Reference: Biol. Bull. 218: 36 47.

(February 2010)
2010 Marine Biological Laboratory

Effects of Estradiol and Progesterone on the

Reproduction of the Freshwater Crayfish
Cherax albidus
E. COCCIA1, E. DE LISA1, C. DI CRISTO1, A. DI COSMO2, AND M. PAOLUCCI1,*
1

Department of Biological and Environmental Sciences, Faculty of Sciences, University of Sannio,

Via PortArsa, 11-82100 Benevento, Italy; and 2Department of Structural and Functional Biology,
University of Naples Federico II, Via Cinthia, 80126 Napoli, Italy

Abstract. In this study we have investigated the role of

17-estradiol and progesterone in the reproduction of the
crayfish Cherax albidus by using vitellogenin (VTG) as a
biomarker. Early-vitellogenic (EV), full-vitellogenic (FV),
and non-vitellogenic (NV) females of Cherax albidus were
treated with 17-estradiol, progesterone, or both for 4
weeks. Levels of VTG mRNA in the hepatopancreas were
detected by RT-PCR. The PCR product was sequenced and
showed 97% homology with Cherax quadricarinatus VTG.
17-estradiol was more effective than progesterone and
17-estradiol plus progesterone in increasing the vitellogenin transcript in the hepatopancreas of EV and FV females.
On the contrary, progesterone was more effective than 17estradiol and 17-estradiol plus progesterone in increasing
the vitellogenin concentration in the hemolymph of EV and
FV females. Hepatopancreas histology and fatty acid composition of females injected with hormones showed major
modifications. No effects were registered in NV females. In
conclusion, 17-estradiol and progesterone influence VTG
synthesis, although our data indicate that they act through
different pathways and are not effective until the proper
hormonal environment is established, as demonstrated by
their inefficacy in NV females.

(Engelmann, 1994). Endocrine control of female reproduction is governed by a variety of hormonal and neuronal
factors that involve neuropeptide hormones, such as gonadstimulating hormone (GSH) and vitellogenesis-inhibiting
hormone (VIH); terpenoids, such as methyl farnesoate, a
stimulator of vitellogenesis; ketosteroids, such as ecdysteroids; and finally sex steroids such as estradiol and progesterone (Huberman, 2000; Zapata et al., 2003). Ecdysteroids are the primary hormonal factors of molting and
positively affect vitellogenesis also (Subramoniam, 2000).
Crustacean ecdysteroids are very polar molecules, and there
is no evidence for carrier proteins in the hemolymph. However, nucleotide sequences responsive to DNA binding domain (DBD) of steroid receptors have been found in the
DNA of Metapenaeus ensis, providing evidence that steroids, upon the binding to specific receptors, activate the
transcription of specific genes (Chan, 1998).
Vertebrate-type steroids have been reported to be present
in the hepatopancreas, ovary, and hemolymph of crustaceans, their levels changing in correlation with the oocyte
maturation cycle (Lafont and Mathieu, 2007 for review).
Indeed, a positive correlation between vitellogenin (VTG)
circulating levels and hemolymph levels of progesterone
and 17-estradiol have been reported for crabs (Shih, 1997;
Warrier et al., 2001; Zapata et al., 2003) and shrimps
(Quinitio et al., 1994; Yano, 2000). Moreover, the stimulatory effects of some vertebrate-type steroids such as 17estradiol and progesterone on ovarian growth in decapods
have been reported by several authors. In the crayfish Macrobrachium rosenbergii, 17-estradiol behaved as a metabolic activator at the cellular level, causing an increase in
mitochondrial ATP-ase, cytosolic malate dehydrogenase,
and glucose-6-phosphate dehydrogenase in the hepatopan-

Introduction
Reproductive physiology in crustaceans is highly controlled and regulated by the nervous and endocrine systems
Received 4 August 2009; accepted 17 November 2009.
* To whom correspondence should be addressed. E-mail:
paolucci@unisannio.it
Abbreviations: EV, early-vitellogenic; FV, full-vitellogenic; GSI, gonadosomatic index; NV, non-vitellogenic; VTG, vitellogenin.
36

STEROIDS IN CRAYFISH REPRODUCTION

creas (Ghosh and Ray, 1993a). In Procambarus clarkii,

17-estradiol and 17-hydroxyprogesterone produced a
significant increase in the gonadosomatic index, while only
the latter brought about a significant increase in oocyte
diameter (Rodriguez et al., 2002b). On the other hand,
17-hydroxyprogesterone, when administered in combination with methyl farnesoate, inhibited oocyte growth by
suppressing the stimulatory action of the methyl farnesoate
on the ovary of Procambarus clarkii (Rodriguez et al.,
2002a); and in Cherax quadricarinatus 17-hydroxyprogesterone administration failed to increase the number of
spawns during the reproductive period (Cahansky et al.,
2003). An endogenous origin for vertebrate-type steroid
hormones has been investigated through the presence of
steroidogenic enzymes. The activity of 17-hydroxysteroid
dehydrogenase, a key enzyme in steroid metabolism, has
been determined in the hepatopancreas and the ovary of
Macrobrachium rosenbergii. The enzyme activity was upregulated by 17-estradiol and thus was higher in the hepatopancreas of maturing females (Ghosh and Ray, 1993b).
Despite numerous reports on the occurrence of vertebrate-type steroid hormones in crustaceans, their exact
mode of action remains to be elucidated. The evidence
points to a physiological role for the vertebrate-type steroids
in crustaceans, which implies the presence of specific receptors. Immunological evidence has recently been reported
for progesterone receptors in the ovary and for both progesterone and estradiol receptors in the hepatopancreas of
the crayfish Austropotamobius pallipes (Paolucci et al.,
2002), suggesting dichotomous roles for these hormones in
vitellogenesis.
Among crustaceans there is evidence that vitellogenin is
synthesized in several tissues including the hepatopancreas
and the ovary itself (Shafir et al., 1992; Khayat et al., 1994;
Lee and Chang, 1999). In these animals, secondary vitellogenesis is accompanied by the accumulation of yolk, composed of lipids, carbohydrates, and proteins (Adiyodi and
Subramoniam, 1983; Charniaux-Cotton and Payen, 1988),
circulating in the hemolymph as VTG, a high-density lipoprotein (HDL) (Lee and Puppione, 1988; Komatsu et al.,
1993). The HDL called LPII in Cherax quadricarinatus is
specific for secondary vitellogenic females and contains
four polypeptides with masses between 80 and 208 kDa
(Abdu et al., 2000; Yehezkel et al., 2000). The lack of LPII
in the hemolymph of spawning females and in females that
are not in their reproductive season indicates that LPII may
be a useful marker of secondary vitellogenesis.
A complete VTG cDNA has been cloned in Cherax
quadricarinatus. The gene is expressed as a single transcript
and is present in the hepatopancreas of females during
secondary vitellogenesis (Abdu et al., 2002; Serrano-Pinto
et al., 2004); in intersex individuals it is negatively regulated by the androgenic gland, as demonstrated by the fact
that removal of these glands results in VTG transcription

37

(Abdu et al., 2002). However, the investigation of VTG

expression in both female and intersex crayfish reveals that
the gene is under a multifactorial regulation (Khalaila et al.,
2001). The X-organ-sinus gland (XO-SG) inhibits the VTG
gene, and its removal results in a partial recovery of VTG
synthesis in males and a total recovery in intersex individuals (Shechter et al., 2005). On the basis of these data, VTG
in crustaceans seems to be under a multifactorial regulation,
including vertebrate-like steroids, although with different
features according to species.
In this study we investigate the effect of the sex steroids
17-estradiol and progesterone on crayfish reproduction,
using VTG as a marker. We employed the genus Cherax
(spp.) as a crayfish model because of the advanced status of
knowledge about its VTG structure and synthesis.
Materials and Methods
Animals
Males and females of the crayfish Cherax albidus (Clark,
1936) were obtained from the Pilot Aquaculture Laboratory for Cherax spp. intensive farming, located in Siculiana
(Sicily, Italy), and transferred to our laboratory. Crayfish
were originally imported from Mulataga Aquaculture
(Perth, Western Australia, P.O. Box 343 Gosnells 6110), as
Cherax albidus, in April 2005, and were, according to the
European Community Law, in good health and disease-free
(Health Certificate n. 4436915). For the present study, animals were kept under natural photoperiod and the water
temperature was set at 20 C. Animals were fed a natural
diet ad libitum every second day. We utilized adult females
that had already spawned once and that were in different
stages of the reproductive cycle at the time of the study. The
stage of the reproductive cycle was defined on the basis of
the time of the year the animals were analyzed and on the
gonadosomatic index (GSI) and the oocyte diameter according to Sagi et al. (1996, 1999). Mean oocyte diameter
(SD) was calculated from a sample of 15 oocytes per
ovary. Females were defined as non-vitellogenic (NV) with
a GSI 0.21 0.05 and whitish oocytes with a diameter
0.5 0.1 mm; early-vitellogenic (EV) with a GSI 3.0
0.5 and yellow oocytes with a diameter 2.0 0.2 mm;
and full-vitellogenic (FV) with a GSI 5.0 0.5 and blue
oocytes with a diameter 2.5 0.3 mm. Adult males were
employed as negative controls. Crayfish body weight
ranged from 25 to 40 g.
Experimental design
On the basis of the stage of their reproductive cycle,
females were divided into three groups of 24 animals each:
Group one NV females; Group two EV females;
Group three FV females. Each group was separated into
the following treatments, with 6 crayfish in each treatment:

38

E. COCCIA ET AL.

Control, injected with saline solution for freshwater crayfish

(Van Harreveld, 1936); E treatment, injected with 17estradiol; P treatment, injected with progesterone; EP
treatment, injected with both steroid hormones.
Steroids were dissolved in ethanol and the obtained solutions were diluted in the saline solution to reach the final
concentration of 107 mol l1/crayfish, according to previous studies on crayfish (Rodriguez et al., 2002b). The steroids were injected in the abdominal muscle, in proximity to
the fifth pleopod, two times a week for 4 weeks. The
injection volume was 100 l. The same experimental design
was carried out on males, with only two animals per group.
At the end of the treatment, the animals were anesthetized
on ice, weighed, and sacrificed. First, the hemolymph was
extracted by a syringe from each animal, then transferred
into a glass tube with EDTA. The samples were centrifuged
at 10000 g for 1 h and were preserved at 80 C.
Subsequently, gonads and hepatopancreas were removed
from each animal. The hepatopancreas was divided into
three pieces: one treated for histological and immunohistochemical analysis; one placed in a solution of phosphate
buffer and protease inhibitor to evaluate the lipidic profile;
and one used for total RNA extraction. Ovaries were treated
for histological analysis. The following variables were measured: gonadosomatic index (GSI fresh weight of ovary/
whole crayfish 100); hepatosomatic index (HIS fresh
weight of hepatopancreas/whole crayfish 100); mean
oocyte diameter (MOD major diameter minor diameter/2).
Histological analysis
A piece of hepatopancreas and a piece of ovary for each
animal were fixed in Bouins solution for about 10 h,
dehydrated with ascending alcoholic series, cleared in xylene, and then embedded in paraffin wax. The sections were
cut to a thickness of 7 m and stained with hematoxylineosin.
Immunohistochemistry
For each animal, a piece of hepatopancreas was fixed in
formalin, dehydrated in ethanol, cleared in xylene, and
embedded in paraffin wax. Serial sections (7 m) were cut
and placed on silane-coated slides. The sections were processed by the immunoperoxidase method. Tissues were
deparaffinized, rehydrated, and then washed in 0.1 mol l1
phosphate buffer solution (PBS) at pH 7.4 for 15 min.
Endogenous peroxidase activity was blocked by incubation
for 30 min in a 0.3% hydrogen peroxide solution diluted in
methanol. After incubation with nonfat dry milk (Bio-Rad)
to reduce background staining, the sections were placed
overnight in a moist chamber at 4 C with anti-VTG primary antibody made against Cherax quadricarinatus (a
generous gift of Prof. Sagi, Ben Gurion University, Beer

Sheva, Israel) at an optimal dilution of 1:500. Afterward, the

sections were rinsed in several baths of PBS and incubated
for 1 h at room temperature with secondary antibodyantirabbit IgG conjugated with horseradish peroxidase (Pierce),
diluted 1:250. The peroxidase reaction was developed in a
solution of 3,3-diaminobenzidine tetrahydrochloride (Sigma
Chemical Co., St. Louis, MO) 0.015% w/v in TrisHCl 0.01
mol l1, pH 7.5, containing 0.03% hydrogen peroxide.
Slides were then dehydrated and mounted in Canada balsam
and examined using a Nikon Eclipse E600 microscope.
Controls were treated by the same methods except that the
primary antibody was omitted.
Fatty acid analysis
The hepatopancreas was homogenized in PBS and centrifuged at 14,000 g. The pellet was employed for fatty
acid analysis. Lipids were extracted following the two-step
method of Bligh and Dyer (1959). The fatty acid transesterification was accomplished using the protocol suggested
by Kramer et al. (1997). Lipid analyses were performed at
the Lipidomic laboratory of Lipinutragen srl (Bologna, Italy), a spin-off company of the Consiglio Nazionale delle
Ricerche, Bologna (Italy). Fatty acid methyl ester analysis
was carried out by gas chromatography on a Varian CP3800 gas chromatograph equipped with a flame ionization
detector and a Rtx-2330 column (90% biscyanopropyl-10%
phenylcyanopropyl polysiloxane capillary column; 60 m,
0.25 mm i.d., 0.20-m film thickness). Helium was the
carrier gas at the constant pressure of 29 psi. Oven temperature started from 160 C held for 55 min, followed by an
increase of 5 C/min up to 195 C, held for 10 min, followed
by a second increase of 10 C/min up to 250 C. Fatty acid
methyl ester values were identified by comparison with the
retention times of authentic samples (Ferreri et al., 2001,
2002).
RNA extraction and cDNA synthesis
Total RNA was isolated from the hepatopancreas using
SV Total RNA Isolation System (Promega). Reverse transcription was performed using 4 g of total RNA, oligo dT
primers and the ImProm-II Inverse Transcription System
(Promega).
PCR amplification
Oligonucleotide primers (VgForward-5AACGAGGAAGACGCTGTGG 3; VgReverse-5GGGTATCGCCGAATAAAGG 3) were designed on the cDNA sequence of the
Cherax quadricarinatus VTG reported by Abdu et al.
(2002) (GenBank Accession no. AF306784). PCR amplification was carried out in a Helix Thermal Cycler (DiaTech),
in a 20-l reaction using 1.25 units of Taq DNA Poly, 1
Taq DNA Poly Buffer, 1.5 mmol l1 MgCl2, 0.2 mmol l1

39

STEROIDS IN CRAYFISH REPRODUCTION

of each dNTP, 0.1 mol l1 of each primer, and 25 l of

template cDNA. PCR conditions consisted of denaturation
at 95 C for 5 min, followed by 35 cycles of denaturation at
94 C for 30 s, annealing at 58 C for 30 s, and extension at
72 C for 1 min. A final elongation step was performed at 72
C for 10 min. The PCR product was separated by 1%
agarose gel electrophoresis with ethidium bromide and visualized with Chemidoc UV transilluminator (BioRad).
cDNA cloning and nucleotide sequencing
The PCR fragment was purified using a QIAquick gel
extraction (Qiagen). The PCR fragment (900-bp long) was
cloned into a pGEM-T Easy Vector (Promega) to transform
Escherichia coli (strain DH-5) using standard methods.
Clones containing the PCR insert were isolated and the
plasmid DNA was purified using a QIAprep Spin Miniprep
kit (Qiagen). The nucleotide sequence was carried out by
PRIMM srl.
Real-Time RT-PCR
The amount of VTG mRNA was determined with realtime RT-PCR to estimate the effects of the hormonal treatments on the VTG expression in the hepatopancreas. Preliminary cDNA synthesis was performed as previously
described. The VTG transcript was quantitatively analyzed
and normalized using both VTG sense (5-TTTTGGTGAAGGCTACGC-3) and antisense (5-TCTTGCAGCTGTTCCAGT-3) primers and adding to the PCR reaction an
additional pair of primers amplifying a fragment of -actin
cDNA as a housekeeping gene. The additional primers
(sense: 5-GGTCGGTATGGGTCAGAAG-3; antisense:
5-GTGGTGGTGAAGGAGTAGCC-3) were designed
based on the Cherax quadricarinatus -actin cDNA sequence reported in the GenBank database (Martnez-Perez
et al., 2005) (GenBank Accession no. AY430093). Realtime reactions were carried out on an ABI 7300 Real-Time
PCR System (Applied Biosystem, Foster City, CA) using
SYBR Green I dye. The real-time PCR mix contained 12.5
l of 2 Brilliant SYBR Green QPCR Master Mix (Stratagene), 0.1 mol l1 upstream and 0.1 mol l1 downstream primers, and 50 ng of template DNA in a 25-l final
volume. The system was initially incubated at 95 C for 10
min for the initial AmpliTaq enzyme activation, followed
by 40 cycles of denaturation at 95 C for 30 s, annealing at
58 C for 1 min, and extension at 72 C for 1 min. A final
elongation step was performed at 72 C for 10 min.
Each reaction was run in triplicate. Accurate amplification of the target amplicon was checked by performing a
melting curve. Data were analyzed according to the relative
quantification method. All the statistical analyses were performed using GraphPad.

SDS-PAGE and Western blotting

Electrophoretic analysis was performed according to the
Laemmli method (Laemmli, 1970) using a marker of known
molecular weight (Color Burst, Sigma). Samples were resuspended in 0.125 mol l1 Tris-HCl (pH 6.8) containing
2% SDS, 10% glycerol, 0.02% bromophenol blue, and 5%
-mercaptoethanol; boiled for 2 min; and loaded into the
wells of a 7.5% denaturing SDS-polyacrylamide gel. After
the run the gel was electroblotted onto nitrocellulose filter
(Millipore). The filter was blocked for 1 h with a solution
containing 0.1% Tween-20 in PBS and 5% BSA and then
incubated for 1 h with anti-VTG primary antibody (kindly
provided by Prof. Sagi) diluted 1:5000 in 1% PBS-TweenBSA. Subsequently, the filter was washed five times with
PBS-Tween and incubated for 1 h with the secondary antibody, anti-rabbit IgG conjugated with horseradish peroxidase (Pierce), diluted 1:10000 in 1% PBS-Tween-BSA.
After five washings with PBS-Tween, the filter was developed using Super Signal West-Pico Chemiluminescent Substrate kit (Pierce) reagents, and the bands were visualized
with Chemidoc (Biorad).
Total protein concentration
Total protein concentration was determined with the
Bradford method (Sigma) using bovine serum albumin
(BSA) as standard.
Statistical analysis
Values were expressed as mean standard error (S.E.).
Data were analyzed by one-way analysis of variance
(ANOVA), and any significant difference was determined at
the 0.05 level by Duncans multiple range test. The analyses
were carried out with the Statistica statistical package, ver.
7.0 (Statsoft Inc., Tulsa, OK).
Results
Histology of hepatopancreas
In decapods, the hepatopancreas is a bilobed brown and
yellowish organ that occupies much of the cephalothoracic
cavity. It is formed of a mass of blind tubules. Tubules
consist of a cylindrical epithelial layer, which constitutes the
glandular epithelium, surrounded by a basal lamina of connective tissue. Each tubule is differentiated into three zones:
the distal and medial zones of the tubules delimit an irregular and narrow lumen and constitute the cortical region of
the gland, while the proximal zones form the medullar
region and delimit an ample tubular (Vogt, 1994). In Cherax
albidus, as in other decapods, the hepatopancreas was composed by tubules lined by a single-layered epithelium. Figure 1 shows the histological section of a typical mid-region
of hepatopancreatic tubules of NV, EV, and FV females. In

40

E. COCCIA ET AL.

Figure 1. Histology of the hepatopancreas of early-vitellogenic females (A control; B animal injected

with 17-estradiol; C animal injected with progesterone) and full-vitellogenic females (D control; E
animal injected with 17-estradiol; F animal injected with progesterone). Scale bars 35 m (A, D, E, F)
and 20 m (B, C).

untreated NV female the tubules were characterized by

cylindrical epithelial cells with the nucleus basally located
and numerous vacuoles in the apical zone. The lumen of the
tubules was narrow. The hepatopancreas histology of females injected with 17-estradiol (E), progesterone (P), and
both hormones (EP) did not show any changes when
compared to the control. In untreated EV females the tubules appeared similar to those of untreated NV females.
The treatment with E caused an enlargement of the lumen of
the tubules with a consequent compression of the epithelial
cells, which formed a thin layer. The lumen of the tubules
was occupied by abundant secretions. The treatment with P
and EP caused an increase of the vacuoles present in the
cylindrical epithelial cells, while the tubule lumen size was
unaffected (Fig. 1AC). In untreated FV females the cylindrical epithelial cells appeared swollen and were occupied
by voluminous vacuoles. After steroid treatment the epithelial cells appeared engorged with large vacuoles, the tubular
walls appeared brittle, and the whole tissue appeared to be
rather loose (Fig.1DF).
Vitellogenin immunolocalization in the hepatopancreas
To determine the possible relationship between the stages
of females and the presence of VTG in the vacuoles of
epithelial cells of the hepatopancreas, we employed an
antibody generated against Cherax quadricarinatus vitellogenin. No VTG immunoreactivity was present in NV
females or in males (not shown). In EV females (Fig. 2A)

VTG immunoreactivity was present in the vacuoles of some

epithelial cells.
Fatty acid composition of hepatopancreas membranes
To investigate the cause of the crumbling of the tubule
walls of the hepatopancreas of the FV females treated with
hormones, we analyzed the fatty acid composition of the
cell membranes. Results are shown in Table 1. Data represent the relative percentages of peaks observed in the GC
analysis. Peaks correspond to the more representative 13
fatty acids, and their sum was set to 100. The relative
percentages indicate approximately the weight of every
fatty acid that constitutes the phospholipids of the cellular
membrane. The comparison of the data highlights possible
changes in the metabolism and, consequently, in the type
and percentages of the fatty acids in the cellular membrane.
Palmitic was the most abundant among saturated fatty
acids (SFA); oleic was the most abundant among the monounsaturated fatty acids (MUFA); and linoleic, eicosapentanoic acid (EPA), and docosahexanoic acid (DHA) were
the most abundant among polyunsaturated fatty acids
(PUFA). When treated FV females were compared with
untreated FV controls, palmitic acid showed a statistically
significant increase with E treatment, oleic showed a statistically significant decrease with P and EP treatment, linoleic acid showed a statistically significant increase with P
treatment, EPA showed a statistically significant increase
with EP treatment, and DHA showed a statistically sig-

41

STEROIDS IN CRAYFISH REPRODUCTION

PCR experiments. Samples were always run in triplicate,

and the analysis of the dissociation curves from both experimental and -actin control samples revealed a single melting peak, indicating a specific signal for both transcripts. In
all negative control samples, no amplification of the fluorescent signal was detected. The quantitative analysis of
VTG gene expression was relative to the VTG mRNA level
in controls that was set as a reference value of one. The
VTG mRNA results for EV females treated with hormones
are as follows: when injected with E, the average increase
was 1.8-fold, corresponding to a percentage increase of 80%
5.2%, which was statistically significant; when injected
with P, the average increase was 1.67-fold, corresponding to
an increase of 68% 3.4%, which was statistically significant; when injected with both steroids, the average increase
was 1.15-fold, corresponding to an increase of 10%
2.3%, which was not statistically significant. For FV females, treatment with E produced an average VTG mRNA
increase of 1.32-fold, corresponding to a percentage increase of 35% 4.2%; treatment with P induced an average
increase of 1.25-fold, corresponding to an increase of 22%
1.8%; injection with both steroids showed an average
increase of 1.22-fold, corresponding to an increase of 24%
2% (Fig. 4). The VTG increase in FV females was thus
not statistically significant with respect to the control. Finally, in NV females and males, hormonal treatment did not
cause any increase in VTG mRNA (data not shown).
VTG in the hemolymph

Figure 2. Vitellogenin immunoreactivity in the hepatopancreas of

early-vitellogenic females (A). (B) control. Scale bar 35 m (A, B).

nificant decrease with E treatment. Total SFA were higher

in E- and EP-treated females, while total PUFA and
MUFA were lower in E- treated females.
VTG cDNA sequencing
The nucleotide sequence of the PCR fragment obtained
by amplification of the cDNA derived from the hepatopancreas of the vitellogenic females was compared to VTG
sequences deposited in GenBank. The result reported in
Figure 3 shows that our cDNA fragment (GenBank Accession no. GQ420689) shared 97% identity with the Cherax
quadricarinatus vitellogenin mRNA (GenBank Accession
no. AF306784).
VTG levels in the hepatopancreas
To ascertain the effect of steroids on the expression of
VTG, RNA from hepatopancreas of both untreated and
treated animals was employed as a template in real-time

The antibody generated against the Cherax quadricarinatus yolk polypeptide of 106 kDa crossreacted with an
immunoreactive band of about 80 kDa in the hemolymph of
Cherax albidus EV (Fig. 5) and FV (Fig. 6) females. In both
cases, treatment with steroids increased the intensity of the
immunoreactive band. This increase was mainly evident in
females injected with progesterone. The immunoreactive
band was not present in the hemolymph of NV females and
untreated males, which were used as a negative control (data
not shown).
Discussion
In this study the effects of 17-estradiol and progesterone
on the reproduction of the freshwater crayfish Cherax albidus are reported. Vitellogenin (VTG) as a marker of reproduction is widely employed in both vertebrates and invertebrates (Sumpter and Jobling, 1995; Marin and Matozzo,
2004). The use of VTG as a marker of endocrine disruption
has revealed itself to be particularly useful (Hutchinson and
Pickford, 2002; Rotchell and Ostrander, 2003; Porte et al.,
2006, for review). Moreover, progesterone or its metabolites seems to induce VTG synthesis in some invertebrates,
although the effects are not entirely clear. A direct stimulatory effect of 17-hydroxyprogesterone on VTG produc-

42

E. COCCIA ET AL.
Table 1

Fatty acid composition of the hepatopancreas membranes of full-vitellogenic Cherax albidus females injected with steroids 17-estradiol (E2),
progesterone (P), 17-estradiol plus progesterone (E2P), and females injected with saline solution (control)
Fatty acids

Control

E2

E2P

16:0 (palmitic acid)

16:1 (palmitoleic acid)
18:0 (stearic acid)
9-trans 18:1 (elaidic acid)
9-cis 18:1 (oleic acid)
11-cis 18:1 (vaccenic acid)
18:2 (linoleic acid)
20:2 (eicosadienoic acid)
20:3 (dihomo--linolenic acid)
20:4n-6 (arachidonic acid)
Trans 20:4 (trans-arachidonic acid)
20:5n-3 (EPA)
22:6n-3 (DHA)
Total PUFA
Total MUFAPUFA
Total SFA

20.37 1.15a
6.96 0.60
4.96 0.52
0.18 0.02
27.69 1.10a
5.03 0.53
19.21 1.12a
0.85 0.08
0.17 0.01
1.17 0.10
0.18 0.03
7.14 0.80a
5.48 0.52a
34.02 0.38a
21.99 0.47a
12.67 0.83a

23.37 1.18b
7.09 1.09
6.00 0.63
0.09 0.02
27.07 1.14a
4.62 0.49
18.53 1.15a
0.88 0.03
0.13 0.01
1.30 0.09
0.17 0.02
6.25 0.79a
3.79 0.38b
30.88 0.35b
20.29 0.51b
14.68 0.90b

20.71 1.14a
6.99 1.07
4.93 0.52
0.13 0.01
25.83 1.18b
4.11 0.43
20.98 1.21b
0.79 0.01
0.15 0.2
1.01 0.93
0.16 0.01
8.16 0.71a
5.47 0.60a
36.56 0.52c
22.91 0.57c
12.82 0.83a

20.29 1.16a
5.63 0.70
6.06 0.79
0.07 0.03
25.15 1.15b
4.15 0.47
19.95 1.18a
0.86 0.02
0.10 0.01
1.63 0.95
0.14 0.02
9.31 0.88b
6.15 0.61a
38.00 0.53c
23.37 0.56c
13.17 0.98a

Values are reported as relative percentage of peaks with the total sum of peaks set at 100%. Each examination was carried out on three animals; table
values are the mean standard error. Values were analyzed by factorial ANOVA. Values in the same row with different letters are significantly different
(P 0.05). EPA eicosapentanoic acid; DHA, docosahexanoic acid; SFA saturated fatty acids; MUFAmonounsaturated fatty acids; PUFA
polyunsaturated fatty acids.

tion has been suggested in the red swamp crayfish Procambarus clarkii (Rodriguez et al., 2002b), and Reddy et al.
(2006) demonstrated that this hormone induced ovarian
growth and ovarian VTG synthesis in the freshwater crab
Oziotelphusa senex senex. This study shows that in vivo
treatment with 17-estradiol and progesterone, alone or in
combination, brought about an increase in VTG mRNA in
early-vitellogenic (EV) females and, although to a lesser
extent, in full-vitellogenic (FV) females of the crayfish
Cherax albidus. 17-estradiol seemed to be more effective
than progesterone on VTG mRNA synthesis in the hepatopancreas, in agreement with Yano (2000) and Yano and
Hoshino (2006) who suggest that in penaeids 17-estradiol
could be the actual hormone that stimulated VTG production, using progesterone as a precursor. Hepatopancreas
explants of the shrimp Metapenaeus ensis incubated in vitro
with steroid hormones demonstrated that both 17-estradiol
and progesterone stimulated VTG gene expression, although 17-estradiol was more effective (Tiu et al., 2006).
In our study both 17-estradiol and progesterone stimulated
VTG mRNA synthesis, although at different rates; and the
treatment with 17-estradiol plus progesterone did not show
any additive effect on mRNA VTG transcription, proving
that these steroids do not act in synergy, at least in the doses
employed here. Although hemolymph levels of 17-estradiol and progesterone have not been detected in crayfish, the
dose employed here falls within the physiological concentrations reported for both hormones in the hemolymph of
the mud crab Scylla serrata (Warrier et al., 2001) and the

prawn Marsupenaeus japonicus (Okumura and Sakiyama,

2004). It seems that in Cherax albidus 17-estradiol and
progesterone act differently on VTG regulation. Moreover,
dichotomous roles for these hormones in vitellogenesis have
been hypothesized for the red mud crab Scylla serrata, in
which maximum levels of 17-estradiol were found in the
hepatopancreas but the highest concentration of progesterone was detected in the ovary (Warrier et al., 2001).
A strong correlation between estrogens and expression of
the heat shock protein HSP90 in the shrimp Metapenaeus
ensis indicates that the expression of VTG may be under the
regulation of estrogen hormones through a mechanism similar to that in vertebrates (Wu and Chu, 2008). However, the
presence of an estrogen receptor gene in crustaceans is still
controversial. Estrogen receptors have not been reported in
crustaceans, although nuclear receptors sharing high similarity with estrogen receptors have been identified in Drosophila (Maglich et al., 2001); and specific androgen binding sites but no estrogen binding sites have been found
in the amphipod Hyalella azteca (reviewed in Koheler et al.,
2007).
In this study, the effect of steroid treatment was blunted
during the full vitellogenesis period in comparison to the
early vitellogenesis period. This phenomenon may be
ascribable to the higher rate of VTG expression in FV
females that were therefore less responsive to steroid stimulation than EV females. In contrast, neither VTG mRNA
nor circulating VTG in the hemolymph were detected in NV
females of Cherax albidus treated with sex steroids. These

43

STEROIDS IN CRAYFISH REPRODUCTION

Cherax quadricarinatus AGATGCAACAATGACTTTCCGTGTGATTAACGAGGAAGACGCTGTGGTGGACATAGCTGG
Cherax albidus
CGACGCCATGGCGGCTCTCCGTTTGATTAACGAGGAAGACGCTGTGGTGGACATAGCTGG
** ** *
* ** ***** *************************************
Cherax quadricarinatus TGTGATGGGGCCAGAAAAAGATCCTGAGTGTAACGGCGTCAACATCAAGGGTGTGGCTTA
Cherax albidus
TGTGATGGGACCAGAAAAAGATCCTGAGTGTAACGGCGTCAACATCAAGGCTGTGGCTTA
********* **************************************** *********
Cherax quadricarinatus CGCTTCTCCCATCGGAAGTTATGATATTCGCTCCAAACTTTGTAGACCATTCTTCTTCGA
Cherax albidus
CACTTCTCCACTCGGAAGTTATGACATTCGCTCCAAACTTTGTAGACCATTCTTCTTCGA
* ******* ************* ***********************************
Cherax quadricarinatus ACTGATTTCGAAGAAACAAGAAAGTCAAAAGGAATTCATAACGAAACTTGGCCTGCAATG
Cherax albidus
AATGATTACGAAGAAACAAGAAAGTCAAAAGGAATTCATAACGAAACTTGGCCTGCAATG
* ***** ****************************************************
Cherax quadricarinatus TCCGAACAGAGCTGAGATTAGCTTATCGGAAAGTAACCTGGATCAACCGTGGAGAAACGC
Cherax albidus
TCCGAACAGAGCTGAGATTAGCTTATCGGAAAGTAACCTGGATCAACCGTTTAGAAACGC
************************************************** ********
Cherax quadricarinatus AATAGCAATGGCCCGTGACAAACTTCCCTCTCCTACTGTTGCTGAAGTTCACTTCGTTTA
Cherax albidus
AATAGCAATGGCCCGTGACAAACTTCCATCTCCTACTGTTGCTGAAGTTCACTTCGTTTA
*************************** ********************************
Cherax quadricarinatus CGAATCTGAAAATATGCACACGGTGAAGGGCGCTTTGAAGGAAGACTGGCAGAGAGTGAT
Cherax albidus
CGAATCTGAAAATATGCACACGGTGAAGGGCGCTTTGAAGGAAGACTGGCAGATGGTGAT
***************************************************** *****
Cherax quadricarinatus GGAGTCTGCTCACTCATGGGCTGACAGTGTGTCTAGATATCTGGAGGAACAAGCACAGCA
Cherax albidus
GGAGTCTGCTCACTCATGGGCTGACAGTGTGTCTAGATATCTGGAGGAACAAGCACAGCA
************************************************************
Cherax quadricarinatus ACAAGGCACTACCTTCCCTAACCCAGAGATCGAAACACTTCTCGAAGAAGTCAAACATGA
Cherax albidus
ACAAGGCACTACCTTCCCTAACCCAGAGATCGAAACACTTATGGAAGAAGTCAAACATGA
**************************************** * *****************
Cherax quadricarinatus TCTTAGGGAAATATATCATGATCTGATTTATAAAGAAATCATCCCACATTATGAGGCTTT
Cherax albidus
TCTTAGGGAAATATATCATGATCTGATTTATAAAGAAATCATCCCTCATTATGAGGCTTT
********************************************* **************
Cherax quadricarinatus CCGTGAATTCCTAAGGCGTCCGCCAGCTTCGTACGTTATACAATTTTCTTCAAGCATCCT
Cherax albidus
CCGTGAATTCCTAAGGCGTCCGCCAGCTTCGTACGTTATACACTTTTCTTCAAGCATCCT
****************************************** *****************
Cherax quadricarinatus CTCAGGTATAGCCAAGATACAGAGAGACCTAAGAAGTCGTCTTCTCCATGAGGTTCTAGC
Cherax albidus
CTCAGGTATAGCCAAGATACAGAGAGACCTTAGAAGTCGTCTTCTCCATGAGGTTCTAGC
****************************** *****************************
Cherax quadricarinatus TTGGCAAGAAGAATTTAAGGATATCACAGAGCGCATCATTGAACTTTTGGTGAAGGCTAC
Cherax albidus
TTGGCAAGAAGAGTTTAAGGATATCACAGAGGGCATCATTGAATTTTTGGTGAAGGCTAC
************ ****************** *********** ****************
Cherax quadricarinatus GCGTTGGGTGGAGACCGGTGAGATTCCAGAGCCAGTGCGTCGCCTACTGGAACAGCTGCA
Cherax albidus
GCATTGTGTGGAGACCGGTGAGATTCCAGAGCCAGTGCGTCGCCTACTGGAACAGCTGCA
** *** *****************************************************
Cherax quadricarinatus AGAAACTAGGATCTTCAGAATGTTTAAGAGGGACGTCGACGCCTTTATTCGGCGATACCC
Cherax albidus
AGAAACTAGGATCTTCAGAATGTTTAAGAGGGACGTCGACGCCTTTATTCAGCAATACCC
************************************************** ** ******

5789
60
5849
120
5909
180
5969
240
6029
300
6089
360
6149
420
6209
480
6269
540
6329
600
6389
660
6449
720
6509
780
6569
840
6629
900

Figure 3. Alignment of the nucleotide sequence obteined by PCR amplification of a VTG mRNA fragment
in Cherax albidus (GenBank Accession no. GQ420689) with the VTG mRNA sequence of the crayfish Cherax
quadricarinatus (GenBank Accession no. AF306784). The alignment was done using the CLUSTAL W method.
The numbers on the right refer to the nucleotide sequences and the asterisk stands for conserved nucleotides.

results are consistent with those reported by Tsukimura

(2001) for the ridgeback shrimp Sicyonia ingentis, in which
sexually quiescent females treated with progesterone, 17hydroxyprogesterone, and 17-estradiol did not show increased levels of yolk protein precursor in the hemolymph.
One possible explanation the author advanced for these
results is that the endocrine environment of NV females
probably involves high levels of gonadotropin inhibiting
hormone, causing the animals to be unresponsive to vertebrate-like steroids. According to our data we can extend and
deepen these observations by suggesting that neither progesterone nor 17-estradiol affects VTG synthesis in
Cherax albidus females in a sexual quiescent phase.
The localization of the VTG mRNA in the hepatopancreas of Cherax albidus confirms what has already been
shown in other crayfish, that exogenous VTG synthesis
occurs in the hepatopancreas. The site of VTG synthesis in
crustaceans has been established in many species. The ovary

(Lui et al., 1974; Lui and OConnor, 1976, 1977; EastmanReks and Fingerman, 1985; Yano and Chinzei, 1987;
Rankin et al., 1989; Browdy et al., 1990), hepatopancreas
(Paulus and Laufer, 1987; Lee and Watson, 1995), or adipose tissue (Tom et al., 1987) have been proposed as organs
of VTG synthesis in decapod crustaceans. Hepatopancreas
was suggested as the main synthetic site of this protein in
the freshwater crayfish Macrobrachium rosenbergii (Lee
and Chang, 1999; Chen et al., 1999) and Macrobrachium
nipponense (Han et al., 1994). The presence of the VTG
mRNA in the hepatopancreas of Cherax albidus represents
further evidence that this organ is the synthetic site of VTG.
In addition to the effect of steroids on VTG transcription,
we also analyzed VTG presence in the hemolymph. We
employed antibodies generated against a Cherax quadricarinatus egg yolk polypeptide of about 106 kDa. In the
hemolymph of Cherax albidus the antibodies against the
106-kDa polypeptide crossreacted with a polypeptide that

44

E. COCCIA ET AL.

Figure 4. Effect of steroids on the expression of VTG mRNA in the

hepatopancreas of Cherax albidus. On the ordinate axis are reported the
levels of VTG mRNA expressed as value standard error relative to the
control, which is set to one. On the abscissa axis are indicated the injected
hormones (C saline solution; E2 17-estradiol; P progesterone).
The white bars refer to the results obtained in EV females, while the
hatched bars refer to the results obtained in FV females. Statistical analyses
have been done on at least six experiments, in triplicate, for each measurement. The asterisks indicate statistically significant values.

appeared as a band of about 80 kDa (present data). The

difference in molecular weight may reflect the high variability of polypeptides generated by the proteolytic cleavage
of VTG when analyzed under denaturing conditions. Although it appears that the VTG gene organization and
expression pattern in decapods is highly conserved (Tiu et
al., 2009), a vast array of VTG subunits of different molec-

Figure 5. Upper panel: western blotting analysis carried out on EV

females. Lower panel: densitometric analysis of the immunoreactive bands.
Each value represents the mean standard error of six independent
experiments. The asterisk indicates statistically significant value. (C
control; E2 animals injected with 17-estradiol; P animals injected
with progesterone; E2P animals injected with 17-estradiol and progesterone).

Figure 6. Upper panel: western blotting analysis carried out on FV

females. Lower panel: densitometric analysis of the immunoreactive bands.
Each value represents the mean standard error of six independent
experiments. The asterisk indicates statistical significant value. (C
control; E2 animals injected with 17-estradiol; P animals injected
with progesterone; E2P animals injected with 17-estradiol and progesterone).

ular weight has been reported (Tsang et al., 2003; Kung et

al., 2004; Serrano-Pinto et al., 2004; Mak et al., 2005; Tiu
et al., 2006). The 80-kDa band of Cherax albidus crossreacted with the antibodies against the 106-kDa polypeptide
corresponding to the molecular weight of one of the four
VTG proteins that Yehezkel et al. (2000) considered specific to secondary-vitellogenic females. The absence of the
80-kDa band in both the male and intersex (data not shown)
of Cherax albidus strongly sustains its validity as a marker
of vitellogenesis in this species. The treatment with sex
steroids caused an increase in the intensity of the 80-kDa
band that was particularly evident in the hemolymph of
vitellogenic females treated with progesterone. In progesterone-treated females in early vitellogenesis, progesterone
brought about a 2-fold increase in the optical density of the
80-kDa band with respect to the control, while in the FV
females there was a 3-fold increase. This result is in conflict
with the effect of sex steroids on VTG mRNA levels in the
hepatopancreas, where 17-estradiol was more effective
than progesterone. This result may indicate different VTG
regulation at the level of gene transcription and protein
translation. RNA metabolism regulation involves an emerging class of proteinsthe RNA binding proteins (Burd and
Dreyfuss, 1994; Mattaj, 1993)that appear to play critical
roles in mRNA splicing (Hodgkin, 1989; Dreyfuss et al.,
1993), nuclear export (Maquat, 1991), translation (Kozak,
1992; Melefors and Hentze, 1993), stabilization and degradation (Nielsen and Shapiro, 1990a; Sachs, 1993). The
control of mRNA stability and degradation represents a
crucial step in the coupling (or uncoupling) of gene tran-

45

STEROIDS IN CRAYFISH REPRODUCTION

scription and protein production. An increasing number of

molecules have been shown to regulate RNA stability, including steroid hormones (Brock and Shapiro, 1983; Noteborn et al., 1986; Paek and Axel, 1987; Nielsen and Shapiro, 1990b). Dodson et al. (1995) identified, in Xenopus
laevis liver, a protein that binds, in a specific manner, a
segment of the 3-untranslated region (3-UTR) of VTG
mRNA. This protein is induced by 17-estradiol and mediates stabilization of VTG transcript. It can be hypothesized that, in Cherax albidus, progesterone induces an increase of VTG synthesis while 17-estradiol induces an
increase of gene transcription and/or stabilizes immature
mRNA, regulating its translation. In this way 17-estradiol
may avoid a sudden impoverishment of the whole VTG
mRNA pool.
In this study, 17-estradiol and progesterone treatment
modified the hepatopancreas morphology of EV and FV
females. In contrast, NV females did not show any difference between the control and steroid-treated females, a
result consistent with the unresponsiveness of NV females
to steroid stimulation in this phase of the reproductive cycle.
In EV and FV females the histological analysis of the
hepatopancreas highlighted that an increase in the size of
the cells in females treated with steroids was mainly due to
large vacuoles probably occupied in vivo by lipids. The
immunohistochemistry of vitellogenic females showed that
the content of some, but not all, vacuoles crossreacted with
antibodies against Cherax quadricarinatus VTG.
In FV females treated with steroids the hepatopancreas
tubular walls were fragmented and brittle in appearance.
Since SFA reduce the permeability and fluidity of membranes and promote their stiffening while PUFA maintain
permeability and fluidity (Vance and Vance, 2002), we
analyzed hepatopancreas membrane fatty acid composition
in control and treated females to get an insight into the
possible causes of membrane fragility. We found that 17estradiol treatment caused an increase in SFA and a decrease in PUFA and MUFA, which might explain the membrane fragility. On the other hand, progesterone treatment
increased both MUFA and PUFA, which does not provide
any satisfactory explanation for the membrane fragility.
However, we should keep in mind that the paucity of data
available in the literature does not allow the formulation of
any hypothesis, and that although the effects of 17-estradiol on lipid biosynthesis have been reported, these are not
directly related to reproduction (Smith et al., 1978; Canesi
et al., 2007; Sharpe and MacLatchy, 2007).
In conclusion, in this study we have monitored how the
administration of 17-estradiol and progesterone affects the
reproduction of the crayfish Cherax albidus. We evaluated
the effects mainly in terms of changes in VTG expression in
the hepatopancreas and VTG concentration in the hemolymph in relation to the phase of the reproductive cycle.
Both sex steroids caused an increase in VTG expression and

concentration, although their effects were not cumulative

and depended on the phase of the reproductive cycle. The
emerging picture is one of great complexity due to the high
variability of actions ascribable to the so-called vertebrate
sex steroids. In support of this view, the ample literature
available along with this study requires a deep investigation
into the molecular mechanisms underlying sex steroid regulation of VTG in invertebrates.
Acknowledgments
This research was supported by the Camera di Commercio di Benevento and the Regione Siciliana, Assessorato
Agricoltura e Foreste grants to Professoressa Marina Paolucci. We thank Sig. Dario DArgenio for his technical
assistance and Dr. Carla Ferreri for assistance in lipid analysis.
Literature Cited
Abdu, U., G. Yehezkel, and A. Sagi. 2000. Oocyte development and
polypeptide dynamics during ovarian maturation in the red-claw crayfish Cherax quadricarinatus. Invertebr. Reprod. Dev. 37: 75 83.
Abdu, U., C. Davis, I. Khalaila, and A. Sagi. 2002. The vitellogenin
cDNA of Cherax quadricarinatus encodes a lipovitellin with calcium
binding ability, and its expression is induced following the removal of
the androgenic gland in a sexually plastic system. Gen. Comp. Endocrinol. 127: 263272.
Adiyodi, R. G., and T. Subramoniam. 1983. Arthropoda-Crustacea.
Pp. 443 495 in Reproductive Biology of Invertebrates, Oogenesis,
Oviposition and Oosorption, K. G. Adiyodi and R. G. Adiyodi, eds.
Wiley, New York.
Bligh, E. G., and W. J. Dyer. 1959. A rapid method of total lipid
extraction and purification. Can. J. Biochem. Physiol. 37: 911917.
Brock, M. L., and D. J. Shapiro. 1983. Estrogen stabilizes vitellogenina
mRNA against cytoplasmic degradation. Cell 34: 207214.
Browdy, C. L., M. Fainzilber, M. Tom, Y. Loya, and E. Lubzens. 1990.
Vitellin synthesis in relation to oogenesis in in vitro-incubated ovaries
of Penaeus semisulcatus (Crustacea, Decapoda, Penaeidae). J. Exp.
Zool. 255: 205215.
Burd, C. G., and G. Dreyfuss. 1994. Conserved structures and diversity
of functions of RNA-binding proteins. Science 265: 615 621.
Cahansky, A. V., L. S. Lopez Greco, and E. M. Rodrguez. 2003.
Incremento de la produccion de hembras ovgeras de la Langosta de
Agua Dulce (Cherax quadricarinatus) durante el perodo reproductivo,
mediante la administracion de hormonas y neuroreguladores. II Congreso Iberoamericano Virtual de Acuicultura (CIVA 2003), 512517.
Canesi, L., C. Borghi, R. Fabbri, C. Ciacci, L. C. Lorusso, G. Gallo,
and L. Vergani. 2007. Effects of 17-estradiol on mussel digestive
gland. Gen. Comp. Endocrinol. 153: 40 46.
Chan, S. M. 1998. Cloning of a shrimp (Metapanaeus ensis) cDNA
encoding a nuclear receptor superfamily member: an insect homologue
of E75 gene. FEBS Lett. 436: 395 400.
Charniaux-Cotton, H., and G. Payen. 1988. Crustacean reproduction.
Pp. 279 303 in Endocrinology of Selected Invertebrate Types, H.
Laufer, and R. G. H. Downer, eds. Alan R. Liss. New York.
Chen, Y. N., D. Y. Tseng, P. Y. Ho, and C. M. Kuo. 1999. Site of
vitellogenin synthesis determined from cDNA encoding a vitellogenin
fragment in the freshwater prawn Macrobrachium rosenbergii. Mol.
Reprod. Dev. 54: 215222.
Dodson, R. E., M. R. Acena, and D. J. Shapiro. 1995. Tissue distribution, hormone regulation and evidence for a human homologue of the

46

E. COCCIA ET AL.

estrogen-inducible Xenopus laevis vitellogenin mRNA binding protein.

J. Steroid Biochem. Mol. Biol. 52: 505515.
Dreyfuss, G., M. J. Matunis, S. Pinol-Roma, and C. G. Burd. 1993.
hnRNP proteins and the biogenesis of mRNA. Annu. Rev. Biochem. 62:
289 321.
Eastman-Reks, S., and M. Fingerman. 1985. In vitro synthesis of
vitellin by the ovary of the fiddler crab, Uca pugilator. J. Exp. Zool.
233: 111116.
Engelmann, F. 1994. Invertebrates: hormone-regulated gonadal activity.
Pp. 36 40 in Prospective in Comparative Endocrinology, K. G.
Davey, R. E. Peter, and S. S. Tobe, eds. National Research Council of
Canada, Ottawa, ON.
Ferreri, C., C. Costantino, L. Perrotta, L. Landi, Q. G. Mulazzani, and
C. Chatgilialoglu. 2001. Cis-trans isomerization of polyunsaturated
fatty acid residues in phospholipids catalyzed by thiyl radicals. J. Am.
Chem. Soc. 123: 4459 4468.
Ferreri, C., M. R. Faraone-Mennella, C. Formisano, L. Landi, and C.
Chatgilialoglu. 2002. Arachidonate geometrical isomers generated
by thiyl radicals: the relationship with trans lipids detected in biological
samples. Free Radic. Biol. Med. 33: 1516 1526.
Ghosh, D., and A. K. Ray. 1993a. Subcellular action of estradiol-17 in
a freshwater prawn, Macrobrachium rosenbergii. Gen. Comp. Endocrinol. 90: 274 281.
Ghosh, D., and A. K. Ray. 1993b. 17-hydroxysteroid dehydrogenase
activity of ovary and hepatopancreas of freshwater prawn, Macrobrachium rosenbergii: relation to ovarian condition and estrogen treatment. Gen. Comp. Endocrinol. 89: 248 254.
Han, C. H, T. Okumura, Y. Suzuki, K. Aida, and I. Hanyu. 1994.
Immunocytochemical identification of the site of vitellogenin synthesis
in the freshwater prawn Macrobrachium nipponense. Fish. Sci. 60:
149 154.
Hodgkin, J. 1989. Drosophila sex determination: a cascade of regulated
splicing. Cell 56: 905906.
Huberman, A. 2000. Shrimp endocrinology. A review. Aquaculture
191: 191208.
Hutchinson, T. H., and D. B. Pickford. 2002. Ecological risk assessment and testing for endocrine disruption in the aquatic environment.
Toxicology 181182: 383387.
Khalaila, I., T. Katz, U. Abdu, G. Yehezkel, and A. Sagi. 2001. Effects
of implantation of hypertrophied androgenic glands on sexual characters and physiology of the reproductive system in the female red claw
crayfish, Cherax quadricarinatus. Gen. Comp. Endocrinol. 121: 242
249.
Khayat, M., E. Lubzens, A. Tietz, and B. Funkenstein. 1994. Are
vitellin and vitellogenin coded by one gene in the marine shrimp
Penaeus semisulcatus? J. Mol. Endocrinol. 12: 251254.
Koheler, H.-R., W. Kloas, M. Schirling, I. Lutz, A. L. Reye, J.-S.
Langen, R. Triebskorn, R. Nagel, and G. Schonfelder. 2007. Sex
steroid receptor evolution and signalling in aquatic invertebrates. Ecotoxicology 16: 131143.
Komatsu, M., S. Ando, and S.-I. Teshima. 1993. Comparison of hemolymph lipoprotein from four species of crustacean. J. Exp. Zool.
266: 257265.
Kozak, M. 1992. Regulation of translation in eukaryotic systems. Annu.
Rev. Cell Biol. 8: 197225.
Kramer, J. K. G., V. Fellner, M. E. R. Dugan, F. D. Sauer, M. M.
Mossoba, and M. P. Yurawecz. 1997. Evaluating acid and base
catalyst in the methylation of milk and rumen fatty acids with special
emphasis on conjugated dienes and total trans fatty acid. Lipids 32:
1219 1228.
Kung, S. Y., S. M. Chan, J. H. Hui, W. S. Tsang, A. Mak, and J. G. He.
2004. Vitellogenesis in the sand shrimp, Metapenaeus ensis: the
contribution from the hepatopancreas-specific vitellogenin gene
(MeVg2). Biol. Reprod. 71: 863 870.

Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680 685.
Lafont, R., and M. Mathieu. 2007. Steroids in aquatic invertebrates.
Ecotoxicology 16: 109 130.
Lee, C. Y., and R. D. Watson. 1995. In vitro study of vitellogenesis in
the blue crab (Callinectes sapidus): site and control of vitellin synthesis. J. Exp. Zool. 271: 364 372.
Lee, F. Y., and C. F. Chang.1999. Hepatopancreas is the likely organ of
vitellogenin synthesis in the freshwater prawn, Macrobrachium rosenbergii. J. Exp. Zool. 284: 798 806.
Lee, R. F., and D. L. Puppione. 1988. Lipoproteins I and II from the
hemolymph of the blue crab Callinectes sapidus: Lipoprotein II associated with vitellogenesis. J. Exp. Zool. 248: 278 289.
Lui, C. W., and J. D. OConnor. 1976. Biosynthesis of lipovitellin by
the crustacean ovary: II. Characterization of in vitro incorporation of
amino acids into the purified subunits. J. Exp. Zool. 195: 4152.
Lui, C. W., and J. D. OConnor. 1977. Biosynthesis of crustacean
lipovitellin: III. The incorporation of labeled amino acid into the
purified lipovitellin of the crab Pachygrapsus crassipes. J. Exp. Zool.
199: 105108.
Lui, C. W., B. A. Sage, and J. D. OConnor. 1974. Biosynthesis of
lipovitellin by the crustacean ovary. J. Exp. Zool. 188: 289 296.
Maglich, J. M., A. Sluder, X. Guan, Y. Shi, D. D. McKee, K. Carrick,
K. Kamdar, T. M. Willson, and J. T. Moore. 2001. Comparison of
complete nuclear receptor sets from the human, Caenorhabditis elegans and Drosophila genomes. Genome Biol. 2: 0029.1 0029.7.
Mak, A. S. C., C. L. Choi, S. H. K. Tiu, J. H. L. Hui, J.-G. He, S. S.
Tobe, and S.-M. Chan. 2005. Vitellogenesis in the red crab Charybdis feriatus: hepatopancreas-specific expression and farnesoic acid
stimulation of vitellogenin gene expression. Mol. Reprod. Dev. 70:
288 300.
Maquat, L. E. 1991. Nuclear mRNA export. Curr. Opin. Cell Biol. 3:
1004 1012.
Marin, M. G., and V. Matozzo. 2004. Vitellogenin induction as a
biomarker of exposure to estrogenic compounds in aquatic environments. Mar. Pollut. Bull. 48: 835 839.
Martnez-Perez, F., S. Zinker, G. Aguilar, J. Valdes, and H. Arechiga.
2005. Circadian oscillations of RPCH gene expression in the eyestalk
of the crayfish Cherax quadricarinatus. Peptides 26: 2434 2444.
Mattaj, I. W. 1993. RNA recognition: a family matter? Cell 73: 837
840.
Melefors, O., and M. W. Hentze. 1993. Translational regulation by
mRNA/protein interactions in eukaryotic cells: ferritin and beyond.
Bioessays 15: 8590.
Nielsen, D. A., and D. J. Shapiro. 1990a. Insights into hormonal control
of messenger RNA stability. Mol. Endocrinol. 4: 953957.
Nielsen, D. A., and D. J. Shapiro. 1990b. Estradiol and estrogen receptor-dependent stabilization of a mini-vitellogenin mRNA lacking 5,100
nucleotides of coding sequence. Mol. Cell. Biol. 10: 371376.
Noteborn, M. H., M. O. Bakker, M. A. W. Dejonge, M. Gruber, and G.
Ab. 1986. Differential estrogen responsiveness of the vitellogenin
and apo very low density lipoprotein II genes in the rooster liver. J.
Steroid Biochem. 24: 281285.
Okumura, T., and K. Sakiyama. 2004. Hemolymph levels of vertebrate-type steroid hormones in female kuruma prawn Marsupenaeus
japonicus (Crustacea: Decapoda: Penaeidae) during natural reproductive cycle and induced ovarian development by eyestalk ablation. Fish.
Sci. 70: 372380.
Paek, I., and R. Axel. 1987. Glucocorticoids enhance stability of human
growth hormone mRNA. Mol. Cell. Biol. 7: 1496 1507.
Paolucci, M., C. Di Cristo, and A. Di Cosmo. 2002. Immunological
evidence for progesterone and estradiol receptors in the freshwater
crayfish Austropotamobius pallipes. Mol. Reprod. Dev. 63: 55 62.
Paulus, J. E., and H. Laufer. 1987. Vitellogenocytes in hepatopancreas

STEROIDS IN CRAYFISH REPRODUCTION

of Carcinus maenas and Libinia emarginata (Decapoda, Brachyura).
Invertebr. Reprod. Dev. 11: 29 44.
Porte, C., G. Janer, L. C. Lorusso, M. Ortiz-Zarragoitia, M. P. Cajaraville, M. C. Fossi, and L. Canesi. 2006. Endocrine disruptors in
marine organisms: approaches and perspectives. Comp. Biochem.
Physiol. Part C 143: 303315.
Quinitio, E. T., A. Hara, K. Yamauchi, and S. Nakao. 1994. Changes
in the steroid hormone and vitellogenin levels during the gametogenic
cycle of the giant tiger shrimp, Penaeus monodon. Comp. Biochem.
Physiol. Part C 109: 2126.
Rankin, S. M., J. Y. Bradfield, and L. L. Keeley. 1989. Ovarian protein
synthesis in the South American white shrimp, Penaeus vannamei,
during the reproductive cycle. Invertebr. Reprod. Dev. 15: 2733.
Reddy, P. R., P. Kiranmayi, K. T. Kumari, and P. S. Reddy. 2006.
17-Hydroxyprogesterone induced ovarian growth and vitellogenesis
in the freshwater rice field crab Oziotelphusa senex senex. Aquaculture
254: 768 775.
Rodriguez, E. M., L. S. Lopez Greco, D. A. Medesani, M. Fingerman,
and H. Laufer. 2002a. Effect of methyl farnesoate, alone and in
combination with other hormones, on ovarian growth of the red swamp
crayfish, Procambarus clarkii, during vitellogenesis. Gen. Comp. Endocrinol. 125: 34 40.
Rodriguez, E. M., D. A. Medesani, L. S. Lopez Greco, and M. Fingerman. 2002b. Effects of some steroids and other compounds on ovarian growth of the red swamp crayfish, Procambarus clarkii, during
early vitellogenesis. J. Exp. Zool. 292: 82 87.
Rotchell, J. M., and G. K. Ostrander. 2003. Molecular markers of
endocrine disruption in aquatic organisms. J. Toxicol. Environ. Health
B Crit. Rev. 6: 453 496.
Sachs, A. B. 1993. Messenger RNA degradation in eukaryotes. Cell 74:
413 421.
Sagi, A., I. Khalaila, A. Barki, G. Hulata, and I. Karplus. 1996.
Intersex red claw crayfish, Cherax quadricarinatus (von Martens):
functional males with pre-vitellogenic ovaries. Biol. Bull. 190: 16 23.
Sagi, A., I. Khalaila, U. Abdu, R. Shoukrun, and S. Weil. 1999. A
newly established ELISA showing the effect of the androgenic gland
on secondary-vitellogenic-specific protein in the hemolymph of the
crayfish Cherax quadricarinatus. Gen. Comp. Endocrinol. 115: 37 45.
Serrano-Pinto, V., I. Landais, M.-H. Ogliastro, M. Gutierrez-Ayala, H.
Mej`a-Ruiz, H. Villareal-Colmenares, A. Garca-Gasca, and C.
Vazquez-Boucard. 2004. Vitellogenin mRNA expression in Cherax
quadricarinatus during secondary vitellogenic at first maturation females. Mol. Reprod. Dev. 69: 1721.
Shafir, S., M. Tom, M. Ovadia, and E. Lubzens. 1992. Protein, vitellogenin, and vitellin levels in the hemolymph and ovaries during
ovarian development in Penaeus semisulcatus (de Haan). Biol. Bull.
183: 394 400.
Sharpe, R. L., and D. L. MacLatchy. 2007. Lipid dynamics in goldfish
(Carassius auratus) during a period of gonadal recrudescence: effects
of -sitosterol and 17-estradiol exposure. Comp. Biochem. Physiol.
Part C 145: 507517.
Shechter, A., E. D. Aflalo, C. Davis, and A. Sagi. 2005. Expression of
the reproductive female-specific vitellogenin gene in endocrinologically induced male and intersex Cherax quadricarinatus crayfish. Biol.
Reprod. 73: 7279.
Shih, J. T. 1997. Sex steroid-like substances in the ovaries, hepatopancreas, and body fluid of female Mictyris brevidactylus. Zool. Stud. 36:
136 145.
Smith, D. F., T. M. Penning, A. Q. Ansari, K. A. Munday, and M.

47

Akhtar. 1978. Oestrogen-induced cholesterol and fatty acid biosynthesis in Xenopus laevis liver during vitellogenic response. Biochem. J.
174: 353361.
Subramoniam, T. 2000. Crustacean ecdysteroids in reproduction and
embryogenesis. Comp. Biochem. Physiol. Part C 125: 135156.
Sumpter, J. P., and S. Jobling. 1995. Vitellogenesis as a biomarker for
estrogenic contamination of the aquatic environment. Environ. Health
Perspect. 103 Suppl. 7: 173178.
Tiu, S. H. K., J.-G. He, S. S. Tobe, and S.-M.Chan. 2006. Characterization of vitellogenin in the shrimp Metapenaeus ensis: expression
studies and hormonal regulation of MeVg1 transcription in vitro. Mol.
Reprod. Dev. 73: 424 436.
Tiu, S. H. K., H. L. Hui, B. Tsukimura, S. S. Tobe, J.-G. He, and
S.-M.Chan. 2009. Cloning and expression study of the lobster (Homarus ameicanus) vitellogenin: conservation in gene structure among
decapods. Gen. Comp. Endocrinol. 160: 36 46.
Tom, M., M. Goren, and M. Ovadia. 1987. Localization of the vitellin
and its possible precursors in various organs of Parapenaeus longirostris (Crustacea, Decapoda, Penaeidae). Invertebr. Reprod. Dev. 12:
112.
Tsang, W.-S., L. S. Quackenbush, B. K. C. Chow, S. H. K. Tiu, J.-G.
He, and S.-M. Chan. 2003. Organization of the shrimp vitellogenin
gene: evidence of multiple genes and tissue specific expression by the
ovary and hepatopancreas. Gene 303: 99 109.
Tsukimura, B. 2001. Crustacean vitellogenesis: its role in oocyte development. Am. Zool. 41: 465 476.
Vance, D. E., and J. E. Vance. 2002. Biochemistry of Lipids, Lipoproteins and Membranes. Elsevier Science, Amsterdam.
Van Harreveld, A. V. 1936. A physiological solution for freshwater
crustaceans. Proc. Soc. Exp. Biol. Med. 34: 408 432.
Vogt, G. 1994. Life-cycle and functional cytology of the hepatopancreatic cells of Astacus astacus (Crustacea, Decapoda). Zoomorphology
114: 83101.
Warrier, S. R., R. Tirumalai, and T. Subramoniam. 2001. Occurrence
of vertebrate steroids, estradiol-17 and progesterone in the reproducing females of the mud crab Scylla serrata. Comp. Biochem. Physiol.
Part A 130: 283294.
Wu, L. T., and K. H. Chu. 2008. Characterization of heat shock protein
90 in the shrimp Metapenaeus ensis: evidence for its role in the
regulation of vitellogenin synthesis. Mol. Reprod. Dev. 75: 952959.
Yano, I. 2000. Endocrine control of reproductive maturation in economically important crustacea for aquaculture. Pp. 161194 in Reproductive Biology of Invertebrates, K. G. Adiyodi and R. G. Adiyodi, eds.
Wiley, New York,
Yano, I., and Y. Chinzei. 1987. Ovary is the site of vitellogenin synthesis in Kuruma prawn, Penaeus japonicus. Comp. Biochem. Physiol.
Part B 86: 213218.
Yano, I., and R. Hoshino. 2006.
Effect of 17 -estradiol on the
vitellogenin synthesis and oocyte development in the ovary of kuruma
prawn (Marsupenaeus japonicus). Comp. Biochem. Physiol. Part A
144: 18 23.
Yehezkel, G., R. Chayoth, U. Abdu, I. Khalaila, and A. Sagi. 2000.
High-density lipoprotein associated with secondary vitellogenesis in
the hemolymph of the crayfish Cherax quadricarinatus. Comp. Biochem. Physiol. Part B 127: 411 421.
Zapata, V., L. S. L. Greco, D. Medesani, and E. M. Rodriguez. 2003.
Ovarian growth in the crab Chasmagnathus granulata induced by
hormones and neuroregulators throughout the year. In vivo and in vitro
studies. Aquaculture 224: 339 352.