Deleage, G. 2000. NPS@:
Network Protein Sequence analysis (CLUSTALW multiple alignment).
TIBS 291: 147150.
Eaton, D.L. and Bammler, T.K. 1999. Concise review of the glutathione Stransferases and their significance in toxicology. Toxicol. Sci. 49: 156
164.
Habig, W.H., Pabst, M.J., and Jakoby, W.B. 1974. Glutathione S-transferases. The first enzymatic step in mercapturic acid formation. J. Biol.
Chem. 249: 71307139.
Hearne, J.L. and Colman, R.F. 2004. Delineation of xenobiotic substrate
site in glutathione S-transferase M1-1 (GST M1-1) by mutagenesis. In
Abstracts of Papers, 228th ACS National Meeting, Philadelphia, PA,
USA, August 2226, p. BIOL-095.
Hu, L. and Colman, R.F. 1995. Monobromobimane as an affinity label of
the xenobiotic binding site of rat glutathione S-transferase 3-3. J. Biol.
Chem. 270: 2187521883.
Hu, L., Borleske, B.L., and Colman, R.F. 1997. Probing the active site of
a-class rat liver glutatione S-transferases using affinity labeling by
monobromobimane. Protein Sci. 6: 4352.
Hulbert, P.B. and Yakubu, S.I. 1983. Monobromobimane: A substrate for
the fluorimetric assay of glutathione transferase. J. Pharm. Pharmacol.
35: 384386.
Jakoby, W.B. and Habig, W.H. 1980. Enzymatic basis of detoxification (ed.
W.B. Jakoby), pp. 6394. Academic Press, New York.
Ji, X., Zhang, P., Armstrong, R.N., and Gilliland, G.L. 1992. The threedimensional structure of a glutathione S-transferase from the m gene
class. Structural analysis of the binary complex of isoenzyme 3-3 and
glutathione at 2.2-A resolution. Biochemistry 31: 1016910184.
Ji, X., Armstrong, R.N., and Gilliland, G.L. 1993. Snapshots along the
reaction coordinate of an SNAr reaction catalyzed by glutathione
transferase. Biochemistry 32: 1294912954.
Johnson, W.W., Liu, S., Ji, X., Gilliland, G.L., and Armstrong, R.N.
1993. Tyrosine 115 participates both in chemical and physical steps of
the catalytic mechanism of a glutathione S-transferase. J. Biol. Chem.
268: 1150811511.

2536

Protein Science, vol. 14

Kretsinger, J.K. and Schneider, J.P. 2003. Design and application of basic
amino acids displaying enhanced hydrophobicity. J. Am. Chem. Soc.
125: 79077913.
Liu, L.F., Hong, J.L., Tsai, S.P., Hsieh, J.C., and Tam, M.F. 1993.
Reversible modification of rat liver glutathione S-transferase 3-3 with
1-chloro-2, 4-dinitrobenzene: Specific labeling of Tyr-115. Biochem. J.
296: 189197.
Mannervik, B. and Danielson, U.H. 1988. Glutathione transferases-structure and catalytic activity. CRC Crit. Rev. Biochem. 23: 283337.
Mannervik, B., Alin, P., Guthenberg, C., Jensson, H., Tahir M.K., Warholm, M., and Jornvall, H. 1985. Identification of three classes of
cytosolic glutathione transferase common to several mammalian species: Correlation between structural data and enzymatic properties.
Proc. Natl. Acad. Sci. 82: 72027206.
Meyer, D.J., Coles, B., Pemble, S.E., Gilmore, K.S., Fraser, G.M., and
Ketterer, B. 1991. Theta, a new class of glutathione transferases purified from rat and man. Biochem. J. 274: 409414.
Pemble, S.E., Wardle, A.F., and Taylor, J.B. 1996. Glutathione S-transferase class k: Characterization by the cloning of rat mitochondrial GST
and identification of a human homologue. Biochem. J. 319: 749754.
Pettigrew, N.E. and Colman, R.F. 2001. Heterodimers of glutathione Stransferase can form between isoenzyme classes p and m. Arch. Biochem. Biophys. 396: 225230.
Pettigrew, N.E., Brush, E.J., and Colman, R.F. 2001. 3-Methyleneoxindole: An affinity label of glutathione S-transferase p which targets
tryptophan 38. Biochemistry 40: 75497558.
Pickett, C.B. and Lu, A.Y. 1989. Glutathione S-transferases: Gene structure, regulation, and biological function. Annu. Rev. Biochem. 58: 743
764.
Ploemen, J.H.T.M., Johnson, W.W., Jespersen, S., Vanderwall, D., van
Ommen, B., van der Greef, J., van Bladeren, P.J., and Armstrong,
R.A. 1994. Active-site tyrosyl residues are targets in the irreversible
inhibition of a class m glutathione transferase by 2-(S-glutathionyl)3, 5, 6,-trichloro-1, 4-benzoquinone. J. Biol. Chem. 269: 26890
26897.
Ralat, L.A. and Colman, R.F. 2003. Monobromobimane occupies a distinct xenobiotic substrate site in glutathione S-transferase p. Protein
Sci. 12: 25752587.
. 2004. Glutathione S-transferase p has at least three distinguishable
xenobiotic substrate sites close to its glutathione-binding site. J. Biol.
Chem. 279: 5020450213.
Rossjohn, J., Polekhina, G., Feil, S.C., Allocati, N., Masulli, M., De Illio,
C., and Parker, M.W. 1998. A mixed disulfide bond in bacterial glutathione transferase: Functional and evolutionary implications. Structure 6: 721734.
Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular cloning: A
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY.
Schneider, J.P., Lear, J.D., and DeGrado, W.F. 1997. A designed buried
salt bridge in a heterodimeric coiled coil. J. Am. Chem. Soc. 119: 5742
5743.
Shan, S. and Armstrong, R.N. 1994. Rational reconstruction of the active
site of a class m GST. J. Biol. Chem. 269: 3237332379.
Sheenan, D., Meade, G., Foley, V.M., and Dowd, C.A. 2001. Structure,
function and evolution of glutathione transferases: Implications for
classification of non-mammalian member of an ancient enzyme superfamily. Biochem. J. 360: 116.
Soberman, R.J. and Austen, K.F. 1989. The cell biology and biochemistry
of leukotriene C4 biosynthesis. Adv. Prostaglandin Thromboxane Leukot Res. 19: 2125.
Vander Jagt, D.L., Hunsaker, L.A., Garcia, K.B., and Royer, R.E. 1985.
Isolation and characterization of the multiple glutathione S-transferases from human liver. Evidence for unique heme-binding sites. J.
Biol. Chem. 260: 1160311610.
Vargo, M.A. and Colman, R.F. 2004. Heterodimers of wild-type and
subunit interface mutant enzymes of glutathione S-transferase A11: Interactive or independent active sites? Protein Sci. 13: 1586
1593.
Vargo, M.A., Nguyen, L., and Colman, R.F. 2004. Subunit interface
residues of glutathione S-transferase A1-1 that are important in the
monomerdimer equilibrium. Biochemistry 43: 33273335.
Waxman, D.J. 1990. Glutathione S-transferases: Role in alkylating agent
resistance and possible target for modulation chemotherapyA
review. Cancer Res. 50: 64496454.
Wilce, M.C. and Parker, M.W. 1994. Structure and function of glutathione
S-transferases. Biochim. Biophys. Acta 1205: 118.