Veterinary Microbiology 177 (2015) 219223

Contents lists available at ScienceDirect

Veterinary Microbiology
journal homepage: www.elsevier.com/locate/vetmic

Short Communication

Prevalence of the immune evasion gene cluster in

Staphylococcus aureus CC398
Christiane Cuny, Mohamed Abdelbary, Franziska Layer, Guido Werner,
Wolfgang Witte *
Robert Koch Institute, Wernigerode Branch, Burgstrasse 37, 38855 Wernigerode, Germany

A R T I C L E I N F O

A B S T R A C T

Article history:
Received 12 November 2014
Received in revised form 21 February 2015
Accepted 23 February 2015

The immune evasion gene cluster (IEC) is typical for Staphylococcus aureus isolated from
humans but is usually absent in S. aureus isolated from animals. Previous studies have
shown that methicillin resistant S. aureus (MRSA) CC398 obviously lost the IEC when
evolving as livestock-associated MRSA from a human-adapted, methicillin-susceptible
ancestor. This study aimed to look for the presence of IEC in MRSA from pigs and horses as
well as from the colonization of humans with occupational animal contact and from
infections in humans. For comparison, methicillin susceptible S. aureus (MSSA) isolates
from infections in humans were included.
We did not detect the IEC among 94 isolates from the nasal colonization of pigs; however,
the IEC was found in 6 of 61 isolates from nosocomial infections in horses. MRSA CC398 isolates
from the nasal colonization of 138 pig farmers were negative for the IEC. It was detected,
however, in 4 of 69 veterinarians treating horses. Among 99 epidemiologically unrelated MRSA
isolates attributed to CC398 originating from infections in humans, 19 were positive for the IEC.
Only three of these isolates which also contained luk-PV were attributed to the ancestral,
human-adapted subpopulation of CC398 by means of PCR for detection of canonical SNPs. A
considerable proportion of LA-MRSA CC398 attributed to the animal subpopulation and
originating from infections in humans had acquired the IEC; this acquisition is, however,
obviously not a prerequisite to the capacity of LA-MRSA CC398 to cause infections in this host.
Among 15 MSSA CC398 isolates from infections in humans, 11 contained the IEC, and of
these, two were attributed to the animal subpopulation. Six isolates containing both the
IEC and luk-PV were attributed to the ancestral, human subpopulation.
Re-acquisition of the IEC by LA-MRSA CC398 suggests readaptation to the human host.
In epidemiological surveillance, discrimination from the ancestral human subpopulation
is important.
2015 Elsevier B.V. All rights reserved.

Keywords:
Livestock associated MRSA
Immune evasion genes
Zoonotic MRSA infection

1. Introduction
Livestock-associated methicillin resistant Staphylococcus aureus (LA-MRSA), in particular clonal complex CC398,
is widely disseminated as colonizer of various livestock

* Corresponding author. Tel.: +49 30 187544246; fax: +49 30 18752203.

E-mail address: wittew@rki.de (W. Witte).
http://dx.doi.org/10.1016/j.vetmic.2015.02.031
0378-1135/ 2015 Elsevier B.V. All rights reserved.

(Graveland et al., 2011). Furthermore, in Europe and North

America, it has become the most prevalent MRSA in horses,
circulating in equine clinics as a colonizer and infectious
agent (Cuny et al., 2008; Van Duijkeren et al., 2010; Vincze
et al., 2014; Gomez-Sanz et al., 2014). MRSA CC398 is a
frequent colonizer of humans with occupational exposure to
livestock (for a review, see Cuny et al., 2013), as well as of
veterinary personnel working in equine clinics (Cuny et al.,
2008; Van Duijkeren et al., 2011). Although dissemination of

220

C. Cuny et al. / Veterinary Microbiology 177 (2015) 219223

LA-MRSA CC398 among the community seems to be rare so

far, infections in humans without animal contact suggest
human to human transmission (Benito et al., 2014). LAMRSA CC398 has also been demonstrated as a causative
agent of infections in humans, in particular those affecting
skin and soft tissue as well as septicemia and ventilatorassociated pneumonia in hospitalized patients (Cuny et al.,
2013). A phylogenetic analysis of genome-wide single
nucleotide polymorphisms (SNPs) of S. aureus/MRSA
CC398 of human and animal origin discriminated between
an ancestral human-adapted clade and an animal-associated clade which evolved from the methicillin-susceptible
human clade (Price et al., 2012). Adaptation to animals was
obviously associated with genome alterations including the
loss and acquisition of genetic elements such as prophages
of integrase group 3 (wSaint3) which contains the immune
evasion gene cluster (IEC) (Schijffelen et al., 2010). wSaint3
phages are usually carried by S. aureus adapted to humans
(McCarthy and Lindsay, 2013) and integrate into the bhemolysin gene. The immune evasion genes of the IEC are
sak, staphylokinase, chp, chemotaxis inhibitory protein, and
scn, staphylococcal complement inhibitory protein, as well
as particular enterotoxin genes such as sea, sep, sek, and seq
(Van Wamel et al., 2006; Goerke et al., 2009). It seems likely
that the expression of superantigens such as sea promotes
the survival of S. aureus in the host by undermining the
neutrophil response, leading to a protective niche (Xu et al.,
2014). In response to antibiotic usage in livestock farming,
adaptation to the animal host is often accompanied by the
acquisition of resistance genes such as tet(M) and mecA.
Although infections in humans caused by LA-MRSA are
comparatively rare so far (Kock et al., 2013), LA-MRSA is
regarded as a potential risk to humans due to wide
dissemination among animals and possibilities of readaptation to humans. Acquisition of wSaint3 is probably
one of the rst steps in this process. In this context, we
investigated the presence of wSaint3 as a prophage by PCR
for int3 and of the immune evasion gene cluster in MRSA
CC398 from (i) the nasal colonization of pigs and from
nosocomial infections in horses, (ii) the nasal colonization of
humans with occupational exposure to pigs and to horses,
(iii) different kinds of infections in humans, and in
methicillin-susceptible S. aureus (MSSA) CC398 from infections in humans.

2. Materials and methods

MRSA from animals: a total of 151 isolates were
included in this study: 94 from pigs at 47 farms in
northwestern Germany (Cuny et al., 2009) and 61 MRSA
from horses which originated from infections in veterinary
care settings in Austria, Belgium, Germany, and the
Netherlands (Cuny et al., 2008; Abdelbary et al., 2014).
MRSA isolates from the nasal colonization of humans
with professional exposure to animals (n = 207) included
138 isolates from pig farmers and 22 from veterinarians
visiting pig farms collected in 2008 and 2009 (Cuny et al.,
2009); an additional 47 isolates originated from individuals
working at horse clinics located in northern Germany in
20122014.

MRSA CC398 from different kinds of infections in

humans were also included; these isolates (n = 96) originated from the sample of MRSA isolates (n = 9950) which were
sent to the German National Reference Center for Staphylococci and Enterococci between 2006 and 2013 for strain
characterization and typing. They were attributed to CC398
by means of spa-typing (if necessary, followed by MLST), as
described previously (Cuny et al., 2009). Data on possible
animal contacts of the included patients and their family
members were not available. For comparison, we also
looked at 15 MSSA isolates attributed to CC398 which were
also sent to the National Reference Center for Staphylococci
and Enterococci from 2006 until 2013 (15 among altogether
MSSA 3198 isolates from various kinds of infections).
Isolation of MRSA from nasal swabs, primary diagnostics, and further characterization by means of spa
typing, attribution to CC398, and demonstration of mecA
as well as phenotypic antibiotic susceptibility testing
were performed as described previously (Cuny et al.,
2009). SCCmec elements were characterized using a PCR
approach, including a combination of different PCRs as
described (www.staphylococcus.net). PCR for int3 was
performed as previously described (Goerke et al., 2009), for
sak, scn, and chp according to Van Wamel et al. (2006), and for
relevant enterotoxin genes (sea, sep, sek, and seq) according to
Holtfreter et al. (2007). Rapid discrimination between the
ancestral subpopulation and the animal subpopulation was
performed by ordinary PCR based on recently described SNP
polymorphisms (canonical SNPs = canSNP). For SAPIG_698
(nucleotide 732.619, AM990992, and nucleotide 616789
in CP003045 (Stegger et al., 2013), we designed the following
primers (degeneration of the second last nucleotide at the 30
end in bold): forward 698,hf 50 TTGATTCGTTAATAATGG
(ancestral population, livestock-independent), and
698,af 50 TTGATTCGTTAATAATAT (animal subpopulation),
reverse primer was 698,r 5 0 TGTTGGCTATTTAACTGG. For
SAPIG_2511 (nucleotide 2597585 in AM90992.1, and
nucleotide 2440348 in CP003045) the forward primer
2511f 5 0 ATGTCAAATACAAATAAAC, and reverse primers
2511,h3r GTGAATACAGCT-ACTAAIC (ancestral subpopulation) and 2511,a1r GTGAATACAGCTACTAAIT (animal
subpopulation) were used. The cycling scheme
was 95 8C (5 min) + [95 8C (30 s), 45 8C (30 s), 72 8C
(30 s)]  35 + 72 8C (4 min), using PuReTaq Ready-ToGo PCR Beads (GE Healthcare). Correct amplication was
conrmed by sequencing of the amplimers for reference
strains 71193 and SO385 (genomes under CP003045 and
AM990992.1 respectively). The primers for PCR for tet(K)
were 50 GTAGCGACAATAGGTAATAG and 50 GTAGTGACAATAAACCTCCT and for tet(M) were 50 AGTGGAGCGATTACAGAA
AGTGGAGCGATTACAGAA and 50 CATATGTCCTGGCGTGTCTA.
The cycling scheme was 95 8C (5 min) + [95 8C (30 s), 55 8C
(30 s), 72 8C (30 s)]  35 + 72 8C (4 min), using PuReTaq ReadyTo-Go PCR Beads (GE Healthcare).
3. Results
3.1. MRSA isolates of animal origin
None of the 94 isolates from the nasal colonization of
pigs was PCR positive for int3, sak, chp, scn, and for the

C. Cuny et al. / Veterinary Microbiology 177 (2015) 219223

checked enterotoxin genes. All of them were attributed to

the livestock-dependent LA-MRSA subpopulation by PCR
for canSNPs (for spa types and antibiotic resistance
phenotypes, see Cuny et al., 2009). All of the 61 isolates
from horses were attributed to the LA-MRSA (non-human)
subpopulation by means of PCR for canSNPs. Among these
isolates, 49 exhibited the typing pattern typical for the
MRSA CC398 subpopulation, which is mainly associated
with horse clinics: spa type t011 or t6867, resistance to
gentamicin and possession of SCCmecIV (Cuny et al., 2008;
Abdelbary et al., 2014). For four of them, int3 as well as sak
and scn but not chp and also none of the checked
enterotoxin genes were demonstrated by PCR. One isolate
was positive for int3, sak, scn, and sea, but negative for chp
and for the checked enterotoxin genes. One further isolate
was positive for int3, sak, chp, and scn, and negative for the
checked enterotoxin genes. The remaining 18 isolates
exhibited different typing patterns and were PCR negative
for int3 as well as for genes of the IEC (Table 1).
3.2. MRSA isolates from the nasal colonization of humans
with occupational exposure to livestock
None of the isolates from the nasal colonization of 138
farmers collected in 2008 and 2009 and none of the 22
isolates from pigs were positive for int3, sak, chp, scn, and
for the checked enterotoxin genes. All of these isolates
were attributed to the animal subpopulation by means of
PCR for canSNPs. Results for spa typing and antibiotic
susceptibility were reported previously (Cuny et al., 2009).
Among the 47 isolates from veterinarians working in horse
clinics, 40 exhibited spa type t011, resistance to gentamicin, and contained SCCmecIV. Of these isolates, four were
positive for int3: one contained sak, chp, and scn, but none
of the checked enterotoxin genes, and three contained sak
and scn but not chp, and also none of the checked
enterotoxin genes. The remaining seven isolates exhibited
different typing patterns and were negative for int3 as well
as for the IEC genes (Table 1).
3.3. MRSA isolates from infections in humans
Among the 99 MRSA CC398 isolates from infections in
humans, 19 (19%) were positive for int3 and the IEC, but only
one of these isolates contained sep (Table 2). Demonstration

221

of int3 was independent on the spa type. All three LA-MRSA

CC398 from ventilator-associated pneumonia (n = 2) and
from a urinary tract infection (n = 1) were negative for int3
and the IEC. PCR for the SNPs in SAPIG_0698 and
SAPIG_2511 attributed 16 of the 19 int3 positive isolates
to the animal subpopulation of CC398. These isolates
contained SCCmecV. The three MRSA CC398 isolates which
were attributed to the ancestral subpopulation contained
both IEC and luk-PV. All of the 99 MRSA CC398 isolates from
infections in humans were resistant to oxytetracycline. The
96 isolates attributed to the animal subpopulation contained tetM, whereas the three attributed to the ancestral
subpopulation contained tetK.
3.4. MSSA CC398 from infections in humans
These 15 isolates originated from invasive infections
(one from septicemia, 14 from deep skin and soft tissue
infections). Their characteristics are shown in Table 3.
Among these isolates, 11 contained the IEC without the
checked enterotoxin genes. The six isolates which were
also positive for luk-PV and the three isolates exhibiting
spa type t571 were attributed to the ancestral subpopulation. Both of the IEC positive and luk-PV negative isolates
exhibiting spa type t034 were attributed to the animal
subpopulation. Oxytetracycline resistance was detected in
three of the 15 MSSA CC398 isolates; two of those isolates
attributed to the human subpopulation contained tet(K)
whereas the one isolate attributed to the animal subpopulation contained tet(M).
4. Discussion
As might be reasonably expected, the wSaint3-containing IEC was absent from LA MRSA CC398 of porcine origin
and also from the nasal colonization of humans with
occupational exposure to conventionally raised pigs. Only
one porcine CC398 isolate which had reacquired IEC has
been reported so far (Stegger et al., 2013). In our study the
IEC was detected, however, in 10% of LA-MRSA CC398
from infections in horse clinics and the colonization of
veterinary personnel.
As IEC has not yet been reported for MRSA from horses
which were attributed to clonal complexes other than
CC398 (Walther et al., 2009), its acquisition from other

Table 1
Characteristics of LA-MRSA CC398 from horses and from veterinary personnel.
Origin

Horses, horse clinics

(n = 61)

Veterinary personnel,
horse clinics
(n = 47)
a

spa types

t011 (37)
t6867 (5)a
t6867 (1)
t6867 (7)
t779 (2)
t034 (9)
t011 (36)
t011 (3)
t011 (1)
t034 (7)

PCR for CC398 subpopulations

PCR

698h/698r

698a/698r

2511f/2611h3r

2511f/2511a1/r

int3

sak

chp

scn

mecA

SCCmec












+
+
+
+
+
+
+
+
+
+












+
+
+
+
+
+
+
+
+
+


+
+




+
+



+
+




+
+




+





+



+
+




+
+


+
+
+
+
+
+
+
+
+


IV
IV
IV
IV
II
V
IV
IV
IV
V

One of these ve isolates was positive for sea.

C. Cuny et al. / Veterinary Microbiology 177 (2015) 219223

222

Table 2
Characteristics of int3 positive LA-MRSA from infections in humans (n = 99).
Clinical origin

Frequency

spa types (n)

Wound infection

13/72

t034 (5)
t011 (3)
t034 (1)
t034 (2)a
t1250 (1)
t011 (1)
t034 (3)
t034 (2)
t034

PCR for CC398 subpopulations

698h/698r

Furuncle, abscess

5/16

Septicemia

1/11

698a/698r

PCR

2511f/2511h3r

5
3
1

2511/2511a1r

sak

chp

scn

luk-PV

mecA

SCCmec

5
3

+
+
+
+
+

+
+
+

+
+
+


+
+
+


+
+
+

+
+
+
+




+




+


+
+
+
+
+
+
+
+
+

V
V
nt
V
V
V
V
nt
V

1
2
1
1
3

2
1
1
3

2
1

nt: non typeable.

a
One of these two isolates was positive for sep.

human-adapted S. aureus along with the nasal colonization

of veterinary personnel and later on retransmission of
these bacteria to horses seems likely. Lysogenic conversion
for the IEC is probably not in favor of the colonization of
mammalian animal hosts. Further observations will show
whether possession of the IEC remains stable in MRSA from
horses. Although staphylokinase seems to not be essential
for the rst step of nasal colonization in humans, it might
be important for maintaining it (Jin et al., 2004). The 19%
proportion of MRSA CC398 attributed to the animal
subpopulation among isolates from infections in humans
in Germany is clearly higher than the 2.5% reported for a
collection of isolates of human origin from different
European countries without differentiation between colonization and infection (Stegger et al., 2013). Possession of
the IEC is obviously not a general prerequisite for the
capacity of LA-MRSA CC398 to cause invasive infections in
humans. As suggested by McCarthy and Lindsay (2013),
each lineage of S. aureus evades host immune responses by
a variety of different mechanisms. The exact role of the IEC
in permanent colonization and infection in humans
remains to be shown. Superantigen determinants not
associated with wSaint3 phages such as seb have been
sporadically found in LA-MRSA CC398 of porcine origin
(Argudn et al., 2011). Possession of sea or sep has not been
reported so far. We found sea in one isolate of horse origin
and sep in one isolate from a wound infection in a human.
Because of the association of PantonValentin leukocidin
(luk-PV) with severe skin and soft tissue infections, isolates

containing luk-PV are of particular interest. Attribution of

MSSA containing luk-PV to the human subpopulation of
CC398 was already reported by Price et al. (2012). Here, we
show that both MSSA and MRSA CC398, which were
isolated from infections in humans in Germany and
contain the IEC and luk-PV, belong to the human
subpopulation. This has not been reported for corresponding MRSA CC398 isolates from other countries so far.
MSSA and MRSA C398 containing luk-PV seem to be
prevalent in China (Yu et al., 2008; Zhao et al., 2012). There
are only a few reports on luk-PV positive MRSA CC398 so
far from Europe, i.e. from Sweden (Welinder-Olsson et al.,
2008) and from Denmark (Stegger et al., 2010). For three of
the four reported cases, a link to China was observed. PCR
for canSNPs discriminating between the ancestral and the
animal subpopulations was found to be useful for
attributing CC398 isolates to an either primarily human
or animal origin. As discussed by Stegger et al. (2013),
phenotypic resistance to oxytetracycline could indicate an
animal origin at rst glance. This resistance was, however,
also found in MRSA isolates attributed to the ancestral
(human) subpopulation which contained the IEC and luk-PV.
However, tet(M) was detected only in isolates attributed to
the animal subpopulation. We should keep in mind that
tet(M) is not generally associated with S. aureus/MRSA of
animal origin, as it has also been demonstrated in
community-associated MRSA ST80 (Witte et al., 2005).
There is also a report on acquisition by communityassociated MRSA ST8 USA300 (McDougal et al., 2010).

Table 3
Characteristics of MSSA CC398 from infections in humans (n = 15).
Number of isolates

3
5
1
2
1
2
1

PCR for CC398 subpopulations

spa types

698h/
698r

698a
698r

2511f/2511h3r

2511/2511a1r

+
+
+








+
+
+
+

+
+
+








+
+
+
+

t571
t034
t3625
t011
t034
t034
t1197

PCR for
int3

sak

chp

scn

luk-PV

mecA

+
+
+


+



+
+


+


+
+
+


+


+
+
+


+



+
+













C. Cuny et al. / Veterinary Microbiology 177 (2015) 219223

5. Conclusion
Surveillance of the emergence of MRSA CC398 with
special virulence characteristics should discriminate between opportunities (i) for the evolution of virulence in LAMRSA with respect to infections in humans, and (ii) the
acquisition of resistance determinants such as mec genes
by the ancestral, human adapted subpopulation. Further
surveillance is required to show whether reacquisition of
the IEC will contribute to the human to human transmission capacity of LA-MRSA CC398 independent of livestock.
Ethical disclosure
Concerning sample collection the study protocol and
data handling the study were approved by ethical
committee of the Otto von Guericke University Magdeburg, afliated to the faculty of medicine (le #47/09).
Funding
The study was supported by the German Ministry for
Research and Education, grant No. 01KI1301G (project
cluster MedVetStaph). The funder had no role in study
design, data collection and analysis, decision to publish, or
preparation of the manuscript.
References
Abdelbary, M.M., Wittenberg, A., Cuny, C., Layer, F., Kurt, K., Wieler, L.H.,
Walther, B., Skov, R., Larsen, J., Hasman, H., Fitzgerald, J.R., Smith, T.C.,
Wagenaar, J.A., Pantosti, A., Hallin, M., Struelens, M.J., Edwards, G.,
Bose, R., Nubel, U., Witte, W., 2014. Phylogenetic analysis of Staphylococcus aureus CC398 reveals a sub-lineage epidemiologically associated with infections in horses. PLOS ONE 9, e88083.
Argudn, M.A., Tenhagen, B.A., Fetsch, A., Sachsenroder, J., Kasbohrer, A.,
Schroeter, A., Hammerl, J.A., Hertwig, S., Helmuth, R., Braunig, J., Mendoza, M.C., Appel, B., Rodicio, M.R., Guerra, B., 2011. Virulence and
resistance determinants of German Staphylococcus aureus ST398 isolates
from nonhuman sources. Appl. Environ. Microbiol. 77, 30523060.
Benito, D., Lozano, C., Rezusta, A., Ferrer, I., Vasquez, M.A., Ceballos, S.,
Zarazaga, M., Revillo, M.J., Torres, C., 2014. Characterization of tetracycline and methicillin resistant Staphylococcus aureus strains in a
Spanish hospital: is livestock-contact a risk factor in infections caused
by MRSA CC398? Int. J. Med. Microbiol. 304, 12261232.
Cuny, C., Strommenger, B., Witte, W., Stanek, C., 2008. Clusters of infections in
horses with MRSA ST1, ST254, and ST398 in a veterinary hospital. Microb.
Drug. Resist. 14, 307310.
Cuny, C., Nathaus, R., Layer, F., Strommenger, B., Altmann, D., Witte, W.,
2009. Nasal colonization of humans with methicillin-resistant Staphylococcus aureus (MRSA) CC398 with and without exposure to pigs.
PLoS ONE 4, e6800.
Cuny, C., Kock, R., Witte, W., 2013. Livestock associated MRSA (LA-MRSA)
and its relevance for humans in Germany. Int. J. Med. Microbiol. 303,
331337.
Gomez-Sanz, E., Simon, C., Ortega, C., Gomez, P., Lozano, C., Zarazaga, M.,
Torres, C., 2014. First detection of methicillin-resistant Staphylococcus
aureus ST398 and Staphylococcus pseudintermedius ST68 from hospitalized equines in Spain. Zoonoses Public Health 61, 192201.
Goerke, C., Pantucek, R., Holtfreter, S., Schulte, B., Zink, M., Grumann, D.,
Broker, B.M., Doskar, J., Wolz, C., 2009. Diversity of prophages in
dominant Staphylococcus aureus clonal lineages. J. Bacteriol. 191,
34623468.
Graveland, H., Duim, B., van Duijkeren, E., Heederik, D., Wagenaar, J.A.,
2011. Livestock-associated methicillin-resistant Staphylococcus aureus in animals and humans. Int. J. Med. Microbiol. 301, 630634.
Holtfreter, S., Grumann, D., Schmudde, M., Nguyen, H.T., Eichler, P., Strommenger, B., Kopron, K., Kolata, J., Giedrys-Kalemba, S., Steinmetz, I.,
Witte, W., Broker, B.M., 2007. Clonal distribution of superantigen genes
in clinical Staphylococcus aureus isolates. J. Clin. Microbiol. 45,
26692680.

223

Jin, T., Bokarewa, M., Foster, T., Mitchell, J., Higgins, J., Tarkowski, A., 2004.
Staphylococcus aureus resists human defensins by production of staphylokinase, a novel bacterial evasion mechanism. J. Immunol. 172,
11691176.
Kock, R., Schaumburg, F., Mellmann, A., Koksal, M., Jurke, A., Becker, K.,
Friedrich, A.W., 2013. Livestock-associated methicillin-resistant
Staphylococcus aureus (MRSA) as causes of human infection and
colonization in Germany. PLOS ONE 8, e55040.
McCarthy, A.J., Lindsay, J.A., 2013. Staphylococcus aureus innate immune evasion
is lineage-specic: a bioinformatics study. Infect. Genet. Evol. 19, 714.
McDougal, L.K., Fosheim, G.E., Nicholson, A., Bulens, S.N., Limbago, B.M.,
Shearer, J.E., Summers, A.O., Patel, J.B., 2010. Emergence of resistance
among USA300 methicillin-resistant Staphylococcus aureus isolates
causing invasive disease in the United States. Antimicrob. Agents
Chemother. 54, 38043811.
Price, L.B., Stegger, M., Hasman, H., Aziz, M., Larsen, J., Andersen, P.S., Pearson, T.,
Waters, A.E., Foster, J.T., Schupp, J., Gillece, J., Driebe, E., Liu, C.M., Springer,
B., Zdovc, I., Battisti, A., Franco, A., Zmudzki, J., Schwarz, S., Butaye, P., Jouy,
E., Pomba, C., Porrero, M.C., Ruimy, R., Smith, T.C., Robinson, D.A., Weese, J.,
Arriola, C.S., Yu, F., Lautend, F., Keim, P., Skov, R., Aarestrup, F.M., 2012.
Staphylococcus aureus CC398: host adaptation and emergence of methicillin resistance in livestock. MBio 3, 4030540311.
Schijffelen, M.J., Boel, C.H., van Strijp, J.A., Fluit, A.C., 2010. Whole genome
analysis of a livestock-associated methicillin-resistant Staphylococcus
aureus ST398 isolate from a case of human endocarditis. BMC Genomics 11, 376.
Stegger, M., Lindsay, J.A., Srum, M., Gould, K.A., Skov, R., 2010. Genetic
diversity in CC398 methicillin-resistant Staphylococcus aureus isolates
of different geographical origin. Clin. Microbiol. Infect. 16, 10171019.
Stegger, M., Liu, C.M., Larsen, J., Soldanova, K., Aziz, M., Contente-Cuomo,
T., Petersen, A., Vandendriessche, S., Jimenez, J.N., Mammina, C., van
Belkum, A., Salmenlinna, S., Laurent, F., Skov, R.L., Larsen, A.R., Andersen, P.S., Price, L.B., 2013. Rapid differentiation between livestockassociated and livestock-independent Staphylococcus aureus CC398
clades. PLOS ONE 8, e79645.
Van Duijkeren, E., Moleman, M., Sloet van Oldruitenborgh-Oosterbaan,
M.M., Multem, J., Troelstra, A., Fluit, A.C., van Wamel, W.J., Houwers,
D.J., de Neeling, A.J., Wagenaar, J.A., 2010. Methicillin-resistant Staphylococcus aureus in horses and horse personnel: an investigation of
several outbreaks. Vet. Microbiol. 141, 96102.
Van Duijkeren, E., Ten Horn, L., Wagenaar, J.A., de Bruijn, M., Laarhoven, L.,
Verstappen, K., de Weerd, W., Meessen, N., Duim, B., 2011. Suspected
horse-to-human transmission of MRSA ST398. Emerg. Infect. Dis. 17,
11371139.
Van Wamel, W.J., Rooijakkers, S.H., Ruyken, M., van Kessel, K.P., van Strijp,
J.A., 2006. The innate immune modulators staphylococcal complement inhibitor and chemotaxis inhibitory protein of Staphylococcus
aureus are located on beta-hemolysin-converting bacteriophages. J.
Bacteriol. 188, 13101315.
Vincze, S., Stamm, I., Kopp, P.A., Hermes, J., Adlhoch, C., Semmler, T., Wieler,
L.H., Lubke-Becker, A., Walther, B., 2014. Alarming proportions of
methicillin-resistant Staphylococcus aureus (MRSA) in wound samples
from companion animals, Germany 20102012. PLOS ONE 9, e85656.
Walther., B., Monecke, S., Ruscher, C., Friedrich, A.W., Ehricht, R., Slickers,
P., Soba, A., Wleklinski, C.G., Wieler, L.H., Lubke-Becker, A., 2009.
Comparative molecular analysis substantiates zoonotic potential of
equine methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol.
47, 704710.
Welinder-Olsson, C., Floren-Johansson, K., Larsson, L., Oberg, S., Karlsson,
L., Ahre, C., 2008. Infection with PantonValentine leukocidin-positive methicillin-resistant Staphylococcus aureus t034. Emerg. Infect.
Dis. 14, 127112722.
Witte, W., Braulke, C., Cuny, C., Strommenger, B., Werner, G., Heuck, D.,
Jappe, U., Wendt, C., Linde, H.J., Harmsen, D., 2005. Emergence of
methicillin-resistant Staphylococcus aureus with PantonValentine
leukocidin genes in central Europe. Eur. J. Clin. Microbiol. Infect.
Dis. 24, 15.
Xu, S.X., Gilmore, K.J., Szabo, P.A., Zeppa, J.J., Baroja, M.L., Haeryfar, S.M.,
McCormick, J.K., 2014. Superantigens subvert the neutrophil response
to promote abscess formation and enhance Staphylococcus aureus
survival in vivo. Infect. Immun. 82, 35883598.
Yu, F., Chen, Z., Liu, C., Zhang, X., Lin, X., Chi, S., Zho, T., Chen, Z., Chen, X.,
2008. Prevalence of Staphylococcus aureus carrying PantonValentine
leukocidin genes among isolates from hospitalised patients in China.
Clin. Microbiol. Infect. 14, 381384.
Zhao, C., Liu, Y., Zhao, M., Liu, Y., Yu, Y., Chen, H., Sun, Q., Chen, H., Jiang, W.,
Liu, Y., Han, S., Xu, Y., Chen, M., Cao, B., Wang, H., 2012. Characterization of community acquired Staphylococcus aureus associated with
skin and soft tissue infection in Beijing: high prevalence of
PVL + ST398. PLOS ONE 7, e38577.