Article

pubs.acs.org/JAFC

Utility of Stable Isotope and Cytochrome Oxidase I Gene Sequencing

Analyses in Inferring Origin and Authentication of Hairtail Fish and
Shrimp
Heejoong Kim,, K. Suresh Kumar,, Seung Yong Hwang,, Byeong-Chul Kang, Hyo-Bang Moon,
and Kyung-Hoon Shin*,

Department of Marine Sciences and Convergent Technology and Department of Molecular and Life Science/Bio-nanotechnology,
Hanyang University, Ansan 426-791, Republic of Korea

Biocore Company Limited, Guro-gu, Seoul 152-796, Republic of Korea

Insilicogen Incorporated, Gweonseon-gu, Suwon 440-825, Republic of Korea

ABSTRACT: Mislabeling of shery products continues to be a serious threat to the global market. Consequently, there is an
urgent necessity to develop tools for authenticating and establishing their true origin. This investigation evaluates the suitability
of stable isotopes and cytochrome oxidase I (COI) sequencing in identifying and tracing the origin of hairtail sh and shrimp. By
use of COI sequencing, the hairtail sh samples were identied as Trichiurus japonicus and Trichiurus lepturus, while the shrimp
samples were identied as Pandalus borealis, Marsupenaeus japonicus, Fenneropenaeus chinensis, Litopenaeus vannamei, Penaeus
monodon, and Solenocera crassicornis. Linear discriminant analysis (LDA) of stable isotopes further categorized the individuals of
the same species based on the country of origin. Natural and farmed shrimp (from the same country) were distinctly
dierentiated on the basis of stable isotope values. Therefore, these two methods could be cooperatively utilized to identify and
authenticate shery products, the utilization of which would enhance transparency and fair trade.
KEYWORDS: sh, shrimp, 13C, 15N, COI sequencing, geographic origin, species identication

INTRODUCTION
Fishery products are among the chief internationally traded
food commodities.1 They improve nutrition, health, and wellbeing2 and, are a prime source of -3 fatty acids, vitamins,
minerals, trace elements, high-quality protein, and essential
amino acids. Acceleration and diversication of transport
(especially maritime trac), increased seafood trade and
consumption, and, greater demand for certain types of sh or
seafood have globalized the sheries trade. However,
concomitant uctuations in supply and inability to meet the
phenomenal demand have encouraged fraudulent practices of
substitution. As a huge number of shery species are either
consumed or utilized as raw material for dierent marketed
preparations, authentication (of species and its origin) becomes
quintessential for confronting deceptive practices. Accurate
labeling of shery products would deter commercial fraud and
prevent potential safety hazards caused by the introduction of
food ingredients that might be harmful to human health.
Fishery products represent a signicant market niche: they
include a wide variety of commercially valuable species such as
hairtail sh (belonging to the family Trichiuridae) and shrimp
(belonging to the superfamily Penaeoidae). The hairtail
comprises the sixth most important captured sh species,
with their present world catch exceeding 1.5 million tons
annually.3 On the other hand, shrimp (either harvested by
extractive shing or farmed in aquaculture facilities) account for
more than 30% of the worldwide demand of crustacean
species.4 Traditional identication and authentication of sh
and penaeid shrimps are carried out by examining morphological features (such as body shape, color, size, ns, and other
2015 American Chemical Society

body parts). In the case of similar species, it is necessary to

consider some internal organs such as gill rakers or otoliths.
However, when the external anatomical parts are not present
(e.g., in the case of sh sold in parts), this is a rather complex or
even impossible task. Additionally, phenotypic similarities
among sh complicate species identication and determination
of their origin. Shrimps with phenotypical similarities are also
dicult to identify, and processing or removal of the external
carapace further obscures this situation. In this scenario,
commercial fraud caused by the inadvertent substitution of
species due to phenotypic similarities, or deliberate replacement
of higher quality species by others of lower quality, could occur,
thereby leading to marketing of mislabeled adulterated
products.46 However, labeling regulations enforced by several
countries, coupled with customer awareness, have made
identication and authentication of sh and seafood a crucial
prerequisite.
Distinctive and systematic analytical methods outlined to
evaluate the origin of sh products facilitate distinguishing
products of various origins. The instrumental techniques
proposed for food authentication include high-performance
liquid chromatography (HPLC), nuclear magnetic resonance
(NMR) spectroscopy, infrared (IR) spectroscopy, capillary
electrophoresis, and trace element and stable isotope analyses,
as well as DNA-based and proteomic methods. As organisms
Received:
Revised:
Accepted:
Published:
5548

March 23, 2015

May 12, 2015
May 18, 2015
May 18, 2015
DOI: 10.1021/acs.jafc.5b01469
J. Agric. Food Chem. 2015, 63, 55485556

Article

Journal of Agricultural and Food Chemistry

Table 1. Primers and Specic Probes for Hairtail Fish

primera

sequence (5 to 3)

target groupb

reaction type

FP-1
RP-1
FP-2
RP-2
FP-3
RP-3
probe 1
probe 2
probe 3

AGAGCTAAGCCAACCAGGCT
AATTATCACGAAGGCATGGG
AGGCACAGCCTTAAGCCTTCT
GCTGTAACGATAACATTGTAAATTTGG
AACTGGCTTATCCCCCTAATGAT
GCGGAGGAGGCTAGGAGAAG
[FAM]- CCCTCCTGGGCGATGACCAA -[TAMRA]
[HEX]- CCGCGCAGAGCTAAGCCAGCC-[TAMRA]
[FAM]- CCGACATGGCCTTCCCCCG -[TAMRA]

G3
G3
G2
G2
G1
G1
G3
G2
G1

multiple
multiple
multiple
multiple
single
single
multiple
multiple
single

FP, forward primer; RP, reverse primer. bGroup 1 (G1): Korea, Japan, and China. Group 2 (G2): Senegal and Canada. Group 3 (G3): Thailand.

have unique isotopic ngerprints, stable isotope composition

analysis could provide information about ecological and
geographical origin of biological products, thereby helping
discrimination of food. The utilization of isotope ratio mass
spectrometry in distinguishing the geographical origin of food
samples has been established. Although this technique is
extensively discussed for authenticating food products such as
meat, wine, fruit juice, honey, and dairy products,7 its utility in
inferring the geographical origin and authentication of sh,
shrimp, and seafood species is scarce.6 On the other hand,
molecular tools, based on protein and DNA biomarkers, have
been proposed as suitable strategies for identication of sh and
crustacean species. In the case of processed products, due to the
lack of stability of the polypeptide targets, electrophoretic and
immunological methods are unreliable. However, due to its
remarkable stability, DNA analysis circumvents these problems.
Among the DNA targets considered for species identication,
12S rRNA, 16S rRNA, tRNAVal, and, to a lesser extent,
cytochrome oxidase I (COI) and cytochrome b genes have
been proposed as useful molecular markers for sh and
crustacean species.4
Authentication, verication of the geographic origin of a
product, and pertinent labeling provide consumers with correct,
complete, and transparent information. This enables the
consumer to make an informed choice on the type and origin
of sh purchased. There has been growing consumer
enthusiasm for high-quality food with a clear regional identity.
There is also an increased public awareness regarding the
means by which it has been produced. This study investigates
the applicability of stable isotopic values (13C and 15N) as
well as cytochrome c oxidase gene I as convergent tools to
identify hairtail sh and shrimp and to verify their geographic
origin. This would abate counterfeit labeling and help
traceability of marketed products.

Vector) combined with a stable isotope mass spectrometer (Isoprime

100, Isoprime Ltd). The 13C and 15N ( deviations from Vienna
Pee Dee Belemnite, VPDB, and atmospheric N2, respectively) are
expressed as follows:

13C () = [(13C/12C)sample /(13C/12C)standard 1] 1000

15 N () = [(15N/14 N)sample /(15 N/14 N)standard 1] 1000
Two international standards, CH-6 and N-1 of International Atomic
Energy Agency (IAEA), were used for calculating the isotope ratios,
and the 13C and 15N values were reported. In case of both carbon
and nitrogen isotope ratios, the analytical precision (standard
deviation) was <0.3. An internal standard was run for every
10 samples.
Molecular Analysis. Genomic DNA Extraction. Genomic DVA
(gDNA) was extracted from muscle tissue by use of the DNeasy blood
and tissue kit (Qiagen, Hilden, Germany) as per the protocol
described by the manufacturer. The gDNA concentration was
measured on a Nanodrop ND-1000 spectrophotometer (ThermoFisher Scientic Inc., Waltham, MA). The extracted gDNA was used
directly for polymerase chain reaction (PCR) and real-time PCR
analysis. Several gDNAs were diluted (1/10), from 10 ng/L to
0.01 pg/L, in order to conrm the detection limit of the real-time
PCR assay.
DNA Amplication and Sequencing. Mitochondrial cytochrome
c oxidase I (COI) was selected as the target gene. The COI gene was
amplied by use of the following primers, where V indicates vertebrate,
F is forward, R is reverse, and In indicates invertebrate:

COI-V-F
COI-V-R
COI-In-F
COI-In-R

5-TCAACCAACCACAAAGACATTGGCAC-3
5- TAGACTTCTGGGTGGCCAAACAATCA-3
5- GTTCAACAAATCATAAAGATATTGG-3
5- TAAACTTCAGGGTGACCAAAAAATCA-3

Compatibility of the primer set was conrmed by comparing the full

sequence of COI genes of hairtail sh and shrimp with the NCBI
database (www.ncbi.nlm.nih.gov). Pre-PCR reaction mixtures were
treated in a TaKaRa PCR thermal cycler (TaKaRa Bio Inc., Shiga,
Japan), wherein the total volume of 20 L contained 10 L of Premix
Taq (TaKaRa Bio), 2 L of primer mix (10 pmol/L), 1 L of 5 M
betaine, 6 L of distilled water, and 1 L of gDNA. Thermal cycling
conditions were programmed for initial denaturation at 95 C for
11 min, followed by a reaction cycle (94 C for 1 min, 50 C for 1 min,
and 72 C for 1 min) repeated 35 times, with a nal extension step of
72 C for 5 min. PCR products were analyzed by 1% agarose gel
electrophoresis and direct sequencing to identify the sequences
accurately (Solgent Inc., Daejeon, Korea).
Primer and Probe Design for Real-Time PCR. Specic primers and
probes for the real-time PCR kit were designed from direct sequencing
data by use of Primer Express software (Applied Biosystems, Foster
City, CA) and web-based software (www.genscript.com, GenScript
Inc., Piscataway Township, NJ). Primer and probe sequence
information is listed in Tables 1 and 2.
Real-Time Polymerase Chain Reaction and Analysis. Realtime PCR was performed in triplicate in 384-well plates. A 384-well

MATERIALS AND METHODS

Sample Collection. Marketable-sized hairtail sh and shrimp were

chosen for the present study. Domestic samples were collected from a
seafood market, and their area of catch was conrmed. Imported shes
were obtained from the national seafood quarantine agency after
verifying their catchment area and country of origin. In each case, ve
authentic samples were evaluated.
Stable Isotope Analysis. All samples were brought to the
laboratory immediately after collection. They were subsequently
separated on the bases of commercial name of the species, country of
its origin, body weight, and total length. Dorsal muscle tissue of hairtail
sh samples and white muscle tissue of shrimp samples were dissected
and stored in the deep freezer (80 C). The samples were analyzed
according to the method stated by Kim et al.7 Stable isotope analysis
was carried out by use of an elemental analyzer (CHNS-O, Euro
5549

DOI: 10.1021/acs.jafc.5b01469
J. Agric. Food Chem. 2015, 63, 55485556

Article

Journal of Agricultural and Food Chemistry

Table 2. Primers and Specic Probes for Shrimp
primera

sequence (5 to 3)

target groupb

reaction type

FP-1
RP-1
FP-2
RP-2
probe 1
probe 2

AACTGGCTTATCCCCCTAATGAT
GCGGAGGAGGCTAGGAGAAG
AGGCACAGCCTTAAGCCTTCT
GCTGTAACGATAACATTGTAAATTTGG
[FAM]- CCGACATGGCCTTCCCCCG -[TAMRA]
[HEX]- CCGCGCAGAGCTAAGCCAGCC-[TAMRA]

G1
G1
G2
G2
G1
G2

single
single
multiple
multiple
single
multiple

a
FP, forward primer; RP, reverse primer. bGroup 1 (G1): Korea (farmed), Malaysia, and Ecuador. Group 2 (G2): India, Netherlands, Thailand, and
Indonesia.

high-throughput analysis was performed with the ABI Prism 7900

sequence detection system (Applied Biosystems); here, white-colored
384-well plates (Applied Biosystems) were used to intensify the
uorescent signals by a factor of 3. This system operated with a
thermal cycler and a laser that was directed via ber optics to each of
the 384 sample wells. Fluorescence emission from each sample was
collected by a charge-coupled device camera. Single real-time PCR
reaction mixtures contained 10 L of TaqMan universal master mix II,
no UNG (Applied Biosystems), 1 L of primer mix (10 pmol/L),
0.5 L of probe 3 (10 pmol/L), 7.5 L of distilled water, and 1 L of
gDNA. Multiplex real-time PCR reaction mixtures contained 10 L of
TaqMan universal master mix II, no UNG (Applied Biosystems), 2 L
of primer mix (10 pmol/L), 0.25 L of probe 1 (10 pmol/L),
0.5 L of probe 2 (10 pmol/L), 6.25 L of distilled water, and 1 L
of gDNA. Thermal cycling conditions for hairtail sh were an initial
denaturation at 95 C for 10 min, followed by a reaction cycle (95 C
for 15 s and 60 C for 1 min) repeated 40 times. Thermal cycling
conditions for shrimp were an initial denaturation at 95 C for 10 min,
followed by a reaction cycle (95 C for 15 s and 50 C for 1 min)
repeated 40 times. Data were analyzed by use of SDS software v 2.3
(Applied Biosystems).
Phylogenetic Analysis. Phylogenic and molecular evolutionary
analyses were conducted with MEGA version 4.8 The evolutionary
history was inferred by use of the neighbor-joining method.9 The
phylogenetic tree was linearized with the assumption of equal
evolutionary rates in all lineages.10 The tree is drawn to scale, with
branch lengths in the same units as those of the evolutionary distances
used to infer the phylogenetic tree. The evolutionary distances were
computed by the maximum composite likelihood method11 and are in
units of number of base substitutions per site.
Statistical Analysis. Data are presented as mean standard deviation (SD). Data were analyzed by one-way analysis of variance
(ANOVA), and signicant dierences were determined by Tukeys
posthoc test. Linear discriminant analysis (LDA) was used to calculate
the discriminant function that classied each group, while leave-oneout cross-validation (LOOCV) was used to examine data among the
test samples.

Figure 1. Biplots of 13C and 15N values (mean SD) of (a) hairtail
sh and (b) shrimp based on their geographical origin. Grouping was
carried out based on the LDA analysis. Data represent the mean
SD of ve replicates. (a) Group 1 (G1, red circles) represents
samples from three countries: Korea [South Sea ID 102 (1), South
Sea ID 110 (2), South Sea ID 234 (3), Mokpo (MP) (4), and
Gunsan (GS) (5)], China (7), and Japan (8). Group 2 (G2, orange
inverted triangles) represents samples from Canada (6) and Senegal
(9). Group 3 (G3, yellow squares) represents samples from Thailand
(10). (b) Group 1 (G1, red circles) represents wild samples from
Korea [Taean (TA) (6) and Gunsan (GS) (7)]. Group 2 (G2,
orange inverted triangles) represents wild samples from Korea Guje
(GJ) (5). Group 3 (G3, yellow squares) represents wild samples
from Yeosu (YS), Korea (8). Group 4 (G4, green diamonds)
represents aquacultured samples from Korea [Gunsan (GS) (1),
Anmyoendo (AM) (2), Mokpo (MP) (3), and Ansan (AS) (4)] as
well as wild samples from Ecuador (12) and Malaysia (15). Group 5
(G5, light blue triangles) represents wild samples from India (9),
Indonesia (10), Thailand (11), and Netherlands (14). Group 6 (G6,
dark blue hexagons) represents wild samples from Argentina (13).

RESULTS
The mean isotopic values and standard deviation [when the
number of authentic samples (n) was 5] are provided in
Figure 1a. As evidenced in Figure 1a, distinct carbon and
nitrogen isotopic values of hairtail sh samples of various
geographic origins were obtained; that is, the 13C and 15N
() values of the sh diered signicantly based on their
origin.
The 13C values of the ve Korean hairtail sh ranged from
17.16 0.56 to 18.03 0.27, whereas the 13C
values of other, non-Korean hairtail sh were 15.55
0.46 (Canadian), 17.90 0.23 (Chinese), 15.43
0.56 (Japanese), 15.73 0.32 (Senegalese), and
17.80 0.14 (Thai). On the other hand, nitrogen
isotope (15N) values of the Korean hairtail sh ranged from
11.66 0.16 to 13.08 0.65, while the values for
5550

DOI: 10.1021/acs.jafc.5b01469
J. Agric. Food Chem. 2015, 63, 55485556

Article

Journal of Agricultural and Food Chemistry

Figure 2. Grouping of (a) hairtail sh and (b) shrimp based on LDA of stable isotopes (13C and 15N). Values in parentheses represent percentage
similarity.

other, non-Korean hairtail sh were 11.59 1.03

(Canadian), 12.14 0.88 (Chinese), 17.36
0.26 (Japanese), 11.49 0.19 (Senegalese), and
11.16 0.15 (Thai) (Figure 1). LDA of stable isotopes
in the hairtail sh samples helped lter the samples into groups
(Figure 2a). LOOCV evaluation of the stable isotope data
demonstrated approximately 64.7% accuracy in classifying the
hairtail sh samples. Here the Korean and Japanese samples
were classied with good accuracy (with similarity of 96% and
100% respectively); they varied distinctly from each other.
Aquacultured shrimp samples collected from four dierent
sites in Korea had 13C values ranging from 20.23
0.50 to 21.72 0.11, whereas the 13C values of
wild Korean shrimp ranged from 14.02 0.18 to
18.69 0.40. The 15N () values of aquacultured
shrimp ranged from 5.60 0.47 to 5.80 0.14,
which was quite dierent from the values for their wild
counterparts (from 11.53 0.57 to 12.82
1.51). The 13C values of other, non-Korean shrimp were
20.46 0.14 (Indian), 18.53 1.20 (Indonesian), 17.11 0.89 (Thai), 21.50 0.81
(Ecuadorian), 15.85 0.38 (Argentinian), 15.44
0.73 (Dutch), and 20.3 0.18 (Malaysian), and their
corresponding 15N values were 7.24 0.32, 4.54
1.31, 6.28 0.30, 5.68 0.27, 14.87
0.51, 11.71 0.35, and 8.23 0.21, respectively
(Figure 1b). The shrimp stable isotope data were ltered to

build a LDA model. Model evaluation, carried out via LOOCV,

demonstrated an overall accuracy of 75.29% in the case of
shrimp. Argentinian and Malaysian shrimp were distinctly
classied by this method. Additionally, Indonesian shrimp
demonstrated 80% similarity; besides, Thai samples were also
classied accurately (80% similarity). All the samples of Korean
farmed shrimp resembled each other, and moreover, the
Korean natural shrimp also resembled each other; they were
classied with 100% accuracy. However, the Korean and natural
shrimp distinctly varied from each other (Figure 2b).
PCR amplication was performed by employing mitogenic
COI gene primers from isolated total genomic DNA from
dierent samples of hairtail sh and shrimp. PCR products were
used for DNA sequencing analysis. Multiple alignments were
performed for sequences obtained from DNA sequencing.
Here, no insertion, deletion, or stop codons were observed in
any sequences. Molecular phylogenetic clustering was undertaken for grouping closely related species or well-identied
species enduring on the same clade or sister clades. Phylogenetic analysis revealed identical phylogenetic relationships
among the species. Particularly, in the case of hairtail
mitochondrial COI sequences, three major clades were
obtained (Figure 3a). The rst clade, comprising Korean,
Japanese, and Chinese hairtail sh samples, formed four
clusters. In addition, sequence alignment revealed more similar
sequences in hairtail species. From DNA barcoding carried out
on the basis of sequencing of a standardized region of the
5551

DOI: 10.1021/acs.jafc.5b01469
J. Agric. Food Chem. 2015, 63, 55485556

Article

Journal of Agricultural and Food Chemistry

Figure 3. Evolutionary relationships of (a) 10 taxa (linearized) of hairtail sh and (b) 15 taxa (linearized) of shrimp, and neighbor-joining (NJ)
phylogenetic trees inferred from DNA sequences of mitochondrial gene COI.

cytochrome c oxidase I (COI) gene, the hairtail sh samples

from Korea, Japan, and China were identied as Trichiurus
japonicus, while the hairtail sh samples from Senegal, Canada,
and Thailand were identied as Trichiurus lepturus.
Phylogenetic analysis of the shrimp samples also displayed
identical phylogenetic relationships among the species. Six
major clades were obtained from shrimp mitochondrial
COI sequences of samples collected from various locations
(Figure 3b). In the rst clade (G5), two clusters were formed
by the species collected from India, Indonesia, and The
Netherlands as well as samples from Thailand. The second
clade (G1) comprised natural shrimp from Korea. The third
phylogenetic clade (G2) (Guje, Korea) was closely related to
the second and forth clades. The fourth clade (G4) was formed
by the group of shrimp from Korea, Malaysia, and Ecuador.
The fth (G6) and sixth clades (G3) comprised samples from
Argentina and Yeosu Korea.
On the basis of DNA barcoding of COI, the shrimp samples
from Yeosu and Guje (Korea) were identied as Pandalus
borealis and Marsupenaeus japonicus, respectively, while samples
from Gunsan and Taean (Korea) were identied as
Fenneropenaeus chinensis. The Korean aquacultured shrimp as
well as the Malaysian and Ecuadorian shrimp were identied
as Litopenaeus vannamei, whereas the samples from India,
The Netherlands, Thailand, and Indonesia belonged to

Penaeus monodon. The shrimp from Argentina were Solenocera

crassicornis.

DISCUSSION
Fishery products are considered as a staple food in Korea. In
fact, the per capita seafood consumption here is considerably
larger than average. In the sh industry, regulations regarding
labeling, product quality, and origin have been tightened.
Therefore, it is mandatory that sh processing rms must
produce proof of origin and traceability. This makes it
absolutely essential to formulate an eective traceability system
to track sh products throughout the supply chain (harvesting,
processing, and marketing). However, identication becomes a
rather daunting task in the case of analogous (closely related)
sh species. Proper identication of hairtail shes and their
origin is relatively dicult due to their morphological similarities. In Japan, consumer preference for Tachiuo and
Tenjikutachi vary with regard to organoleptic characteristics;
however, fresh ones are mainly used for raw consumption
(sashimi).12 In addition, most of the morphological characteristicss that are used for species identication (such as head
pattern, presence or absence of pectoral n, dorsal and anal n
ray counts) are lost upon processing; thus, identication of sh
species in processed llets is extremely dicult. This also holds
5552

DOI: 10.1021/acs.jafc.5b01469
J. Agric. Food Chem. 2015, 63, 55485556

Article

Journal of Agricultural and Food Chemistry

true for sh sold in parts. Further, shrimp too are often dicult
to identify owing to their phenotypic similarities and to the
frequent removal of external carapace during processing.12
Analytical techniques based on measurement of stable
isotopes and DNA-based techniques are suitable for identication of closely related species (both fresh and processed).5,12
Consequently, they are powerful tools for the detection of
counterfeit. This investigation focused on the utility of carbon
and nitrogen isotopes, as well as molecular markers, for deriving
the geographic origin of hairtail sh and shrimp.
The present study validates the fact that isotopic values of
sh vary depending upon the species13 (Figure 1a). Strikingly
distinct 13C and 15N values were obtained for hairtail sh of
dierent origin. From a stable 13C and 15N biplot for hairtail
sh, they could be classied into three groups, wherein samples
15, 7, and 10 fell under one group, samples 6 and 9 formed
another group, and the remaining sample 8 formed an
individual group. Isotopic values (both 13C and 15N) of the
hairtail sh collected from various sites in Korea diered
signicantly [p < 0.05, Tukeys honestly signicant dierence
(HSD)] from their international counterparts. Moreover, the
13C and 15N values of hairtail sh collected from the Asian
nations (Korea, China, Japan, and Thailand) were distinctly
dierent (p < 0.05, Tukeys HSD) from their Canadian and
Senegalese counterparts. Dierences in the hydrogeomorphic
characteristics between the basins lead to dierences in the C
signatures of sh.14 Reports suggest that, in the case of C,
isotope ratios of consumers are usually similar to isotope ratios
of their diets.15 On this accord, Gomez-Requeni et al.16
described that marine sh diets (comprising macroalgae and
phytoplankton, which form the lower trophic levels of the
marine food web) are isotopically heavier due to their source of
carbon (dissolved inorganic carbon pool, 13C 0), as
compared with terrestrial plant photosynthesis from atmospheric CO2 (13C 7.8). Tanaka et al.17 reported higher
(more enriched) 13C and 15N ratios in the case of anchovy
sampled from inshore habitats as compared to oshore habitats
(where lower depleted values were obtained for both). They
surmised that higher carbon isotope ratios (in the inshore
regions) may reect a carbon source from benthic primary
producers in addition to phytoplankton.17 Precipitation and
temperature variations can also aect the stable isotope ratio of
organisms.18 With respect to the global ocean environment,
there is generally a positive correlation between decreasing
seawater temperature and lighter 13C values of particulate
organic matter (POM) in cases of high latitude.19 The
geographically classied 13C values of hairtail sh obtained
in this investigation could be attributed to dierences in
seawater temperature.
The remarkable similarity obtained between the 13C values
of hairtail sh samples collected from various sites within Korea
conrm that these values could essentially help traceability of
hairtail sh originating from Korea. Nominal variations
encountered in the 13C values of the samples within Korea
(in the present investigation) could probably be due to their
seasonal and dietary preferences. On this stand, Schell et al.20
attributed oscillation in carbon isotope ratios of bowhead whale
(Balaene mysticetus) to seasonal uctuations of the variety of
dierent zooplankton in the area of study. According to
France,21 the 13C values of oshore shes ranged from 20
to 11, while sea grass shes showed a greater range from 20
to 8. This occurred because a substantial proportion of the
shes collected from sea grass meadows ultimately got their

carbon from the plankton-based food web, rather than the

benthic-based food web. There are pronounced 13C isotopic
dierences between dierent species. For example, Geukensia
demissa mussels and Crassostrea virginica oysters are isotopically
more similar to plankton than to Spartina cordgrass, whereas
Orchelimum dicinium katydids and Littorina irrorata sea snails
are isotopically similar to Spartina.22 The 13C values of the
Chinese and Thai hairtail sh (17.90 and 17.80)
obtained in this study concurred with the 13C value of POM
reported from China (19).23 However, the 13C values
obtained for Chinese and Thai samples diered remarkably
from those of Canadian, Japanese, and Senegalese hairtail sh
(Figure 1a).
During dietary assimilation, nitrogen is more strongly fractionated than carbon, with a mean trophic increase of 3, as
compared to 1 in carbon.24 Nitrogen undergoes a 24
increase in heavier isotope enrichment with each trophic level;
it can serve as a tool for determining dietary shifts.25 Variations
in the nitrogen stable isotope ratio reect not only dierences
in the trophic level of prey species but also variations in the
baseline level of food webs.17 Measurement of 15N values
allows determination of trophic relationships in complex food
webs. These values generally vary with species, diet, and stress.
Although the most important application of nitrogen stable
isotopes is to determine the trophic level of a species, these
values could also indicate an important seasonal change in the
marine nitrogen cycle. High anthropogenic inputs on estuarine
food webs have also been reported to result in 15N-enriched
stable isotope ratios in the community inhabiting the
Westerschelde (The Netherlands).26 In this study, the 15N
value of hairtail sh from China was similar to the report by
Wan et al.,27 who reported 15N values of 12.9 for Chinese
hairtail sh. The 15N values of Japanese hairtail sh in this
study were similar to the reports of Shibata et al.28 and Takai
and Mishima;29 they reported 15N values of 17.5 and
17.8, respectively, for hairtail sh. Nevertheless, the 13C and
15N values of hairtail sh species T. lepturus from Brazil
(16.8 and 15 )30 diered from the values obtained for
the samples analyzed in this study.
The 13C values of Korean hairtail sh (17.16 to
18.03) were proximate to the 13C values of POM
(20.2) reported by Lee et al.31 in Korea. The 13C and
15N values for Chinese (17.90 and 12.14), Japanese
(15.43 and 17.36), and Thai (17.80 and 11.16)
hairtail sh were also in compliance with the 13C and 15N
values of POM in Chinese (19 and 9.8), Japanese
(19 and 7.3), and Thai seawater (23 to 17 and
5.7 to 8.4 ).23,32,33
The stable 13C and 15N biplot for shrimp classied them
into six groups. Here, G1 comprised samples 6 and 7. G2
comprised sample 5, while G3 comprised sample 8. G4
comprised samples 14, 12, and 15, while G5 comprised
samples 911 as well as 14. The remaining sample 13 formed
G6 (Figure 2b). Distinct 13C and 15N of various species of
shrimp collected from dierent countries showed signicant
dierences. The 13C and 15N signatures are known to vary
from species to species: for example, the respective 13C and
15N values for Farfantepenaeus indicus are 16.87 and
10.7; for Farfantepenaeus merguiensis, 16.26 and 9.71;
for Farfantepenaeus notialis, 17.15 and 9.26; for L.
vannamei, 11.72 and 8.9; for P. borealis, 18.07 and
10.78; for P. monodon, 18.90 and 9.66; and for
Pleoticus muelleri, 16.12 and 16.86).6 In addition, these
5553

DOI: 10.1021/acs.jafc.5b01469
J. Agric. Food Chem. 2015, 63, 55485556

Article

Journal of Agricultural and Food Chemistry

forms such as phytoplankton. But it is essential to carry out

climate, seasonal, and age- and diet-related studies on isotopic
ratios in order to derive a better equation. This study positively
suggests the reliability of using isotopic ratios of shes for
determining geographic traceability.
DNA barcoding favorably assists identication of seafood
species and determination of its origin (i.e., traceability). Here,
three gene regionsrelatively slowly evolving genes cytochrome b (cyt b, specied in 72.5% of responses), cytochrome
oxidase I (COI, 27.5%), and 16S rDNA (16S, 17.5%)37are
proved to be the markers of choice. The COI or COX1 region
demonstrates a good discriminatory power in the identication
of sh species. Ward et al.38 showed 98% of probed marine sh
and 93% of freshwater sh were successfully identied from the
COX1 region. DNA barcoding based on partial sequence
information from the COI gene has been widely used for
species identication of shes.39 It provides a paradigm for the
development of simple, inexpensive PCR-based assays that can
clearly dierentiate virtually all sh species. Our results also
conrm that the COI barcode is an eective marker for
identication of hairtail sh and shrimp; it outright segregates
the organisms based on their country of origin (Figure 3).
Investigation of the COI of hairtail sh helped separate the
species based on their country of origin. The samples of hairtail
sh collected from Korea, Japan, and China were identied as
T. japonicus, while the samples from Senegal, Canada, and
Thailand were identied as T. lepturus. Tzeng and Chiu40
identied 12 cutlass sh species using mitochondrial
cytochrome c oxidase subunit I (COI) gene of each species
and the standard barcode sequences. They illustrated high
interspecic dierences between the samples of sh, together
with high within-species similarities (>95% similarity). These
authors explained the degree of interspecic dierences was due
to the age of phylogenetic origin, and thus, barcode dierences
were genetically comprehensive.39 In our study, a clear
segregation of patterns of COI was also observed on the
basis of geographic origin and species. This validates the
eectiveness of the DNA barcoding technique in identifying
shrimp as well as hairtail sh and also ascertains its reliability in
determining geographic origin. Thus, this particular procedure
could be put to use for conservative sheries management as
well as governmental scrutiny of shery products.
In order to improve the reliability of seafood authentication
via statistical analysis, stable isotope ratios as well as the DNA
barcoding were combined in this study. The stable isotope data
were processed by use of the LDA model. On the basis of this
LDA, the hairtail sh (Figure 2a) were segregated into groups.
Group 1 consisted of two subgroups; the rst clustered
together the Korean (with 96% similarity within them) and the
Chinese hairtail sh (which had 0% similarity within them),
while the second subgroup comprised the Japanese hairtail sh
(with 100% match within themselves). LDA of the stable
isotope data categorized group 2 as the Senegal (with 60%
similarity within them) and Canadian hairtail sh (with 0%
similarity within themselves).
The LDA of stable isotopes in shrimp helped subcategorize
the Group 4 shrimp into two subgroups. The rst subgroup
comprised Korean aquacultured shrimp (100% similarity within
themselves; 100% accuracy) and natural Ecuador shrimp (0%
similarity within themselves), while the second subgroup
comprised Malaysian shrimp (having 100% similar proles).
LDA of stable isotopes helped subcategorize group 5 into four
subgroups based on the country of origin, wherein the

stable isotopic values also vary with the country of origin; for
example, the shrimp P. borealis from Greenland has dierent
13C and 15N values (18.1 and 10.3)34 compared to
shrimp from the Mid-Atlantic Ridge (10.9 and 7) and
Japan (14.7 and 15.8).29,35 Ortea and Gallardo6
reported unique 13C and 15N values of shrimp species from
Argentina (16.12 and 16.86), North Atlantic (18.07
and 10.78), Mozambique (16.77 and 10.55), Nigeria
(17.87 and 10.34), and Senegal (16.80 and
8.72). These reported 13C and 15N values of various
shrimp species from dierent countries diered signicantly
from the values of shrimp obtained in our study. This reveals
that stable isotopic values could positively indicate the origin of
shrimp.
In the present investigation, shrimp from the natural environment showed higher isotopic variability and their mean 13C
and 15N values were statistically dierent than the farmed
ones. The 13C values of Korean aquacultured shrimp ranged
from 20.23 to 21.72, whereas the 13C values of
Korean natural shrimp ranged from 14.02 to 18.69. In
contrast, the 15N values of aquacultured shrimp (5.60
6.20) were lower than the 15N values (11.5312.28) of
natural shrimp; this was probably because of dierences in diet.
Gamboa-Delgado et al.36 also reported distinct 13C and 15N
values for the shrimp species L. vannamei from Ecuador (open
sea 16.6 and 9.76, estuary 18.32 and 4.25, semiintensively farmed 19.86 and 6.02) and L. vannamei
from the Gulf of Mexico (open sea 17.14 and 12.19,
estuary 18.59 and 5.88, semi-intensively farmed
19.69 and 8.32, intensively farmed 21.56 and
8.69). Aquaculture feeds are frequently formulated with
varying dietary levels of plant meals. These plant meals are
mostly derived from terrestrial plants having C3 photosynthesis
and are less enriched in 13C (mean 13CVPDB = 29) as
compared to C4 plants (mean 13CVPDB = 13).36 Also, the
C3 plants are less enriched as compared to several marinederived ingredients such as sh meal (13CVPDB = 17). For
example, some shrimp feeds used in Mexico have 13CVPDB
values ranging from 23.6 to 22.3 and 15N values
ranging from 5.8 to 9.7; the 13CVPDB values of feed are
transferred to the farmed organisms, thereby causing contrasting 13C values (more isotopically depleted) as compared
to the wild type.36 Thus, stable isotopic values could help
distinguish farmed and natural shrimp.
The unique isotopic values obtained for hairtail sh and
shrimp obtained from various regions, viewed through the
present study, assert that 13C and 15N could be used as
discriminatory variables to distinguish between various geographic origins.
Although several schematic reports and strategies have been
outlined to identify shery products, determine their geographical origin, and preserve domestic shery products
without adulteration, most of the techniques involved discuss
animal meat (beef and lamb). But this study brings forth the
applicability of isotopic analysis in the traceability of marine sh
products. The identied dierences in isotopic patterns of
samples from various origins obtained in this study elucidate
the potential of stable isotope analysis for validation of
geographic authenticity. However, the identied patterns will
have to be conrmed in another detailed study comprising a
larger number of samples from certied origins and over a time
course. Nevertheless, it is a fact that isotopic ratios of shes are
bound to be more stable as compared to other smaller life
5554

DOI: 10.1021/acs.jafc.5b01469
J. Agric. Food Chem. 2015, 63, 55485556

Article

Journal of Agricultural and Food Chemistry

(Panaeus monodon), the white leg shrimp (Litopenaeus vannamei) and

the Indian white shrimp (Fenneropenaeus indicus) by PCR targeted to
the 16S rRNA mtDNA. Food Chem. 2011, 125, 14571561.
(5) Lavilla, I.; Costas-Rodrguez, M.; Bendicho, C. Authentication of
fishery products. Comp. Anal. Chem. 2013, 60, 657717.
(6) Ortea, I.; Gallardo, J. M. Investigation of production method,
geographical origin and species authentication in commercially
relevant shrimps using stable isotope ratio and/or multi-element
analyses combined with chemometrics: An exploratory analysis. Food
Chem. 2015, 170, 145153.
(7) Kim, H.; Suresh Kumar, K.; Shin, K. H. Applicability of stable C
and N isotope analysis in inferring the geographical origin and
authentication of commercial fishes (mackerel, yellow croaker and
pollock). Food Chem. 2015, 172, 523527.
(8) Tamura, K.; Dudley, J.; Nei, M.; Kumar, S. MEGA4: Molecular
Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol.
Biol. Evol. 2007, 24, 15961599 DOI: 10.1093/molbev/msm092.
(9) Saitou, N.; Nei, M. The neighbor-joining method: A new method
for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406
425.
(10) Takezaki, N.; Rzhetsky, A.; Nei, M. Phylogenetic test of the
molecular clock and linearized trees. Mol. Biol. Evol. 2004, 12, 823
833.
(11) Tamura, K.; Nei, M.; Kumar, S. Prospects for inferring very large
phylogenies by using the neighbor-joining method. Proc. Natl. Acad.
Sci. U.S.A. 2004, 101, 1103011035.
(12) Chakraborty, A.; Aranishi, F.; Iwatsuki, Y. Polymerase chain
reaction and restriction fragment length polymorphism analysis for
species identification of hairtail fish fillets from supermarkets in Japan.
Fish. Sci. (Tokyo, Jpn.) 2007, 73, 197201.
(13) Kurle, C. M.; Sinclair, E. H.; Edwards, A. E.; Gudmundson, C. J.
Temporal and spatial variation in the 15N and 13C values of fish and
squid from Alaskan waters. Mar Biol. 2011, 158, 23892404.
(14) Arcagni, M.; Campbell, L. M.; Arribere, M. A.; Kyser, K.;
Klassen, K.; Casaux, R.; Miserendino, M. L.; Guevara, S. R. Food web
structure in a double-basin ultra-oligotrophic lake in Northwest
Patagonia, Argentina, using carbon and nitrogen stable isotopes.
Limnologica 2013, 43, 131142.
(15) DeNiro, M. J.; Epstein, S. Influence of diet on the distribution of
carbon isotopes in animals. Geochim. Cosmochim. Acta 1978, 42, 495
506.
(16) Gomez-Requeni, P.; Mingarro, M.; Calduch-Giner, J. A.;
Medale, F.; Martin, S. A. M.; Houlihan, D. F.; Kaushik, S.; PerezSanchez, J. Protein growth performance, amino acid utilisation and
somatotropic axis responsiveness to fish meal replacement by plant
protein sources in gilthead sea bream (Sparus aurata). Aquaculture
2004, 232, 493510.
(17) Tanaka, H.; Ohshimo, S.; Takagi, N.; Ichimaru, T. Investigation
of the geographical origin and migration of anchovy Engraulis japonicus
in Tachibana Bay, Japan: A stable isotope approach. Fish Res. 2010,
102, 217220.
(18) Suh, Y. J.; Shin, K. H. Size-related and seasonal diet of the
Manila clam (Ruditapes philippinarum), as determined using dual
stable isotopes. Estuarine, Coastal Shelf Sci. 2013, 135, 94105.
(19) Libes, S. M. An Introduction to Marine Biogeochemistry; John
Wiley and Sons: New York, 1992.
(20) Schell, D. M.; Saupe, S. M.; Haubenstock, N. Bowhead whale
(Balaena mysticetus) growth and feeding as estimated by 13C
techniques. Mar. Biol. 1989, 103, 433443.
(21) France, R. L. Carbon-13 enrichment in benthic compared to
planktonic algae: foodweb implications. Mar. Ecol.: Prog. Ser. 1995,
124, 307312.
(22) Peterson, B.; Howarth, R. W. Sulfur, carbon and nitrogen
isotopes used to trace organic matter flow in the salt-marsh estuaries of
Sapelo Island, Georgia. Limnol. Oceanogr. 1987, 32, 11951213.
(23) Wu, Y.; Zhang, J.; Li, D. J.; Wei, H.; Lu, R. X. Isotope variability
of particulate organic matter at the PN section in the East China Sea.
Biogeochemistry 2003, 65, 3149.

subgroups comprising Indonesian, Indian, Dutch, and Thai

shrimp were identied accurately (as they had 80%, 100%,
100%, and 80% similarity, respectively). Group 6 comprised
Argentinian shrimp; the members demonstrated 100%
similarity between themselves.
Nowadays, consumers are increasingly interested in validating the reliability of sh products and determining if it is of
natural (wild) origin. Nevertheless, international shery and
seafood trade are bound by food safety regulations, which insist
on traceability (through all stages of production, processing,
and distribution). These regulations aim to promote resource
sustainability, quality distinction, and product safety. In fact, the
FAO have outlined several analytical approaches for species
authentication (NMR analysis, isotope analysis, ngerprints,
electrophoresis, peptide mapping, immunological techniques
analyzing proteins, target recognition, and blot hybridization),
verication of geographic origin (NMR analysis, stable isotope
and trace element analysis), and determining if the product is
wild or cultivated. This study evaluates two of these techniques:
stable isotope analysis and COI sequencing. Both these
analyses harmonized in authenticating and tracing the origin
of hairtail sh and shrimp from various origins.
Stable isotopes (13C and 15N) and COI gene sequencing
have been used to authenticate, discriminate, and trace various
food products. But their use in determining the provenance of
sh has not been prevalent. On the basis of the present study,
we can summarize that COI sequencing helped identify the
species of hairtail sh and shrimp. The LDA of stable isotopes
helped in further categorizing each species into subgroups,
based on the country of origin. Moreover, the stable isotope
values distinctly dierentiated natural and farmed shrimp from
the same country. Thus, this study on hairtail sh and shrimp
validates the utility of these tools in identifying these species
and establishing their geographical origin.

AUTHOR INFORMATION

Corresponding Author

*Phone +82 31 400 5536; fax +82 31 416 6173; e-mail

shinkh@hanyang.ac.kr.
Author Contributions

H.K. and K.S.K. contributed equally.

Funding

This research was a part of the project Development of

integrated techniques for the identication of seafood origin
using chemical index and genetic information, funded by the
Ministry of Oceans and Fisheries, Korea. It was also supported
by a grant from the National Research Foundation (No.
2012012617).
Notes

The authors declare no competing nancial interest.

REFERENCES

(1) Ortea, I.; Pascoal, A.; Canas, B.; Gallardo, J. M.; BarrosVelazquez, J.; Calo-Mata, P. Food authentication of commercially
relevant shrimp species: From classical methods to foodomics.
Electrophoresis 2012, 33, 22012211.
(2) Tacon, A. G. J.; Metian, M. Fish matters: Importance of aquatic
foods in human nutrition and global food supply. Rev. Fish Sci. 2013,
21, 2238.
(3) http://www.dpi.nsw.gov.au/__data/assets/pdf_le/0008/
375902/Hairtail-and-Frostsh.pdf (accessed on July 27, 2014).
(4) Pascoal, A.; Barros-Velasquez, J.; Ortea, I.; Cepeda, A.; Gallardo,
J. M.; Calo-Mata, P. Molecular identification of the black tiger shrimp
5555

DOI: 10.1021/acs.jafc.5b01469
J. Agric. Food Chem. 2015, 63, 55485556

Article

Journal of Agricultural and Food Chemistry

(24) MacKenzie, K. M.; Palmer, M. R.; Moore, A.; Ibbotson, A. T.;
Beaumont, W. R. C.; Poulter, D. J. S.; Trueman, C. L. Locations of
marine animals revealed by carbon isotopes. Sci. Rep. 2011, 1, 16.
(25) Hobson, K. A. Applying isotopic methods to tracking animal
movements. In Tracking Animal Migration Using Stable Isotopes;
Hobson, K. A., Wassenaar, L. I., Eds.; Academic Press: London, 2008;
pp 4578.
(26) Riera, P.; Stal, L. J.; Nieuwenhuize, J. Heavy 15N in intertidal
benthic algae and invertebrates in the Scheldt Estuary (The
Netherlands): Effect of river nitrogen inputs. Estuarine, Coastal Shelf
Sci. 2000, 51, 365372.
(27) Wan, R.; Wu, Y.; Huang, L.; Zhang, J.; Gao, L.; Wang, N. Fatty
acids and stable isotopes of a marine ecosystem: study on the Japanese
anchovy (Engraulis japonicus) food web in the Yellow Sea. Deep Sea
Res. Part II 2010, 57, 10471057.
(28) Shibata, J. Y.; Matsumoto, K.; Hamaoka, H.; Sogabe, A.; Nanko,
T.; Kunihiro, T.; Onishi, H.; Omori, K. Contribution of pelagic and
benthic grazing and detritus food chains to the coastal ecosystem of
the Western Seto Inland Sea: A stable isotope and Bayesian mixing
model analysis approach. In Interdisciplinary Studies on Environmental
ChemistryEnvironmental Pollution and Ecotoxicology; Kawaguchi, M.,
Misaki, K., Sato, H., Yokokawa, T., Itai, T., Nguyen, T. M., Ono, J.,
Tanabe, S., Eds.; Terrapub: Tokyo, 2012; pp 427435.
(29) Takai, N.; Mishima, Y. Carbon sources for demersal fish in the
western Seto Inland Sea, Japan, examined by 13C and 15N analyses.
Limnol. Oceanogr. 2002, 47, 730741.
(30) Di Beneditto, A. P. M.; Bittar, V. T.; de Rezende, C. E.;
Camargo, P. B.; Kehrig, H. A. Mercury and stable isotopes (15N and
13C) as tracers during the ontogeny of Trichiurus lepturus. Neotrop.
Ichthyol. 2013, 11, 211216.
(31) Lee, Y.; Hur, J.; Shin, K. H. Characterization and source
identification of organic matter in view of land uses and heavy rainfall
in Lake Shihwa, Korea. Mar. Pollut. Bull. 2014, 84, 322329.
(32) Yokoyama, H.; Tamaki, A.; Harada, K.; Shimoda, K.; Koyama,
K.; Ishihi, Y. Variability of diet-tissue isotopic fractionation in estuarine
macrobenthos. Mar. Ecol.: Prog. Ser. 2005, 296, 115128.
(33) Kuramoto, T.; Minagawa, M. Stable carbon and nitrogen
isotopic characterization of organic matter in a mangrove ecosystem
on the south-western coast of Thailand. J. Oceanogr. 2001, 57, 421
431.
(34) Riget, F.; Mller, P.; Dietz, R.; Nielsen, T. G.; Asmund, G.;
Strand, J.; Larsen, M. M.; Hobson, K. A. Transfer of mercury in the
marine food web of West Greenland. J. Environ. Monit. 2007, 9, 877
783.
(35) Vereshchaka, A. L.; Vinogradov, G. M.; Dalton, A. Y. L. S.;
Dehairs, F. Carbon and nitrogen isotopic composition of the fauna
from the Broken Spur hydrothermal vent field. Mar. Biol. 2000, 136,
1117.
(36) Gamboa-Delgado, J.; Molina-Poveda, C.; Godnez-Siordia, D.
E.; Villarreal-Cavazos, D.; Ricque-Marie, D.; Cruz-Suarez, L. E.
Application of stable isotope analysis to differentiate shrimp extracted
by industrial fishing or produced through aquaculture practices. Can. J.
Fish Aquat. Sci. 2014, 71, 15201528.
(37) Griffiths, A. M.; Sotelo, C. G.; Mendes, R.; Perez-Martn, R. I.;
Schroder, U.; Shorten, M.; Silva, H. A.; Verrez-Bagnis, V.; Mariani, S.
Current methods for seafood authenticity testing in Europe: Is there a
need for harmonisation? Food Control 2014, 45, 95100.
(38) Ward, R. D.; Hanner, R.; Hebert, P. D. N. The campaign to
DNA barcode all fishes, FISH-BOL. J. Fish Biol. 2009, 74, 329356.
(39) Spies, I. B.; Gaichas, S.; Stevenson, D. E.; Orr, J. W.; Canino, M.
F. DNA based identification of Alaska skates (Amblyraja, Bathyraja
and Raja: Rajidae) using cytochrome c oxidase submit (COI)
variation. J. Fish Biol. 2006, 69(B), 283292.
(40) Tzeng, C. H.; Chiu, T. S. DNA barcode-based identification of
commercially caught cutlassfishes (Family: Trichiuridae) with a
phylogenetic assessment. Fish Res. 2012, 127128, 176181.

5556

DOI: 10.1021/acs.jafc.5b01469
J. Agric. Food Chem. 2015, 63, 55485556