Biochimica et Biophysica Acta 1823 (2012) 13891394

Contents lists available at SciVerse ScienceDirect

Biochimica et Biophysica Acta

journal homepage: www.elsevier.com/locate/bbamcr

In vitro cultured human Sertoli cells secrete high amounts of acetate that is
stimulated by 17-estradiol and suppressed by insulin deprivation
Marco G. Alves a, Slvia Socorro a, Joaquina Silva b, Alberto Barros b, c, Mrio Sousa b, d,
Jos E. Cavaco a, Pedro F. Oliveira a,
a

CICS UBI Health Sciences Research Centre, University of Beira Interior, 6201-506 Covilh, Portugal
Centre for Reproductive Genetics Alberto Barros, 4100-009 Porto, Portugal
Department of Genetics, Faculty of Medicine, University of Porto, 4200 319 Porto, Portugal
d
Department of Microscopy, Laboratory of Cell Biology, Institute of Biomedical Sciences Abel Salazar (ICBAS), UMIB, University of Porto, 4099-003 Porto, Portugal
b
c

a r t i c l e

i n f o

Article history:
Received 5 March 2012
Received in revised form 22 May 2012
Accepted 5 June 2012
Available online 12 June 2012
Keywords:
Human Sertoli cells
Energy metabolism
Insulin
Acetate
Acetyl-CoA

a b s t r a c t
Background: Several important functions for a successful spermatogenesis are dependent on Sertoli cells
(SCs). Besides their unique characteristics as support cells, they produce essential cofactors and metabolites,
and are responsible for nurturing the developing germ cells. The continuous production of lipids, phospholipids and proteins by germ cells must require high amounts of metabolic precursors. Thus, we hypothesized
that hSCs could produce acetate in a hormonally-regulated manner. Methods: hSC-enriched primary cultures
were maintained in the absence of insulin or in the presence of 17-estradiol (E2) or 5-dihydrotestosterone
(DHT). Acetate production was determined by 1H-NMR. mRNA gene expression levels of Acetyl CoA hydrolase (ACoA Hyd) and Acetyl CoA synthase (ACoA Synt) were determined by RT-PCR. Results: hSCs produced
high amounts of acetate suggesting that this metabolite should play a key role on the progression of spermatogenesis, namely as a metabolic precursor for the synthesis of cellular constituents. In addition, acetate
metabolism proved to be under strict hormonal regulation. In the presence of E2 or DHT, hSCs produced
different amounts of acetate. While E2 treatment increased acetate production, increasing ACoA Hyd gene
transcript levels, DHT-treated cells showed decreased acetate production, differently modulating the ratio
ACoA Hyd/ACoA Synt. Surprisingly, insulin-deprivation completely suppressed acetate production/export
and signicantly decreased the ACoA Hyd gene transcript levels. General signicance: Taken together, these
results suggest that, although hSCs are primarily described as lactate producers, the elevated production of
acetate deserves special attention, in order to clarify the mechanisms behind its hormonal regulation and
its role on a successful spermatogenesis.
2012 Elsevier B.V. All rights reserved.

1. Introduction
The Sertoli cells (SCs) are located within the seminiferous epithelium creating the blood-testis barrier, which is responsible for a specic microenvironment where post-meiotic germ cell development
takes place. Thus, SCs supply the physical and nutritional support

Abbreviations: 1H-NMR, proton nuclear magnetic resonance; ACoA Hyd, Acetyl-CoA

hydrolase; ACoA Synt, Acetyl-CoA synthase; AR, androgen receptor; ATP, Adenosine-5triphosphate; Ck-18, Cytokeratin-18; DHT, 5-Dihydrotestosterone; DM, Diabetes
Mellitus; dNTPs, deoxynucleotide triphosphates; E2, 17-estradiol; EDTA, Ethylenediaminetetraacetic acid; ER, estrogen receptor; GLUT1, glucose transporter 1; GLUT3, glucose transporter 3; hSCs, human Sertoli cells; InsD, insulin deprivation; LDHA, lactate
dehydrogenase A; MCT4, monocarboxylate transporter 4; RT-PCR, reverse transcriptase
polymerase chain reaction; M-MLV RT, moloney murine leukemia virus reverse transcriptase; SCs, Sertoli cells
Corresponding author at: Health Sciences Research Centre, Faculty of Health Sciences, University of Beira Interior, Av. Infante D. Henrique , 6201-506 Covilh, Portugal.
E-mail address: pfobox@gmail.com (P.F. Oliveira).
0167-4889/$ see front matter 2012 Elsevier B.V. All rights reserved.
doi:10.1016/j.bbamcr.2012.06.002

for germ cells. The developing germ cells are unable to use glucose
for their energy metabolism and preferentially use lactate as a substrate for ATP production [13]. The SCs are often described as
nurse cells because they produce the lactate used by the developing
germ cells. Although glucose is described as the preferred substrate of
SCs, they can metabolize other substrates such as fatty acids and ketone bodies [4]. Also, in the absence of glucose, the lactate production
by SCs has been suggested to occur due to aminoacids or glycogen
metabolism [5,6]. Since the spermatogenic cells that undergo differentiation go through changes in their metabolism [7], it has been
suggested that there are specic metabolic signals required for the
differentiation process of germ cells to occur [810].
Androgens and estrogens are known to play a crucial role in testis
of mammals and particularly in SCs [11,12]. We have recently described [13,14] that 17-estradiol (E2) and 5-Dihydrotestosterone
(DHT) regulate SCs metabolism by modulating glucose metabolism.
DHT-treated cells consumed less glucose and as expected produced
less lactate. Those were the rst reports showing that E2 and DHT

1390

M.G. Alves et al. / Biochimica et Biophysica Acta 1823 (2012) 13891394

control lactate metabolism in SCs by changing the gene transcript

levels of MCT4, a membrane protein mainly involved in lactate export
to extracellular medium [15], of GLUT3, a membrane protein involved
in glucose transport [16], and of LDHA, a subunit of an enzyme responsible for the interconversion of pyruvate to lactate [17]. We concluded that E2 increased MCT4 gene transcript levels while DHT
decreased LDHA and GLUT3 gene transcript levels. More recently,
we further extended the knowledge on the hormonal regulation of
SCs metabolism by assessing the effect of the absence of insulin
[18]. In insulin-deprivation conditions, SCs differentially modulate
GLUT1 and GLUT3 gene transcript levels in order to maintain glucose
consumption. Nevertheless, insulin-deprived cells presented decreased LDHA and MCT4 expression levels and signicantly lower
production of lactate [18]. The data obtained in these experiments
with insulin-deprivation conditions raised several questions concerning SCs metabolism, since lactate production was severely affected while extracellular glucose consumption was kept constant,
although under hormonal control.
In fact, it is well known that SCs can use various metabolites as energy sources [19] and that they are the most important testicular cells
for the conversion of essential fatty acids [20]. When labeled fatty
acids were injected in the testis, they were rstly taken and metabolized by SCs [21]. Acetate has been described as a crossroad metabolite and is the most common intermediate for the synthesis of fatty
acids and also of cholesterol [22]. Acetyl-CoA synthase (ACoA Synt)
is responsible for the esterication of acetate to acetyl-CoA in the cytosol and mitochondria [23,24] and, reversely, Acetyl-CoA hydrolase
(ACoA Hyd) is responsible for the re-conversion of acetyl-CoA to acetate [25]. We hypothesize that SCs, due to their function as nurse
cells, export acetate for developing germ cells and that this acetate
production could be under hormonal regulation. To test our hypothesis, we analyzed acetate production by hSCs cultured in vitro in the
presence or absence of E2 and DHT and also under insulindeprivation conditions. The gene expression levels of ACoA Synt and
ACoA Hyd were also determined to examine if the crossroad pathway
of acetate metabolism would be hormonally regulated.
2. Material and Methods
2.1. Chemicals
The Taq DNA Polymerase was purchased from Fermentas Life Sciences (Ontario, Canada). Random primers, polyclonal antibodies and
M-MLV RT were purchased from Invitrogen (Carlsbad, CA, USA), the
dNTPs were purchased from GE Healthcare (Buckinghamshire, UK)
and Fetal Bovine Serum (FBS) was obtained from Biochrom AG (Berlin,
Germany). All other chemicals were purchased from Sigma-Aldrich
(St. Louis, MO, USA).

2.3. Sertoli cell culture

Human SCs were obtained by previously described methods [14].
Culture purity was assessed by immunoperoxidase detection of SCsspecic markers such as anti-mullerian hormone and vimentin.
Only cultures with cell contaminants below 5%, as examined by
phase contrast microscopy after 96 h, were used. The possibility of
hSCs dedifferentiation was discarded by evaluation of mRNA expression of Cytokeratin-18 (Ck-18) that is known to be only present in
immature SCs. No expression of Ck-18 was observed after or before
treatments.
2.4. Experimental groups
After hSCs reached 90-95% of conuence, they were washed and
the medium replaced by serum-free medium (DMEM:F12 1:1 with
ITS supplement, pH 7.4) [Control group]. To evaluate the effect of E2
and DHT in acetate metabolism, hSCs were treated with 100 nM of
E2 [E2 group] or 100 nM of DHT [DHT group]. The total estrogen or
androgen content in the interstitial testicular uid have been described and several works found values of estrogen ranging from 2
to 700 nM [2729]. It has also been described that intratesticular testosterone levels can reach 4000 nM, although DHT levels are not as
high in the interstitial uid [30,31]. Therefore, these concentrations
were chosen based on previous studies by our team and others, and
also based on works reporting that in intratesticular interstitial uid
the concentrations of these hormones are higher than in circulating
plasma reaching values up to 200 nanomolar [3235]. In order to
evaluate the effect of insulin in acetate metabolism, SC medium was
supplemented either with Insulin-Transferrin-Sodium Selenite
(10 mg/mL - 5 mg/mL - 5 g/mL, respectively) [Control group] or
with Transferrin-Sodium Selenite (5 mg/mL - 5 g/mL, respectively)
[InsD group].
During the experimental period, 250 L of the culture medium
were collected for 1H-NMR analysis at different time intervals: 0-6,
6-24 and 24-48 hours. At the end of the treatment, the cells were detached using a trypsin-EDTA solution and collected for RNA extraction. A viability test was performed using the Trypan Blue Exclusion
Test and the total number of cells per ask was determined with a
Neubauer chamber.
2.5. NMR spectroscopy
1
H-NMR spectroscopy was performed to determine acetate production in different experimental groups during the time-course of
experiment using previously described conditions [36]. Sodium fumarate (nal concentration of 2 mM) was used as an internal reference
(singlet, 6.50 ppm) to quantify the acetate in solution (singlet,
1.91 ppm).

2.2. Patient Selection, Ethical Issues and Testicle Tissue Preparations

2.6. RT-PCR
Testicle tissue and the clinical study of the patients were performed at the Centre for Reproductive Genetics Alberto Barros
(Porto, Portugal) in accordance with the Guidelines of the Local, National and European Ethical Committees. The testicular biopsies
were obtained from infertile patients under treatment for recovery
of male gametes and used after informed written consent. Only cells
left in the tissue culture plates after treatment of the patients were
used. Studies have been performed according to the Declaration of
Helsinki for Medical Research involving Human Subjects.
Human SCs were isolated from ve testicular biopsies with conserved spermatogenesis (patients with anejaculation psychological,
vascular or neurologic and vasectomy or traumatic section of the
vas deferens). After selection, each biopsy was collected in sperm
preparation medium (SPM-Hepes buffer; Medicult) and kept at
32 C with 5% CO2 in air until use as previously described [26].

Total RNA (RNAt) was isolated from hSCs by using TRI reagent
according to the manufacturer's instructions. RNAt concentration
and absorbance ratios (A260/A280) were determined by spectrophotometry (Nanophotometer TM, Implen, Germany) and RNAt was reversely transcribed using standard methods [37]. The resulting
cDNA was used to amplify Acetyl-CoA hydrolase and Acetyl-CoA
synthase cDNA fragments using exon-exon spanning primer sets
according to the conditions indicated in Table 1. The PCR reactions
were carried out in triplicate. Kidney mRNA was used as positive control and cDNA-free sample was used as negative control. The ACoA
Hyd and ACoA Synt mRNA levels were normalized with 18 S gene expression as internal control. The PCR products were separated electrophoretically, stained with ethidium bromide and visualized using
a CN-TFX imaging system equipped with a monochrome CCD camera

M.G. Alves et al. / Biochimica et Biophysica Acta 1823 (2012) 13891394

Table 1
Oligonucleotides and cycling conditions for PCR amplication of Acetyl CoA synthase
(ACoA Synt), Acetyl CoA hydrolase (ACoA Hyd) and 18 S. Abbreviations: AT - annealing
temperature; C - number of cycles during exponential phase of amplication.
Gene name/
Genbank
accession
number

Sequence (5'3)

ACoA Hyd/
AB078619
ACoA Synt/
AF263614
18S/
K03432. 1

Sense: AGATTATGGCGTGGATGGAGAC
Antisense: GACAATGGCAGTGAAGACAAGAC
Sense: CAGAAGTGTCAGGAGAAGG
Antisense: TGCCACCACAAGTCAATC
Sense: AAGACGAACCAGAGCGAAAG
Antisense: GGCGGGTCATGGGAATAA

AT
(C)

Amplicon
Size

1391

the rst 6 hours of culture. When studying the gene transcript levels
of ACoA Synt and ACoA Hyd, we found that in control conditions,
the ratio ACoA Hyd/ACoA Synt was 1.22 0.06 indicating that ACoA
Hyd is more expressed in control conditions than ACoA Synt (Fig. 3).

60

143

40

60

150

40

56

149

25

using standard methods. Intensities of the band of each fragment

were measured according to standard methods, using BIO-PROFIL
Bio-1D Software from Quantity One (Vilber Lourmat, Marne-laValle, France). The obtained band density for each sample was divided by the respective 18 S band density to obtain the relative abundance in each experimental condition (Control, E2, DHT and InsD
groups). Relative abundances of the E2, DHT and InsD groups were divided by the relative abundances of the Control group to express the
values as fold induction/reduction of the treated groups versus the
Control.

3.2. DHT-treated cells produce less acetate and display decreased ACoA
Hyd gene transcript levels
It has been described that SCs under DHT treatment have altered
glucose metabolism. We expected that DHT could also modulate acetate metabolism. Accordingly, DHT-treated cells produced signicantly more acetate (168 3 pmol/cell) than cells from the control group
during the rst 6 hours (Fig. 1A) at a rate of 28 0.4 pmol/cell/h
(Fig. 1B). Noteworthy, this acetate production rapidly decreases between the 6th and the 24th hour, producing less acetate than control
group in this period (Fig. 1B), and remains at a basal level until the
48th hour (Fig. 1B). This change in acetate metabolism was followed
by alterations in the gene transcript levels of ACoA Hyd that were signicantly decreased to 0.86 0.04 fold of control group after 48 hours
while the ACoA Synt gene transcript levels were not signicantly altered (Fig. 2). Nevertheless, when looking for the ratio between
ACoA Hyd/ACoA Synt, there were no signicant alterations relatively
to the control (Fig. 3). The androgen receptor (AR) mRNA gene transcript level was not signicantly altered after DHT-treatment (Data
not shown).

2.7. Statistical analysis

The statistical signicance of acetate variation and mRNA expression (ACoA Hyd and ACoA Synt) among the experimental groups
was assessed by one-way ANOVA, followed by Dunn post-test. The
statistical analysis was performed using GraphPad Prism 5 (GraphPad
Software, San Diego, CA). P b 0.05 was considered signicant. All experimental data are shown as mean SEM (n = 5 for each condition).
3. Results
3.1. SCs cultured under control conditions produce high amounts of
acetate
SCs are often described as major lactate producers to the developing germ cells. Nevertheless, they are also expected to produce other
factors and co-factors important for germ cell development. Interestingly, we have found that in the rst 6 hours of culture, SCs cultured
in control conditions produce 153 5 pmol/cell of acetate (Fig. 1A)
at a rate of 26 1 pmol/cell/h (Fig. 1B). This acetate production rapidly decreases to 4 1 pmol/cell/h, between the 6th and 24th hour, and
to 2 1 pmol/cell/h between the 24th and 48th hour (Fig. 1B). Thus,
the nal acetate production after 48 hours was 166 9 pmol/cell
(Fig. 1A). Noteworthy, the majority of acetate was produced during

3.3. E2-treated cells show increased acetate production and ACoA Hyd
gene transcript levels
It is known that SCs under E2 treatment alter their glucose metabolism to alanine production although the lactate production remained
unaltered. We could also expect that, at some point, E2-treated cells display alterations in acetate production. During the rst 6 hours of culture, E2-treated cells produce signicantly more acetate (197 12
pmol/cell) than cells in control group (Fig. 1A) at a rate of 33 2
pmol/h/cell (Fig. 1B). Although the acetate production rate decreased
to 4 1 pmol/h/cell between the 6th and 24th hour (Fig. 1B), at the
end of this period the acetate production was signicantly higher
(229 7 pmol/cell) (Fig. 1A) than in control or DHT-treated cells. At
the end of the 48th hour of treatment, acetate production was also signicantly higher (188 7 pmol/cell) in E2-treated cells than in the control or DHT-treated cells (Fig. 1A). After the 48 hours, the ACoA Hyd
gene transcript levels were also signicantly increased when comparing
to DHT-treated cells (Fig. 2) although the ratio between ACoA Hyd and
ACoA Synt was not signicantly different between the cells from E2 and
DHT groups, nor between E2 and control cells (Fig. 3). The estrogen receptors ER, ER and GPR30 mRNA gene transcript levels were not signicantly altered after E2-treatment (Data not shown).

Fig. 1. Acetate production (A) and acetate production rate (B) in human Sertoli cells cultured in vitro in control (Ctrl), after E2 or DHT-treatment, and in insulin-deprivation (InsD)
conditions. Results are expressed as mean SEM (n = 5). Signicantly different results (P b 0.05) are as indicated: * - vs control; # - vs DHT-treatment; + - vs E2-treatment.

1392

M.G. Alves et al. / Biochimica et Biophysica Acta 1823 (2012) 13891394

Fig. 2. Gene transcript levels of Acetyl CoA hydrolase (ACoA Hyd) and Acetyl CoA synthase (ACoA Synt) after E2 and DHT-treatment, and in insulin deprivation conditions (InsD).
Panel A shows a representative agarose gel electrophoresis. Panel B shows fold variation of ACoA Hyd and ACoA Synt gene transcript levels relative to control, after normalization of
individual bands density with those of 18 S. The results are expressed as mean SEM (n = 5). Signicantly different results (P b 0.05) are as indicated: * - vs to control; # - vs DHT
treatment; + - vs E2-treatment; vs ACoA Hyd.

3.4. Insulin deprivation supresses acetate production and alters ACoA

Hyd/ACoA Synt ratio
Insulin deprivation has proved to modulate SCs metabolism and
transcript levels of metabolism-associated genes. In fact, insulin deprivation decreases initial glucose consumption, decreases lactate production and is involved in the regulation of transcription of genes crucial for
lactate production and export. Thus, it was also expected that insulin
deprivation could modulate acetate metabolism. In fact, the production
of acetate detected in control conditions was completely supressed in
the rst 6 hours of insulin-deprivation (Fig. 1A). The suppression of acetate production continued during the 48 hours of insulin-deprivation
(Fig. 1A). As expected, the acetate production rate was not different
from zero, except for the rst 6 hours where the rate was very low
(Fig. 1B). Interestingly, the insulin-deprived hSCs only produced a
very low, insignicant amount of acetate during all the 48 hours of
culture (Fig. 1A). Noteworthy, insulin-deprived cells have also
signicantly less mRNA gene transcript levels of ACoA Hyd than ACoA
Synt, (Fig. 2). The ACoA Hyd gene transcript levels decreased in
insulin-deprived cells to 0.8 0.01 fold the levels of the control group,
after the 48 hours treatment (Fig. 2). The ACoA Hyd gene transcript
levels of insulin-deprived hSCs were also signicantly lower when compared to E2-treated cells (1.02 0.05 fold variation to control) (Fig. 2).
The signicant lower ACoA Hyd gene transcript levels was reected in a
signicantly lower ratio of ACoA Hyd/ACoA Synt (0.98 0.07) than control (1.22 0.06), E2 (1.09 0.03) and DHT-treated cells (1.13 0.06)
(Fig. 3).

Fig. 3. Ratio of Acetyl CoA hydrolase (ACoA Hyd)/Acetyl CoA synthase (ACoA Synt)
gene transcript levels in control conditions (Ctrl), after E2 and DHT-treatment, and
in insulin deprivation conditions (InsD). The results are expressed as mean SEM
(n = 5). Signicantly different results (P b 0.05) are as indicated: * - vs to control;
# - vs DHT treatment; + - vs E2-treatment.

4. Discussion
SCs metabolism is crucial for the developing germ cells as they produce lactate, which is the preferred energy substrate for spermatocytes
and spermatids [1,2], leading to the conclusion that changes in carbohydrate metabolism of SCs may result in a compromised spermatogenesis.
In this work hSCs were obtained from individuals undergoing infertility
treatment but displaying conserved spermatogenesis. Selected patients
had conserved spermatogenesis and the cases included anejaculation
psychological, vascular or neurologic and vasectomy or traumatic section of the vas deferens. We have recently described the metabolic
modulation induced by sex steroid hormones and insulin in SCs
[13,14,18]. One of the most interesting ndings was that lactate production, which is crucial for developing germ cells, was severely affected by
hormonal treatment.
It is also known that SCs can utilize lipids, and particularly fatty
acids, as the major source to produce energy through -oxidation
[38] and that they can oxidize palmitate to CO2 and ketone bodies
[39]. Acetate, which is converted to Acetyl-CoA in the cytosol and mitochondria by Acetyl-CoA synthase [23], is commonly described as an
intermediate for synthesis of fatty acids and cholesterol [22]. We observed that, in control conditions, SCs produced and exported high
amounts of acetate (166 9 pmol/cell) to the extracellular medium.
Interestingly this acetate production was much higher than the one
described in the literature for lactate production (13.0 0.4 pmol/
cell) for hSCs cultured in the same conditions [14]. Thus, hSCs not
only produce lactate but also acetate, probably for the developing
germ cells. It is well known that lactate is the preferred substrate
for round spermatids [40] and spermatocytes [1] but the signicance
of this elevated production of acetate has not been investigated so far.
SCs are also responsible for the synthesis and export of several cofactors that maintain spermatogenesis. And although it has been described that in human spermatozoa there is a greater glucose oxidation than acetate [41], one of the crucial processes known to occur
in the developing germ cells during spermatogenesis is a high rate
of lipid synthesis and remodeling [42,43], a process where glucose
and lipid metabolism sub-products can be utilized for the de novo
synthesis of lipids. This lipid's synthesis could be maintained by a
high concentration of acetate, as this metabolite has long been recognized as a central metabolite in the synthesis of cholesterol and other
precursors essential in lipid and phospholipid composition [43,44]. It
is also well known that in some metabolically active cells, such as rat
ventral prostate cells, androgens play a crucial role in acetate incorporation into phospholipids [45]. Also, progesterone decreases the rate
of glucose and acetate uptake in slices of luteinized rat ovary [46].
These studies showed that acetate metabolism is under strict hormonal control in the reproductive system, where hormonal regulation is crucial.

M.G. Alves et al. / Biochimica et Biophysica Acta 1823 (2012) 13891394

We have previously described that glucose metabolism in rat [13]

and human [14,18] SCs is under hormonal control, but the hormonal
regulation of acetate production by those cells remained unexplored
up till now. With the work described herein, we concluded that
DHT and E2 stimulate acetate production during the rst 6 hours of
culture, although after 48 hours these hormones have a very distinct
effect. Acetate production was decreased by DHT and increased by
E2 treatment although the mRNA gene transcript levels of hormone
receptors AR, ER, ER and GPR30 remained unchanged after the
hormonal treatment. The decrease of acetate production by DHT
treatment is related with a decrease on gene transcript levels of
ACoA Hyd, since ACoA Hyd is responsible for the hydrolysis of
acetyl-CoA to acetate plus coenzyme A [25]. Although these changes
on mRNA levels are not a direct measure of the protein functioning,
they clearly indicate a regulatory effect of DHT on ACoA Hyd expression and a decrease on gene transcript levels of ACoA Hyd would reect a decrease on acetate production. In fact, we have described
that DHT increased glucose consumption but decreased lactate production [14]. This fact, led us to suggest that DHT-treated cells were
redirecting glucose metabolism to Krebs cycle. This hypothesis is concomitant with the observed decrease on acetate production, because
if glucose uptake is similar in DHT-treated and control SCs, and as in
DHT-treated cells acetate production is decreased, acetyl-CoA is not
being degraded by ACoA Hyd to acetate and coenzyme A in these
cells, leading us to suggest that acetyl-CoA is being involved preferentially as a substrate for Krebs cycle. The suggestion that DHT stimulates the Krebs cycle is supported by studies that showed an
increase on the activity and expression of enzymes involved in
Krebs cycle by DHT [47].
Acetate metabolism is also known to be regulated by insulin under
in vitro conditions [48] and several studies have already described a
relation between acetate and glucose metabolism, supporting a conversion between acetate and glucose (via Acetyl-CoA) [23,49]. Interestingly, as we described above, in vitro hSCs cultured under
insulin-deprivation suppressed acetate production. In our previous
studies, we concluded that hSCs cultured in insulin-deprivation conditions presented a similar glucose consumption when compared
with control group (insulin available), but lactate production was severely compromised in cells exposed to insulin-deprivation conditions, by modulation of lactate export via MCTs and lactate
conversion from pyruvate by LDH [18]. Those results clearly pointed
to a glycolysis inhibition in insulin-deprivation conditions. We also
observed that ACoA Hyd gene transcript levels were signicantly decreased in insulin-deprivation conditions, which exhibit an unbalanced ratio ACoA Hyd/ACoA Synt in favor of ACoA Synt. In these
conditions, there is greater acetate consumption with coenzyme A,
to form acetyl-CoA, than acetate production from acetyl-CoA. Noteworthy, acetate production is not only reduced but is indeed
suppressed. This is concomitant with a major decrease on glycolysis
as described previously by our group [18]. Thus, it seems that in conditions of insulin absence SCs maintain their physiologic need for energy by switching from glycolysis, the preferred way to do it and
assure lactate for developing germ cells, to a Krebs cycle preference
that allow them to survive in these difcult conditions, although
compromising the possible development of germ cells and consequently, the spermatogenesis.
Our results point towards a very important role for acetate in spermatogenesis. Although it has been suggested that SCs produce acetate,
this is the rst report that quanties this metabolite production by in
vitro cultured hSCs.
The high amount of acetate produced in control conditions led us
to conclude that, although lactate seems to play the main role in the
energizing of the developing germ cells, acetate and acetate metabolism have a probable role in producing sub-products essential to maintain a high rate of lipid synthesis in the developing germ cells. Hence,
acetate may play key roles on the progression of spermatogenesis and

1393

new experiments will be needed to test this hypothesis. Additionally,

we show that acetate metabolism is under hormonal regulation. The
steroid hormones DHT and E2, similarly to what have been described
for lactate metabolism, act in a very distinct manner. E2 increases acetate production by increasing ACoA Hyd, while DHT-treated cells decrease acetate production, by differently modulating the ratio ACoA
Hyd/ACoA Synt. Remarkably, insulin-deprivation dramatically changed hSCs metabolism by completely suppressing acetate production
and export. This condition of insulin-deprivation roughly mimics
type I diabetes mellitus, enlightening a possible reason for the fertility
problems in individuals with this pathology. Besides the already described alterations in lactate metabolism, we concluded in this work
that insulin is crucial for the production of acetate by hSCs in vitro.
The results presented here raise new questions and point new directions towards the understanding of the hormonal control of hSCs
metabolism and thus of spermatogenesis. Co-culture experiments
are the next logical step to clarify the role of acetate on the interaction
between germ cells and SCs. The full enlightenment of the hormonal
control of hSCs metabolism is crucial to clarify the mechanisms behind the numerous hormonally-dependent infertility conditions.
Acknowledgments
This work was partially supported by the Pluriannual Programme
of Portuguese Foundation for Science and Technology (FCT). PF
Oliveira was nanced by FCT under the program Cincia 2008 and
PTDC/QUI-BIQ/121446/2010. M.G Alves was nanced by FCT (SRFH/
BPD/80451/2011).
References
[1] N.H. Jutte, J.A. Grootegoed, F.F. Rommerts, H.J. van der Molen, Exogenous lactate
is essential for metabolic activities in isolated rat spermatocytes and spermatids,
J. Reprod. Fertil. 62 (1981) 399405.
[2] M. Mita, J.M. Price, P.F. Hall, Stimulation by follicle-stimulating hormone of synthesis of lactate by Sertoli cells from rat testis, Endocrinology 110 (1982)
15351541.
[3] F. Boussouar, M. Benahmed, Lactate and energy metabolism in male germ cells,
Trends Endocrinol. Metab. 15 (2004) 345350.
[4] L. Rato, M.G. Alves, S. Socorro, A.I. Duarte, J.E. Cavaco, P.F. Oliveira, Metabolic regulation is important for spermatogenesis, Nat. Rev. Urol. 9 (2012)
330228.
[5] B. Leiderman, R.E. Mancini, Glycogen content in the rat testis from postnatal to
adult ages, Endocrinology 85 (1969) 607609.
[6] G.R. Slaughter, A.R. Means, Follicle-stimulating hormone activation of glycogen
phosphorylase in the Sertoli cell-enriched rat testis, Endocrinology 113 (1983)
14761485.
[7] M. Bajpai, G. Gupta, B.S. Setty, Changes in carbohydrate metabolism of testicular
germ cells during meiosis in the rat, Eur. J. Endocrinol. 138 (1998) 322327.
[8] E. Herrera, K. Salas, N. Lagos, D.J. Benos, J.G. Reyes, Energy metabolism and its
linkage to intracellular Ca2 + and pH regulation in rat spermatogenic cells, Biol.
Cell 92 (2000) 429440.
[9] J.G. Reyes, E. Herrera, L. Lobos, K. Salas, N. Lagos, R.A. Jorquera, P. Labarca, D.J.
Benos, Dynamics of intracellular calcium induced by lactate and glucose in rat
pachytene spermatocytes and round spermatids, Reproduction 123 (2002)
701710.
[10] A.J. Yanez, X. Bustamante, R. Bertinat, E. Werner, M.C. Rauch, I.I. Concha, J.G.
Reyes, J.C. Slebe, Expression of key substrate cycle enzymes in rat spermatogenic
cells: fructose 1,6 bisphosphatase and 6 phosphofructose 1-kinase, J. Cell. Physiol.
212 (2007) 807816.
[11] S. Komori, H. Kasumi, K. Sakata, K. Koyama, The role of androgens in spermatogenesis, Soc. Reprod. Fertil. Suppl. 63 (2007) 2530.
[12] S. Carreau, H. Bouraima-Lelong, C. Delalande, Role of estrogens in spermatogenesis, Front. Biosci. (Elite Ed.) 4 (2012) 111.
[13] L. Rato, M.G. Alves, S. Socorro, R.A. Carvalho, J.E. Cavaco, P.F. Oliveira, Metabolic
modulation induced by oestradiol and DHT in immature rat Sertoli cells cultured
in vitro, Biosci. Rep. 32 (2012) 6169.
[14] P.F. Oliveira, M.G. Alves, L. Rato, J. Silva, R. Sa, A. Barros, M. Sousa, R.A. Carvalho,
J.E. Cavaco, S. Socorro, Inuence of 5-Dihydrotestosterone and 17-Estradiol
on Human Sertoli Cells Metabolism, Int. J. Androl. 34 (2011) e612e620.
[15] M.N. Galardo, M.F. Riera, E.H. Pellizzari, S.B. Cigorraga, S.B. Meroni, The AMPactivated protein kinase activator, 5-aminoimidazole-4-carboxamide-1-b-D-ri
bonucleoside, regulates lactate production in rat Sertoli cells, J. Mol. Endocrinol.
39 (2007) 279288.
[16] B. Thorens, Glucose transporters in the regulation of intestinal, renal, and liver
glucose uxes, Am. J. Physiol. 270 (1996) G541553.

1394

M.G. Alves et al. / Biochimica et Biophysica Acta 1823 (2012) 13891394

[17] C. Hawtrey, E. Goldberg, Differential synthesis of LDH in mouse testes, Ann. N. Y.

Acad. Sci. 151 (1968) 611615.
[18] P.F. Oliveira, M.G. Alves, L. Rato, S. Laurentino, J. Silva, R. Sa, A. Barros, M. Sousa,
R.A. Carvalho, J.E. Cavaco, S. Socorro, Effect of insulin deprivation on metabolism
and metabolism-associated gene transcript levels of in vitro cultured human
Sertoli cells, Biochim. Biophys. Acta 1820 (2012) 8489.
[19] J. Grootegoed, R. Oonk, R. Jansen, H. Van der Molen, Metabolism of radiolabelled
energy-yielding substrates by rat Sertoli cells, Reproduction 77 (1986) 109.
[20] K. Retterstol, T. Haugen, T. Tran, B. Christophersen, Studies on the metabolism of
essential fatty acids in isolated human testicular cells, Reproduction 121 (2001)
881.
[21] J.K. Beckman, J.G. Coniglio, The metabolism of polyunsaturated fatty acids in rat
Sertoli and germinal cells, Lipids 15 (1980) 389394.
[22] M. Yoshimoto, A. Waki, Y. Yonekura, N. Sadato, T. Murata, N. Omata, N. Takahashi,
M.J. Welch, Y. Fujibayashi, Characterization of acetate metabolism in tumor cells
in relation to cell proliferation: acetate metabolism in tumor cells, Nucl. Med.
Biol. 28 (2001) 117122.
[23] B. Crabtree, M.J. Gordon, S.L. Christie, Measurement of the rates of acetyl-CoA hydrolysis and synthesis from acetate in rat hepatocytes and the role of these uxes
in substrate cycling, Biochem. J. 270 (1990) 219225.
[24] R.P. Goldberg, H. Brunengraber, Contributions of cytosolic and mitochondrial
acetyl-CoA syntheses to the activation of lipogenic acetate in rat liver, Adv. Exp.
Med. Biol. 132 (1980) 413418.
[25] H. Yamashita, A. Itsuki, M. Kimoto, M. Hiemori, H. Tsuji, Acetate generation in rat
liver mitochondria; acetyl-CoA hydrolase activity is demonstrated by 3-ketoacylCoA thiolase, Biochim. Biophys. Acta 1761 (2006) 1723.
[26] P.F. Oliveira, M. Sousa, A. Barros, T. Moura, A. Rebelo da Costa, Intracellular pH
regulation in human Sertoli cells: role of membrane transporters, Reproduction
137 (2009) 353359.
[27] B. Setchell, M. Laurie, A. Flint, R. Heap, Transport of free and conjugated steroids
from the boar testis in lymph, venous blood and rete testis uid, J. Endocrinol.
96 (1983) 127136.
[28] R. Hess, K. Carnes, The role of estrogen in testis and the male reproductive tract: a
review and species comparison, Anim. Reprod. 1 (2004) 530.
[29] M.Y. Roth, K. Lin, J. Amory, A. Matsumoto, B. Anawalt, C. Snyder, T. Kalhorn, W.
Bremner, S. Page, Serum LH correlates highly with intratesticular steroid levels
in normal men, J. Androl. 31 (2010) 138.
[30] A.D. Coviello, W.J. Bremner, A.M. Matsumoto, K.L. Herbst, J.K. Amory, B.D.
Anawalt, X. Yan, T.R. Brown, W.W. Wright, B.R. Zirkin, J.P. Jarow, Intratesticular
Testosterone Concentrations Comparable With Serum Levels Are Not Sufcient
to Maintain Normal Sperm Production in Men Receiving a Hormonal Contraceptive Regimen, J. Androl. 25 (2004) 931938.
[31] J.P. Jarow, B.R. Zirkin, The androgen microenvironment of the human testis and
hormonal control of spermatogenesis, Ann. N. Y. Acad. Sci. 1061 (2005) 208220.
[32] R.A. Hess, Oestrogen in uid transport in efferent ducts of the male reproductive
tract, Rev. Reprod. 5 (2000) 8492.

[33] J.P. Jarow, H. Chen, T.W. Rosner, S. Trentacoste, B.R. Zirkin, Assessment of the androgen environment within the human testis: minimally invasive method to obtain
intratesticular uid, J. Androl. 22 (2001) 640645.
[34] P. Vijay, R. Yeshwanth, K.L. Bairy, The effect of sodium valproate on the biochemical parameters of reproductive function in male albino Wistar rats, Indian J.
Pharmacol. 40 (2008) 248250.
[35] M. Zhao, S.D. Baker, X. Yan, Y. Zhao, W.W. Wright, B.R. Zirkin, J.P. Jarow, Simultaneous determination of steroid composition of human testicular uid using liquid
chromatography tandem mass spectrometry, Steroids 69 (2004) 721726.
[36] M.G. Alves, P.F. Oliveira, F.O. Martins, P.J. Oliveira, R.A. Carvalho, Gender-dependent Metabolic Remodeling During Heart Preservation in Cardioplegic Celsior
and Histidine Buffer Solution, J. Cardiovasc. Pharmacol. 59 (2012) 151157.
[37] S. Laurentino, J. Gonalves, J.E. Cavaco, P.F. Oliveira, M.G. Alves, M. de Sousa, A.
Barros, S. Socorro, Apoptosis-inhibitor Aven is downregulated in defective spermatogenesis and a novel estrogen target gene in mammalian testis, Fertil. Steril.
96 (2011) 745750.
[38] W. Xiong, H. Wang, H. Wu, Y. Chen, D. Han, Apoptotic spermatogenic cells can be
energy sources for Sertoli cells, Reproduction 137 (2009) 469479.
[39] N.H. Jutte, L. Eikvar, F.O. Levy, V. Hansson, Metabolism of palmitate in cultured rat
Sertoli cells, J. Reprod. Fertil. 73 (1985) 497503.
[40] M. Mita, P.F. Hall, Metabolism of round spermatids from rats: lactate as the preferred substrate, Biol. Reprod. 26 (1982) 445455.
[41] C. Terner, Oxidation of exogenous substrates by isolated human spermatozoa,
Am. J. Physiol. 198 (1960) 4850.
[42] G.M. Oresti, J.G. Reyes, J.M. Luquez, N. Osses, N.E. Furland, M.I. Aveldano, Differentiation-related changes in lipid classes with long-chain and very long-chain polyenoic fatty acids in rat spermatogenic cells, J. Lipid Res. 51 (2010) 29092921.
[43] M. Bajpai, G. Gupta, S. Jain, B. Setty, Lipid metabolising enzymes in isolated rat
testicular germ cells and changes associated with meiosis, Andrologia 30
(1998) 311315.
[44] B.V. Howard, Acetate as a carbon source for lipid synthesis in cultured cells, Biochim. Biophys. Acta 488 (1977) 145151.
[45] N. del Hoyo, J.A. Pulido, M.T. Carretero, M.A. Perez-Albarsanz, Comparison of linoleate, palmitate and acetate metabolism in rat ventral prostate, Biosci. Rep. 10
(1990) 105112.
[46] A.P. Flint, Effects of progesterone in vitro on glucose and acetate metabolism by
the luteinized rat ovary, J. Endocrinol. 46 (1970) 497506.
[47] G. Gupta, A. Srivastava, B.S. Setty, Androgen-estrogen synergy in the regulation of
energy metabolism in epididymis and vas deferens of rhesus monkey, Endocr.
Res. 17 (1991) 383394.
[48] H. Sone, H. Shimano, Y. Sakakura, N. Inoue, M. Amemiya-Kudo, N. Yahagi, M. Osawa,
H. Suzuki, T. Yokoo, A. Takahashi, K. Iida, H. Toyoshima, A. Iwama, N. Yamada, Acetyl-coenzyme A synthetase is a lipogenic enzyme controlled by SREBP-1 and energy
status, Am. J. Physiol. Endocrinol. Metab. 282 (2002) E222230.
[49] S.E. Knowles, I.G. Jarrett, O.H. Filsell, F.J. Ballard, Production and utilization of acetate in mammals, Biochem. J. 142 (1974) 401.