Curr Microbiol (2015) 71:650657

DOI 10.1007/s00284-015-0898-3

New Primers Targeting Full-Length Ciliate 18S rRNA Genes

and Evaluation of Dietary Effect on Rumen Ciliate Diversity
in Dairy Cows
Jun Zhang1 Shengguo Zhao1 Yangdong Zhang1 Peng Sun1 Dengpan Bu1,2,3
Jiaqi Wang1

Received: 4 April 2015 / Accepted: 16 July 2015 / Published online: 30 August 2015
 Springer Science+Business Media New York 2015

Abstract Analysis of the full-length 18S rRNA gene

sequences of rumen ciliates is more reliable for taxonomical classification and diversity assessment than the analysis of partial hypervariable regions only. The objective of
this study was to develop new oligonucleotide primers
targeting the full-length 18S rRNA genes of rumen ciliates,
and to evaluate the effect of different sources of dietary
fiber (corn stover or a mixture of alfalfa hay and corn
silage) and protein (mixed rapeseed, cottonseed, and/or
soybean meals) on rumen ciliate diversity in dairy cows.
Primers were designed based on a total of 137 previously
reported ciliate 18S rRNA gene sequences. The 30 -terminal
sequences of the newly designed primers, P.1747r_2,
P.324f, and P.1651r, demonstrated [99 % base coverage.
Primer pair D (P.324f and P.1747r_2) was selected for the

cloning and sequencing of ciliate 18S rRNA genes because

it produced a 1423-bp amplicon, and did not amply the
sequences of other eukaryotic species, such as yeast. The
optimal species-level cutoff value for distinguishing
between the operational taxonomic units of different ciliate
species was 0.015. The phylogenetic analysis of full-length
ciliate 18S rRNA gene sequences showed that distinct
ciliate profiles were induced by the different sources of
dietary fiber and protein. Dasytricha and Entodinium were
the predominant genera in the ruminal fluid of dairy cattle,
and Dasytricha was significantly more abundant in cows
fed with corn stover than in cows fed with alfalfa hay and
corn silage.

Introduction
Jun Zhang and Shengguo Zhao contributed equally to this study.

Electronic supplementary material The online version of this

article (doi:10.1007/s00284-015-0898-3) contains supplementary
material, which is available to authorized users.
& Dengpan Bu
budengpan@126.com
& Jiaqi Wang
jiaqiwang@vip.163.com
1

State Key Laboratory of Animal Nutrition, Institute of

Animal Sciences, Chinese Academy of Agricultural Sciences,
No. 2 Yuanmingyuanxilu, Haidian, Beijing 100193,
Peoples Republic of China

CAAS-ICRAF Joint Laboratory on Agroforestry and

Sustainable Animal Husbandry (ASAH), World Agroforestry
Centre, East and Central Asia, Beijing 100081,
Peoples Republic of China

Synergetic Innovation Center of Food Safety and Nutrition,

Harbin 150030, Peoples Republic of China

123

Ciliate protozoa are important members of the rumen

microbial community in ruminants, and account for up to
50 % of the total microbial biomass of the ruminal contents
[24]. Rumen ciliates play important roles in the degradation of carbohydrate polymers and the production of
volatile fatty acids, lactate, carbon dioxide, and hydrogen
gas [3]. By engulfing bacteria, rumen ciliates promote
ruminal nitrogen turnover, which leads to reduced nitrogen
utilization efficiency [24]. Therefore, numerous studies
have investigated rumen microbial communities in dairy
cattle.
In recent years, denaturing gradient gel electrophoresis
(DGGE), real-time polymerase chain reaction (qPCR),
molecular cloning, and DNA sequencing have been used to
study the diversity of rumen ciliate communities in dairy
cows, and various primers have been designed for these
analyses [12, 21, 22, 24, 26]. Short PCR amplicons

J. Zhang et al.: New Primers Targeting Full-Length Ciliate 18S rRNA Genes and Evaluation of

(\ 600 bp) have been used to study rumen ciliate diversity

using DGGE, real-time PCR, and pyrosequencing [7, 11,
19]. However, an analysis of short amplicons is not as
accurate as an analysis based on long amplicons
([1300 bp) for taxonomical classification and the assessment of ciliate diversity. With the development of single
molecule real-time (SMRT) and nanopore sequencing, the
use of primers that produce full-length 18S ribosomal RNA
gene amplicons represents a more powerful method for
evaluating ciliate diversity. Previous studies have developed ciliate primers that produce long amplicons [4, 9, 21,
24]. Although studies of long amplicons have been performed as recently as 10 years ago, genomic databases for
ciliates were limited at that time, which precluded a thorough assessment of whether the primers used to identify
rumen ciliate sequences were affected by PCR bias [8, 24,
27].
With the recent expansion of genomic databases for
rumen ciliates, it may now be possible to improve the
efficiency and specificity of PCR-based methods of
detecting diversity in rumen ciliates based on 18S rRNA
gene sequences by designing primers based on the currently available genomic data. The current greater abundance of known genomic sequences of the rumen microbes
isolated from other eukaryotic species also benefits efforts
to optimize PCR primers for the detection of 18 s rRNA
gene sequences by improving primer specificity.
Alfalfa and corn silage are ideal dietary fiber sources for
dairy cow diets, and soybean meal is an ideal source of
protein [17]. In previous studies of dairy cows, a diet
consisting of corn stover only resulted in a lower level
rumen microbial protein, reduced milk production, and a
shift in the rumen microbial metabolome, relative to that of
cows fed with mixed corn silage and alfalfa [29, 30].
However, whether supplementing dairy cow diets with
different sources of dietary fiber and protein can restore the
rumen ciliate profile remains unclear. In our current study,
we designed PCR primers that targeted the full-length 18S
rRNA gene sequences of dairy cows, and evaluated the
effects of changes in dietary fiber and protein sources on
the rumen ciliate profile.

651

been used in previous studies were also included in our

comparison. The number of degenerate bases in the
P.1747r and Medlin B primers was increased, relative to
those of the primer sequences used in previous studies [8,
15, 26]. The length of amplicon was calculated based on
the 18S rRNA gene of Saccharomyces cerevisiae strain
NCYC505 (GenBank accession number Z75578). The base
coverage of the four newly designed primers and the four
previously described primers was calculated based on the
137 previously reported 18S rRNA gene sequences, and a
heat map was constructed using the R, version 3.1.1,
software (R Foundation for Statistical Computing, Vienna,
Austria). The melting temperatures of the newly designed
primers were evaluated using the Primer Express program
(Applied Biosystems, Carlsbad, CA, USA). The specificity
of the primers was evaluated based on the PCR amplification of a yeast DNA template. The yeast DNA was
extracted from yeast powder (Angel, Changyi, China)
using cetyltrimethylammonium bromide (CTAB) and the
bead-beating method, as described previously [28]. Each
reaction contained 10 lL of PCR premix (Takara Bio,
Shiga, Japan), 0.5 lL of each primer (10 lM), 25 ng of
DNA template, and 8.5 lL of deionized water. Thermal
cycling was performed with an initial denaturation at 94 C
for 3 min, followed by 30 cycles of denaturation at 94 C
for 30 s, primer annealment for 1 min at the respective
annealing temperature (Table 1), and extension at 72 C
for 2 min, with a final extension at 72 C for 7 min. The
sizes of the PCR products were confirmed by electrophoresis in a 1.5 % (w/v) agarose gel.
Species-Level Cutoff Value for 18S rRNA Gene
Sequences Clustering

Materials and Methods

The previously reported ciliate 18S rRNA gene sequences

(n = 137) were trimmed based on the primer pair D
amplicon (Table 1), and imported into the MOTHUR,
version 1.33.0, program [20]. The distance matrix was
calculated and used to assign the 18S rRNA gene
sequences to operational taxonomic units (OTUs) using a
cutoff value between 0.010 and 0.041. The optimal cutoff
value was determined for each OTU. Each OTU contained
sequence from one species only, and only one species
clustered into each OTU at the species level.

Design and Evaluation of Ciliate Primers

Dietary Treatment of Dairy Cows

A total of 137 previously reported ciliate 18S rRNA gene

sequences were downloaded from the Silva database
(http://www.arb-silva.de). After aligning the sequences
using the ARB, version 5.5, software [18], primers were
designed based on the sequences of conserved regions
(Table 1). As shown in Table 1, two primer pairs that had

The protocols for our animal experiments were approved

by the Animal Care Committee of the Institute of Animal
Science (Beijing, China). Forty-eight Chinese Holstein
dairy cows with similar milk production characteristics
(55 15 days in milk and milk yields of 31 4 kg) were
randomly assigned to three groups that received different

123

652

J. Zhang et al.: New Primers Targeting Full-Length Ciliate 18S rRNA Genes and Evaluation of

Table 1 The primers for ciliate cloning

Primer pair

Primer

Sequence (50 30 )

Annealing
temperature (C)

Amplicon (bp)b

References

P.SSU-54f

CAYGTCTAAGTATAAATAACTAC

55

1693

Sylvester et al. [24]

P.SSU-1747r

CTCTAGGTGATWWGRTTTAC

P-SSU-342f

CTTTCGATGGTAGTGTATTGGACTAC

37

1480

Medlin B

TGATCCTTCTGCAGGTTCACCTAC

P.324f

CGGTAGTGTATTGGACWACCATG

P.1651r

TARKAGCGACGGGCGGTGTGTAC

Da

P.324f
P.1747r_2

CGGTAGTGTATTGGACWACCATG
CTCTARGTGATRWGRTTTAC

50

1423

This study
This study

P.324f

CGGTAGTGTATTGGACWACCATG

60

1473

This study

Medlin B_2

TGATCCTTCYGCAGGTTCACCTAC

B
C

Sylvester et al. [24]

Karnati et al. [8]
Medlin et al. [15]
60

1327

This study
This study

This study

Primer pair D was selected and used for cloning and sequencing

The length of amplification correspond to base positions in the Saccharomyces cerevisiae strain NCYC505 18S rRNA gene (GenBank
accession number Z75578)

diets (Online Resource 1.). The MF group was fed alfalfa

hay, corn silage, and a mixture soybean, rapeseed, and
cottonseed meals. The CSA group was fed corn stover and
a mixture soybean, rapeseed, and cottonseed meals. The
CSB group was fed corn stover and a mixture rapeseed and
cottonseed meals. All of the cows were fed at 07:00, 14:00,
and 21:00 h, and milked at 06:00, 13:00, and 20:00 h daily,
respectively. Samples of ruminal fluid were collected using
an oral lavage tube immediately before (0 h) and 2 h after
the morning feeding on day 91. A 2-mL aliquot of each
ruminal fluid sample was fixed overnight at room temperature in an equal volume of MFS solution containing 3.5 %
formalin, 0.8 % sodium chloride, and 0.06 % methyl green
(Sigma-Aldrich, Saint Louis, MO, USA), and then loaded
into a Sedgewick-Rafter counting chamber (Pyser-SGI,
Kent, UK) and viewed at 9100 magnification, as described
previously [1, 2]. The remaining ruminal fluid was frozen
in liquid nitrogen, and stored at -80 C.
Cloning, Sequencing, and Bioinformatics Analysis
of Ciliate 18S rRNA Gene Sequences
Microbial DNA was extracted from the ruminal fluid collected on day 91 using CTAB and the bead-beating
method, as described above. Ciliate 18S rRNA gene
sequences were amplified using the P.324f and P.1747r_2
primers (Table 1), as described above. The amplicons were
pooled based on feeding group and sampling date. The
amplicons (approximately 1.4 kb) were ligated into the
pMD18-T plasmid (Takara Bio), and competent JM109
cells (Takara Bio) were transformed with the ligation
product, according to the manufacturers instructions.
Sequencing was performed by the Beijing Genomics

123

Institute (Beijing, China). The OTUs of the 18S rRNA

gene sequences were assigned using a cutoff value of 0.015
in MOTHUR. The ACE and Chao1 richness indices,
ShannonWeaver index, LibShuff, and Goods coverage
analyses were performed using MOTHUR. A representative sequence from each OTU was aligned using BLAST in
GenBank. A phylogenetic tree was constructed based on
the neighbor-joining method with 1000 bootstrap replicates
using the MEGA5 software [25]. The Paramecium
tetraurelia sequence was used as the out group to root the
tree [8]. The unique 18S rRNA gene sequences determined
in our study were deposited in GenBank (Accession
Numbers KF893326 to KF894051).
Relative Quantification of Entodinium
and Dasytricha
The Oph-151F and Ento-472R primers were used to
quantify Entodinium, and the Tso-Das-151F and Das-472R
primers were used to quantify Dasytricha using qPCR in an
Applied Biosystems 7500 Real-Time PCR system (Applied
Biosystems, Carlsbad, CA, USA) [23]. Each reaction
contained 5 lL of 29 Power SYBR Green PCR Master
Mix (Takara Bio), 1 lL of each primer (10 lM), 0.2 lL of
Rox (Takara Bio), 25 ng of microbial DNA, and 2.3 lL of
deionized water. Thermal cycling was performed at 95 C
for 30 s, followed by 40 cycles of 95 C for 15 s, 55 C for
34 s, and 72 C for 1 min. The 2DDCT method was used
for the relative quantification of the qPCR data, as
described previously [13], using general protozoa 18S
rRNA gene [24] as reference gene and CSA group as the
control. The significance of the intergroup differences was
evaluated using the PROC GLM model in the SAS, version

J. Zhang et al.: New Primers Targeting Full-Length Ciliate 18S rRNA Genes and Evaluation of

9.2, software (SAS Institute, Cary, NC, USA). The level of

statistical significance was set at P \ 0.05.

Results and Discussion

Based on the sequences of the 137 previously reported
ciliate 18S rRNA gene sequences, we designed the P.324f
and P.1651r primers, and modified the sequences of the
P.1747r_2 and Medlin B_2 primers by including more
degenerate bases than the sequences previously described
for P.1747r and Medlin B, respectively. The primer sets
were designed to amplify the full-length sequences of ciliate 18S rRNA gene sequences by annealing at the 50 and 30
ends of each gene. During PCR, the specificity of primer
annealment is crucial, especially the specificity of base
pairing at the 30 terminus of the primer. As shown in Fig. 1,
only P.1747r_2, P.324f, and P.1651r demonstrated [99 %
base coverage at the 30 terminus. The P.1747r_2, P.324f,
and P.1651r primers demonstrated the capacity to amplify
the 18S rRNA gene sequences of almost all of the rumen
ciliate species. Based on these results, four newly designed
primers and four previously described primers were combined into five primer pairs. The optimal annealing

653

temperatures for primer pairs C, D, and E were 60, 55, and

60 C, respectively (Table 1).
As shown in the electropherogram, nonspecific amplification of yeast genomic DNA was observed using primer
pairs B, C, and E, whereas nonspecific amplification was
not observed using primer pairs A and D (Fig. 2). However, primer pair A produced nonspecific bands that were
similar in size to the target bands in the analysis of
microbial DNA isolated from ruminal fluid, which may
have been the result of amplification of 18S rRNA gene
sequences from other types of microbes. Compared with
primer pair A, primer pair D contained more degenerate
bases, which contributed to higher ciliate species coverage.
The forward primer, P-SSU-342f, in primer pair B had a
single mismatch, compared with the Entodinium caudatum
sequence [8], which likely contributed to inefficient
amplification. Therefore, primer pair D (P.324f and
1747r_2) was selected for amplifying the full-length 18S
rRNA gene sequences of ciliates in the ruminal fluid
samples collected from cows in the different treatment
groups.
Several primers have been designed and validated for
the pyrosequencing of ciliate gene sequences. Kittelmann
et al. [11] designed the RP841F and Reg1302R primers,

Fig. 1 Coverage heat map of

the ciliate primer bases. The
heat map was based on the last
19 bases at the 30 end of each
primer. High and low coverages
are represented by color shading
from blue to red, respectively
(Color figure online)

123

654

J. Zhang et al.: New Primers Targeting Full-Length Ciliate 18S rRNA Genes and Evaluation of

Fig. 2 Evaluation of the

candidate ciliate primers.
Primer pairs A, B, C, D, and
E indicate P.SSU-54f/P.SSU1747r, P-SSU-342f/Medlin B,
P.324f/P.1651r, P.324f/
P.1747r_2, and P.324f/Medlin
B_2, respectively

which produced a 511-bp amplicon, for investigating the

rumen ciliate profile and pyrosequencing amplicons [19].
Ishaq and Wright [7] also designed two primer pairs (PSSU-316F/GIC758R and GIC1080F/GIC1578R), which
produced amplicons that were 482 and 498 bp in size, for
the analysis and pyrosequencing of ciliate rRNA gene
sequences identified in microbial DNA isolated from the
gastrointestinal tract of cows. In our current study, we
designed primers that produced amplicons that were longer
(Primer Pair D, 1423 bp) than those produced in these
previous studies. These amplicons were analyzed by conventional dye-terminator DNA sequencing or third-generation SMRT to determine the phylogenetic and taxonomic
classifications of rumen ciliates with a high level of
accuracy.
In our analysis of ciliate diversity, the 18S rRNA genes
of rumen ciliates were sequenced, and clustered into OTUs.
The key parameter for clustering was the cutoff value. To
determine the optimal species-level cutoff values for the
primer pair D amplicons, all known ciliate 18S rRNA gene
sequences were clustered into OTUs using different cutoff
values, and 63, 52, 47, 38, 31, 28, and 24 OTUs were
generated using cutoff values of 0.010, 0.015, 0.019, 0.026,
0.030, 0.036, and 0.041, respectively. The standard of
selection of cutoff values at the species level required that
the sequences from all of the strains of a single species are
to be included in the same OTU, and that each OTU
contained sequences from one species only. We selected a
species-level cutoff value of 0.015 for our analysis of the
ciliate OTUs because this value was more closed to the
above standard compared with other values (Online
Resource 2). It was noted that cutoff value of 0.015 could
not delineate boundaries of partial species unambiguously.

123

For example, Isotricha prostoma clustered into two OTUs,

and different species of Cycloposthium clustered into one
OTU. Previous studies of ciliates have used cutoff values
of 0.020 [16] and 0.031 [7] for full-length ciliate 18S rRNA
gene sequences and 0.040 [7] for partial sequences
(482 bp). We selected a slightly lower species-level cutoff
value to reduce the rate at which an OTU contained more
than one ciliate species.
We determined rumen ciliate abundance using a
microscopic counting method, and found no significant
difference in the abundance of ciliates based on diet
(P [ 0.05). Even though microscopic counting is a highly
accurate method of assessing ciliate abundance, 18S rRNA
gene sequencing is highly useful for precise comparisons of
ciliate community structures [10]. Although thousands of
sequences can be obtained from one sample using
pyrosequencing, the short amplicons produced confound
the accurate classification of ciliates. Recent developments
in third-generation sequencing methods, such as SMRT
and nanopore sequencing, have made possible the cloning
and sequencing of full-length 18S rRNA gene sequences,
which should facilitate efforts to more accurately classify
ciliates.
In our current study, we cloned and sequenced the fulllength 18S rRNA genes of rumen ciliates using primer pair
D. A total of 726 clean reads of 18S rRNA gene sequences
were obtained. The Goods coverage for the treatment
groups ranged from 89.7 to 91.7 %, indicating that the use
of these primers in our cloning and sequencing procedures
resulted in an acceptable level of coverage. The heat map
showed that the ciliate profiles of the three dietary groups
were distinct (Online Resource 3). The LibShuff analysis
showed that the ciliate profiles of the corn stover and mixed

J. Zhang et al.: New Primers Targeting Full-Length Ciliate 18S rRNA Genes and Evaluation of

655

Fig. 3 The phylogenetic tree of the 18S rRNA gene sequences of

rumen ciliates. The length of the colored bar and the number in
parentheses for the OTUs indicate the numbers of sequences in each
OTU. The number in parentheses for known ciliates indicates the
GenBank accession number. The 18S rRNA gene sequence of

Paramecium tetraurelia was used as the out group. The CSA_0,

CSB_0, and MF_0 samples were collected from the CSA, CSB, and MF
groups, respectively, before the morning feeding. The CSA_2, CSB_2,
and MF_2 samples were collected from the CSA, CSB, and MF groups,
respectively, at 2 h after the morning feeding (Color figure online)

forage groups differed significantly (P \ 0.005), whereas

no significant difference in ciliate profile was observed
between the cows that received different sources of protein
(P = 0.250).
The dominant genera of ciliates in rumen communities
can vary based on host species, diet, and season, and previous studies have investigated the effects of different
dietary nutrients on rumen ciliate diversity [5, 6, 9, 22].
Leng et al. [12] showed that the Entodinium, Dasytricha,

Isotricha, and Diplodinium genera were abundant in the

rumen of Chinese yellow cattle. Shin et al. [21] found that
the predominant protozoan genus in the ruminal fluid of
Korean cows was Entodinium. In our current study, the
phylogenetic tree of the 18S rRNA gene sequences of
rumen ciliates showed that most were from Dasytricha or
Entodinium (54 and 35 %, respectively; Fig. 3). Relative
quantification of ciliate rRNA gene sequences showed that
the abundance of Dasytricha in the rumen of dairy cows

123

656

J. Zhang et al.: New Primers Targeting Full-Length Ciliate 18S rRNA Genes and Evaluation of

Table 2 Diet-related changes in ciliate abundance in ruminal fluid

Sampling time

Treatments
MF

SEM
CSA

CSB

Microscopic counting of total ciliates (log cells/mL ruminal fluid)

0

5.20

5.07

5.03

0.06

0.52

5.06

4.82

4.96

0.05

0.13

Fold change in Entodinium spp.

0

1.42

1.02

1.24

0.14

0.71

0.97

1.01

1.10

0.92

0.90

1.43a

0.17

0.01

0.22

0.01

Fold change in Dasytricha spp.

0
0.02b
1.02a
2

\0.01

1.00

1.38

Different letters in the same row indicate significant difference

(p \ 0.05)

0 indicates samples collected before morning feeding, and 2 indicates samples collected at 2 h after morning feeding

fed with corn stover was 50-fold greater than that of the
cows fed with mixed forage (Table 2). Mao et al. [14]
studied ciliate diversity using pyrosequencing, and found
that the relative abundance of Dasytricha increased with
increasing dietary fiber, whereas the relative abundance of
Entodinium decreased. Therefore, the higher fiber content
of corn stover likely contributed to the higher abundance of
Dasytricha in the ruminal fluid of cows in the CSA and
CSB groups in our current study, compared with that of the
cows fed a mixture of alfalfa and corn silage.
Acknowledgments This study was funded by grants from the
National Natural Science Foundation of China (Grant No.
31261140365), the National Key Basic Research Program of China
(Grant No. 2011CB100804), and Agricultural Science and Technology Innovation Program (Grant No. ASTIP-IAS07).
Compliance with Ethical Standards
Conflict of interest

No conflict of interest declared.

References
1. Benchaar C, McAllister TA, Chouinard PY (2008) Digestion,
ruminal fermentation, ciliate protozoal populations, and milk
production from dairy cows fed cinnamaldehyde, quebracho
condensed tannin, or Yucca schidigera saponin extracts. J Dairy
Sci 91(12):47654777
2. Benchaar C, Romero-Perez GA, Chouinard PY, Hassanat F,
Eugene M, Petit HV, Cortes C (2012) Supplementation of
increasing amounts of linseed oil to dairy cows fed total mixed
rations: effects on digestion, ruminal fermentation characteristics,
protozoal populations, and milk fatty acid composition. J Dairy
Sci 95(8):45784590
3. Euge`ne M, Archime`de H, Sauvant D (2004) Quantitative metaanalysis on the effects of defaunation of the rumen on growth,
intake and digestion in ruminants. Livest Prod Sci 85(1):8197

123

4. Findley SD, Mormile MR, Sommer-Hurley A, Zhang XC, Tipton

P, Arnett K, Porter JH, Kerley M, Stacey G (2011) Activity-based
metagenomic screening and biochemical characterization of
bovine ruminal protozoan glycoside hydrolases. Appl Environ
Microbiol 77(22):81068113
5. Franzolin R, Dehority BA (1996) Effect of prolonged high-concentrate feeding on ruminal protozoa concentrations. J Anim Sci
74(11):28032809
6. Hristov AN, Ivan M, Rode LM, McAllister TA (2001) Fermentation characteristics and ruminal ciliate protozoal populations in
cattle fed medium- or high-concentrate barley-based diets.
J Anim Sci 79(2):515524
7. Ishaq SL, Wright ADG (2014) Design and validation of four new
primers for next-generation sequencing to target the 18S rRNA
genes of gastrointestinal ciliate protozoa. Appl Environ Microbiol
80(17):55155521
8. Karnati SK, Yu Z, Sylvester JT, Dehority BA, Morrison M,
Firkins JL (2003) Technical note: specific PCR amplification of
protozoal 18S rDNA sequences from DNA extracted from
ruminal samples of cows. J Anim Sci 81(3):812815
9. Kittelmann S, Janssen PH (2011) Characterization of rumen ciliate community composition in domestic sheep, deer, and cattle,
feeding on varying diets, by means of PCR-DGGE and clone
libraries. FEMS Microbiol Ecol 75(3):468481
10. Kittelmann S, Devente SR, Kirk MR, Seedorf H, Dehority BA,
Janssen PH (2015) Phylogeny of the intestinal ciliates including
first sequences from charonina ventriculi and comparison of
microscopy and 18S rRNA gene pyrosequencing for rumen ciliate community structure analysis. Appl Environ Microbiol
81(7):24332444
11. Kittelmann S, Seedorf H, Walters WA, Clemente JC, Knight R,
Gordon JI, Janssen PH (2013) Simultaneous amplicon sequencing
to explore co-occurrence patterns of bacterial, archaeal and
eukaryotic microorganisms in rumen microbial communities.
PLoS One 8(2):e47879
12. Leng J, Zhong X, Zhu RJ, Yang SL, Gou X, Mao HM (2011)
Assessment of protozoa in Yunnan Yellow cattle rumen based on
the 18S rRNA sequences. Mol Biol Rep 38(1):577585
13. Livak KJ, Schmittgen TD (2001) Analysis of relative gene
expression data using real-time quantitative PCR and the 2-44CT
method. Methods 25(4):402408
14. Mao SY, Huo WJ, Zhu WY (2015) Microbiome-metabolome
analysis reveals unhealthy alterations in the composition and
metabolism of ruminal microbiota with increasing dietary grain in a
goat model. Environ Microbiol. doi:10.1111/1462-2920.12724
15. Medlin L, Elwood HJ, Stickel S, Sogin ML (1988) The characterization of enzymatically amplified eukaryotic 16S-like rRNAcoding regions. Gene 71(2):491499
16. Nebel M, Pfabel C, Stock A, Dunthorn M, Stoeck T (2011)
Delimiting operational taxonomic units for assessing ciliate
environmental diversity using small-subunit rRNA gene sequences. Environ Microbiol Rep 3(2):154158
17. Pang YZ, Liu YP, Li XJ, Wang KS, Yuan HR (2008) Improving
biodegradability and biogas production of corn stover through
sodium hydroxide solid state pretreatment. Energy Fuels
22(4):27612766
18. Pruesse E, Quast C, Knittel K, Fuchs BM, Ludwig W, Peplies J,
Glockner FO (2007) SILVA: a comprehensive online resource for
quality checked and aligned ribosomal RNA sequence data
compatible with ARB. Nucleic Acids Res 35(21):71887196
19. Regensbogenova M, Pristas P, Javorsky P, Moon-van der Staay
SY, van der Staay GW, Hackstein JH, Newbold CJ, McEwan NR
(2004) Assessment of ciliates in the sheep rumen by DGGE. Lett
Appl Microbiol 39(2):144147
20. Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M,
Hollister EB, Lesniewski RA, Oakley BB, Parks DH, Robinson

J. Zhang et al.: New Primers Targeting Full-Length Ciliate 18S rRNA Genes and Evaluation of

21.

22.

23.

24.

25.

CJ, Sahl JW, Stres B, Thallinger GG, Van Horn DJ, Weber CF
(2009) Introducing mothur: open-source, platform-independent,
community-supported software for describing and comparing
microbial
communities.
Appl
Environ
Microbiol
75(23):75377541
Shin EC, Cho KM, Lim WJ, Hong SY, An CL, Kim EJ, Kim YK,
Choi BR, An JM, Kang JM, Kim H, Yun HD (2004) Phylogenetic
analysis of protozoa in the rumen contents of cow based on the
18S rDNA sequences. J Appl Microbiol 97(2):378383
Singh KM, Tripathi AK, Pandya PR, Rank DN, Kothari RK,
Joshi CG (2011) Dasytricha dominance in Surti buffalo rumen
revealed by 18S rRNA sequences and real-time PCR assay. Curr
Microbiol 63(3):281288
Skillman LC, Toovey AF, Williams AJ, Wright ADG (2006)
Development and validation of a real-time PCR method to
quantify rumen protozoa and examination of variability between
Entodinium populations in sheep offered a hay-based diet. Appl
Environ Microbiol 72(1):200206
Sylvester JT, Karnati SKR, Yu ZT, Morrison M, Firkins JL
(2004) Development of an assay to quantify rumen ciliate protozoal biomass in cows using real-time PCR. J Nutr
134(12):33783384
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S
(2011) MEGA5: molecular evolutionary genetics analysis using

26.

27.

28.

29.

30.

657

maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28(10):27312739
Tan HY, Sieo CC, Abdullah N, Liang JB, Huang XD, Ho YW
(2013) Effect of condensed tannins on bovine rumen protist
diversity based on 18S rRNA gene sequences. J Eukaryot
Microbiol 60(1):98100
Tymensen L, Barkley C, McAllister TA (2012) Relative diversity
and community structure analysis of rumen protozoa according to
T-RFLP and microscopic methods. J Microbiol Methods
88(1):16
Yeager CM, Kornosky JL, Housman DC, Grote EE, Belnap J,
Kuske CR (2004) Diazotrophic community structure and function
in two successional stages of biological soil crusts from the
Colorado Plateau and Chihuahuan Desert. Appl Environ Microbiol 70(2):973983
Zhao S, Zhao J, Bu D, Sun P, Wang J, Dong Z (2014) Metabolomics analysis reveals large effect of roughage types on rumen
microbial metabolic profile in dairy cows. Lett Appl Microbiol
59(1):7985
Zhu W, Fu Y, Wang B, Wang C, Ye JA, Wu YM, Liu JX (2013)
Effects of dietary forage sources on rumen microbial protein
synthesis and milk performance in early lactating dairy cows.
J Dairy Sci 96(3):17271734

123