a r t ic l e s

Dopamine D2 receptors in addiction-like reward

dysfunction and compulsive eating in obese rats

2010 Nature America, Inc. All rights reserved.

Paul M Johnson & Paul J Kenny

We found that development of obesity was coupled with emergence of a progressively worsening deficit in neural reward
responses. Similar changes in reward homeostasis induced by cocaine or heroin are considered to be crucial in triggering the
transition from casual to compulsive drug-taking. Accordingly, we detected compulsive-like feeding behavior in obese but
not lean rats, measured as palatable food consumption that was resistant to disruption by an aversive conditioned stimulus.
Striatal dopamine D2 receptors (D2Rs) were downregulated in obese rats, as has been reported in humans addicted to drugs.
Moreover, lentivirus-mediated knockdown of striatal D2Rs rapidly accelerated the development of addiction-like reward deficits
and the onset of compulsive-like food seeking in rats with extended access to palatable high-fat food. These data demonstrate
that overconsumption of palatable food triggers addiction-like neuroadaptive responses in brain reward circuits and drives the
development of compulsive eating. Common hedonic mechanisms may therefore underlie obesity and drug addiction.
Feeding is influenced by pleasure and reward, and obtaining food
reward can powerfully motivate consumption1,2. Nevertheless, the
hedonic mechanisms contributing to obesity remain poorly under
stood. In hyperphagic humans with congenital leptin deficiency, acti
vity in the dorsal and ventral striatum, which are core components
of brain reward circuits increases markedly in response to images of
food3, and leptin replacement therapy attenuates both striatal activity
and self-reported liking of food3. This suggests that the striatum
is important in hedonic aspects of feeding behavior. It was shown
recently that activation of the striatum in response to highly pala
table food is blunted in obese individuals when compared with lean
controls4. Moreover, hypofunction of the dorsal striatum and longterm weight gain are most pronounced in individuals with the TaqIA
allele of the DRD2ANKK1 gene locus, which results in decreased
striatal D2R expression and has been shown to predispose individuals
to substance dependence disorders4,5. In rats, both susceptibility to
obesity and diet-induced obesity have been linked to deficits in meso
limbic dopamine signaling, with obesity-susceptible animals exhibit
ing reduced levels of D2 receptors50,51. These and similar observations
have led to the proposal that deficits in reward processing may be an
important risk factor for the development of obesity, and that obese
individuals may compulsively consume palatable food to compensate
for reward hyposensitivity6. Notably, it is unclear whether deficits in
reward processing are constitutive and precede obesity, or whether
excessive consumption of palatable food can drive reward dysfunction
and thereby contribute to diet-induced obesity.
A defining characteristic of overweight and obese individuals is that
they continue to overeat despite the well known negative health and
social consequences. Indeed, many overweight individuals express a
desire to limit their food consumption, yet struggle to control their

intake and repeatedly consume beyond their energy requirements7,8.

Development of feeding behavior that is insensitive to negative out
come is analogous to the compulsive drug-taking behavior seen in
human drug addicts, which is similarly impervious to negative con
sequences9. Here we investigated the effects of extended access to a
palatable high-fat diet on the sensitivity of brain reward systems in rats.
We also examined the link between diet-induced hedonic dysregulation
and the emergence of compulsive food seeking. Finally, we investigated
the role for striatal D2Rs in these addiction-like behavioral responses.
RESULTS
Addiction-like reward deficits in obese rats
To test the effects of restricted or extended access to a palatable highfat diet, we prepared male Wistar rats (300350 g) with a bipolar
stimulating electrode in the lateral hypothalamus and trained them
for 1014 d in a discrete-trial current-threshold brain stimulation
reward (BSR) procedure until stable reward thresholds were estab
lished4. In the BSR procedure, rats respond vigorously to obtain
rewarding electrical self-stimulation through the indwelling stimulat
ing electrode, with the minimal stimulation intensity that maintains
self-stimulation behavior termed the reward threshold10. Because
reward thresholds remain stable and unaltered over prolonged times
under baseline conditions, this procedure provides a sensitive measure
of the responsiveness of brain reward systems. After establishment of
stable BSR thresholds (defined as <10% variation in thresholds across
three consecutive sessions), we allocated rats to three groups that
showed no differences in mean body weights or reward thresholds
between groups. The three groups were given differential access to a
cafeteria-style diet consisting of palatable energy-dense food readily
available for human consumption (see Online Methods). Rats had

Laboratory of Behavioral and Molecular Neuroscience, Department of Molecular Therapeutics, The Scripps Research Institute-Scripps Florida, Jupiter, Florida, USA.
Correspondence should be addressed to P.J.K. (pjkenny@scripps.edu).
Received 29 December 2009; accepted 16 February 2010; published online 28 March 2010; corrected after print 9 July 2010; doi:10.1038/nn.2519

nature NEUROSCIENCE VOLUME 13 | NUMBER 5 | MAY 2010

635

a r t ic l e s

100
50
0
0

10 15 20 25 30 35 40
Days of access

Chow only
Restricted
Extended

40
30
20
10
0
10
20

10 15 20 25 30 35 40
Days of access

2010 Nature America, Inc. All rights reserved.

Figure 1 Weight gain and reward dysfunction in rats with extended

access to a cafeteria diet. (a) Mean ( s.e.m.) weight gain in chow-only,
restricted-access and extended-access rats (access day interaction:
F39,702 = 7.9, P < 0.0001; *P < 0.05 compared with chow-only group,
post hoc test). (b) Mean ( s.e.m.) percentage change from baseline
reward thresholds (access time interaction: F78,1092 = 1.7, P < 0.0005;
*P < 0.05 compared with chow-only group, post hoc test).

0 h (chow-only rats; n = 9), 1 h (restricted-access rats; n = 11), or

1823 h (extended-access rats; n = 11) access to the diet per day for
40 consecutive days. Cafeteria diets are known to result in dietinduced obesity in rats11. All rats also had ad libitum access to standard
laboratory chow, with reward thresholds, weight gain and caloric
intake recorded throughout.
Weight increased markedly in rats with extended access to the cafeteria
diet compared to the chow-only or restricted-access groups (Fig. 1a).
Weight also tended to increase in the restricted-access rats compared to
chow-only rats, but this effect did not reach statistical significance. The
development of obesity in extended-access rats was closely associated with
a worsening deficit in brain reward function, reflected in progressively
elevated BSR thresholds (Fig. 1b). Because no differences in response
latencies for BSR were observed among the three groups (Supplementary
Fig. 1), deficits in behavioral performance cannot account for this obser
vation. Similar deficits in brain reward function have been reported in
rats with extended but not restricted access to intravenous cocaine or
heroin self-administrations1214. Thus, extended access to palatable highfat food can induce addiction-like deficits in brain reward function, con
sidered an important source of motivation that may drive overeating and
contribute to the development of obesity1,6.
When we examined feeding behavior in detail (Fig. 2), we found
that total daily caloric intake was similar between chow-only and
restricted-access rats (Fig. 2a,d). By contrast, total caloric intake in
rats with extended access was almost twice that of the restrictedaccess and chow-only rats (Fig. 2a,d). Although the restricted-access
Figure 2 Patterns of consumption in rats with extended access to a
cafeteria diet. (a) Mean ( s.e.m.) daily caloric intake in chow-only,
restricted-access and extended-access rats (access: F1,324 = 100.6,
P < 0.0001; time: F18,324 = 7.8, P < 0.0001; access time interaction:
F18,324 = 4.6, P < 0.0001; *P < 0.05 compared with chow-only group,
post hoc test). (b) Mean daily caloric intake ( s.e.m.) from chow (access:
F2,504 = 349.1, P < 0.0001; time: F18,504 = 5.9, P < 0.0001; access
time interaction: F36,504 = 3.52, P < 0.0001; *P < 0.05 compared with
chow-only group, post hoc test). (c) Mean daily caloric intake ( s.e.m.)
from fat (access: F2,486 = 118.7, P < 0.0001; time: F18,486 = 8.8,
P < 0.0001; access time interaction: F36,486 = 6.2, P < 0.0001;
*P < 0.05 compared with chow-only group, post hoc test). (d) Comparison
of mean ( s.e.m.) total caloric intake, and calories consumed exclusively
from chow, during the entire 40-day period of access (access: F2,54 =
25.0, P < 0.0001; calorie source: F2,54 = 1235.2, P < 0.0001; access
calorie source interaction: F2,54 = 485.7, P < 0.0001; ***P < 0.001
compared with total calories in chow-only group, ###P < 0.001 compared
with total calories in the same group of rats, post hoc test).

636

and chow-only rats maintained approximately the same daily caloric

intake (Fig. 2a,d), restricted-access rats obtained only ~33% of their
daily calories from chow (Fig. 2b,d), indicating that they developed
binge-like feeding behavior and consumed ~66% of their daily caloric
intake during their 1 h access session to the cafeteria diet15 (Fig. 2d).
Extended-access rats obtained only a small fraction (~5%) of their
total caloric intake from chow (Fig. 2b); they consumed the cafeteria
diet almost exclusively (Fig. 2d). The shift in dietary preference in
the restricted- and extended-access groups was also reflected in a
marked increase in fat intake compared with chow-only rats (Fig. 2c
and Supplementary Fig. 2). Consistent with previous reports16, there
was a tendency for consumption of the cafeteria diet to decrease over
time in the extended-access rats. This may reflect the development of
tolerance to the palatability of the food items provided as part of the
cafeteria diet over time. Nevertheless, the preference for the cafeteria
diet versus standard chow remained consistently high in these rats
(Supplementary Fig. 3). These data demonstrate that extended but
not restricted access to a palatable high-fat diet induces addictionlike reward deficits, overeating and loss of homeostatic energy
balance. By contrast, restricted access to palatable food gives rise to
binge-like patterns of consumption, but does not disrupt homeostatic
energy balance nor brain reward function. However, it is possible that
restricted access to the cafeteria diet for more than 40 consecutive
days would induce significant weight gain and disruption of brain
reward function.
After 40 d, rats were no longer permitted access to the palatable diet
but continued to have ad libitum access to standard laboratory chow.
We assessed reward thresholds and chow consumption daily during
this enforced abstinence period. The elevations in reward thresholds
persisted for at least 2 weeks in the extended-access rats when they no
longer had access to the palatable diet (Fig. 3a). This contrasts with the
relatively transient (~48 h) deficits in reward function reported in rats
undergoing abstinence from self-administered cocaine13. There was
also a marked decrease in caloric intake (Fig. 3b) and a gradual decrease
in body weight (Fig. 3c) in extended-access rats, and to a lesser extent
in restricted-access rats, during this abstinence period, consistent with
previous reports11,15. After 14 d of abstinence, rats were killed and elec
trode placements were determined by cresyl violet staining (Fig. 3d).
Striatal D2Rs in obese rats: role in reward deficits
We next tested the hypothesis that overconsumption of a palatable
cafeteria diet might reduce striatal D2R density, contributing to the
development of addiction-like reward hyposensitivity. A new cohort of

Chow only
Restricted
Extended

375
300
225
150
75
0

10 15 20 25 30 35 40
Days of access
Chow only
Restricted
Extended

200
150
100
50
0

10 15 20 25 30 35 40
Days of access

Energy intake (kCal from chow)

150

50

Chow only
Restricted
Extended

150
125
100
75
50
25
0

d
Energy intake (kCal)

200

Energy intake (kCal)

Chow only
Restricted
Extended

Energy intake (kCal from fat)

250

Reward thresholds (%)

Weight gain (g)

250
200

10

15 20 25 30
Days of access

Total calories
Calories from chow

35

40

***

150
100
50

###
###

0
Chow-only Restricted

Extended

VOLUME 13 | NUMBER 5 | MAY 2010 nature NEUROSCIENCE

a r t ic l e s

nature NEUROSCIENCE VOLUME 13 | NUMBER 5 | MAY 2010

800
750
700
650
600
550

ed
nd

Ex

te

nd

-H

-L

-H

es
t

Ex
te

r ic
te

ed

-L

-H

ed
R

es

tri

ct

-L

500

D2R
-actin

70 kDa
43 kDa

1.75
1.50
1.25
1.00
0.75

**

0.50

**

0.25

ed
-L
nd
ed
-H
te

nd
te

Ex

Ex

-L

es

tri

ct
e

-H

ed
R

es

tr i

ct

y
on
l

-H

Figure 4 Weight gain is inversely related to striatal D2R levels. (a) Chowonly, restricted-access and extended-access rats were subdivided into
two groups per access condition based on a median split of body weights:
light (L) or heavy (H). (b) The entire striatal complex was collected from
all rats and D2R levels in each group measured by western blotting.
The membrane-associated D2R band was resolved at 70 kDa, and the
protein-loading control is displayed below (-actin, 43 kDa). Full-length
immunoblots are shown in Supplementary Figure 12. (c) Relative amounts
of D2R in the striatum of chow-only, restricted-access and extended-access
rats were quantified by densitometry (F2,6 = 5.2, P < 0.05, main effect of
access; *P < 0.05 and **P < 0.01 compared with chow-only-L group).

Compulsive eating in obese rats: role for striatal D2R

We next tested the hypothesis that compulsive-like eating might
emerge in rats with extended access to the cafeteria diet and that
deficits in striatal D2R signaling might contribute to this effect.
A new cohort of chow-only, restricted-access and extended-access rats
were permitted access to the cafeteria diet for >40 d until statistically
significant weight increases occurred in the extended rats (P < 0.05 com
pared with chow-only rats; data not shown). All three groups of rats were

ly

chow-only, restricted-access and extended-access rats were permitted

access to the cafeteria diet until there was a statistically significant
increase in body weight in the extended-access rats compared to the
chow-only group (P < 0.05; Fig. 4a). Striatal expression of the report
edly heavily glycosylated (~70 kDa) membrane-bound form of the
D2R was lower in the extended-access rats than in the restricted-access
or chow-only rats (Fig. 4b; see Online Methods). When we divided the
rats in each access group into two subgroups on the basis of a median
split of body weights (light or heavy), we found a clear inverse rela
tionship between body weight and striatal D2R expression (Fig. 4a,c).
We detected no statistically significant decreases in expression of the
unglycosylated immature (~39 kDa) and intermediately glycosylated
cytoplasmic (~51 kDa) forms of the D2R (Supplementary Fig. 4)17,
indicating that striatal D2R expression in extended-access rats is prob
ably regulated through post-transcriptional mechanisms.
Next, to test the functional relevance of diet-induced reductions
in striatal D2R to brain reward function, we designed and validated a
lentiviral vector to deliver a short hairpin interfering RNA (shRNA) in
order to knock down D2R (Lenti-D2Rsh; Fig. 5 and Supplementary
Fig. 5). Reward thresholds began to increase in rats treated with LentiD2Rsh almost immediately upon being permitted extended access to
the cafeteria diet, whereas reward thresholds remained unaltered in
extended-access rats treated with an empty lentivirus vector (Lenticontrol) over the relatively short period of access to the cafeteria diet
(14 d; Fig. 6a). Response latencies were unaltered in both groups of
rats, showing that this effect was not secondary to deficits in task
performance (Supplementary Fig. 6). Reward thresholds were also
unaltered in rats treated with Lenti-D2Rsh or Lenti-control that
had access to chow only over the same period (Fig. 6b). Thresholds
remained persistently elevated during an extra 15 d of abstinence when
all rats had access only to standard chow (Supplementary Fig. 7).

Knockdown of striatal D2R therefore increased vulnerability to dietinduced reward hypofunction but did not alter the baseline activity
of brain reward systems.
We found that caloric intake (Fig. 6c) and weight gain (Fig. 6d) were
similar in the Lenti-D2Rsh and corresponding Lenti-control groups
under chow-only or extended-access conditions (Supplementary
Figs. 8 and 9). Thus, striatal D2R knockdown altered neither prefer
ence for the cafeteria diet nor total caloric intake when the palatable
food was freely available for consumption.

on
l

4 6 8 10 12 14
Days abstinent

on

ho
w

3.80
mm

-L

3.30
mm

2.30
mm

ho
w

Chow only
Restricted
Extended

d
40
30
20
10
0
10
20
30
Baseline

ho
w

14

2010 Nature America, Inc. All rights reserved.

body weight (g)

0
Baseline 1 2 3 4 5 6 7 8
Days abstinent

on
l

14

50

ho
w

25
Baseline 1 2 3 4 5 6 7 8
Days abstinent

100

150

Body weight (g)

25

200

Figure 3 Persistent reward dysfunction and hypophagia during abstinence

in rats with extended access to a cafeteria diet. (a) Mean percentage
change from baseline reward thresholds ( s.e.m.) during abstinence from
a palatable high-fat diet (access: F2,112 = 3.7, P < 0.05; time: F4,112 =
2.3, P > 0.05; *P < 0.05 compared with chow-only group, post hoc test).
(b) Mean caloric intake ( s.e.m.) on the last day of access to the highfat diet (baseline) and during the 14 d of abstinence when only standard
chow was available (access: F2,168 = 41.7, P < 0.0001; time: F6,168 =
65.6, P < 0.0001; access time interaction: F12,168 = 38.3, P < 0.0001;
*P < 0.05 compared with chow-only group, post hoc test). (c) Change in
mean body weight ( s.e.m.) compared with body weight on the last day of
access to the high-fat diet (baseline) and during the 14 d of abstinence
when only standard chow was available (access: F1,126 = 37.2, P < 0.0001;
time: F7,126 = 3.1, P < 0.01; access time interaction: F7,126 = 40.9,
P < 0.0001; *P < 0.05 compared with chow-only group, post hoc test).
(d) Histological reconstruction of the location of BSR stimulating
electrodes in the lateral hypothalamus of chow-only (triangles), restrictedaccess (squares) and extended-access (circles) rats.

50

Chow only
Restricted
Extended

Fold change in D2R

(normalized to chow only - L group)

75

Chow only
Restricted
Extended

Energy intake (kCal)

reward thresholds (%)

637

a r t ic l e s
Figure 5 Lentivirus-mediated knockdown
of striatal D2R expression. (a) Graphical
representation of the striatal areas in which
Lenti-D2Rsh was overexpressed. Green circles
in the left striatal hemisphere represent the
locations at which viral infusions were targeted.
Green staining in the right striatal hemisphere
is a representative immunochemistry staining
for green fluorescent protein (GFP) from the
brain of a Lenti-D2Rsh rat. (b) Representative
immunoblot of the decreased D2R expression
in the striatum of Lenti-D2Rsh rats. Full-length
D2R
70 kDa
immunoblots are shown in Supplementary
-actin
43 kDa
Figure 13. (c) Relative amounts of D2R in the
Lenti-control Lenti-D2SH
striatum of Lenti-control and Lenti-D2Rsh
1.5
rats, quantified by densitometry (*P < 0.05
compared with the Lenti-control group,
post hoc test). (d) Infection of glial cells in the
1.0
striatum by the Lenti-D2Rsh vector was not
*
detected. Green staining is GFP from virus;
0.5
red is the astrocyte marker glial fibrillary acidic
protein (GFAP); cell nuclei are highlighted by
0
DAPI staining in blue. White arrows indicate a
Lenti-control
Lenti-D2Rsh
localized area of gliosis found only at the site
of virus injection in the striatum and not in the surrounding tissues into which the virus has diffused. Even in this area, none of the astrocytes are GFPpositive. The yellow arrows in the magnified image highlight the typical GFP-negative astrocytes that were detected. (e) High levels of neuronal infection
in the striatum by the Lenti-D2Rsh vector. Green staining is GFP from virus; red is the neuronal nuclear marker NeuN; cell nuclei are highlighted
by DAPI staining in blue. The yellow arrows in the magnified image highlight GFP-positive and NeuN-positive neurons in the striatum. (f) A highermagnification image of a virally infected (GFP-positive) neuron in the striatum of Lenti-D2Rsh rats that shows the typical morphological features of
medium spiny neurons.

b
c

then permitted only 30 min access per day to the cafeteria diet for 57 d
in an operant chamber until stable intake was achieved (defined as <10%
variation in daily intake). Half the rats in each access condition then were
exposed to a light (conditioned stimulus) paired with delivery of foot
shocks (punished group), whereas the remaining rats in each group were
exposed to the cue light in the absence of foot shock (unpunished group).
On the test day, we examined the effects of cue light exposure alone on
palatable food consumption (Fig. 7; see Online Methods). We found that
mean caloric intake during the 30-min baseline sessions was higher in
the chow-only and restricted-access rats than in the extended-access rats
(Fig. 7a,b). This suggests that the chow-only and restricted-access rats
binged on the palatable food during the intermittent 30-min access
sessions, reflected in the fact that these rats consumed ~4050%
of their daily caloric intake, typically ~100 kCal, during these sessions
(Fig. 7a,b). By contrast, extended-access rats seem resistant to developing

250

6
8
10
Days of access

12

150
100
50
0

reward thresholds (%)

d 100

Chow only

10
6
8
Days of access

12

***

75
50
25

Extended access

Chow only

co
nt
ro
i-D l
2R
sh
nt
Le

Le
nt
i-

i-c

on

nt
Le

nt
Le

i-D

tro
l
2R
sh

on

i-D

i-c
nt

nt
Le

nt

nt

i-c

Le

tro
l
2R
sh

Chow only

638

Lenti-control
Lenti-D2Rsh

50
40
30
20
10
0
10
20

14

Weight gain (g)

***

200

on
tro
i-D l
2R
sh

Energy intake (kCal)

Extended access

Lenti-control
Lenti-D2Rsh

50
40
30
20
10
0
10
20

Le

reward thresholds (%)

Le

2010 Nature America, Inc. All rights reserved.

Fold change

Extended access

14

this binge-like feeding behavior, perhaps because their history of almost

unlimited access to the palatable food for >40 consecutive days estab
lished patterns of eating that were relatively inflexible to change. On
the test day, we observed no statistically significant effects of cue light
replay on food consumption in the unpunished rats from the chowonly, restricted-access or extended-access groups when compared with
intake during the baseline period (Fig. 7a). The cue light alone therefore
had no motivational salience. In punished rats, the shock-paired cue
light significantly decreased palatable food intake in the chow-only and
restricted-access rats. However, the cue light had no effect on palatable
food intake in the extended-access rats, showing that their consump
tion was insensitive to aversive environmental cues predicting adversity.
Baseline energy intake in the extended-access rats was lower than that
in the other groups. However, because chow intake during similar timeperiods was far lower (Fig. 7d), it is unlikely that this represents a floor
effect that confounds our findings. Together, our data support the idea
that compulsive-like eating behavior can emerge in extended-access rats
in a manner analogous to the compulsive cocaine-taking seen in rats
with a history of extended access to the drug18.
Finally, we examined the effects of the punishment-paired condi
tioned stimulus on food intake in the Lenti-control and Lenti-D2Rsh
rats that had previously had access to chow only or extended access to
Figure 6 Knockdown of striatal D2R increases vulnerability to reward
dysfunction in rats with extended access to a cafeteria diet. (a) Mean
( s.e.m.) percentage change from baseline reward thresholds in Lenticontrol and Lenti-D2Rsh rats that had extended access to the cafeteria diet
for 14 consecutive days (virus: F1,156 = 5.9, P < 0.05; time: F13,156 = 2.2,
P < 0.05; virus time interaction: F13,156 = 2.2, P < 0.05; #P < 0.05,
interaction effect). (b) Mean ( s.e.m.) percentage change from baseline
reward thresholds in Lenti-control and Lenti-D2Rsh rats that had
chow-only access. (c) Mean ( s.e.m.) caloric intake of rats during 14 d
of chow only or extended access (access: F2,28 = 135.6, ***P < 0.0001).
(d) Mean ( s.e.m.) weight gain during 14 d of chow only or extended access
(access: F2,28 = 96.4, P < 0.0001; ***P < 0.001, main effect of access).

VOLUME 13 | NUMBER 5 | MAY 2010 nature NEUROSCIENCE

a r t ic l e s

Extended access

Punished rats

Chow only Restricted Extended

Baseline
Test

Chow

3
2
1

**

Chow only

D Len
2R ti
sh -

C Len
on t
tro il

**

Baseline
Test

D Len
2R ti
sh -

**

Energy intake (kCal)

Cafeteria diet

D Len
2R ti
sh -

Baseline
Test

70
60
50
40
30
20
10
0

co Len
nt tiro
l

Chow only Restricted Extended

Chow only

2010 Nature America, Inc. All rights reserved.

b 80

Energy intake (kCal)

C Len
on t
tro il

80
70
60
50
40
30
20
10
0

Unpunished rats

Baseline
Test

co Len
nt tiro
l

Energy intake (kCal)

80
70
60
50
40
30
20
10
0

D Len
2R ti
sh -

Energy intake (kCal)

Extended access

the cafeteria diet (rats from Fig. 6). We found that baseline palatable
food intake during the 30-min baseline sessions was similarly high
(~40 kCal) in all four groups (Fig. 7c). In addition, total daily chow con
sumption (in the home cage) was similar between all four groups of rats
during the conditioning sessions and on the test day (Supplementary
Fig. 10). The 14 d of prior access to the cafeteria diet was therefore
not sufficient to block binge-like eating behavior in a manner similar
to that seen in rats that had >40 d extended access to the cafeteria
diet (Fig. 7a,b). The aversive cue light stimulus disrupted palatable
food intake in Lenti-control and Lenti-D2Rsh rats that previously had
chow-only access (Fig. 7c). Similarly, the aversive conditioned stimulus
disrupted palatable food intake in the Lenti-control rats that previously
had 14 d extended access to the cafeteria diet. By contrast, the aversive
conditioned stimulus had no impact on palatable food consumption
in the Lenti-D2Rsh rats that previously had 14 d extended access to
the cafeteria diet (Fig. 7c). BSR thresholds remained significantly
elevated in these rats when recorded 48 h after the test session, whereas
thresholds remained stable and unaltered in the other three groups
of rats (Supplementary Fig. 11). To verify that resistance to condi
tioned stimulusinduced suppression of palatable food intake in the
Lenti-D2Rsh extended-access rats was not secondary to impairments
in classical conditioning processes, we tested the effects of the aversive
conditioned stimulus on consumption of less palatable standard chow
in all four groups of rats. In contrast to the binge-like consumption of
palatable food, we found that all four groups of rats consumed little
chow (~2 kCal) during the 30 min baseline sessions (Fig. 7d) and that
chow intake was disrupted in all four groups by a similar magnitude
upon exposure to the aversive conditioned stimulus (Fig. 7d). These
data demonstrate that knockdown of striatal D2Rs markedly acceler
ated the emergence of compulsive-like eating of palatable food, but
only in rats with a history of extended access. Moreover, because com
pulsive eating was detected only in Lenti-D2Rsh rats that had elevated
BSR thresholds, diet-induced reward hypofunction may be a necessary
antecedent to the emergence of compulsive food seeking.
DISCUSSION
Ease of access to palatable high-fat food is considered to be an impor
tant environmental risk factor for obesity19. We found that extended
access to a highly palatable cafeteria-style diet resulted in overeating
and weight gain coupled with progressively elevating BSR thresholds
in rats. This effect on BSR thresholds can be explained by gradually
nature NEUROSCIENCE VOLUME 13 | NUMBER 5 | MAY 2010

Figure 7 Compulsive-like responding for palatable food. (a) Mean

( s.e.m.) palatable diet consumption in unpunished rats during the
30-min baseline sessions and on the test day when rats were exposed
to a neutral conditioned stimulus that was not previously paired with
noxious foot shock (access: F2,20 = 5.2, P < 0.05; #P < 0.05 compared
with chow-only rats). (b) Mean ( s.e.m.) palatable diet consumption in
punished rats during the 30-min baseline sessions and on the test day
when rats were exposed to a conditioned stimulus that was previously
paired with noxious foot shock (access: F2,21 = 3.9, P < 0.05; cue:
F1,21 = 8.6, P < 0.01; access cue interaction: F2,21 = 4.7, P < 0.05;
*P < 0.05 compared with intake during the baseline session, #P < 0.05
compared with chow-only rats). (c) Mean ( s.e.m.) palatable diet
consumption during the 30-min baseline sessions and on the test day
in Lenti-control and Lenti-D2Rsh rats that previously had chow-only or
extended access to a cafeteria diet (cue: F1,26 = 29.7, P < 0.0001;
*P < 0.05, **P < 0.01 compared with intake during the baseline
sessions, post hoc test). (d) Mean ( s.e.m.) chow consumption during
the 30-min baseline sessions and on the test day in Lenti-control and
Lenti-D2Rsh rats that previously had chow only or extended access to
a cafeteria diet (cue: F1,26 = 44.9, P < 0.0001; *P < 0.05, **P < 0.01
compared with intake during the baseline sessions, post hoc test).

decreasing responsiveness of brain reward circuits, an interpreta

tion consistent with the fact that food restriction and weight loss
can increase20, whereas acute overfeeding can transiently decrease21,
responding for BSR in rats. This finding represents an extension of
work showing that acute overfeeding of rats through an intragastric
feeding tube21, and gastric distention or intravenous glucagon infusion
that mimics postprandial satiety2224, decreases responding for reward
ing lateral hypothalamic BSR and increases aversion-like responses
to the stimulation25. Previous work has also shown that repeatedly
force-feeding rats through intragastric tubes until their weight has
increased by ~200 g similarly decreases rates of responding for BSR,
an effect that persists until body weight has normalized23. As in these
findings in rats, responding in cats for lateral hypothalamic BSR was
inhibited by previous feeding to satiation26, showing that interactions
between brain reward function and metabolic state are conserved and
thus are likely to occur in humans as well. Ease of access and conse
quent overeating of cafeteria-style diets in humans is considered an
important environmental contributor to the current obesity epidemic
in Western societies19. Our data show that reward hypofunction arises
in rats that volitionally overeat a palatable cafeteria diet similar to that
consumed by humans and that this effect becomes progressively worse
as they gain more weight. Notably, all rats with reward threshold eleva
tions 20% had BSR electrodes located within ~500 m of the fornix
dorsolaterally. The sensitivity of reward-related neurons in this area
is increased by food restriction in a manner that is sensitive to the fatderived hormone leptin, and this brain region is considered an impor
tant substrate for food reward27. The brain circuits that regulate food
hedonics are therefore inhibited by postingestive signals that predict
satiety, consistent with recent human imaging studies showing that
gastric distention28 and the gut-derived postprandial factor peptide
YY3-36 (PYY)29 modulate the activity of regions of the brain involved
in reward processing. In addition, reward systems are also inhibited by
excessive weight gain. Recent reports indicate that circulating leptin, a
key regulator of energy balance, can penetrate into brain tissues and
inhibit the activity of reward circuits3,27,30,31.
Reward deficits in overweight rats may reflect counteradaptive
decreases in the baseline sensitivity of brain reward circuits to oppose
their overstimulation by palatable food. Such diet-induced reward hypo
function may contribute to the development of obesity by increasing
the motivation to consume high-reward obesogenic diets to avoid or
alleviate this state of negative reward6,32. This might account for the
639

 2010 Nature America, Inc. All rights reserved.

a r t ic l e s
hypophagia we observed in extended-access rats and to a lesser degree
in restricted-access rats when the palatable food was withdrawn and
only the less palatable chow was available. Such a scenario is also con
sistent with data from human brain imaging studies in which blunted
activation of the striatum in response to highly palatable food, particu
larly in individuals with genetic polymorphisms thought to decrease
striatal D2R expression, is associated with long-term weight gain4. It
has been unclear whether such reward hyposensitivity in obese individ
uals is manifested before the development of obesity and related solely
to genetic factors (reward deficiency syndrome) or whether overeating
can cause disruption in reward processing. Our data demonstrate that
extended access to palatable high-energy food and subsequent overeat
ing blunts reward sensitivity and may therefore represent an important
hedonic mechanism that promotes the development of obesity. Similar
reward dysfunction to that reported here in obese rats is also detected
in rats with a history of extended access to intravenous cocaine or
heroin self-administration, but not in those with a history of restricted
access1214. Moreover, the transition from casual to compulsive drug
seeking has been proposed to result from an attempt to alleviate the
persistent state of diminished reward induced by this drug-induced
reward dysfunction12,32,33. Thus, our data indicate that obesity and
drug addiction may share underlying hedonic mechanisms.
The downregulation of striatal D2R expression is a notable neu
roadaptive response to overconsumption of palatable food. Indeed,
reductions in striatal D2R density are seen in overweight individuals4,34
and rodents35,36. Conversely, individuals with anorexia nervosa have
elevated striatal D2R37, and weight loss in obese individuals after bari
atric (gastric bypass) surgery is associated with elevated striatal D2R
density28. The gene polymorphism referred to as the TaqIA A1 allele
results in decreased striatal D2R density, and individuals harboring
this allele are over-represented in obese populations4. The TaqIA allele
also increases vulnerability to alcohol, opioid and psychomotor stimu
lant addiction38. Reductions in striatal D2R density occurring either
through constitutive genetic factors or as a consequence of overeating
may therefore contribute to the neurobiological mechanisms of obesity.
We found that striatal levels of the 70 kDa D2R isoform, thought to
reflect the membrane-associated D2R, were inversely related to body
weight in rats from the chow-only, restricted-access and extendedaccess groups (Fig. 4). Knockdown of striatal D2R expression, most
prominently in the dorsolateral striatum (Fig. 5), caused BSR thres
holds to increase almost immediately upon exposure to the cafeteria
diet. Decreases in striatal D2R expression therefore rapidly accelerated
the emergence of reward hypofunction in rats with extended access to
highly palatable food, a finding consistent with human brain imaging
data that indicate that deficits in striatal D2R density contribute to
reward hypofunction in obese individuals4.
Three features of the Lenti-D2Rsh rats are also noteworthy. First,
although striatal D2R knockdown combined with extended access
to the palatable diet resulted in elevating BSR thresholds, there were
no differences in caloric intake or weight gain in these rats compared
to control rats. This might reflect that fact that rats only had 14 d of
access to the cafeteria diet; longer periods of access might have resulted
in higher weight gain over time, similarly to the higher susceptibility
to weight gain seen in humans with deficits in striatal D2R signaling 4.
However, the advantage of limiting access to the cafeteria diet to only
14 d is that the knockdown rats with extended access were the only
group to show elevated BSR thresholds, and this permitted us to assess
the potential role of reward hypofunction in the development of com
pulsive eating (see below). Second, BSR thresholds remained stable
and unaltered in the knockdown rats that had access to chow only. This
indicates that reduced striatal D2R expression alone was not sufficient
640

to induce reward hyposensitivity; instead, it seemed to interact with

overconsumption of palatable food to accelerate the emergence of this
state of reduced reward sensitivity. Other adaptive responses in brain
reward circuits might therefore trigger reward hyposensitivity in rats
with extended access to the cafeteria diet. With this in mind, we note
that the D2R agonist bromocriptine reduces circulating levels of leptin39,
and leptin inhibits feeding at least in part by inhibiting the striatal
regions that control hedonic responses to food3,30,31. Thus, it is possible
that downregulation of striatal D2R in response to increasing body
weight increases leptin signaling and thereby boosts the inhibitory
effects of this adipokine on brain reward systems. Finally, we note that
we targeted our lentivirus vectors towards the dorsolateral striatum.
This was primarily for technical reasons, as lateral placement of cannu
lae for virus delivery into the striatum enabled us also to accommodate
the indwelling hypothalamic stimulating electrode for BSR threshold
determination. Thus, it is possible that targeting of D2Rs for knock
down in other areas of the striatum, particularly the dorsomedial and
ventral areas (nucleus accumbens core and shell), might have elevated
BSR thresholds even in the absence of the palatable diet.
The dorsolateral striatum has been heavily implicated in stimu
lus-response habit type learning, as reflected in the development
of consummatory behavior that is insensitive to devaluation by
prior feeding to satiation or by pairing with noxious stimuli 40. By
targeting predominately the dorsolateral striatum, we might have
knocked down populations of D2Rs that regulate the rats vulner
ability to the development of compulsive-like eating. In keep
ing with a role for striatal D2Rs in compulsive behaviors, the
TaqIA allele of the human DRD2ANKK1 gene locuswhich
results in low striatal D2R density5, blunts striatal activation
in response to palatable food4 and elevates vulnerability to obesity4is
also associated with deficits in learning to avoid actions with nega
tive consequences41. Loss of inhibitory control over behavior that can
have a negative outcome is a characteristic feature of both obesity
and drug addiction, in which consummatory behaviors persist despite
negative social, health or financial consequences. Cocaine-taking
behavior in rats with a history of extensive drug intake can become
inflexible and resistant to disruption by an aversive conditioned stimu
lus that predicts a negative outcome (foot shock)18. Similarly, mice
that previously had access to a palatable high-fat diet will spend more
time in an aversive environment (brightly lit) to obtain the palatable
food than mice that had no experience with the diet42. We found that
palatable food consumption in rats with extended access to the cafete
ria diet was similarly insensitive to an aversive conditioned stimulus.
Consistent with a role for striatal D2Rs in this effect, compulsive-like
eating was found in the striatal D2R knockdown rats that previously
had 14 d extended access to the cafeteria diet but not in the control
groups. From a neurocircuitry perspective, extended access to palat
able food might trigger plasticity in corticostriatal pathways, thereby
rendering animals more vulnerable to the development of compulsivelike behaviors, with deficits in striatal D2R signaling enhancing this
process. Indeed, reduced striatal D2R density in obese individuals is
correlated with reduced metabolism in prefrontal and orbitofrontal
cortical areas43 that exert inhibitory control over behavior44.
Notably, compulsive-like consumption of palatable food was detected
only in the knockdown rats that previously had extended access to the
cafeteria diet, not in control rats that had extended access to the cafeteria
diet for the same time period, nor in knockdown rats that had chowonly access. The main difference between the knockdown rats with prior
extended access and to the other groups was their persistently elevated
BSR thresholds. This might reflect common neurobiological origins of
reward hypofunction and the emergence of compulsive-like eating, which
VOLUME 13 | NUMBER 5 | MAY 2010 nature NEUROSCIENCE

a r t ic l e s

2010 Nature America, Inc. All rights reserved.

are temporally coincident yet independent phenomena. Alternatively,

diet-induced reward hypofunction might serve as a substrate for negative
reinforcement that facilitates the development of compulsive-like eat
ing14,32,33. Whatever the underlying mechanisms, our findings demon
strate that addiction-like compulsive responding for palatable food can
emerge in obese rats, and indicate that deficits in striatal D2R signaling
increase vulnerability to the development of this behavior.
In summary, we found that over-stimulation of brain reward
systems through excessive consumption of palatable, energy-dense
food induces a profound state of reward hyposensitivity and the
development of compulsive-like eating. These maladaptive behav
ioral responses in obese rats probably arise from diet-induced defi
cits in striatal D2R signaling. Overconsumption of drugs of abuse
similarly decreases striatal D2R density, induces a profound state
of reward hypofunction and triggers the emergence of compulsivelike drug-taking behaviors. Our findings therefore support previous
work4,19,42,4547 in indicating that obesity and drug addiction may
arise from similar neuroadaptive responses in brain reward circuits.
Methods
Methods and any associated references are available in the online
version of the paper at http://www.nature.com/natureneuroscience/.
Note: Supplementary information is available on the Nature Neuroscience website.
Acknowledgments
This work was supported by a Bank of America Fellowship (P.M.J.), the
Landenberger Foundation (P.J.K.) and a grant from the US National Institutes of
Health (DA025983; P.J.K.). This is publication number 19,563 from the Scripps
Research Institute.
AUTHOR CONTRIBUTIONS
P.M.J. conducted all experiments. P.M.J. and P.J.K. designed the experiments,
analyzed the data and wrote the manuscript.
COMPETING FINANCIAL INTERESTS
The authors declare no competing financial interests.
Published online at http://www.nature.com/natureneuroscience/.
Reprints and permissions information is available online at http://www.nature.com/
reprintsandpermissions/.
1. Saper, C.B., Chou, T.C. & Elmquist, J.K. The need to feed: homeostatic and hedonic
control of eating. Neuron 36, 199211 (2002).
2. Zheng, H. & Berthoud, H.R. Eating for pleasure or calories. Curr. Opin. Pharmacol.
7, 607612 (2007).
3. Farooqi, I.S. et al. Leptin regulates striatal regions and human eating behavior.
Science 317, 1355 (2007).
4. Stice, E., Spoor, S., Bohon, C. & Small, D.M. Relation between obesity and blunted striatal
response to food is moderated by TaqIA A1 allele. Science 322, 449452 (2008).
5. Noble, E.P. Addiction and its reward process through polymorphisms of the D2
dopamine receptor gene: a review. Eur. Psychiatry 15, 7989 (2000).
6. Wang, G.J., Volkow, N.D. & Fowler, J.S. The role of dopamine in motivation for food
in humans: implications for obesity. Expert Opin. Ther. Targets 6, 601609 (2002).
7. Booth, M.L., Wilkenfeld, R.L., Pagnini, D.L., Booth, S.L. & King, L.A. Perceptions
of adolescents on overweight and obesity: the weight of opinion study. J. Paediatr.
Child Health 44, 248252 (2008).
8. Puhl, R.M., Moss-Racusin, C.A., Schwartz, M.B. & Brownell, K.D. Weight
stigmatization and bias reduction: perspectives of overweight and obese adults.
Health Educ. Res. 23, 347358 (2008).
9. American Medical Association. Diagnostic and Statistical Manual of Mental
Disorders, Fourth Edition (DSM-IV) (American Psychiatric Association Publishing,
Washington, D.C., 1994).
10. Markou, A. & Koob, G.F. Construct validity of a self-stimulation threshold paradigm: effects
of reward and performance manipulations. Physiol. Behav. 51, 111119 (1992).
11. Rolls, B.J., Rowe, E.A. & Turner, R.C. Persistent obesity in rats following a period of
consumption of a mixed, high energy diet. J. Physiol. (Lond.) 298, 415427 (1980).
12. Ahmed, S.H., Kenny, P.J., Koob, G.F. & Markou, A. Neurobiological evidence for hedonic
allostasis associated with escalating cocaine use. Nat. Neurosci. 5, 625626 (2002).
13. Markou, A. & Koob, G.F. Postcocaine anhedonia. An animal model of cocaine
withdrawal. Neuropsychopharmacology 4, 1726 (1991).
14. Kenny, P.J., Chen, S.A., Kitamura, O., Markou, A. & Koob, G.F. Conditioned
withdrawal drives heroin consumption and decreases reward sensitivity. J. Neurosci.
26, 58945900 (2006).

nature NEUROSCIENCE VOLUME 13 | NUMBER 5 | MAY 2010

15. Cottone, P., Sabino, V., Steardo, L. & Zorrilla, E.P. Opioid-dependent anticipatory
negative contrast and binge-like eating in rats with limited access to highly preferred
food. Neuropsychopharmacology 33, 524535 (2008).
16. Llad, I. et al. Effects of cafeteria diet feeding on beta3-adrenoceptor expression
and lipolytic activity in white adipose tissue of male and female rats. Int. J. Obes.
Relat. Metab. Disord. 24, 13961404 (2000).
17. Fishburn, C.S., Elazar, Z. & Fuchs, S. Differential glycosylation and intracellular
trafficking for the long and short isoforms of the D2 dopamine receptor. J. Biol.
Chem. 270, 2981929824 (1995).
18. Vanderschuren, L.J. & Everitt, B.J. Drug seeking becomes compulsive after prolonged
cocaine self-administration. Science 305, 10171019 (2004).
19. Volkow, N.D. & Wise, R.A. How can drug addiction help us understand obesity?
Nat. Neurosci. 8, 555560 (2005).
20. Blundell, J.E. & Herberg, L.J. Relative effects of nutritional deficit and deprivation
period on rate of electrical self-stimulation of lateral hypothalamus. Nature 219,
627628 (1968).
21. Hoebel, B.G. & Teitelbaum, P. Hypothalamic control of feeding and self-stimulation.
Science 135, 375377 (1962).
22. Mount, G. & Hoebel, B.G. Lateral hypothalamic self-stimulation: self-determined
threshold increased by food intake. Psychon. Sci. 9, 265266 (1967).
23. Hoebel, B.G. Feeding and self-stimulation. Ann. NY Acad. Sci. 157, 758778 (1969).
24. Hoebel, B.G. & Balagura, S. Self-stimulation of the lateral hypothalamus modified
by insulin and glucagon. Physiol. Behav. 2, 337340 (1967).
25. Hoebel, B.G. & Thompson, R.D. Aversion to lateral hypothalamic stimulation caused
by intragastric feeding or obesity. J. Comp. Physiol. Psychol. 68, 536543
(1969).
26. Wilkinson, H.A. & Peele, T.L. Modification of intracranial self-stimulation by hunger
satiety. Am. J. Physiol. 203, 537540 (1962).
27. Fulton, S., Woodside, B. & Shizgal, P. Modulation of brain reward circuitry by leptin.
Science 287, 125128 (2000).
28. Wang, G.J. et al. Gastric distention activates satiety circuitry in the human brain.
Neuroimage 39, 18241831 (2008).
29. Batterham, R.L. et al. PYY modulation of cortical and hypothalamic brain areas
predicts feeding behavior in humans. Nature 450, 106109 (2007).
30. Hommel, J.D. et al. Leptin receptor signaling in midbrain dopamine neurons
regulates feeding. Neuron 51, 801810 (2006).
31. Fulton, S. et al. Leptin regulation of the mesoaccumbens dopamine pathway. Neuron
51, 811822 (2006).
32. Koob, G.F. & Le Moal, M. Plasticity of reward neurocircuitry and the dark side of
drug addiction. Nat. Neurosci. 8, 14421444 (2005).
33. Kenny, P.J. Brain reward systems and compulsive drug use. Trends Pharmacol. Sci.
28, 135141 (2007).
34. Wang, G.J. et al. Brain dopamine and obesity. Lancet 357, 354357 (2001).
35. Huang, X.F. et al. Dopamine transporter and D2 receptor binding densities in mice
prone or resistant to chronic high fat diet-induced obesity. Behav. Brain Res. 175,
415419 (2006).
36. Thanos, P.K., Michaelides, M., Piyis, Y.K., Wang, G.J. & Volkow, N.D. Food restriction
markedly increases dopamine D2 receptor (D2R) in a rat model of obesity as
assessed with in vivo muPET imaging ([11C] raclopride) and in vitro ([3H] spiperone)
autoradiography. Synapse 62, 5061 (2008).
37. Frank, G.K. et al. Increased dopamine D2/D3 receptor binding after recovery from
anorexia nervosa measured by positron emission tomography and [11C]raclopride.
Biol. Psychiatry 58, 908912 (2005).
38. Neville, M.J., Johnstone, E.C. & Walton, R.T. Identification and characterization of
ANKK1: a novel kinase gene closely linked to DRD2 on chromosome band 11q23.1.
Hum. Mutat. 23, 540545 (2004).
39. Mastronardi, C.A., Yu, W.H., Srivastava, V.K., Dees, W.L. & McCann, S.M.
Lipopolysaccharide-induced leptin release is neurally controlled. Proc. Natl. Acad.
Sci. USA 98, 1472014725 (2001).
40. Yin, H.H., Knowlton, B.J. & Balleine, B.W. Inactivation of dorsolateral striatum
enhances sensitivity to changes in the action-outcome contingency in instrumental
conditioning. Behav. Brain Res. 166, 189196 (2006).
41. Klein, T.A. et al. Genetically determined differences in learning from errors. Science
318, 16421645 (2007).
42. Teegarden, S.L. & Bale, T.L. Decreases in dietary preference produce increased
emotionality and risk for dietary relapse. Biol. Psychiatry 61, 10211029
(2007).
43. Volkow, N.D. et al. Low dopamine striatal D2 receptors are associated with prefrontal
metabolism in obese subjects: possible contributing factors. Neuroimage 42,
15371543 (2008).
44. Clarke, H.F., Dalley, J.W., Crofts, H.S., Robbins, T.W. & Roberts, A.C. Cognitive
inflexibility after prefrontal serotonin depletion. Science 304, 878880 (2004).
45. Avena, N.M., Rada, P. & Hoebel, B.G. Evidence for sugar addiction: behavioral and
neurochemical effects of intermittent, excessive sugar intake. Neurosci. Biobehav.
Rev. 32, 2039 (2008).
46. Volkow, N.D. & OBrien, C.P. Issues for DSM-V: should obesity be included as a
brain disorder? Am. J. Psychiatry 164, 708710 (2007).
47. Cottone, P. et al. CRF system recruitment mediates dark side of compulsive eating.
Proc. Natl. Acad. Sci. USA 106, 2001620020 (2009).
50. Geiger, B.M. et al. Evidence for defective mesolimbic dopamine exocytosis in
obesity-prone rats. FASEB J. 22, 27402746 (2008).
51. Geiger, B.M. et al. Deficits of mesolimbic dopamine neurotransmission in rat dietary
obesity. Neuroscience 10, 11931199 (2009).

641

ONLINE METHODS

2010 Nature America, Inc. All rights reserved.

Rats. Male Wistar rats weighing 300350 g at the start of the experiments were
obtained from Charles River. Upon arrival, rats were housed individually at
constant temperature on a 12-h lightdark cycle (lights on at 2200 h). Rats were
permitted ad libitum access to standard laboratory chow and water for the dura
tion of the experiment. All procedures were approved by the Institutional Animal
Care and Use Committee of Scripps Florida, and rats were treated in accordance
with the guidelines set forth by the National Institutes of Health regarding the
principles of animal care.
Surgical procedures. Rats prepared with BSR stimulating electrodes were first
anaesthetized by inhalation of 13% isoflurane in oxygen and positioned in a
stereotaxic frame (Kopf). Bipolar BSR electrodes (11 mm long) were implanted
into the posterior lateral hypothalamus (anteroposterior, 0.5 mm from bregma;
mediolateral, 1.7 mm from midline; dorsoventral, 8.3 mm from dura; incisor bar
was adjusted to 5 mm above the interaural line)47. Rats receiving virus injections
were also prepared with bilateral guide cannulae (23 gauge, 14 mm long) posi
tioned above the striatum (anteroposterior, 2.8 mm from bregma; mediolateral,
3.1 mm from midline; dorsoventral, 2.4 mm from dura)48 and filled with 14-mm
stylets. Four stainless steel skull screws and dental acrylic held the electrode and
cannulae in place. The surgical wound was treated with topical antibiotic once
every 12 h for 5 d after the surgery. Rats were allowed 710 d to recover from
surgery and were then trained in the BSR threshold procedure.
BSR procedure. Rats were trained to respond for BSR stimulation according to a
discrete-trial current-threshold procedure similar to that described elsewhere10,14.
Briefly, BSR current levels were varied in alternating descending and ascending
series in 5-A steps. In each testing session, four alternating descending/ascending
series were presented. The threshold for each series was defined as the midpoint
between two consecutive current intensities for which rats responded in at least
three of the five trials, and two consecutive current intensities for which rats
did not respond in three or more of the five trials. The overall threshold of the
session was defined as the mean of the thresholds for the four individual series.
Each testing session was approximately 30 min in duration. Stable BSR thresholds
were defined as 10% variation in thresholds over 5 consecutive days, usually
established after 1014 d of training. The response latency for each test session
was defined as the mean response latency of all trials during which a positive
response occurred.
Viral packaging and delivery. Short hairpin RNA was delivered and constitu
tively expressed using the pRNAT-U6.2/Lenti vector system (GenScript). Viral
particles were prepared according to the manufacturers protocol. Briefly, HEK
293FT cells were transfected with vector containing the shRNA insert (5-GGA
TCCCGCGCAGCAGTCGAGCTTTCTTCAAGAGAGAAAGCTCGACTGCTGC
GCTTTTTTCCAACTCGAG-3) or the empty vector, plus ViraPower Packaging
Mix (Invitrogen) for 72 h (medium replaced after 24 h). Supernatant was then
collected and concentrated by ultracentrifugation (76,755g, Beckman Coulter SW
32 TI rotor., 90 min, 4 C) and viral titer was determined by fluorescence-activated
cell sorting according to the manufacturers instructions. Virus was aliquoted and
stored in light-protected boxes at 80 C until use.
Rats with stable BSR thresholds received bilateral viral injections at three sites
in the striatum of each brain hemisphere (2 l per injection, 1 l min1, 1 min
between injections, a total of six injections per rat). Rats were allowed at least
23 d recovery from intrastriatal injections before BSR threshold assessment was
resumed. Daily BSR threshold assessment continued for 33 d after virus injections
to ensure maximal striatal D2R knockdown was achieved before permitting rats
access to the cafeteria diet. There were no differences in BSR thresholds between
the Lenti-control and Lenti-D2Rsh rats during these 33 d (data not shown).
Immunoblotting. Rats were killed approximately 1 h after their regularly
scheduled access to the cafeteria diet, and brains were rapidly removed. Brain
sections of ~12 mm thickness were prepared using a coronal brain matrix
(1-mm slice interval; Plastics One) on an ice block, and tissue punches of dorsal
striatum (bregma: ~2.2 to 0.26 mm) were taken. Striatal tissue punches were rapidly
collected, snap frozen and stored at 80 C until use. Individual samples were
thawed on ice and equal amounts of striatal tissue were pooled on the basis of
a weight-dependent median split of access groups (710 rats per pool). Tissue

nature NEUROSCIENCE

was resuspended in 500 l ice-cold RIPA buffer (Thermo Scientific) containing

sodium orthovanadate, phosphatase cocktail inhibitors 1 and 2 (Sigma-Aldrich),
leupeptin and pepstatin before homogenization. Tissue lysates were boiled
for 10 min in sample buffer and loaded onto 4%20% or 10% Tris-glycine
SDS gels (Invitrogen). Protein was transferred to nitrocellulose membranes,
blocked for 1 h at ~2325 C (5% non-fat dry milk and 0.2% Tween-20 in PBS,
pH 7.4), and incubated in primary antibody overnight at 4 C. The following
primary antibodies were diluted in block solution: D2R mouse monoclonal
(Santa Cruz, 1:100) or -actin mouse monoclonal (Santa Cruz, 1:200).
Chemiluminescent ECL reagent was added after incubation with horseradish
peroxidaseconjugated secondary antibodies (Amersham, 1:2,000). The mature
membrane-associated form of D2DR (~70 kDa)17,49 was normalized to a proteinloading control (-actin; 43 kDa) and quantified by densitometry using NIH
Image J software.
Immunochemical analysis. Rats were anesthetized and transcardially perfused
with 4% paraformaldehyde in PBS (pH 7.6). Brains were removed, postfixed
overnight and stored in sucrose (30% solution in PBS, pH 7.4) for at least 72 h.
Frozen tissue sections (30 m thickness) were collected from a microtome and
blocked (3% BSA, 5% normal goat serum and 0.3% Triton X-100 in PBS) for
1 h at ~2325 C. The following primary antibodies were added to the block
solution and incubated overnight at 4 C: chicken polyclonal to GFP (Abcam,
1:1,000); rabbit monoclonal to GFAP (Millipore, 1:1,000); mouse monoclonal
to NeuN (Millipore, 1:1,000). Sections were incubated with fluorescent-dyeconjugated secondary antibodies at ~2325 C: anti-chicken488-nm dye (Jackson
ImmunoResearch, 1:1,000), anti-rabbit594-nm dye (Invitrogen, 1:1,000), and
anti-mouse594-nm dye (Invitrogen, 1:1000). Sections were mounted with
Vectashield mounting media containing DAPI (Vector Labs) and coverslipped.
Images were taken using an Olympus BX61 fluorescence microscope (2 objective)
or an Olympus confocal microscope (10 and 100 objectives).
Feeding procedure. Rats were housed individually on paper bedding (alpha pads;
Shepherd Specialty Papers) to prevent food products from being soiled with loose
bedding materials. The cafeteria diet consisted of bacon, sausage, cheesecake,
pound cake, frosting and chocolate, which were individually weighed before
being made available to the rats. The cafeteria diet food items were delivered in
small metal receptacles. All food items, including standard laboratory chow, were
weighed again on completion of the feeding session. Caloric intake from the various
macronutrients was calculated using the nutritional information provided by
the manufacturer.
Cue-induced suppression of feeding behavior. Feeding procedures took place in
sound-attenuated operant chambers identical in dimensions to those used in the
BSR experiments. Rats were placed into an operant chamber and had access to the
cafeteria diet or chow for 30 min. The food products were delivered in small metal
receptacles. All food items were weighed before and after feeding sessions, which
were carried out during the rats normal feeding period. Chow consumption was
assessed by consumption of 45-mg chow pellets identical in composition to chow
provided in the rats home cages. Rats were then permitted 30 min access per day
to the cafeteria diet until stable intake was achieved (defined as <10% variation in
daily intake), requiring 57 d. After stabilization of palatable food intake during
this baseline period, rats in each access condition were allocated to two groups:
punished (those receiving foot shock) and unpunished (not receiving foot shock).
Rats were then subjected to four conditioning sessions on consecutive days in the
same operant chamber in which they previously had had access to the palatable
food. During the 30-min conditioning sessions a cue light (conditioned stimulus)
was activated for 10 min, turned off for 10 min, and then turned back on for
10 min. Punished rats received foot shock only during presentation of the cue light
(0.5 mA for 1.0 s; 10 stimulations with ~1-min intervals). The unpunished rats
were presented with the cue light in the same manner, but without the delivery
of foot shock. On the test day, the day after the final conditioning session, rats in
the punished groups received intermittent foot shock (five stimulations in total)
paired with activation of the cue light for 5 min. The unpunished rats were again
exposed to the cue light in the absence of foot shock. After the 5-min punishment
period, all rats were permitted access to the palatable food for a 30-min session
with the conditioned stimulus activated intermittently (10 min cue light on,
10 min cue light off, 10 min cue light on).

doi:10.1038/nn.2519

the within-subjects factor. When appropriate, main effects in the analyses

of variance were further analyzed by Bonferroni post hoc tests. All statistical
analyses were performed using GraphPad Prism software.

48. Pellegrino, L.J., Pellegrino, A.S. & Cushman, A.J. A Stereotaxic Atlas of the Rat
Brain (Plenum, New York, 1979).
49. David, C., Fishburn, C.S., Monsma, F.J. Jr., Sibley, D.R. & Fuchs, S. Synthesis and
processing of D2 dopamine receptors. Biochemistry 32, 81798183 (1993).

2010 Nature America, Inc. All rights reserved.

Statistical analyses. Baseline reward thresholds were defined as the average

threshold value for the 5 d before access to the cafeteria diet for each subject.
Reward thresholds were expressed as the percentage change from the base
line threshold value. Data on percentage of baseline reward threshold values,
weight gain, caloric consumption, and caloric consumption from fat were
analyzed by two-factor, repeated-measures analysis of variance, with access
(chow only, restricted access or extended access), calorie source (standard
chow or cafeteria diet), virus (Lenti-control or Lenti-D2Rsh) and cue (paired
or unpaired with punishment) as the between-subjects factors and time as

doi:10.1038/nn.2519

nature NEUROSCIENCE

CORRI G EN D a

Corrigendum: Dopamine D2 receptors in addiction-like reward dysfunction

and compulsive eating in obese rats
Paul M Johnson & Paul J Kenny
Nat. Neurosci. 13, 635641 (2010); published online 28 March 2010; corrected after print 9 July 2010
In the version of this article initially published, two citations were inadvertently omitted. To correct this, the following sentence was inserted after
the sixth sentence in the introduction (first paragraph, line 16): In rats, both susceptibility to obesity and diet-induced obesity have been linked
to deficits in mesolimbic dopamine signaling, with obesity-susceptible animals exhibiting reduced levels of D2 receptors50,51.
These references have been added to the reference list as follows:
50. Geiger, B.M. et al. Evidence for defective mesolimbic dopamine exocytosis in obesity-prone rats. FASEB J. 22, 27402746 (2008).
51. Geiger, B.M. et al. Deficits of mesolimbic dopamine neurotransmission in rat dietary obesity. Neuroscience 10, 11931199 (2009).

2010 Nature America, Inc. All rights reserved.

The error has been corrected in the HTML and PDF versions of the article.

nature neuroscience