Biochemical and Biophysical Research Communications 468 (2015) 525e532

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications

journal homepage: www.elsevier.com/locate/ybbrc

A polymeric nanoparticle formulation of curcumin in combination

with sorafenib synergistically inhibits tumor growth and metastasis in
an orthotopic model of human hepatocellular carcinoma
Bo Hu a, 1, Ding Sun a, f, 1, Chao Sun a, 1, Yun-Fan Sun a, Hai-Xiang Sun a, Qing-Feng Zhu b, d,
Xin-Rong Yang a, Ya-Bo Gao e, Wei-Guo Tang a, Jia Fan a, d, 1, Anirban Maitra c, 1,
Robert A. Anders b, **, 1, Yang Xu a, *, 1
a
Department of Liver Surgery, Liver Cancer Institute, Zhongshan Hospital, Fudan University, Key Laboratory of Carcinogenesis and Cancer Invasion, Ministry
of Education, Shanghai, 200032, PR China
b
The Johns Hopkins University School of Medicine, Division of Gastrointestinal and Liver Pathology, Baltimore, MD, 21205, USA
c
The Sol Goldman Pancreatic Cancer Research Center, Departments of Oncology, Johns Hopkins University School of Medicine, Baltimore, MD, 21205, USA
d
Institute of Biomedical Sciences, Fudan University, Shanghai, 200032, PR China
e
Department of Radiation Oncology, Zhongshan Hospital, Fudan University, Shanghai, 200032, PR China
f
Department of Hepatobiliary Surgery, First Afliated Hospital of Soochow University, Suzhou, 215004, PR China

a r t i c l e i n f o

a b s t r a c t

Article history:
Received 23 September 2015
Accepted 6 October 2015
Available online 19 October 2015

Curcumin, a yellow polyphenol extracted from the rhizome of turmeric root (Curcuma longa) has potent
anti-cancer properties in many types of tumors with ability to reverse multidrug resistance of cancer
cells. However, widespread clinical application of this agent in cancer and other diseases has been
limited due to its poor aqueous solubility. The recent ndings of polymeric nanoparticle formulation of
curcumin (NFC) have shown the potential for circumventing the problem of poor solubility, however
evidences for NFC's anti-cancer and reverse multidrug resistance properties are lacking. Here we provide
models of human hepatocellular carcinoma (HCC), the most common form of primary liver cancer,
in vitro and in vivo to evaluate the efcacy of NFC alone and in combination with sorafenib, a kinase
inhibitor approved for treatment of HCC. Results showed that NFC not only inhibited the proliferation
and invasion of HCC cell lines in vitro, but also drastically suppressed primary tumor growth and lung
metastases in vivo. Moreover, in combination with sorafenib, NFC induced HCC cell apoptosis and cell
cycle arrest. Mechanistically, NFC and sorafenib synergistically down-regulated the expression of MMP9
via NF-kB/p65 signaling pathway. Furthermore, the combination therapy signicantly decreased the
population of CD133-positive HCC cells, which have been reported as cancer initiating cells in HCC. Taken
together, NanoCurcumin provides an opportunity to expand the clinical repertoire of this agent. Additional studies utilizing a combination of NanoCurcumin and sorafenib in HCC are needed for further
clinical development.
2015 Elsevier Inc. All rights reserved.

Keywords:
Curcumin
Sorafenib
Hepatocellular carcinoma
NF-kB
MMP-9

1. Introduction
Liver cancer is the second most common cause of cancer death
among men, and the sixth leading cause of cancer death among

* Corresponding author. Liver Cancer Institute, Fudan University, 136 Yi Xue Yuan
Road, Shanghai, 200032, PR China.
** Corresponding author.
E-mail addresses: rander54@jhmi.edu (R.A. Anders), drxuyang@gmail.com
(Y. Xu).
1
These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.bbrc.2015.10.031
0006-291X/ 2015 Elsevier Inc. All rights reserved.

women. Almost half of liver cancer cases and deaths worldwide are
estimated to have occurred in China and hepatocellular carcinoma
(HCC) accounts for 70%e85% of liver cancers globally [1,2]. Because
tumors can develop resistance to chemotherapeutic agents, there is
an urgent need for the development of agents that can reverse
drug-resistance and suppress proliferation and metastasis of HCC
without toxicity to normal cells [3].
Sorafenib is a vascular endothelial growth factor receptor and
multikinase inhibitor, approved for the treatment of unresectable
HCCs. This drug has been used as a rst-line treatment for advanced
HCC. Although sorafenib can prolong median survival time by

526

B. Hu et al. / Biochemical and Biophysical Research Communications 468 (2015) 525e532

almost 3 months in patients with late-stage HCC (10.7 vs. 7.9

months), its application is limited because of its high cost, partial
effect on metastasis, and severe adverse side-effects, including risk
of hemorrhage [4,5].
Curcumin
(1,7-bis(4-hydroxy-3-methoxy-phenyl)-1,6-hepta
diene-3,5-dione; diferuloylmethane) is a diphenolic compound
extracted from the rhizome of turmeric (Curcuma longa), a plant
grown in tropical Southeast Asia [6]. It has been used in the
treatment of anorexia, inammation, and biliary and hepatic disorders. In traditional Indian medicine, turmeric is also used to treat
sinusitis and rheumatism [7], and recent evidences suggests that
curcumin have potential antitumor effects in colon, lung, breast,
pancreatic, and prostate cancers and can also reverse multidrug
resistance in cancer cells [8e15]. However, widespread clinical use
of curcumin is limited by its poor bioavailability in oral formulations [16]. In rat model, most of the curcumin administered orally is
excreted in feces, resulting in a low blood concentration of curcumin. However, a nanoparticle-encapsulated formulation of curcumin (NFC) has been shown to improve the solubility, bioavailability,
and pharmacokinetic properties of free curcumin [17]. It has also
been shown to suppress the effects of the carcinogen, diethylnitrosamine, and inhibit HCC growth [18]. In this study, we evaluated
the ability of NanoCurcumin [17] combined with sorafenib to
suppress proliferation, migration or metastasis of human HCC cells
in vitro and in vivo, and investigated the potential mechanism underlying its effects.
2. Materials and methods
2.1. Drug formulations
Polymeric encapsulated curcumin was prepared as described
[17]. A stock solution of sorafenib (Bayer Pharmaceutical Corporation) was prepared in 100% dimethyl sulfoxide (DMSO). For in vitro
experiments, working solutions were prepared by diluting the
stock solution with Dulbecco's Modied Eagle Medium (DMEM)
(nal DMSO concentration is 0.1%).
2.2. Cell lines
The HCC cell line, Huh7, was supplied by the Japanese Cancer
Research Resources Bank. MHCCLM3 and MHCCLM3-RFP (red
uorescent protein) cells, human HCC cell lines with high metastatic potential, were established in our lab [19,20]. The cells were
cultured in DMEM with high glucose supplemented with 10% fetal
bovine serum (Gibco BRL, Grand Island, NY).
2.3. In vitro cell proliferation, wound-healing, and Matrigel
invasion assays
Cell proliferation was assessed using the cell counting kit-8
(CCK8) assay (Dojindo Laboratories, Kumamoto, Japan) according
to the manufacture instruction [21]. The cells were treated with 1%
DMSO (control), 40 mM NFC, 10 mM sorafenib, or combination
treatment (40 mM NFC 10 mM sorafenib). The wound healing
assay was performed as previously described [21]. The cells were
washed with phosphate-buffered saline (PBS) and treated with 1%
DMSO, 40 mM NFC, 10 mM sorafenib, or 40 mM NFC 10 mM sorafenib for 48 h. The in vitro invasion assay was performed by using a
Matrigel-coated lter (No. 3422, Corning, USA). MHCCLM3 or Huh7
cells (2  104 cells/well) were seeded into the migration chamber
containing serum-free DMEM with 1% DMSO, 40 mM NFC, 10 mM
sorafenib, or 40 mM NFC 10 mM sorafenib, and incubated for 24 h
at 37  C. Cells that migrated to the lower surface of the lters were
stained and counted under a light microscope. All assays were

performed in triplicate.
2.4. Cell cycle analysis and apoptosis assay
Huh7 and MHCCLM3 cells were seeded into 6-well plates,
incubated overnight, and then treated with 1% DMSO, 40 mM NFC,
10 mM sorafenib, or 40 mM NFC 10 mM sorafenib for 48 h. For cell
cycle analysis, the cells were xed in 75% ethanol for 1 h at 4  C, and
stained with the DNA-binding dye propidium iodide (1 mg/mL) and
RNase (0.5 mg/mL) for 30 min at 37  C. Finally, the DNA changes in
cells were examined with a ow cytometer (Beckman cytomics
FC500). For apoptosis assay, the cells were stained using the
Annexin-V-FITC/PI apoptosis detection kit (BD Biosciences, USA)
according to the manufacturer's instructions. Each test was performed in triplicate.
2.5. Orthotopic xenograft models of HCC
MHCCLM3-RFP cells (1  106) in 0.2 mL serum-free culture
medium were injected subcutaneously into three 4- to 6-week old
male athymic BALB/c nu/nu mice (Shanghai Institute of Material
Medical, Chinese Academy of Science). The mice were housed at the
Zhongshan Hospital of Fudan University and the experimental
protocol was approved by the Animal Welfare Committee of Fudan
University.
When the subcutaneous tumor reached 1 cm in diameter, it
was minced into pieces (approximately 2 mm3) and then
implanted into the livers of 24 mice. The mice were randomly
divided into four groups according to treatment: 1) control (PBS,
100 ml, intraperitoneal injection), 2) NFC (1.56 g/kg, daily intraperitoneal injection), 3) sorafenib (30 mg/kg, daily oral administration), and 4) NFC plus sorafenib (administered as described for
single agent treatments). After 4 weeks, the mice were sacriced
by overdosage of pentobarbital, and the tumors were removed for
measurement and analysis by western blot, quantitative reverse
transcription-polymerase chain reaction (qRT-PCR), and immunohistochemical staining. Primary tumor volumes were calculated
using the formula V 1/2a  b2, where a is the longest tumor axis,
and b is the shortest tumor axis. Each metastatic tumor in the
lungs was cryosectioned and observed under uorescence microscopy (for excitation of RFP at 584 nm). Finally, the lung sections were stained with hematoxylin and eosin (H&E) to quantify
metastatic foci.
2.6. Western blot analysis
The concentration of protein extracted from the HCC cell lines
and mouse tumor tissue was determined by using the BCA Protein
Assay Kit (Pierce, USA). Samples were analyzed with primary antibodies against matrix metalloproteinase 9 (MMP-9; AB911, R&D
Systems, 1:1000), tissue inhibitor of metalloproteinases-1 (TIMP-1;
No. 8946, Cell Signaling Technology, 1:1000), nuclear factor-kappalight-chain-enhancer of activated B cells (NF-kB; No. 3034, Cell
Signaling Technology, 1:1000), unphosphorylated extracellular
signal-related kinase (ERK1/2; ab17942, Abcam, 1:1000), and
phosphorylated ERK1/2 (No. 9102, Cell Signaling Technology,
1:1000).
2.7. Enzyme-linked immunosorbent assay (ELISA)
MHCCLM3 and Huh7 cells were treated with 1% DMSO, 40 mM
NFC, 10 mM sorafenib, or 40 mM NFC 10 mM sorafenib for 48 h.
Samples were incubated with a monoclonal anti-MMP-9 antibody
(AB911, R&D Systems), and incubated with an enzyme-linked
polyclonal antibody specic for MMP-9 (KHC3061, Life

B. Hu et al. / Biochemical and Biophysical Research Communications 468 (2015) 525e532

Technologies). After washing away the unbound conjugate, a substrate solution was added to each well, and absorbance at 450 nm
was determined using a microplate reader (Bio-Rad). All measurements were performed in duplicate, and MMP-9 concentration
was expressed in pg/mL.

527

3. Results
3.1. NanoCurcumin inhibits HCC cell proliferation and invasion
in vitro

Liver tumor specimens from the in vivo studies were xed in

10% formalin. After dehydration in graded ethanol, the specimens
were embedded in parafn, sectioned (4 mm thick), placed on
coated glass slides, deparafnized in xylene and ethanol, and
rehydrated through a graduated alcohol series to distilled water.
The sections were then placed in 0.01 M citrate buffer (pH 6.0) and
heated 98e100  C, cooling (5e10 min), repeated twice in a microwave for antigen retrieval. After incubation with primary antibodies against MMP-9 (AB911, R&D Systems, 1:100) or CD133
(No. 130-090-422, Miltenyi Biotec, 1:300) for 60 min at room
temperature or overnight at 4  C, the sections were incubated
with secondary antibodies. The tissues were stained using 3, 30 diaminobenzidine (DAB) peroxidase substrate, and images were
obtained using a Leica DMLA light microscope (Leica Microsystems, Wetzlar, Germany).

Results of the CCK8 assay showed that NanoCurcumin signicantly inhibited the viability of Huh7 and MHCCLM3 cells (P < 0.01;
Fig. S1). In MHCCLM3 cells the half maximal inhibitory concentration (IC50) of NanoCurcumin was 40 mM at 24 h, 35 mM at 48 h, and
33 mM at 72 h, and in Huh7 cells, the IC50 of NanoCurcumin was
74 mM (24 h), 30 mM (48 h), and 27 mM (72 h). Although combination treatment appeared to more strongly inhibit cell proliferation, the inhibition was not statistically signicant from that of
NanoCurcumin or sorafenib alone (Fig. 1A).
To further determine the cellular effects of NanoCurcumin on
HCC, we performed wound healing and migration assays. We found
that the wound healing ability of combination treatment was at
least 2-fold lower than that of sorafenib alone (Fig. 1BeC). Consistent with these results, NanoCurcumin substantially reduced the
migration of both MHCCLM3 and Huh7 cells in the Boyden chamber
migration assay compared with the control (P < 0.01), and the
combination treatment reduced the migration of MHCCLM3 cells
(P < 0.05) (Fig. 1D).

2.9. qRT-PCR

3.2. NanoCurcumin induces HCC cell apoptosis and cell cycle arrest

Total RNA was extracted from cell lines and frozen tumor
specimens using Trizol reagent (Invitrogen), and 1 mg total RNA
was reverse transcribed using the PrimeScript RT Reagent kit
(Takara Bio, Tokyo, Japan). Real-time PCR was performed using a
SYBR PrimeScript RT-PCR Kit (Takara Bio) and ABI7300 instrument (Applied Biosystems) according to the manufacturer's instructions. Three independent experiments were performed, and
all reactions were performed in triplicate with glyceraldehyde 3phosphate dehydrogenase (GAPDH) as the internal control.
Primer sequences for NF-kB, MMP-9, and GAPDH were as
follows:
NF-kB,
forward
GGGGGTTGCCCCAGTTTAATTCCCCAGCCTTG, reverse CAAGGCTGGGGAATTAAACTGGGGCAACCCCC;
MMP-9 forward GCCAACTACGACACCGACGAC, reverse TTGGCC
TTGGAAGATGAATGGA; CD133 forward CTGGGGCTGCTGTTTATTATTCTG, reverse ACGCCTTGTCCTTGGTAGTGTTG; and GAPDH
forward GGCATCCTGGGCTACACTGA, reverse GTGGTCGTTGAG
GGCAATG. Relative mRNA levels were calculated according to the
equation: 2DCt [DCt Ct (target)  Ct (GAPDH)].

Results of ow cytometry showed that NanoCurcumin and/or

sorafenib signicantly increased the percentages of early apoptotic,
late apoptotic, and necrotic Huh7 and MHCCLM3 cells, and induction of apoptosis by combination treatment was signicantly
higher that of NanoCurcumin or sorafenib alone (all P < 0.05;
Fig. 2A and B, S2A and S2B). In experiments using MHCCLM3 cells,
more necrotic cells were detected after combination treatment
than after treatment with NanoCurcumin or sorafenib alone
(P < 0.01) (Fig. 2A and B, S2A and S2B).
In addition, NanoCurcumin and/or sorafenib treatments
induced G2/M arrest in both cell lines (all P < 0.01), but the proportion of cells in G2/M arrest was higher after combination
treatment compared with single agent treatments (Fig. 2C and D,
S2C and S2D).

2.8. Immunohistochemistry

2.10. Flow cytometry analysis of CD133 population

The anti-human CD133-PE antibody (No. 130-080-801, Miltenyi Biotec) was used for immunouorescent detection of
CD133-expressing cells by ow cytometry, using the isotypematched mouse immunoglobulin (No. 130-092-212, Miltenyi
Biotec) as a control. Cells were incubated with the primary
antibody in PBS containing 2% bovine serum albumin and 0.1%
sodium azide, and analyzed using a FACSCalibur cytometer (BD
Biosciences).
2.11. Statistical analysis
Statistical analyses were performed with SPSS 19.0 for Windows. Quantitative data were presented as mean standard error
(SE) of at least three independent experiments. Continuous data
were analyzed by one-way ANOVA and Student's t-test, and categorical data were analyzed by Fisher's exact test or chi-square test;
P < 0.05 was considered signicant.

3.3. NanoCurcumin inhibits in vivo progression and metastasis of

HCC cells
One week after subcutaneous and orthotopic tumor implantation, athymic mice were treated with PBS (control), NanoCurcumin,
sorafenib, or both NanoCurcumin and sorafenib. After 4 weeks of
treatment, the subcutaneous and orthotopic liver xenografts were
harvested (Fig. 2E). No adverse effects (e.g., morbidity, mortality,
body weight changes) were observed in any of these groups. Volumes of the subcutaneous tumors were smaller in the treated mice
(P < 0.05; Fig. 2F). Although combination treatment appeared to
exert an effect in reducing orthotopic tumor weight compared with
NanoCurcumin alone (0.41 0.14 vs. 0.75 0.96 g) or sorafenib
alone (0.41 0.14 vs. 0.48 0.11 g), these differences were not
statistically signicant (P > 0.05; Table 1). We then examined the
mice for metastatic tumors in the diaphragm, peritoneal cavity,
lymph nodes, and visceral organs, and found that tumors formed
primarily in the lungs (Fig. 2G). Tumors were detected in all mice in
the control group but in only 50% of the NanoCurcumin-treated
mice (P > 0.05; Table 1). However, combination treatment
showed the best therapeutic efcacy, signicantly reducing lung
metastatic tumors compared with control treatment (16.7% vs.
100%; P 0.015).

528

B. Hu et al. / Biochemical and Biophysical Research Communications 468 (2015) 525e532

Fig. 1. Effect of NanoCurcumin and/or sorafenib (SO) on cell proliferation, migration and invasion in vitro. (A) Viability of Huh7 and MHCCLM3 cells was decreased by 48-h
treatment with NanoCurcumin (40 mM) and/or SO (10 mM). (B,C) The wound healing abilities of Huh7 and MHCCLM3 cells were evaluated after NanoCurcumin and/or SO treatment.
(D) To determine effects on invasion and migration, Huh7 and MHCCLM3 cells were seeded onto Matrigel-coated Boyden chamber insert containing NanoCurcumin (40 mmol/L), SO
(10 mmol/L), or NanoCurcumin (40 mmol/L) SO (10 mmol/L). The cells were stained and quantied after 8 h. Results are expressed as mean SE of at least three independent
experiments. *P < 0.05, #P < 0.01 compared with vehicle control. Magnication, 100 (D). Scale bar, 200 mm.

3.4. NanoCurcumin in combination with sorafenib regulates MMP9 and its endogenous inhibitors in vivo and in vitro
To investigate the mechanism by which NanoCurcumin and
sorafenib inhibit HCC metastasis, we evaluated expression of MMP9, an important marker of HCC migration [22,23]. Our results
demonstrated that combination treatment decreased MMP-9
mRNA levels both in vitro and in vivo (Figs. 3A and 4A). Furthermore, both western blot and ELISA results demonstrated that
combination treatment decreased MMP-9 and increased TIMP-1,
the inhibitor of MMP-9, compared with single agent treatments
(Figs. 3D, E and 4D, E). Similar results were obtained by immunohistochemical staining (Fig. 3A).
3.5. NanoCurcumin in combination with sorafenib inhibits MMP-9
expression by inactivating NF-kB/p65 in vivo and in vitro
In human head and neck squamous cell carcinoma cells, curcumin has been shown to suppress MMP-9 expression through

modulation of NF-kB activity [24]. We therefore investigated the

effects of NanoCurcumin combined with sorafenib on NF-kB activity in MHCCLM3 and Huh7 cells. Our results demonstrated that
p65 was signicantly elevated in the cytoplasm but was dramatically decreased in the nucleus of cells when treated with both
NanoCurcumin and sorafenib compared with single agent treatments (Fig. 3E). In addition, combination treatment signicantly
suppressed p65 mRNA levels (Fig. 3B). Similar results were obtained in vivo (Fig. 4B and E). In addition, western blot analysis
showed that NanoCurcumin and sorafenib combination treatment
decreased phosphorylation of ERK1/2 both in vitro and in vivo
(Figs. 3E and 4E).
3.6. NanoCurcumin in combination with sorafenib decreases
CD133-positive HCC cells in vivo and in vitro
NanoCurcumin in combination with sorafenib downregulated
CD133 mRNA levels both in vivo and in vitro (all P < 0.01; Figs. 3C
and 4C), and signicantly decreased the population of CD133-

B. Hu et al. / Biochemical and Biophysical Research Communications 468 (2015) 525e532

529

Fig. 2. Effect of NanoCurcumin on tumor growth and metastasis of MHCCLM3-RFP cells in vitro and in vivo. (A) Huh7 cells and (B) MHCCLM3 cells were treated with
NanoCurcumin (40 mmol/L), SO (10 mmol/L), or NanoCurcumin (40 mmol/L) SO (10 mmol/L) for 48 h and analyzed by ow cytometry. The X-axis represents Annexin V, and the Yaxis represents propidium iodide. Cell cycle analysis of (C) Huh7 cells and (D) MHCCLM3 was assessed by ow cytometry. The Y-axis represents number of cells, and the X-axis
represents DNA content as uorescence intensity of propidium iodide staining. Results are expressed as mean SE of three independent experiments, *P < 0.05, #P < 0.01 compared
with controls. (E) One week after MHCCLM3-RFP cell implantation, male athymic BALB/c nu/nu mice underwent 28-day treatment with NanoCurcumin (1.56 g/kg daily), sorafenib
(SO, 30 mg/kg daily), or both. Representative orthotopic and subcutaneous tumor xenografts for each treatment group. (F) Tumor volumes of treated mice were smaller than those
of untreated mice (*P < 0.05, #P < 0.01). (G) Left panel: hematoxylin and eosin staining of a metastatic nodule in the lung; magnication of the selected areas showing number of
tumor cells within a single nodule. Right panel: representative image of metastasis in the lung visualized as uorescence of MHCCLM3-RFP cells. Flow cytometry analysis of (H)
Huh7 cells and (I) MHCCLM3 cells showed that NanoCurcumin and/or sorafenib signicantly decreased CD133-positive cells in vitro. Results expressed as mean SE of at least three
independent experiments.

positive cells compared with either NanoCurcumin or sorafenib

alone (P < 0.05; Fig. 4C and S4). Results of ow cytometry showed
that the percentage of CD133-positive MHCCLM3 cells was

decreased by NanoCurcumin alone (13.80 0.63% vs. 20.81 1.07%;

P < 0.01) and sorafenib alone (9.42 0.52% vs. 20.81 1.07%;
P < 0.01) compared with control (Fig. 4C and S4). However,

Table 1
Summary of orthotopic xenograft liver tumor model.

Pulmonary metastasis
Percentage
Tumor weight (g)

Control

NFC

SO

NFC SO

P value (NFC vs control)

P value (SO vs control)

P value (NFC SO vs control)

6/6
100%
1.53 0.48

3/6
50%
0.75 0.96

4/6
66.7%
0.48 0.11

1/6
16.7%
0.41 0.14

0.182
0.001

0.455
<0.001

0.015
<0.001

530

B. Hu et al. / Biochemical and Biophysical Research Communications 468 (2015) 525e532

Fig. 3. Effect of NanoCurcumin on NF-kB/p65, MMP-9, and CD133 in vitro. Huh7 and MHCC97L cell lines were treated with NanoCurcumin (40 mM), sorafenib (SO, 10 mM), or
NanoCurcumin (40 mM) SO (10 mM) for 48 h. Results of qRT-PCR showing mRNA levels of (A) MMP-9, (B) p65, and (C) CD133. Protein levels of MMP-9, p65 (whole cell, cytoplasm
and nucleus), TIMP-1, ERK1/2 (total and phosphorylated), as determined by (D) ELISA and (E) western blot analysis.

combination treatment was most effective in decreasing CD133

marker expression in both MHCCLM3 (4.82 1.22%) and Huh7
(5.46 0.68%) cells (Fig. 4C and S4). Protein levels of CD133, as
assessed by immunohistochemistry, were consistent with our ow
cytometry results (Fig. S4C).
4. Discussion
The 5-year survival rate of patients with HCC remains lower
than 15% because of metastasis and recurrence [25,26]. Thus, there
is an urgent need for drugs with anti-metastatic effects. Natural
products have proven to be important sources of cancer chemotherapeutic and chemopreventive agents, with 70% of current
anticancer drugs being derived from natural products [27,28].
A nanoparticle-encapsulated formulation of curcumin overcomes the poor water solubility of free curcumin and improves its
therapeutic index. We found that NanoCurcumin treatment effectively decreased cell proliferation, migration and invasion of HCC
cells. These results were consistent with the effects of high doses of
free curcumin in other HCC cell lines (HEP3B, SK-Hep-1, SNU449)
[29]. Previous studies have reported that NanoCurcumin synergistically enhances the antitumor effects of doxorubicin [30e32].
Therefore, in this study we investigated the potential synergistic
effects of NanoCurcumin with the a kinase inhibitor, sorafenib, in
the treatment of HCC. Our results show that the combination of
NanoCurcumin and sorafenib produces stronger antitumor effects

on HCC than either NanoCurcumin or sorafenib alone. Combination

treatment inhibited HCC cell migration and invasion, and increased
cell apoptosis in vitro and in vivo, dramatically decreasing the
number of pulmonary metastases. These results indicate the ability
of NanoCurcumin to attenuate HCC progression and metastasis.
To better understand the mechanism underlying the anticancer
effects of NanoCurcumin, we evaluated its effects on MMP-9, which
facilitates tumor metastasis [33,34]. Previous reports have indicated free curcumin suppresses MMP-9 expression in HCC through
an unknown mechanism [35,36]. Because NF-kB is a key transcription factor involved in MMP-9 expression, we investigated the
effect of NanoCurcumin on NF-kB signaling and found that NanoCurcumin inhibited the nuclear translocation of the active form of
NF-kB, phosphorylated p65, thereby decreasing MMP-9 expression
and increasing TIMP-1 expression [37,38]. In addition, NanoCurcumin inhibited the phosphorylation of ERK1/2, a key downstream effector of the mitogen-activated protein kinase (MAPK)/
ERK pathway. The MAPK pathway is often constitutively active in
HCC, leading to overexpression of genes that promote cell
proliferation.
Liang et al. reported that use of the curcumin analog EF24 could
overcome sorafenib resistance through von Hippel Lindau tumor
suppressor-dependent degradation of hypoxia-inducible factor 1-a
and inactivation of NF-kB [39]. This may partly explain why
combining sorafenib with NanoCurcumin enhances its anticancer
effects. Sorafenib suppresses ERK phosphorylation by targeting Raf/

B. Hu et al. / Biochemical and Biophysical Research Communications 468 (2015) 525e532

531

Fig. 4. Mechanism of action of NanoCurcumin in HCC xenograft model. After 28-day treatment with NanoCurcumin and/or sorafenib (SO), mRNA levels of (A) MMP-9, (B) p65,
and (C) CD133 levels in orthotopic tumors were determined by qRT-PCR. Protein levels of MMP-9, p65 (whole cell, cytoplasm, and nucleus), TIMP-1, ERK1/2 (total and phosphorylated), as determined by (D) ELISA and (E) western blot. Results are expressed as mean SE of at least three independent experiments. *P < 0.05, #P < 0.01 compared with
controls. Magnication, 400 (D). Scale bar, 200 mm.

mitogen-activated protein extracellular kinase/ERK signaling at the

level of Raf kinase [40]. Its combination with NanoCurcumin may
act synergistically to downregulate MMP-9 through the simultaneous inhibition of ERK1/2 phosphorylation and NF-kB DNAbinding activities.
Recent studies have suggested that CD133 is a biomarker for
cancer stem cells in HCC, and the malignant characteristics of
CD133-positive human HCC cells are regulated by MMPs [41e43].
In view of these ndings, we evaluated the effects of NanoCurcumin
on the CD133-positive population of HCC cells. The results showed
that NanoCurcumin signicantly decreased CD133-positive cells,
and combining NanoCurcumin with sorafenib produced the
strongest effects. However, it remains unclear how NanoCurcumin
decreases the expression of CD133 or how combination treatment
enhances this activity.
In summary, our results indicate that combination therapy with
NanoCurcumin and sorafenib represents a promising strategy for
the treatment of HCC and needs further clinical investigation.
Disclosure statement
The authors disclose no conicts of interest.
Acknowledgments
Supported by National Key Sci-Tech Project (2013ZX10002011004), National Natural Science Foundation of China (81372317,
81071661 and 81302100), the Shanghai Pujiang Scholar Award
(13PJD007), National Institute of Health USA (DK 080736), STCSM
Funds (13140901900) and Specialized Research Fund for the

Doctoral Program of Higher Education of China (20120071120068).

Appendix A. Supplementary data
Supplementary data related to this article can be found at http://
dx.doi.org/10.1016/j.bbrc.2015.10.031.
Transparency document
Transparency document related to this article can be found
online at http://dx.doi.org/10.1016/j.bbrc.2015.10.031.
References
[1] A. Jemal, F. Bray, M.M. Center, J. Ferlay, E. Ward, et al., Global cancer statistics,
CA Cancer J. Clin. 61 (2011) 69e90.
[2] J. Ferlay, H.R. Shin, F. Bray, D. Forman, C. Mathers, et al., Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008, Int. J. Cancer 127 (2010)
2893e2917.
[3] M.M. Yallapu, M. Jaggi, S.C. Chauhan, Curcumin nanoformulations: a future
nanomedicine for cancer, Drug Discov. Today 17 (2012) 71e80.
[4] A.S. Darvesh, B.B. Aggarwal, A. Bishayee, Curcumin and liver cancer: a review,
Curr. Pharm. Biotechnol. 13 (2012) 218e228.
[5] T. Yau, P. Chan, K.K. Ng, S.H. Chok, T.T. Cheung, et al., Phase 2 open-label study
of single-agent sorafenib in treating advanced hepatocellular carcinoma in a
hepatitis B-endemic Asian population: presence of lung metastasis predicts
poor response, Cancer 115 (2009) 428e436.
[6] R.K. Maheshwari, A.K. Singh, J. Gaddipati, R.C. Srimal, Multiple biological activities of curcumin: a short review, Life Sci. 78 (2006) 2081e2087.
[7] S. Singh, From exotic spice to modern drug? Cell 130 (2007) 765e768.
[8] G. Sa, T. Das, Anti cancer effects of curcumin: cycle of life and death, Cell Div. 3
(2008) 14.
[9] Y. Kwon, B.A. Magnuson, Age-related differential responses to curcumininduced apoptosis during the initiation of colon cancer in rats, Food Chem.
Toxicol. 47 (2009) 377e385.

532

B. Hu et al. / Biochemical and Biophysical Research Communications 468 (2015) 525e532

[10] C.L. Yang, Y.Y. Liu, Y.G. Ma, Y.X. Xue, D.G. Liu, et al., Curcumin blocks small cell
lung cancer cells migration, invasion, angiogenesis, cell cycle and neoplasia
through Janus kinase-STAT3 signalling pathway, PLoS One 7 (2012) e37960.
[11] D. Sinha, J. Biswas, B. Sung, B.B. Aggarwal, A. Bishayee, Chemopreventive and
chemotherapeutic potential of curcumin in breast cancer, Curr. Drug Targets
13 (2012) 1799e1819.
[12] Z. Wang, Y. Zhang, S. Banerjee, Y. Li, F.H. Sarkar, Notch-1 down-regulation by
curcumin is associated with the inhibition of cell growth and the induction of
apoptosis in pancreatic cancer cells, Cancer 106 (2006) 2503e2513.
[13] S. Lev-Ari, H. Zinger, D. Kazanov, D. Yona, R. Ben-Yosef, et al., Curcumin
synergistically potentiates the growth inhibitory and pro-apoptotic effects of
celecoxib in pancreatic adenocarcinoma cells, Biomed. Pharmacother. 59
(Suppl. 2) (2005) S276eS280.
[14] T.O. Khor, Y.S. Keum, W. Lin, J.H. Kim, R. Hu, et al., Combined inhibitory effects
of curcumin and phenethyl isothiocyanate on the growth of human PC-3
prostate xenografts in immunodecient mice, Cancer Res. 66 (2006) 613e621.
[15] D. Deeb, H. Jiang, X. Gao, M.S. Hafner, H. Wong, et al., Curcumin sensitizes
prostate cancer cells to tumor necrosis factor-related apoptosis-inducing
ligand/Apo2L by inhibiting nuclear factor-kappaB through suppression of
IkappaBalpha phosphorylation, Mol. Cancer Ther. 3 (2004) 803e812.
[16] R.A. Sharma, H.R. McLelland, K.A. Hill, C.R. Ireson, S.A. Euden, et al., Pharmacodynamic and pharmacokinetic study of oral Curcuma extract in patients
with colorectal cancer, Clin. Cancer Res. 7 (2001) 1894e1900.
[17] S. Bisht, G. Feldmann, S. Soni, R. Ravi, C. Karikar, et al., Polymeric nanoparticleencapsulated curcumin (nanocurcumin): a novel strategy for human cancer
therapy, J. Nanobiotechnol. 5 (2007) 3.
[18] D. Ghosh, S.T. Choudhury, S. Ghosh, A.K. Mandal, S. Sarkar, et al., Nanocapsulated curcumin: oral chemopreventive formulation against diethylnitrosamine induced hepatocellular carcinoma in rat, Chem. Biol. Interact. 195
(2012) 206e214.
[19] Y. Li, B. Tian, J. Yang, L. Zhao, X. Wu, et al., Stepwise metastatic human hepatocellular carcinoma cell model system with multiple metastatic potentials
established through consecutive in vivo selection and studies on metastatic
characteristics, J. Cancer Res. Clin. Oncol. 130 (2004) 460e468.
[20] Q.H. Ye, L.X. Qin, M. Forgues, P. He, J.W. Kim, et al., Predicting hepatitis B viruspositive metastatic hepatocellular carcinomas using gene expression proling
and supervised machine learning, Nat. Med. 9 (2003) 416e423.
[21] X.R. Yang, Y. Xu, B. Yu, J. Zhou, J.C. Li, et al., CD24 is a novel predictor for poor
prognosis of hepatocellular carcinoma after surgery, Clin. Cancer Res. 15
(2009) 5518e5527.
[22] H.M. El Tayebi, W. Salah, I.H. El Sayed, E.M. Salam, A.R. Zekri, et al., Expression
of insulin-like growth factor-II, matrix metalloproteinases, and their tissue
inhibitors as predictive markers in the peripheral blood of HCC patients,
Biomarkers 16 (2011) 346e354.
[23] L.X. Qin, Z.Y. Tang, Recent progress in predictive biomarkers for metastatic
recurrence of human hepatocellular carcinoma: a review of the literature,
J. Cancer Res. Clin. Oncol. 130 (2004) 497e513.
[24] S. Aggarwal, Y. Takada, S. Singh, J.N. Myers, B.B. Aggarwal, Inhibition of growth
and survival of human head and neck squamous cell carcinoma cells by
curcumin via modulation of nuclear factor-kappaB signaling, Int. J. Cancer 111
(2004) 679e692.
[25] R. Siegel, D. Naishadham, A. Jemal, Cancer statistics, 2012, CA Cancer J. Clin. 62
(2012) 10e29.
[26] N.N. Rahbari, A. Mehrabi, N.M. Mollberg, S.A. Muller, M. Koch, et al., Hepatocellular carcinoma: current management and perspectives for the future,
Ann. Surg. 253 (2011) 453e469.

[27] J.M. Pezzuto, Plant-derived anticancer agents, Biochem. Pharmacol. 53 (1997)

121e133.
[28] D.J. Newman, G.M. Cragg, S. Holbeck, E.A. Sausville, Natural products and
derivatives as leads to cell cycle pathway targets in cancer chemotherapy,
Curr. Cancer Drug Targets 2 (2002) 279e308.
[29] L. Ning, L. Wentworth, H. Chen, S.M. Weber, Down-regulation of Notch1
signaling inhibits tumor growth in human hepatocellular carcinoma, Am. J.
Transl. Res. 1 (2009) 358e366.
[30] C.Y. Cheng, Y.H. Lin, C.C. Su, Curcumin inhibits the proliferation of human
hepatocellular carcinoma J5 cells by inducing endoplasmic reticulum stress
and mitochondrial dysfunction, Int. J. Mol. Med. 26 (2010) 673e678.
[31] J. Jiang, H. Jin, L. Liu, J. Pi, F. Yang, et al., Curcumin disturbed cell-cycle distribution of HepG2 cells via cytoskeletal arrangement, Scanning 35 (2013)
253e260.
[32] E. Meiyanto, D.D. Putri, R.A. Susidarti, R. Murwanti, Sardjiman, et al., Curcumin
and its analogues (PGV-0 and PGV-1) enhance sensitivity of resistant MCF-7
cells to doxorubicin through inhibition of HER2 and NF-kB activation, Asian
Pac. J. Cancer Prev. 15 (2014) 179e184.
[33] L.E. Littlepage, M.D. Sternlicht, N. Rougier, J. Phillips, E. Gallo, et al., Matrix
metalloproteinases contribute distinct roles in neuroendocrine prostate
carcinogenesis, metastasis, and angiogenesis progression, Cancer Res. 70
(2010) 2224e2234.
[34] P. Yang, W. Yuan, J. He, J. Wang, L. Yu, et al., Overexpression of EphA2, MMP-9,
and MVD-CD34 in hepatocellular carcinoma: Implications for tumor progression and prognosis, Hepatol. Res. 39 (2009) 1169e1177.
[35] L.I. Lin, Y.F. Ke, Y.C. Ko, J.K. Lin, Curcumin inhibits SK-Hep-1 hepatocellular
carcinoma cell invasion in vitro and suppresses matrix metalloproteinase-9
secretion, Oncology 55 (1998) 349e353.
[36] Y. Ohashi, Y. Tsuchiya, K. Koizumi, H. Sakurai, I. Saiki, Prevention of intrahepatic metastasis by curcumin in an orthotopic implantation model,
Oncology 65 (2003) 250e258.
[37] H. Takeshita, T. Yoshizaki, W.E. Miller, H. Sato, M. Furukawa, et al., Matrix
metalloproteinase 9 expression is induced by Epstein-Barr virus latent
membrane protein 1 C-terminal activation regions 1 and 2, J. Virol. 73 (1999)
5548e5555.
[38] H. Rangaswami, A. Bulbule, G.C. Kundu, Nuclear factor-inducing kinase plays a
crucial role in osteopontin-induced MAPK/IkappaBalpha kinase-dependent
nuclear factor kappaB-mediated promatrix metalloproteinase-9 activation,
J. Biol. Chem. 279 (2004) 38921e38935.
[39] Y. Liang, T. Zheng, R. Song, J. Wang, D. Yin, et al., Hypoxia-mediated sorafenib
resistance can be overcome by EF24 through Von Hippel-Lindau tumor
suppressor-dependent HIF-1alpha inhibition in hepatocellular carcinoma,
Hepatology 57 (2013) 1847e1857.
[40] L. Liu, Y. Cao, C. Chen, X. Zhang, A. McNabola, et al., Sorafenib blocks the RAF/
MEK/ERK pathway, inhibits tumor angiogenesis, and induces tumor cell
apoptosis in hepatocellular carcinoma model PLC/PRF/5, Cancer Res. 66 (2006)
11851e11858.
[41] K. Kohga, T. Tatsumi, T. Takehara, H. Tsunematsu, S. Shimizu, et al., Expression
of CD133 confers malignant potential by regulating metalloproteinases in
human hepatocellular carcinoma, J. Hepatol. 52 (2010) 872e879.
[42] Y. Hou, Q. Zou, R. Ge, F. Shen, Y. Wang, The critical role of CD133()CD44(/
high) tumor cells in hematogenous metastasis of liver cancers, Cell Res. 22
(2012) 259e272.
[43] S. Ma, K.W. Chan, L. Hu, T.K. Lee, J.Y. Wo, et al., Identication and characterization of tumorigenic liver cancer stem/progenitor cells, Gastroenterology
132 (2007) 2542e2556.