Bioresource Technology 202 (2016) 17

Contents lists available at ScienceDirect

Bioresource Technology
journal homepage: www.elsevier.com/locate/biortech

Selective conversion of carbon monoxide to hydrogen by anaerobic

mixed culture
Yafeng Liu a,b, Jingjing Wan a, Sheng Han b, Shicheng Zhang a, Gang Luo a,
a
b

Shanghai Key Laboratory of Atmospheric Particle Pollution and Prevention (LAP3), Department of Environmental Science and Engineering, Fudan University, 200433 Shanghai, China
School of Chemical and Environmental Engineering, Shanghai Institute of Technology, 201418 Shanghai, China

h i g h l i g h t s

Efficiently fermentative CO conversion was obtained by anaerobic granular sludge.

Addition of chloroform was necessary to achieve selective conversion of CO to H2.

Stable and efficient H2 production from CO was obtained in a continuous reactor.

Gas recirculation was crucial to increase the CO conversion efficiency.

The abundance of known CO-utilizing bacteria enriched in the reactor was very low.

a r t i c l e

i n f o

Article history:
Received 8 October 2015
Received in revised form 22 November 2015
Accepted 24 November 2015
Available online 5 December 2015
Keywords:
CO
H2
Mixed culture
Reactor performance
Microbial community

a b s t r a c t
A new method for the conversion of CO to H2 was developed by anaerobic mixed culture in the current
study. Higher CO consumption rate was obtained by anaerobic granular sludge (AGS) compared to waste
activated sludge (WAS) at 55 C and pH 7.5. However, H2 was the intermediate and CH4 was the final
product. Fermentation at pH 5.5 by AGS inhibited CH4 production, while the lower CO consumption rate
(50% of that at pH 7.5) and the production of acetate were found. Fermentation at pH 7.5 with the addition of chloroform achieved efficient and selective conversion of CO to H2. Stable and efficient H2 production was achieved in a continuous reactor inoculated with AGS, and gas recirculation was crucial to
increase the CO conversion efficiency. Microbial community analysis showed that high abundance
(44%) of unclassified sequences and low relative abundance (1%) of known CO-utilizing bacteria
Desulfotomaculum were enriched in the reactor.
2015 Elsevier Ltd. All rights reserved.

1. Introduction
The challenge in fossil fuel shortage and the threat in atmosphere pollution are becoming serious in the fast developing countries, and they lead us to search for the alternative cleaner and
sustainable energy sources. The renewable energy from biomass
is attracting more attention. Although there are biological methods
for the conversion of biomass into bioenergy, a significant part of
the biomass (e.g. lignocellulosic materials) is difficult to be biodegraded. The non-biodegradable biomass can be converted to synthesis gas (syngas) by thermo-chemical gasification (Guiot et al.,
2011).
Syngas is a mixture of mainly CO and H2, which can be used as
fuel directly (Luo et al., 2013). However, the low energy density
and toxicity of CO limit its application (Haddad et al., 2014).
Corresponding author. Tel.: +86 21 65642297.
E-mail address: gangl@fudan.edu.cn (G. Luo).
http://dx.doi.org/10.1016/j.biortech.2015.11.071
0960-8524/ 2015 Elsevier Ltd. All rights reserved.

Alternatively, CO in syngas can be converted to H2, which will

increase the amount of H2 in syngas and provide a cheap source
of H2. After further purification and separation, H2 can be used as
clean fuel or raw material for industry.
The conversion of CO to H2 by anaerobic microorganisms has
been reported previously (Henstra et al., 2007; Sokolova et al.,
2009). The detailed reaction processes of carboxydotrophic
hydrogenogenesis are shown in the following reactions:

CO H2 O ! H2 CO2

DGo0 20 kJ=mol CO

CO H2 O ! CO2 2e 2H

2H 2e ! H2

Molecular H2 is formed by the biological watergas shift reaction

(1). More specifically, the CO dehydrogenase (CODH) provides electrons and protons derived from H2O for the electron transformation
by reaction (2). At the same time, the hydrogenase supplies energy

Y. Liu et al. / Bioresource Technology 202 (2016) 17

for cell growth through reaction (3) (Phillips et al., 1994) and
reduces the protons to form H2.
Carboxydothermus
hydrogenoformans,
Desulfotomaculum
carboxydivorans et al. (Table S1) are able to metabolize CO to H2
by biological watergas shift reaction (Parshina et al., 2005;
Tiquia-Arashiro, 2014), and the process has special advantages
over chemical catalytic process, which generally requires high
temperature or pressure and has low product selectivity (Henstra
et al., 2007). The temperature and pressure needed in the biological
reaction are moderate, inducing an energy saving in the operation.
Besides, the high specificity of enzymes enable a higher product
yield with fewer by-products evolved during the process.
Furthermore, most biocatalysts can tolerate trace amounts of contaminants such as sulfur and chorine (Mohammadi et al., 2011).
Until now, there are only studies on H2 production from CO by
pure microorganisms (Haddad et al., 2014; Jung et al., 2002; Kim
et al., 2015; Younesi et al., 2008). The conversion of CO to H2 by
mixed culture has not been investigated until now, which has
the potential advantages including non-sterilized conditions and
utilization of wastewater as nutrients. It is possible to enrich one
or more of the pure microorganisms listed in Table S1 in a mixed
culture if the operation conditions are available. The conversion
of CO to CH4 or acetate by mixed culture has been reported before
(Alves et al., 2013; Guiot et al., 2011), and H2 was observed as an
intermediate during the mixed culture conversion of syngas, especially in thermophilic conditions (Guiot et al., 2011). The activities
of hydrogenotrophic methanogens (4H2 + CO2 ? CH4 + 2H2O) and
homoacetogens (4H2 + 2CO2 ? CH3COOH + 2H2O) need to be fully
inhibited (Luo et al., 2011a) in order to achieve selective conversion of CO to H2 by the mixed culture. Other scientific questions
are also needed to be considered. First, CO is both substrate and
inhibitor to microorganisms and its effect on the CO conversion
efficiency by mixed culture is still unknown (Oelgeschlager and
Rother, 2008). Second, CO has low solubility in water, and the
gasliquid mass transfer may limit its conversion in a continuously
operated reactor. Therefore, the methods to overcome the gas
liquid mass transfer limitation have to be investigated (Yasin
et al., 2015). In addition, mixed culture fermentation may involve
various microorganisms that could achieve CO conversion, and it
is necessary to characterize the microbial community compositions in the mixed culture.
Based on the above considerations, the present study aimed at
developing a new biological process for H2 production from CO
by anaerobic mixed culture. Specifically, the effects of inoculum
sources, pH, methods to inhibit hydrogen consuming microorganisms, and CO partial pressures on H2 production from CO were
investigated to achieve selective conversion of CO to H2. Moreover,
a continuous reactor was operated to study the performance of
continuous production of H2 from CO, and also gas recirculation
was tested to increase the gasliquid mass transfer. The microbial
community composition in the long-term operated reactor was
analyzed by high-throughput sequencing of the 16S rRNA genes.

2. Methods
2.1. Inoculum sources
Two different inocula were tested in order to compare their
potentials to convert CO into H2. One was the waste activated
sludge (WAS) (pH = 6.4 0.2, TSS = 15 0.1 g/L, VSS = 11.7 0.1 g/
L) obtained from Quyang wastewater treatment plant (Shanghai,
China), and the other one was anaerobic granular sludge
(AGS) (pH = 7.5 0.5, TSS = 133.4 4.6 g/L, VSS = 103.3 2.5 g/L)
obtained from an up-flow anaerobic sludge blanket (UASB) reactor

treating papermaking wastewater in Longchen Paper CO., LTD

(Jiangsu, China).
2.2. H2 production potential from CO by mixed culture
Four batch experiments were carried out. In batch experiment
1, both WAS and AGS were tested for their potentials to convert
CO to H2. The inocula were diluted by basic medium (prepared
according to a previous publication (Angelidaki and Sanders,
2004)) to 100 mL with a final VSS concentration 10 g/L. The mixture also contained 50 mM phosphate buffer saline (pH 7.5) to
keep a constant pH. The 100 mL mixtures were added to 320 mL
serum bottles, and the pH of the mixtures were then adjusted to
7.5 by 2 M NaOH. The bottles were closed with butyl stoppers
and aluminum crimps to make them air tight, and they were subsequently purged with N2 for 2 min to maintain anaerobic conditions. CO was injected into the closed bottles to achieve CO
partial pressure 0.2 atm in the gas phase. Finally, all the bottles
were incubated in a shaker at 55 C. The shaker was controlled at
300 rpm to overcome the gasliquid mass transfer limitation.
Bottles without CO were used as control to determine H2 production from endogenous respiration. During the experiments, the
gas composition (CO, H2 and CH4) in the headspace of each bottle
was measured every day, and the liquid samples were collected
and analyzed for the possible presence of volatile fatty acids
(VFA) every two days. All the tests were prepared in triplicate. In
batch experiment 2, the effect of different pH (5.5 and 7.5) on
the H2 production from CO was conducted by AGS based on the
results from batch experiment 1. In batch experiment 3, three different methods (heat pretreatment of the inoculum (120 C, 1 h),
the addition of 2-bromoethanesulfonic acid (BES) (10 mM) and
the addition of chloroform (5 mM)), were investigated to inhibit
the hydrogen consumption to increase the H2 production from
CO. The methods were chosen according to the previous studies
focusing on fermentative hydrogen production from organic
wastes/wastewater (Bundhoo et al., 2015; Luo et al., 2010) and also
our preliminary experiments. CO is both substrate and inhibitor for
microorganisms, and therefore the effect of different CO partial
pressures (0.05, 0.1, 0.2, 0.4 and 0.8 atm) on H2 production from
CO was tested in batch experiment 4. 320 mL serum bottles with
100 mL mixture containing both inoculum and nutrients were
used. The stability of H2 production process was also studied by
successively refreshing the CO in the headspace of each bottle.
The experimental procedure for batch experiments 2, 3, and 4
was similar to batch experiment 1.
2.3. H2 production from CO in a continuous reactor
A lab-scale UASB reactor with 1L working volume was used to
study the performance of continuous H2 production from CO by
anaerobic mixed culture. The reactor was inoculated with AGS,
and the VSS concentration in the reactor was 10 g/L. The temperature and pH in the bioreactor were controlled at 55 C and pH 7.5,
respectively. 2 M NaOH was used to adjust the pH. Basic medium
containing chloroform (5 mM) was fed to the UASB reactor every
two days (100 mL/2d) in order to provide nutrients and inhibit
hydrogen-consuming microorganisms. Three experimental phases
were set to study the effect of gas recirculation and increased CO
loading rate on the CO conversion efficiency. In phase I, pure CO
was continuously pumped into the reactor through a gas diffuser
at a flow rate of 1 L/d with no gas circulation. The volume and concentration of H2 and CO in the collected gas, as well as the VFA concentration in the liquid were measured periodically. From day 22
onwards (phase II), gas recirculation was implemented with a
recirculation flow rate of 1 L/h. After the reactor achieved a steady
state, the CO loading rate was doubled while the gas recirculation

Y. Liu et al. / Bioresource Technology 202 (2016) 17

was kept at 1 L/h in phase III (from 97 days), and the CO conversion
rate with increased CO loading rate was investigated.
2.4. Microbial community analysis
The inoculum of the reactor and also the sample collected from
the reactor under steady-state of phase II were used for microbial
community analysis. Three samples were obtained from the reactor on days 92, 94 and 96, and then the samples were equally
mixed together to get a representative sample. Total genomic
DNA was extracted from each sample using QIAamp DNA Stool
Mini Kit (QIAGEN,51504) according to the manufacturers instructions. 341f (CCTACACGACGCTCTTCCGATCTN) and 805r (GACTG
GAGTTCCTTGGCACCCGAGAATTCCA) were used as primers. The
PCR conditions were as follows: 94 C for 3 min; 5 cycles of three
steps: 94 C for 30 s, 45 C for 20 s, and 65 C for 30 s; 20 cycles
of three steps: 94 C for 20 s, 55 C for 20 s, and 72 C for 30 s; a
final step at 72 C for 5 min. The PCR products were purified, quantified, and used for barcoded libraries preparation and sequencing
on an Illumina Miseq platform according to the standard protocols.
The low-quality sequences were removed. The numbers of
sequences were normalized to the same sequencing depths
(3649) by MOTHUR program in order to facilitate the comparison
of the two samples. The sequences were then used for taxonomic
classification by RDP and a diversity analysis (OTU, Chao1,
Refraction curve, Shammon index and Venn diagram) by MOTHUR
program. Detailed information about the analysis can be found in
our previous study (Luo et al., 2013). The sequences of the two
samples were deposited into the NCBI sequence read archive database (PRJNA294844).
2.5. Analytic methods
The gas composition in the headspace was analyzed by a gas
chromatography equipped with a TCD. For H2, the carrier gas
was N2, and the temperatures of the injector, detector and oven
were 190 C, 110 C, and 190 C, respectively. For CH4 and CO,
the carrier gas was He, and the temperatures of the injector, detector and oven were 120 C, 110 C and 120 C, respectively. The
concentrations of acetate, propionate, iso-butyrate, butyrate, isovalerate and valerate were determined by HPLC and they were separated with a 7.8  300 Aminex HPX-87-H column (Bio-Rad) at
55 C with a refractive index detector at 50 C. The mobile phase
was 5 mmol H2SO4, at a flow rate of 0.4 mL/min. Total suspended
solids and volatile suspended solids were analyzed according to
APHA (APHA, 1995).
3. Results and discussion
3.1. H2 production potentials from CO by two different inocula
The AGS and WAS were first investigated for their potential to
convert CO to H2 under thermophilic condition at pH 7.5. As shown
in Table 1, only around 50% of the CO was consumed with WAS
after 8 days of fermentation, while CO was fully consumed with
AGS, which indicated that AGS had high potential for CO conver-

sion. It could be due to that the WAS contained mainly aerobic

microorganisms, and it took time to accumulate the anaerobic
microorganisms for CO conversion. It was supported by the long
lag phase for the experiment with WAS (four days). For the experiment with AGS, CO was fully consumed even in the first four days.
Fig. 1 shows the time course of CO consumption and products (H2
and CH4) formation by AGS. Initially H2 was the only product from
CO, but H2 was fully converted to CH4 after 6 days of fermentation.
The CH4 production was probably due to the methanogens contained in the inoculum and also the favorable conditions (pH
7.5). It was consistent with a previous study that H2 was an intermediate for CO conversion to CH4 in thermophilic anaerobic reactor for biogas production (Luo et al., 2013). Table 1 also shows the
CO balance in the batch experiment, and it was 92% for WAS and
93% for AGS. The missing 78% CO could be related with the
growth of microorganisms. Considering the higher specific activity
of CO consumption by AGS compared to WAS, further studies were
conducted to achieve selective conversion of CO to H2 by AGS.
It is known that the methanogens are sensitive to pH (Luo et al.,
2011a), and therefore the H2 production from CO at pH 5.5 with
AGS was investigated. As shown in Table 1, CO was fully consumed
after 8 days of fermentation. Although only trace amount of CH4
was found, acetate was observed as an important product besides
H2. Most of the isolated thermophilic CO-utilizing microorganisms
were hydrogenogenic bacteria and archaea (Sokolova et al., 2009),
and the production of acetate was most probably due to the presence of homoacetogens, which converted H2 and CO into acetate
(Siriwongrungson et al., 2007). From Table 1, it can be seen that
specific activities of CO consumption and H2 production at pH
7.5 by AGS were much higher than that at pH 5.5. It is consistent
with the previous reports that most of the isolated thermophilic
CO-utilizing microorganisms had optimal pH around 7 (Henstra
et al., 2007; Sokolova et al., 2009). Therefore, pH 7.5 should be
more suitable for H2 production from CO if the H2 consuming
microorganisms, especially methanogens, were inhibited.

3.2. Effects of different pretreatment methods on H2 production from

CO by AGS
Three different methods were tested to inhibit the H2 consuming microorganisms in the AGS in order to increase the H2 production efficiency from CO. The time courses of CO consumption and
products formation by AGS with different pretreatment methods
are shown in Fig. 2. In the presence of BES, a considerable amount
of H2 was observed initially, but the produced H2 was consumed
gradually since day 5. CH4 was not observed during the whole fermentation process, which demonstrated BES was effective to inhibit methanogens. The consumption of H2 was due to the
homoacetogens which formed acetate from H2 and CO2, and it
was proved by the detected acetate as seen in Table 2.
Homoacetogenesis has been found in fermentative H2 production from organic wastes/wastewater in many previous publications, which is still an unresolved challenge for efficient H2
production (Saady, 2013). Our results also showed that both
methanogens and homoacetogens were present in AGS at pH 7.5.
Fig. 2 (Heat) shows that a rapid CO conversion took place after

Table 1
The summary of specific activities and final products from batch experiments 1 and 2.
Inoculum

pH

Waste activated sludge

Anaerobic granular sludge
Anaerobic granular sludge

7.5
7.5
5.5

Specific activity

Products formed after 8d incubation

mmol CO/g VSSd

mmol H2/g VSSd

Acetate (mmol)

CH4 (mmol)

H2 (mmol)

Residual CO (mmol)

CO balance (%)

0.23 0.04
0.68 0.06
0.32 0.06

0.19 0.02
0.50 0.07
0.23 0.05

0.03 0.01
0.07 0.01
0.28 0.03

0
0.39 0.02
0.08 0.02

0.81 0.13
0
0.25 0.05

0.89 0.12
0
0

92
93
86

Y. Liu et al. / Bioresource Technology 202 (2016) 17

2.0
pH=7.5

Gas (mmol)

1.6

Table 2
The summary of final products from batch experiment 3.

CO
CH 4

Pretreatment

H2

1.2
0.8

BES
Heat
Chloroform

0.4
0.0
0

4
Time (d)

Fig. 1. The time courses of CO and product (H2 and CH4) amount with anaerobic
granular sludge at pH 7.5 and thermophilic condition.

2.5

CO
CH4

pH 7.5, BES

Gas (mmol)

2.0

H2

1.5
1.0
0.5
0.0
0

Final product
Acetate
(mmol)

CH4
(mmol)

H2 (mmol)

Residual
CO
(mmol)

CO
balance
(%)

0.3 0.09
0.08 0.01
0

0
0.35 0.02
0 0.02

0.56 0.17
0
1.8 0.11

0
0
0

93
91
94

low fermentation pH, instead of heat pretreatment, was able to

inhibit methanogens. Fig. 2 (Chloroform) shows that in the presence of chloroform, the maximal amount of produced H2 was
nearly equal to the initial amount of CO supplied. Also, the produced H2 was not converted in 8 days of fermentation, indicating
that chloroform inhibited the activities of both methanogens and
homoacetogens. It is known BES as a structural analogue of coenzyme M, can be used to specifically inhibit methanogenesis, and
therefore the activity of homoacetogens still could be present with
the addition of BES (Xu et al., 2010). For heat pretreatment, it might
not kill the methanogens and therefore methane was produced
during the fermentation due to the suitable pH (7.5). However,
chloroform was nonspecific inhibitors, and therefore it can inhibit
both methanogens as well as homoacetogens (Liu et al., 2011).
Chloroform can block the function of corrinoid enzymes and to
inhibit methyl-coenzyme M reductase of methanogens. The present study demonstrated that it was possible to achieve selective
conversion of CO to H2 by AGS, even at pH 7.5.

2.5
pH 7.5, Heat

3.3. Effects of CO partial pressures on H2 production from CO by AGS

Gas (mmol)

2.0
1.5
1.0
0.5
0.0
0

2.5
pH 7.5, Chloroform

Gas (mmol)

2.0
1.5
1.0
0.5
0.0
0

10

12

Time (d)
Fig. 2. The time courses of CO and product (H2 and CH4) amount with anaerobic
granular sludge at pH 7.5 and thermophilic condition with different methods for
inhibiting H2 consuming microorganisms.

2 days of fermentation and resulted in the obvious H2 accumulation. However, the produced H2 decreased rapidly resulting in
CH4 production, and it showed that methanogens were not effectively inhibited by heat pretreatment. Although heat pretreatment
has been demonstrated to be able to inhibit methanogens previously for H2 production from wastes/wastewater, most of the previous studies were carried out at pH around 5.5 (Guo et al., 2008;
Wong et al., 2014). In the present study, the fermentation pH was
7.5, and heat pretreatment was not effective for inhibiting
methane production from AGS. The results demonstrated that a

CO is known to be an inhibitor to microorganisms, and

therefore the sensitivity of the AGS to CO was also investigated.
Different CO partial pressures (0.05, 0.1, 0.2, 0.4, and 0.8 atm) were
studied at pH 7.5 with the addition of chloroform. Assuming there
were equilibriums between the gas and liquid phase in the bottles,
the different CO partial pressures were equal to around 0.83, 1.66,
3.32, 6.64 and 13.28 mgCO/L based on a value of around
1700 atm L/mol for the Henry constant at 55 C (Lide, 1999). The
specific activities relating with CO consumption and H2 production
of the AGS are shown in Fig. 3. The increase of CO partial pressures
from 0.05 atm to 0.4 atm resulted in the increase of the specific
activities of CO consumption. However, the CO partial pressures
higher than 0.4 atm seriously inhibited the specific activities of
CO consumption, which was due to the toxicity of CO to microorganisms. The specific activities of H2 production was also
decreased. The consumed CO was almost stoichiometrically
converted to H2 under all the tested CO partial pressures. The CO
partial pressures higher than 0.2 atm were shown to inhibit CH4
production by mixed anaerobic culture (Guiot et al., 2011; Luo
et al., 2013). However, the maximum specific activities of CO consumption were observed at CO partial pressures as high as 0.4 atm
for H2 production. The results indicated that H2 production from
CO was not so sensitive to high CO partial pressures compared to
CH4 production, and therefore it might be a better choice to produce H2 from CO instead of CH4. Since gasliquid mass transfer is
a main engineering challenge for syngas fermentation (Guiot
et al., 2011; Munasinghe and Khanal, 2010), the higher tolerance
to CO for H2 production meant the higher CO partial pressure that
could be allowed in the gas phase (e.g. fermentation at high gas
pressure), which would increase the dissolved CO concentration
based on Henrys Law and thereby increase the gasliquid mass
transfer rate.
Based on the above results, further study was carried out to
investigate the stability for H2 production from CO. When the

Y. Liu et al. / Bioresource Technology 202 (2016) 17

Fig. 3. The effects of different CO partial pressures on specific activities of CO

consumption and H2 production.

experiment was conducted at CO partial pressure 0.2 atm, CO was

completely converted to H2 within 4 days, and then the experiment was repeated by using the same inoculum without additional
chloroform addition. Almost full conversion of CO to H2 was successfully repeated for another 3 times, as shown in Fig. S1. At CO
partial pressure of 0.4 atm, CO conversion was similar to that at
CO partial pressure of 0.2 atm. CO was depleted completely and
H2 was produced steadily in three successive incubations. The
results further demonstrated that stable and efficient H2 production from CO could be achieved by anaerobic mixed culture
fermentation.

3.4. Process performance and microbial community composition

analysis of the UASB reactor converting CO to H2
The H2 production from CO by anaerobic mixed culture was
then tested in a UASB reactor, in order to investigate the longterm process performance and microbial community composition
of the enriched mixed culture. Different operational conditions
were investigated and the reactor performances are shown in
Table 3. In phase I, CO was directly injected into the UASB reactor
by gas diffuser. It was found that only around 38% of the CO was
consumed, which resulted in the high CO concentration (51%) in
the gas collected from the UASB reactor. The higher CO in the
Table 3
The summary of reactor performances under different operational conditions.
Phase

I (121)

II (2296)

III (97102)

CO loading rate (mmol/d)

Gas retention time (d)
Gas recirculation rate (L/h)
Collected gas (mmol/d)
H2 concentration (%)
CO concentration (%)
CO conversion efficiency (%)
H2 production rate (mmol/gVSS/d)
Yield H2/CO (%)

45
1
0
53.8 2.6
28.5 1.3
51.2 2.8
38.8 3.8
1.53 0.1
88

45
1
1
78.5 5.9
45.3 2.1
8.1 1.2
85.9 2.4
3.6 0.1
91.8

90
0.5
1
146.3 9.4
41.3 2.3
15.1 1.7
75.3 4.3
6.1 0.1
89.4

collected gas might be due to its low solubility and therefore limited by the low gasliquid mass transfer rate (Yasin et al., 2015). In
phase II, gas recirculation (1 L/h) was implemented in order to
increase the gasliquid mass transfer rate of CO. Gas recirculation
was an effective method to improve the CO conversion efficiency,
since the amount of consumed CO was increased to around 86%.
The CO in the collected gas was decreased, and correspondingly
the concentration of H2 was increased from 28.5% (phase I) to
45.3% (phase II). The residual gas in the collected gas was CO2,
which was produced during the conversion of CO to H2 as shown
in Eq. (1). In phase III, the CO loading rate was doubled. A decrease
of CO conversion rate (from 85.9% to 75.3%) was observed, and it
could possibly be improved by further increasing the gas recirculation rates. Although there were still CO left in the collected gas
(51.2% phase I, 8.1% phase II and 15.1% phase III), it can be further
reduced by increasing the gasliquid mass-transfer rate
(Munasinghe and Khanal, 2010). For example, hollow fiber membrane, which can achieve bubbleless gas diffusion, would be able
to increase the CO conversion efficiency and should be tested in
the future (Sahinkaya et al., 2011). In all three phases, the accumulation of VFA was not detected, and around 90% of the consumed
CO was converted to H2. The missing 10% of CO could be due to
the growth of the microorganisms in the reactor. The H2 production rate was increased from phase I to phase III due to the
increased gasliquid mass transfer (phase II) and also the increased
CO loading rate (phase III) (Table 3). It should be noted that the H2
production rate in the continuous experiment was higher than that
in the batch experiments (Fig. 3). For example, in phases II and III,
the H2 production rates were 3.6 and 6.1 mmol/gVSS/d, which was
much higher than the maximum value (1.6 mmol/gVSS/d)
observed in Fig. 3. The reason was that the CO-converting microorganisms were enriched in the UASB reactor due to the continuous
feeding of CO to the reactor, which resulted in the gradual growth
of CO-converting microorganisms, while in batch experiments AGS
were not accumulated to CO.
High-throughput sequencing of the 16S rRNA genes was conducted in order to understand the differences of microbial community compositions between the inoculum and the enriched mixed
culture in the UASB reactor. The species richness of the inoculum
was higher than that of the enriched mixed culture, which was
reflected by the large numbers of OTUs and Chao 1 (Table S2).
The reason was that the enriched mixed culture only used CO as
substrate, while the inoculum was obtained from the UASB reactor
treating complex organic wastewater. The rarefaction curves of the
two samples at 0.03 distance are shown in Fig. S2, which suggested
that the sequencing depths were still not enough to cover the
whole diversity. Nevertheless, most common OTUs were detected
in the present study since the coverage values were all around
70%. The Shannon diversity, which reflects both species richness
and evenness of the communities (Lu et al., 2012), was also slightly
higher in the inoculum than that in the enriched mixed culture.
Fig. S3 shows that only 291 OTUs (11.7% of the total detected
OTUs) were shared by the inoculum and the enriched mixed culture at 0.03 distance, and it indicated that the microbial communities of the two samples were largely different, and CO converting
microorganisms might be enriched in the reactor.
Phylogenetic classification was then performed on the
sequences of the two samples, and the results are shown in
Fig. 4. The differences between the two samples were not obvious
standing in the phylum and class levels. Firmicutes and Proteobacteria, which were reported to be dominant in anaerobic digestion
process treating organic wastes (Sundberg et al., 2013), were also
the dominant phyla for the two samples. Clostridia were the dominant class for the two samples. However, obvious difference was
found in the genus level. The sequences belonging to Clostridium
were less, while the unclassified sequences were higher in the

Y. Liu et al. / Bioresource Technology 202 (2016) 17

more efforts should be made to identify unknown CO-utilizing bacteria, especially from the mixed anaerobic culture enriched from
CO.
For the first time, continuous and efficient H2 production from
CO by anaerobic mixed culture was successfully achieved in the
present study. In previous studies, either acetate or CH4 was the
final product after long-term accumulation of the mixed culture
for CO fermentation under thermophilic condition at neutral pH
(Alves et al., 2013; Guiot et al., 2011). However, stable and efficient
H2 production was achieved in our study by the inhibition of the H2
consuming microorganisms with the addition of chloroform. In the
current study, chloroform was added together with the nutrient
solution (basic medium) every two days (100 mL/2d, equals to 20
d HRT). In a further study, we found that chloroform was not necessarily added to the reactor every two days, and the stable H2 production could last at least one month (data not shown). Although
there were studies on H2 production from lignocellulosic biomass
(e.g. straw) by dark fermentation, the H2 yields were generally
low due to the production of organic acids and the difficulty to
be biodegraded (He et al., 2014; Liu et al., 2014). Correspondingly,
the recovered energy as H2 was very low (only around 56% even
for some easily biodegradable organics (Luo et al., 2011b; Zhu
et al., 2008)). By thermal gasification of the lignocellulosic biomass
and then fermentative conversion of the CO in the syngas to H2,
ideally full conversion of biomass to H2 could be achieved.
However, gasliquid mass transfer is the main bottleneck for the
fermentative conversion of CO to H2 in large-scale facilities due
to its low solubility. The improvement of gasliquid mass transfer
rate is needed in future study. Hollow fiber membrane, which can
achieve efficient and bubbleless gas transfer to the liquid (Luo
et al., 2013), might be a promising solution for increasing the CO
conversion efficiency.
4. Conclusions

Fig. 4. Phylogenetic classification of the sequences in phylum, class and genus

levels. CO the enriched culture obtained from the reactor; I the inoculum.

enriched mixed culture compared to the inoculum. The known

hydrogenogenic CO-oxidizing thermophilic bacteria were
summarized in Table S1. Only the genus Desulfotomaculum,
containing hydrogenogenic CO-oxidizing thermophilic specie
Desulfotomaculum carboxydivorans (Parshina et al., 2005), was
found in the enriched mixed culture, but not in the inoculum.
The result suggested that Desulfotomaculum were enriched by CO
in the continuous reactor. More sequences relating to CO
conversion should be expected, however, the percentage of
Desulfotomaculum in the enriched mixed culture was only 1%.
The lower abundance of CO relating sequences might be due to
the possible presence of unknown hydrogenogenic CO-oxidizing
thermophilic bacteria, and it was reflected by the higher percentage of unclassified sequences in the enriched mixed culture.
Similar result was also reported in a previous study (Luo et al.,
2013), where the lack of known CO-utilizing bacteria and high percentage of unclassified sequences were found from the bacterial
sequences in a continuous reactor that converting both CO and
sewage sludge to CH4. The above results probably indicated that

The study showed AGS had higher potential for the anaerobic
conversion of CO to H2 compared to WAS at 55 C and pH 7.5,
and the addition of chloroform was necessary to inhibit both
methanogens and homoacetogens in AGS to achieve the conversion of CO to H2. The continuous experiment showed stable and
efficient H2 production was obtained from a UASB reactor, and
gas recirculation was crucial to increase the CO conversion efficiency. Microbial community analysis showed low abundance
(1%) of known CO-utilizing bacteria Desulfotomaculum and high
abundance (44%) of unclassified sequences were enriched in the
reactor.
Acknowledgements
This study was funded by the Yangfan project from Science and
Technology Commission of Shanghai Municipality (14YF1400400),
National Natural Science Foundation of China (51408133,
51378373), SRF for ROCS, SEM.
Appendix. A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.biortech.2015.11.
071.
References
Alves, J.I., Stams, A.J.M., Plugge, C.M., Alves, M.M., Sousa, D.Z., 2013. Enrichment of
anaerobic syngas-converting bacteria from thermophilic bioreactor sludge.
FEMS Microbiol. Ecol. 86, 590597.

Y. Liu et al. / Bioresource Technology 202 (2016) 17

Angelidaki, I., Sanders, W., 2004. Assessment of the anaerobic biodegradability of
macropollutants. Rev. Environ. Sci. Biotechnol. 3, 117129.
APHA, 1995. Standard Methods for the Examination of Water and Wastewater,
19th ed. American Public Health Association, New York, USA.
Bundhoo, M.A.Z., Mohee, R., Hassan, M.A., 2015. Effects of pre-treatment
technologies on dark fermentative biohydrogen production: a review. J.
Environ. Manage. 157, 2048.
Guiot, S.R., Cimpoia, R., Carayon, G., 2011. Potential of wastewater-treating
anaerobic granules for biomethanation of synthesis gas. Environ. Sci. Technol.
45, 20062012.
Guo, W.Q., Ren, N.Q., Wang, X.J., Xiang, W.S., Meng, Z.H., Ding, J., Qu, Y.Y., Zhang, L.S.,
2008. Biohydrogen production from ethanol-type fermentation of molasses in
an expanded granular sludge bed (EGSB) reactor. Int. J. Hydrogen Energy 33,
49814988.
Haddad, M., Cimpoia, R., Guiot, S.R., 2014. Performance of Carboxydothermus
hydrogenoformans in a gas-lift reactor for syngas upgrading into hydrogen. Int.
J. Hydrogen Energy 39, 25432548.
He, L., Huang, H., Lei, Z., Liu, C., Zhang, Z., 2014. Enhanced hydrogen production from
anaerobic fermentation of rice straw pretreated by hydrothermal technology.
Bioresour. Technol. 171, 145151.
Henstra, A.M., Sipma, J., Rinzema, A., Stams, A.J.M., 2007. Microbiology of synthesis
gas fermentation for biofuel production. Curr. Opin. Biotechnol. 18, 200206.
Jung, G.Y., Kim, J.R., Park, J.-Y., Park, S., 2002. Hydrogen production by a new
chemoheterotrophic bacterium Citrobacter sp. Y19. Int. J. Hydrogen Energy 27,
601610.
Kim, M.-S., Choi, A.R., Lee, S.H., Jung, H.-C., Bae, S.S., Yang, T.-J., Jeon, J.H., Lim, J.K.,
Youn, H., Kim, T.W., Lee, H.S., Kang, S.G., 2015. A novel CO-responsive
transcriptional regulator and enhanced H2 production by an engineered
Thermococcus onnurineus NA1 Strain. Appl. Environ. Microbiol. 81, 17081714.
Lide, D.R., 1999. CRC Handbook of Chemistry and Physics, 80th ed. CRC Press, Boca
Raton, FL.
Liu, H., Wang, J., Wang, A., Chen, J., 2011. Chemical inhibitors of methanogenesis
and putative applications. Appl. Microbiol. Biotechnol. 89, 13331340.
Liu, Z., Li, Q., Zhang, C., Wang, L., Han, B., Li, B., Zhang, Y., Chen, H., Xing, X.-H., 2014.
Effects of operating parameters on hydrogen production from raw wet steamexploded cornstalk and two-stage fermentation potential for biohythane
production. Biochem. Eng. J. 90, 234238.
Lu, L., Xing, D., Ren, N., 2012. Pyrosequencing reveals highly diverse microbial
communities in microbial electrolysis cells involved in enhanced H-2
production from waste activated sludge. Water Res. 46, 24252434.
Luo, G., Karakashev, D., Xie, L., Zhou, Q., Angelidaki, I., 2011a. Long-term effect of
inoculum pretreatment on fermentative hydrogen production by repeated
batch cultivations: homoacetogenesis and methanogenesis as competitors to
hydrogen production. Biotechnol. Bioeng. 108, 18161827.
Luo, G., Wang, W., Angelidaki, I., 2013. Anaerobic digestion for simultaneous sewage
sludge treatment and CO biomethanation: process performance and microbial
ecology. Environ. Sci. Technol. 47, 1068510693.
Luo, G., Xie, L., Zhou, Q., Angelidaki, I., 2011b. Enhancement of bioenergy production
from organic wastes by two-stage anaerobic hydrogen and methane production
process. Bioresour. Technol. 102, 87008706.
Luo, G., Xie, L., Zou, Z.H., Wang, W., Zhou, Q., 2010. Evaluation of pretreatment
methods on mixed inoculum for both batch and continuous thermophilic

biohydrogen production from cassava stillage. Bioresour. Technol. 101, 959

964.
Mohammadi, M., Najafpour, G.D., Younesi, H., Lahijani, P., Uzir, M.H., Mohamed, A.
R., 2011. Bioconversion of synthesis gas to second generation biofuels: a review.
Renewable Sustainable Energy Rev. 15, 42554273.
Munasinghe, P.C., Khanal, S.K., 2010. Syngas fermentation to biofuel: evaluation of
carbon monoxide mass transfer coefficient (k(L)a) in different reactor
configurations. Biotechnol. Progr. 26, 16161621.
Oelgeschlager, E., Rother, M., 2008. Carbon monoxide-dependent energy
metabolism in anaerobic bacteria and archaea. Arch. Microbiol. 190, 257269.
Parshina, S.N., Sipma, J., Nakashimada, Y., Henstra, A.M., Smidt, H., Lysenko, A.M.,
Lens, P.N.L., Lettinga, G., Stams, A.J.M., 2005. Desulfotomaculum
carboxydivorans sp. nov., a novel sulfate-reducing bacterium capable of
growth at 100% CO. Int. J. Syst. Evol. Microbiol. 55, 21592165.
Phillips, J., Clausen, E., Gaddy, J., 1994. Synthesis gas as substrate for the biological
production of fuels and chemicals. Appl. Biochem. Biotechnol. 4546, 145157.
Saady, N.M.C., 2013. Homoacetogenesis during hydrogen production by mixed
cultures dark fermentation: Unresolved challenge. Int. J. Hydrogen Energy 38,
1317213191.
Sahinkaya, E., Hasar, H., Kaksonen, A.H., Rittmann, B.E., 2011. Performance of a
sulfide-oxidizing, sulfur-producing membrane biofilm reactor treating sulfidecontaining bioreactor effluent. Environ. Sci. Technol. 45, 40804087.
Siriwongrungson, V., Zeny, R.J., Angelidaki, I., 2007. Homoacetogenesis as the
alternative pathway for H-2 sink during thermophilic anaerobic degradation of
butyrate under suppressed methanogenesis. Water Res. 41, 42044210.
Sokolova, T.G., Henstra, A.M., Sipma, J., Parshina, S.N., Stams, A.J.M., Lebedinsky, A.V.,
2009. Diversity and ecophysiological features of thermophilic carboxydotrophic
anaerobes. FEMS Microbiol. Ecol. 68, 131141.
Sundberg, C., Al-Soud, W.A., Larsson, M., Alm, E., Yekta, S.S., Svensson, B.H.,
Sorensen, S.J., Karlsson, A., 2013. 454 pyrosequencing analyses of bacterial and
archaeal richness in 21 full-scale biogas digesters. FEMS Microbiol. Ecol. 85,
612626.
Tiquia-Arashiro, S., 2014. CO-oxidizing microorganisms. In: Thermophilic
Carboxydotrophs and their Applications in Biotechnology. Springer
International Publishing, pp. 1128.
Wong, Y.M., Wu, T.Y., Juan, J.C., 2014. A review of sustainable hydrogen production
using seed sludge via dark fermentation. Renewable Sustainable Energy Rev. 34,
471482.
Xu, K., Liu, H., Chen, J., 2010. Effect of classic methanogenic inhibitors on the
quantity and diversity of archaeal community and the reductive
homoacetogenic activity during the process of anaerobic sludge digestion.
Bioresour. Technol. 101, 26002607.
Yasin, M., Jeong, Y., Park, S., Jeong, J., Lee, E.Y., Lovitt, R.W., Kim, B.H., Lee, J., Chang, I.
S., 2015. Microbial synthesis gas utilization and ways to resolve kinetic and
mass-transfer limitations. Bioresour. Technol. 177, 361374.
Younesi, H., Najafpour, G., Ku Ismail, K.S., Mohamed, A.R., Kamaruddin, A.H., 2008.
Biohydrogen production in a continuous stirred tank bioreactor from synthesis
gas by anaerobic photosynthetic bacterium: Rhodopirillum rubrum. Bioresour.
Technol. 99, 26122619.
Zhu, H., Stadnyk, A., Bland, M., Seto, P., 2008. Co-production of hydrogen and
methane from potato waste using a two-stage anaerobic digestion process.
Bioresour. Technol. 99, 50785084.