Sie sind auf Seite 1von 19
Pre-examination Process (for labs) Validation of test - II Francesco Fiorentino Lab Director GENOMA -
Pre-examination Process (for labs)
Validation of test - II
Francesco Fiorentino
Lab Director
GENOMA - Molecular Genetics Laboratory
Rome – Italy
fiorentino@laboratoriogenoma.it
MUTATIONMUTATION ANALYSISANALYSIS MutationMutation AnalysisAnalysis DirectDirect IndirectIndirect DiagnosisDiagnosis
MUTATIONMUTATION ANALYSISANALYSIS
MutationMutation
AnalysisAnalysis
DirectDirect
IndirectIndirect
DiagnosisDiagnosis
DiDiagnosagnosiiss
DirectDirect
++
MinisequencingMinisequencing
SequencingSequencing
RestrictionRestriction enzimeenzime
digestiondigestion
PCRPCR productsproducts sizingsizing
SSCPSSCP--DGGEDGGE
ARMSARMS // DD--ARMSARMS
MolecularMolecular beaconsbeacons
IndirectIndirect
LinkageLinkage AnalysisAnalysis
ExclusionExclusion testingtesting
WGAWGA ++ STRSTR
haplotypinghaplotyping
DirectDirect mutationmutation testingtesting
++ LinkedLinked STRSTR markersmarkers
MUTATIONMUTATION ANALYSISANALYSIS IndirectIndirect DiagnosisDiagnosis
MUTATIONMUTATION ANALYSISANALYSIS
IndirectIndirect
DiagnosisDiagnosis
Indications for indirect diagnosis • Direct mutation testing is not possible • The mutation is
Indications for indirect diagnosis
• Direct mutation testing is not possible
• The mutation is unknown
• The mutation is a large deletion/insertion with unknown breakpoints
• Direct mutation testing is not efficient
• The gene region to be amplified is refractory to PCR (e.g. GC-rich)
• Presence of a pseudogene
• Genes with a wide spectrum of mutations
• indirect diagnosis as a general protocol for different couples
• Preimplantation HLA matching
• flexible indirect HLA typing protocol applicable to a wide spectrum of
possible HLA genotypes
• Exclusion testing
• e.g. Huntington disease
Indirect diagnosis: Pros / Cons Advantages:Advantages: • No mutation analysis • same protocol useful for
Indirect diagnosis: Pros / Cons
Advantages:Advantages:
• No mutation analysis
• same protocol useful for many couples
• Useful for rare disorders with private mutations
Disadvantages:Disadvantages:
• Applicable to informative couples with family history
• At least two affected family members needed
• Not applicable in cases of de novo mutation and no previous
pregnancies
PrinciplePrinciple ofof indirectindirect diagnosisdiagnosis FatherFather MotherMother ChildChild
PrinciplePrinciple ofof indirectindirect diagnosisdiagnosis
FatherFather
MotherMother
ChildChild
PGDPGD forfor 21-21-OHOH deficiencydeficiency byby linkagelinkage analysisanalysis
PGDPGD forfor 21-21-OHOH deficiencydeficiency byby linkagelinkage analysisanalysis
GeneticGenetic MarkersMarkers ••SingleSingle nucleotidenucleotide polymorphismspolymorphisms (SNPs)(SNPs) ••
GeneticGenetic MarkersMarkers
••SingleSingle nucleotidenucleotide polymorphismspolymorphisms (SNPs)(SNPs)
•• singlesingle basebase changechange inin genomicgenomic DNADNA
•• oneone perper everyevery 500500 -- 10001000 basebase pairspairs
•• lessless informativeinformative thanthan microsatellitemicrosatellite markersmarkers
•• lowlow mutationmutation rate*rate* ((≈≈ 1010 --99 ))
TGCATTTGCATTGGCGTAGGCCGTAGGC
TGCATTTGCATTCCCGTAGGCCGTAGGC
••ShortShort TandemTandem RepeatsRepeats (STRs)(STRs)
oror MicrosatellitesMicrosatellites
TGCTGCTTCCACACACACACAACACACACACA GCGC
TGCTGCTTCCACACAACACA ------------GCGC
•• 11 everyevery fewfew kb,kb, highhigh degreedegree ofof heterozygosityheterozygosity
•• mutationmutation rate*rate* ≤≤ 1010 --33
•• Types:Types:
• di- (CA)n,
• tri- (CAG)n,
≤ ≤
100bpbp 100
• tetra- (GATA)n.
• Penta – (AAAAT)n nucleotide repeats
••MinisatellitesMinisatellites (VNTR(VNTR -- variablevariable numbernumber tandemtandem repeats)repeats)
**perper generationgeneration
•• 11 everyevery fewfew kbkb
•• mutationmutation rate*rate* ≤≤ 1010 --11
MicrosatellitesMicrosatellites MarkersMarkers microsatellite the repeat region is variable between samples while the
MicrosatellitesMicrosatellites MarkersMarkers
microsatellite
the repeat region is variable between
samples while the flanking regions
where PCR primers bind are constant
(ca)n
gacctaatc ca ca taccgtta
Allele 2
gacctaatc ca ca ca ca ca taccgtta
Allele 5
197.2
223.4
Alleles distinguishable
by PCR product length
Homozygote = both alleles are the same length
Heterozygote = alleles differ and can be resolved from one another
MicrosatelliteMicrosatellite CharacteristicsCharacteristics StutterStutter Peaks:Peaks: DiDi--nucleotidenucleotide vsvs
MicrosatelliteMicrosatellite CharacteristicsCharacteristics
StutterStutter Peaks:Peaks: DiDi--nucleotidenucleotide vsvs TetraTetra--nucleotidenucleotide RepeatsRepeats
True Allele
True Allele
Stutter -
Stutter -
Stutter -
4bp
2bp
4bp
MicrosatelliteMicrosatellite MarkerMarker TypesTypes DinucleotideDinucleotide RepeatRepeat MarkersMarkers E.g.:
MicrosatelliteMicrosatellite MarkerMarker TypesTypes
DinucleotideDinucleotide RepeatRepeat MarkersMarkers
E.g.: (CA)(CA)(CA)…(CA)n
•• AbundantAbundant coveragecoverage
•• CharacteristicCharacteristic stutterstutter patternspatterns
•• InterpretationInterpretation cancan bebe complexcomplex
MicrosatelliteMicrosatellite MarkerMarker TypesTypes TetranucleotideTetranucleotide RepeatRepeat MarkersMarkers E.g.
MicrosatelliteMicrosatellite MarkerMarker TypesTypes
TetranucleotideTetranucleotide RepeatRepeat MarkersMarkers
E.g. (TCTA)(TCTA)…(TCTA)n
•• WellWell characterisedcharacterised
•• DiscreteDiscrete alleleallele peakspeaks
•• Low,Low, predictablepredictable andand measurablemeasurable stutterstutter peakspeaks
••
EasierEasier interpretationinterpretation
HowHow toto buildbuild thethe haplotypes?haplotypes? • Selection of the STR markers linked to the disease
HowHow toto buildbuild thethe haplotypes?haplotypes?
• Selection of the STR markers linked to the disease causing
gene
TheThe choicechoice ofof linkedlinked STRSTR markersmarkers TelomereTelomere 1.501.50 MbMb D11S4146D11S4146 0.700.70
TheThe choicechoice ofof linkedlinked STRSTR markersmarkers
TelomereTelomere
1.501.50
MbMb
D11S4146D11S4146
0.700.70
MbMb
D11S988D11S988
0.480.48
MbMb
D11S4146D11S4146
HBBHBB
0.150.15
MbMb
D11S1760D11S1760
0.740.74
MbMb
D11S1338D11S1338
1.121.12
MbMb
D11S1997D11S1997
2.052.05
MbMb
D11S1331D11S1331
CentromereCentromere
ChromosomeChromosome 1111
HowHow toto buildbuild thethe haplotypes?haplotypes? • Selection of the STR markers linked to the disease
HowHow toto buildbuild thethe haplotypes?haplotypes?
• Selection of the STR markers linked to the disease causing
gene
• Evaluation of the informativity of the markers:
• Selection of the informative markers
• Preferably fully informative (i.e., 4 different alleles, father a/b and
mother c/d)
• Identification of the alleles associated with the
mutation/disease
AffectedAffected ChildChild FatherFather MotherMother InformativitInformativit yy testintestin gg AffectedAffected
AffectedAffected ChildChild
FatherFather
MotherMother
InformativitInformativit
yy
testintestin
gg
AffectedAffected ChildChild
FatherFather
MotherMother
HowHow toto buildbuild thethe haplotypes?haplotypes? • Selection of the STR markers linked to the disease
HowHow toto buildbuild thethe haplotypes?haplotypes?
• Selection of the STR markers linked to the disease causing
gene
• Evaluation of the informativity of the markers:
• Selection of the informative markers
• Preferably fully informative (i.e., 4 different alleles, father a/b and
mother c/d)
• Identification of the alleles associated with mutation/disease
• Determination of the haplotypes
DETERMININGDETERMINING HAPLOTYPESHAPLOTYPES FORFOR LINKAGELINKAGE ANALYSYSANALYSYS D11S4146 156156 162162 156156
DETERMININGDETERMINING HAPLOTYPESHAPLOTYPES FORFOR LINKAGELINKAGE ANALYSYSANALYSYS
D11S4146
156156 162162
156156
162162
160160 D11S4146
168168
D11S988
126126 120120
XX
126126
120120
132132 D11S988
124124
D11S4181
105105 109109
105105
109109
116116 D11S4181
111111
HBBHBB
NN
HBBHBB
IVSIIVSI--110110
FatherFather
MotherMother
NN
IVSIIIVSII--745745
D11S1760
107107
103103 D11S1760
111111
105105
D11S1338
134134
136136 D11S1338
130130
132132
D11S4146
162162
162162
160160
D11S988
120120
120120
132132
D11S4181
109109
109109
116116
HBBHBB
IVSIIVSI--110110 IVSIIVSI--110110
IVSIIIVSII--745745
D11S1760
111111
111111
103103
D11S1338
130130
130130
136136
AffectedAffected
ChildChild
DETERMININGDETERMINING HAPLOTYPESHAPLOTYPES FORFOR LINKAGELINKAGE ANALYSYSANALYSYS D11S4146 172172 156156 162162
DETERMININGDETERMINING HAPLOTYPESHAPLOTYPES FORFOR LINKAGELINKAGE ANALYSYSANALYSYS
D11S4146
172172
156156
162162
164164
D11S4146
D11S988
118118
126126
120120
134134
D11S988
D11S4181
120120
105105
109109
124124
D11S4181
HBBHBB
NN
IVSIIVSI--110110
NN
NN
HBBHBB
D11S1760
115115
111111
107107
115115
D11S1760
GrandfatherGrandfather
GrandmotherGrandmother
D11S1338
142142
130130
134134
126126
D11S1338
D11S4146
162162
156156
160160 D11S4146
168168
D11S988
120120 XX
126126
132132 D11S988
124124
D11S4181
109109
105105
116116 D11S4181
111111
HBBHBB
NN
IVSIIVSI--110110
FatherFather
MotherMother
HBBHBB
NN
IVSIIIVSII--745745
D11S1760
107107
111111
103103 D11S1760
105105
D11S1338
134134
130130
136136 D11S1338
132132
AffectedAffected
ChildChild
D11S4146
162162
160160
D11S988
120120
132132
D11S4181
109109
116116
HBBHBB
IVSIIVSI--110110
IVSIIIVSII--745745
D11S1760
111111
103103
D11S1338
130130
136136
Linkage-based PGD protocols: general guidelines • Type of markers: • STRs, preferably tetra-nucleotide repeat
Linkage-based PGD protocols: general guidelines
• Type of markers:
• STRs, preferably tetra-nucleotide repeat (di-nucleotide repeat are
also acceptable)
• Location of STR markers:
• preferentially intragenic or extragenic, very closed to the gene (max 1
Mb of distance) to reduce the risk of recombination events
• Heterozygosity of STR markers
• High (>0.8) to improve informativity of the markers
• No. of STR markers
• Preferably 4, 2 upstream and 2 downstream
• Size of the alleles
• Small product size (preferably < 250 bp) to improve PCR efficiency
• Number of family members
• At least two generations or affected family members
IndirectIndirect DiagnosisDiagnosis ExclusionExclusion TestingTesting
IndirectIndirect DiagnosisDiagnosis
ExclusionExclusion
TestingTesting
Exclusion of HD using linkagelinkage 11 66 2121 2626 D4S127 D4S127 22 77 2222 2727
Exclusion of HD using linkagelinkage
11
66
2121
2626
D4S127
D4S127
22
77
2222
2727
D4S1614
D4S1614
2323
D4S3034
33
88
2828
D4S3034
MotherMother
2424
2929
D4S412
D4S412
44
99
FatherFather
55
1010
2525
3030
D4S126
D4S126
CC
DD
A
B
2121
2626
D4S127
2222
2727
D4S1614
?
2323
2828
D4S3034
2424
2929
D4S412
MaleMale partnerpartner
FFeemmaallee paparrttnneerr
2525 3030 D4S126
A/B - CC/DD
50% risk
EE FF
EmbryoEmbryo 11
?
EmbryoEmbryo 22
EmbryoEmbryo 33
?
EmbryoEmbryo 44
D4S127
11
66
2121
2121
2121
11
66
2626
2121
2626
D4S1614
22
77
2222
2222
2222
22
77
2727
2222
2727
D4S3034
33
88
2323
2323
2323
33
88
2828
2323
2828
D4S412
44
99
2424
2424
2424
44
99
2929
2424
2929
D4S126
55
1010
2525
2525
2525
55
1010
3030
2525
3030
A or B
EE
CC
EE
A or B
FF
CC
FF
50%50% riskrisk
50%50% riskrisk
IndirectIndirect DiagnosisDiagnosis WGAWGA ++ HaplotypingHaplotyping
IndirectIndirect DiagnosisDiagnosis
WGAWGA
++
HaplotypingHaplotyping
WholeWhole GenomeGenome AmplificationAmplification (WGA)(WGA) • Universal first amplification step • WGA product
WholeWhole GenomeGenome AmplificationAmplification (WGA)(WGA)
• Universal first amplification step
• WGA product analysis in conventional facilities
• No requirement for development of special
single cell/mutation detection tests
LINKED
MUTATION
MARKERS
ANALYSIS
SINGLE
HLA
ANEUPLOIDY
CELL
HAPLOTYPING
DNA
FINGERPRINTING
Multiple Displacement Amplification • Isothermal, no cycling involved (incubation at 30°C) • Random priming using
Multiple Displacement Amplification
• Isothermal, no cycling
involved (incubation at 30°C)
• Random priming using
exonuclease resistant
modified random hexamers
• Polymerase makes strand
and displaces other strand,
e.g. F29 polymerase
• 104-106-fold amplification
• Obtaining µgs of DNA
Spits et al., 2006, Nature Protocols, Vol 1(4): 1965-1970
MDA and PGD • Use for haplotyping in PGD for monogenic disease (PGH) • High
MDA and PGD
• Use for haplotyping in PGD for
monogenic disease (PGH)
• High ADO rate, many markers have to be included
in the protocol
• Use for array-CGH in PGS
• A combination of both
MUTATIONMUTATION ANALYSISANALYSIS DirectDirect ++ IndirectIndirect DiagnosisDiagnosis
MUTATIONMUTATION ANALYSISANALYSIS
DirectDirect ++ IndirectIndirect
DiagnosisDiagnosis
TheThe useuse ofof STRSTR markersmarkers inin PGDPGD procedureprocedure Represents a diagnostic tool for indirect
TheThe useuse ofof STRSTR markersmarkers inin PGDPGD procedureprocedure
Represents a diagnostic tool for indirect mutation analysis, providing
an additional confirmation of the results obtained with the direct
genotyping procedure
provides a control of misdiagnosis due to undetected ADO
provides an additional control for contamination with exogenous DNA
Provides information on embryo’s chromosomes copy number
PGD protocols for SGD are not appropriate for clinical practice
without including a set of linked STR markers
Allele drop-out Allele drop-out (ADO) is defined as the non-amplification of one allele when performing
Allele drop-out
Allele drop-out (ADO) is defined as the non-amplification of one
allele when performing PCR at the single cell level.
This phenomenon can only be demonstrated in heterozygote
cells, which show a homozygous pattern when ADO has occurred
ADO occurs in all cell types, e.g. blastomeres, lymphocytes,
buccal cells and fibroblasts.
An undetected ADO event leads to misdiagnosis
AvoidanceAvoidance ofof misdiagnosismisdiagnosis duedue toto ADOADO HBB gene Father Mother HBB gene and markers and
AvoidanceAvoidance ofof misdiagnosismisdiagnosis duedue toto ADOADO
HBB gene
Father
Mother
HBB gene
and markers
and markers
Telomere
Telomere
D11S4146
162
156
160
168
D11S4146
D11S988
120
126
132
124
D11S988
D11S4181
109
105
116
111
D11S4181
HBBHBB
IVSI-110
N
IVSII-745
N
HBBHBB
D11S1760
111
107
103
105
D11S1760
D11S1338
130
134
136
132
D11S1338
Centromere
Centromere
HBB gene
Embryo
Embryo
Embryo
Embryo
Embryo
Embryo
Embryo
HBB gene
and markers
5
1
2
3
6
7
8
and markers
D11S4146
162 160
162 168
156
160
156
168
156
168
156
160
162
160
D11S4146
D11S988
120 132
120 124
126
132
126
124
126
124
126
132
120
132
D11S988
D11S4181
109 116
109 111
105
116
105
111
105
111
105
116
109
116
D11S4181
HBBHBB
-110
N
-110
N
N
IVSII-745
N
N
N
N
N
IVSII-745
-110
-745
HBBHBB
D11S1760
111 103
111 105
107
103
107
105
107
105
107
103
111
103
D11S1760
D11S1338
130 136
130 132
134
136
134
132
134
132
134
136
130
136
D11S1338
Affected
Carrier
Carrier
Normal
Normal
Carrier
Affected
with ADO
STR markers: Other application in PGD PreimPreimpplantationlantation HLAHLA MatchingMatching
STR markers: Other application in PGD
PreimPreimpplantationlantation
HLAHLA MatchingMatching
PreimplantationPreimplantation HLAHLA MatchingMatching byby STRSTR haplotyinghaplotying D6S439 190 198 188 194
PreimplantationPreimplantation HLAHLA MatchingMatching byby STRSTR haplotyinghaplotying
D6S439
190
198
188
194
HLA-DQ
3
4
7
6
DQCAR II
155
162
150
158
HLA-DRB
5
6
5
4
DRA-CA
148
154
FatherFather
MotherMother
144
152
TNF-a
128
133
120
130
HLA-B
7
8
3
2
HLA-BC
130
139
128
132
HLA-C
9
10
1
8
D6S265
148
160
150
155
D6S510
270
288
260
268
PGDPGD
HLA-A
11
12
9
10
MOG-CA
135
155
130
145
190
194
D6S439
190
194
3
6
HLA-DQ
3
6
155
158
DQCAR II 155
HLA-DRB 5
158
5
4
4
148
152
DRA-CA
148
152
128
130
TNF-a
128
130
7
2
HLA-B
7
2
130
132
HLA-BC
130
132
9
8
HLA-C
9
8
148
155
D6S265
148
155
270
268
D6S510
270
268
11
10
HLA-A
11
10
135
145
MOG-CA
135
145
HLA
AffectedAffected
identical
childchild
embryo
HLAHLA STRSTR haplotypinghaplotyping Indirect typing of the HLA region by segregation analysis of the STR

HLAHLA STRSTR haplotypinghaplotyping

Indirect typing of the HLA region by segregation analysis of the STR alleles

The HLA identity of the embryos with the affected sibling is ascertained evaluating the inheritance of the matching haplotypes.

A panel of 50 different STRs is studied during the pre-clinical work-up

AtAt leastleast 88 informativeinformative markers,markers, evenlyevenly spacedspaced throughoutthroughout thethe HLAHLA regionregion areare selectedselected toto bebe usedused inin clinicalclinical PGDPGD

Achievement of an accurate mapping of the whole HLA region

InformativityInformativity testingtesting forfor preimplantationpreimplantation HLAHLA matchingmatching

MARKERMARKER MOTHERMOTHER FATHERFATHER CHILDCHILD TNF1TNF1 107107 114114 105105 114114 105105 114114
MARKERMARKER
MOTHERMOTHER
FATHERFATHER
CHILDCHILD
TNF1TNF1
107107
114114
105105
114114
105105
114114
D6S510D6S510
155155
140140
151151
148148
151151
140140
D6S426D6S426
120120
128128
120120
124124
120120
128128
MICMIC AA
168168
171171
171171
168168
171171
171171
D6S273D6S273
142142
144144
136136
142142
136136
144144
D6S276D6S276
218218
220220
216216
211211
216216
220220
LH1LH1
144144
146146
141141
144144
141141
146146
DQDQ CARCAR IIII
DRADRA CACA
MOGMOG CACA
131131
118118
130130
123123
130130
118118
130130
137137
130130
139139
130130
137137
215215
206206
225225
206206
225225
206206
HLAHLA BCBC CACA
117117
129129
120120
132132
120120
129129
D6S265D6S265
110110
114114
120120
116116
120120
114114
D6S291D6S291
156156
160160
158158
158158
158158
160160
TNF2TNF2
111111
111111
113113
111111
113113
111111
8282--11
111111
111111
104104
111111
104104
111111
G51152G51152
145145
145145
147147
147147
147147
145145
D3AD3A
200200
202202
202202
202202
202202
202202
RING3RING3 CACA
126126
124124
124124
126126
124124
124124
6262
156156
163163
156156
163163
156156
163163
D6S439D6S439
120120
122122
120120
122122
120120
122122
MIBMIB
177177
177177
172172
177177
172172
177177
D6S105D6S105
141141
141141
139139
153153
139139
141141
D6S105D6S105 141141 141141 139139 153153 139139 141141 TheThe useuse ofof STRSTR markersmarkers inin HLAHLA
TheThe useuse ofof STRSTR markersmarkers inin HLAHLA matchingmatching procedureprocedure The same strategy can be used
TheThe useuse ofof STRSTR markersmarkers inin HLAHLA matchingmatching procedureprocedure
The same strategy can be used for different cases (and allele
combinations)
STRs provide an additional control for contamination with
exogenous DNA
The whole HLA complex can be covered, allowing the detection
of recombination events between HLA genes.
AvoidanceAvoidance ofof misdiagnosismisdiagnosis duedue toto recombinationrecombination D6S439 190 198 188 194 DQCAR
AvoidanceAvoidance ofof misdiagnosismisdiagnosis duedue toto recombinationrecombination
D6S439
190
198
188
194
DQCAR II
155
162
150
158
DRA-CA
148
154
144
152
TNF-a
128
133
120
130
HLA-BC
130
139
FatherFather
MotherMother
128
132
D6S265
148
160
150
155
XX
D6S510
270
288
260
268
MOG-CA
135
155
130
145
PGDPGD
D6S439
190
194
190
194
190
194
DQCAR II
155
158
155
158
155
158
DRA-CA
148
152
148
152
148
152
128
130
128
130
TNF-a
128
130
130
128
HLA-BC
130
132
130
132
148
D6S265
148
155
148
155
150
270
260
D6S510
270
268
270
268
135
135
130
MOG-CA
135
145
145
AffectedAffected
HLA
Recombinant
childchild
identical
embryo
embryo
STR markers: Other application in PGD DetectionDetection ofof chromosomalchromosomal AneuploidiesAneuploidies
STR markers: Other application in PGD
DetectionDetection ofof
chromosomalchromosomal
AneuploidiesAneuploidies
AneuploidyAneuploidy DetectionDetection byby usingusing STRSTR markers:markers: microsatellite Chromosomes:Chromosomes:
AneuploidyAneuploidy DetectionDetection byby usingusing STRSTR markers:markers:
microsatellite
Chromosomes:Chromosomes:
AMAAMA
RIFRIF
(ca)n
13,13, 14,14, 15,15, 16,16, 18,18,
21,21, 22,22, XX ,Y,Y
RMRM
gacctaatc ca ca taccgtta
gacctaatc ca ca ca ca ca taccgtta
gacctaatc ca ca ca ca ca ca cataccgtta
Allele 1
Allele 2
Allele 3
Alleles are
distinguishable
by PCR product
length
EmbryoEmbryo withwith trisomytrisomy 2121
197.2
223.4
AneuploidyAneuploidy DetectionDetection byby usingusing STRSTR markersmarkers 13 18 21 X Y Trisomy 21 21 21
AneuploidyAneuploidy DetectionDetection byby usingusing STRSTR markersmarkers
13
18
21
X
Y
Trisomy
21
21
21
18
13
18
XX
1818
1313
2121
1313
1313
TrisomyTrisomy
2121 YY
1313
STR markers: Other application in PGD DetectionDetection ofof unbalancedunbalanced chromosomalchromosomal
STR markers: Other application in PGD
DetectionDetection ofof
unbalancedunbalanced
chromosomalchromosomal
translocationstranslocations
SegregationSegregation ofof RobertsonianRobertsonian TranslocationsTranslocations 2323 ChrChr 1313 ChrChr 1414
SegregationSegregation ofof RobertsonianRobertsonian TranslocationsTranslocations
2323
ChrChr 1313
ChrChr 1414
AdjacentAdjacent 11
1313
AdjacentAdjacent 22
2424
2121
2222
1414
GametesGametes
1111
1212
AlternateAlternate
2323
2323
1313
1313
2323
2424
2121
2222
2424
1313
1414
2121
2222
1212
1414
1111
2424
1111
1212
2121
1414
2222
Gamete 1
Gamete 2
Gamete 5
1111
Gamete 6
1212
(
U
n
b
a ance
l
d
)
(
U
n
b
a ance
l
d
)
(
U
n
b
a ance
l
d
)
(Unbalanced)
Gamete 3
Gamete 4
(NORMAL)
(BALANCED)
EmbryosEmbryos
2323
2424
4343
1313
1414
3333
2323
4343
1313
3333
2424
4343
2222
4141
1414
3333
1212
4141
2121
2222
2121
4141
3131
1212
3131
1111
1111
3131
2323
4343
TrisomyTrisomy 1414
NormalNormal
1313
3333
TrisomyTrisomy 1313
4343
3333
4141
2424
4343
2222
4141
2121
4141
MonosomyMonosomy
1414
3333
3131
BalancedBalanced
1212
1111
MonosomyMonosomy 1313
3131
1414 3131
14 13 13 14 13
14
13
13
14
13

4141

3131

13 14 14
13
14
14
2323 4343 1313 3333 2121 2222 1212 1111 TrisomyTrisomy 1313 4141 2424 4343 1414 3333
2323
4343
1313
3333
2121
2222
1212
1111
TrisomyTrisomy 1313
4141
2424
4343
1414
3333
3131

MonosomyMonosomy 1313

2424 4343 14 1414 3333 13 14 2121 4141 13 1111 3131 NormalNormal
2424
4343
14
1414
3333
13
14
2121
4141
13
1111
3131
NormalNormal
D13S631D13S631 D13S217D13S217 D13S634D13S634
D13S631D13S631
D13S217D13S217
D13S634D13S634
4343 14 1414 3333 13 14 2121 4141 13 1111 3131 NormalNormal D13S631D13S631 D13S217D13S217 D13S634D13S634
4343 14 1414 3333 13 14 2121 4141 13 1111 3131 NormalNormal D13S631D13S631 D13S217D13S217 D13S634D13S634
13 13 14 14 14
13
13
14
14
14
13 13 14
13
13
14
14 13 14 13
14
13
14
13
D14S549D14S549 D14S553D14S553 D14S617D14S617 2323 2424 4343 1313 1414 3333 ADOADO 2222 4141 1212 3131
D14S549D14S549
D14S553D14S553
D14S617D14S617
2323
2424
4343
1313
1414
3333
ADOADO
2222
4141
1212
3131
TrisomyTrisomy 1414
4343
3333
2121
4141
1111
3131
MonosomyMonosomy 1414
2424
4343
1414
3333
2121
4141
1111
3131

NormalNormal

4343 3333 2121 4141 1111 3131 MonosomyMonosomy 1414 2424 4343 1414 3333 2121 4141 1111 3131
SegregationSegregation ofof ReciprocalReciprocal TranslocationsTranslocations (in(in gametesgametes)) AdjacentAdjacent 11
SegregationSegregation ofof ReciprocalReciprocal TranslocationsTranslocations (in(in gametesgametes))
AdjacentAdjacent 11
AdjacentAdjacent 22
AA
11
33
CC
55 77
66 88
BB
22
DD
44
11
33
55
77
11
55
AlternateAlternate
33 77
66
88
22
44
66 88
22
44
Gamete 1
Gamete 2
(Unbalanced)
(Unbalanced)
Gamete 6
11
33 55
Gamete 5
77
(Unbalanced)
66
(Unbalanced)
88
22
44
3:3:11
3:3:11
Gamete 4
Gamete 3 (BALANCED)
(NORMAL)
55
77
11
55
88
55 11
33 77
33
11
55
77
77
11
33
44
33
22
66 88
66
88
88
66
44
44 22
66
22
22
44
Gamete 11
Gamete 7
Gamete 8
Gamete 9
(Unbalanced)
Gamete 13
Gamete 14
Gamete 10
Gamete 12
(Unbalanced)
(Unbalanced)
(Unbalanced)
(Unbalanced)
(Unbalanced)
(Unbalanced)
(Unbalanced)
SegregationSegregation ofof ReciprocalReciprocal TranslocationsTranslocations (in(in embryosembryos)) 1111 11 33 1111
SegregationSegregation ofof ReciprocalReciprocal TranslocationsTranslocations (in(in embryosembryos))
1111
11
33 1111
1515 1111
1515 55
11
1111
1515
33
55
77
1515
77
1616
66
1212
1616
1616
1616 88
66
22
1212
88
1212
1212
44
44 22
Embryo 1 (Unbalanced)
Embryo 3 (NORMAL)
Embryo 4 (BALANCED)
Embryo 2 (Unbalanced)
1515
1515
77
55
1515
55
1515
1616
1111
1616
1111
11
33
88 1111
1111 1515
1616
1111
11
33
1616
77
44
33 1616
66
44
1212
1212
22
88
1212
1212
66
1212 66
22
Embryo 5 (Unbalanced)
Embryo 9 (Unbalanced)
Embryo 6 (Unbalanced)
Embryo 7 (Unbalanced) Embryo 8 (Unbalanced)
1515 77
55 1515
1515
1515
55
1616
1616
1111
1515
55
1111
88
11
33
11
1111
77
11
33
77 1616
1616 1111
1616
44 1111
88
66
88
44 66
1212 44
1212
22
1212
22
22
1212
1212
Embryo 14
Embryo 10 (Unbalanced)
Embryo 11 (Unbalanced) Embryo 12 (Unbalanced) Embryo 13 (Unbalanced)
(Unbalanced)
SegregationSegregation ofof RobertsonianRobertsonian TranslocationsTranslocations (1PB(1PB testingtesting)) Trivalent
SegregationSegregation ofof RobertsonianRobertsonian TranslocationsTranslocations
(1PB(1PB testingtesting))
Trivalent forms of
Chromosomes in synapsis
phase during Meiosis I
33
33
44
44
44
44
33
33
11
11
22
22
ChrChrChrChr 14141414
ChrChrChrChr 13131313
33
33
33
33
22
22
11
11
33
33
11
11 44
44
11
11
22
22
22
22
44
44
NORMAL
BALANCED
Unbalanced
Unbalanced
Unbalanced
Unbalanced
CHR13: 1
CHR13: 2
CHR13: 2
CHR13: 1
CHR13: 1/2
CHR13: null
CHR14: 4
CHR14: 3
CHR14: 3/4
CHR14: null
CHR14: 3
CHR14: 4
AdjacentAdjacent 11
AlternateAlternate
AdjacentAdjacent 22
11
11
22
22
4444

PCGDPCGD forfor RobertsonianRobertsonian TranslocationsTranslocations byby 1PB1PB testingtesting

33 33 22 22 11 11
33
33
22
22
11
11

Unbalanced

CHR13: 1/2

CHR14: 3

11 11 44 44
11
11 44
44

NORMAL

CHR13: 1

CHR14: 4

D13S240D13S240 D13S243D13S243 D13S252D13S252
D13S240D13S240
D13S243D13S243
D13S252D13S252

PCGDPCGD forfor RobertsonianRobertsonian TranslocationsTranslocations byby 1PB1PB testingtesting

33 33 22 22 4444
33
33
22
22
4444

Unbalanced

CHR13: 2

CHR14: 3/4

11 11 44 44
11
11 44
44

NORMAL

CHR13: 1

CHR14: 4

D14S121D14S121 D14S122D14S122 D14S551D14S551
D14S121D14S121
D14S122D14S122
D14S551D14S551
STRSTR--basedbased PGDPGD forfor translocations:translocations: advantagesadvantages • Easy procedure and data
STRSTR--basedbased PGDPGD forfor translocations:translocations: advantagesadvantages
• Easy procedure and data interpretation
• Amenable to automation
• Rapid procedure (<12 h)(4-6 h for 1PB testing)
• Cell fixation (PBs or blastomeres) is not necessary
• Solve suboptimal fixation problems, easier procedure for transport PGD
• Overcome to several technical limitation of FISH procedure:
• Overlapping signals, split signals, lack of signals, cross-hybridization,
polymorphisms, limited availability of the probes, combination of colours
• Possibility to perform combined testing
• e.g. Translocation + PGS; Translocation + SGD with or w/o PGS
• Post-hybridization wash and re-probing are not necessary for combined testing
• UPD can be detected
• Lower error rate
• Low expensive
• A DNA fingerprint is achievable from each embryos
• Identification of embryos that have implanted
STRSTR--basedbased PGDPGD forfor translocations:translocations: disadvantagesdisadvantages •• AffectedAffected byby
STRSTR--basedbased PGDPGD forfor translocations:translocations: disadvantagesdisadvantages
•• AffectedAffected byby contaminationcontamination
•• AffectedAffected byby ADOADO –– PreferentialPreferential AmplificationAmplification
•• RecombinationRecombination riskrisk inin casescases ofof 1PB1PB testingtesting
FutureFuture vision:vision: uniqueunique protocolprotocol forfor PGDPGD PGDPGD WGAWGA TranslocationTranslocation
FutureFuture vision:vision: uniqueunique protocolprotocol forfor PGDPGD
PGDPGD
WGAWGA
TranslocationTranslocation
AneuploidyAneuploidy
SGDSGD
CombinedCombined
ReciprocalReciprocal
RIFRIF
SGDSGD ++ AneuploidAneuploidyy
TranslocationTranslocation ++
RobertsonianRobertsonian
RMRM
AneuploidyAneuploidy
InversionInversion
AMAAMA
AllAll ChrChr
PrePre--examinationexamination ProcessProcess (for(for labs)labs) VValidationalidation ofof thethe PGDPGD
PrePre--examinationexamination ProcessProcess (for(for labs)labs)
VValidationalidation ofof thethe
PGDPGD ProtocolProtocol
DevelopingDeveloping aa PGDPGD protocolprotocol ConfirmatoryConfirmatory testingtesting ofof thethe
DevelopingDeveloping aa PGDPGD protocolprotocol
ConfirmatoryConfirmatory testingtesting ofof thethe mutation(s)mutation(s)
ChoiceChoice ofof thethe PGDPGD strategystrategy (direct(direct mutationmutation diagnosis,diagnosis, linkage)linkage)
InformativityInformativity testingtesting forfor linked/unlinked/un--linkedlinked STRSTR markersmarkers
TestTest multimultipplexlex PCR:PCR: combinationcombination ofof pprimers,rimers, etc.etc.
ApplicationApplication toto thethe singlesingle cellcell levellevel (i.e.(i.e. singlesingle lymphocytes,lymphocytes,
fibroblast,fibroblast, buccalbuccal cells,cells, etc.)etc.)
AmplificationAmplification efficiency,efficiency, contaminationcontamination andand ADOADO ratesrates inin
heterozygousheterozygous samplessamples
TestTest onon sparespare blastomeresblastomeres (depending(depending onon availabilityavailability ))
ReadyReady forfor PGDPGD
PreliminaryPreliminary PGDPGD work-work-up:up: parametersparameters toto bebe evaluatedevaluated • Pre-clinical tests
PreliminaryPreliminary PGDPGD work-work-up:up: parametersparameters toto bebe evaluatedevaluated
• Pre-clinical tests on single cells (lymphocytes, fibroblasts,
amniocytes, buccal cells, etc.)
• At least 50 cells in total
• Amplification efficiency > 90 % should be aimed
• Lower efficiency coincides with higher ADO
• ADO rates should be as low as possible (preferably <10%)
• ADO is mostly influenced by PCR method (conventional vs.
fluorescent)
• The contamination rate should be less than 5% (preferably zero)
• At least 50 cell wash blanks
ESHRE PGD Consortium guidelines, Hum Reprod. 2005 Jan;20(1):35-48
OneOne--cellcell versusversus twotwo--cellscells biopsybiopsy • Doubts and discussion about one vs two-cell biopsy •
OneOne--cellcell versusversus twotwo--cellscells biopsybiopsy
• Doubts and discussion about one vs two-cell biopsy
• Risk of misdiagnosis (e.g. autosomal dominant disorders)
• Claims that higher implantation rate is achieved after one-cell biopsy
• Randomized control trial (Goossens V. et al., Hum Reprod 2007)
• Removal of two blastomeres significantly decreases the likelihood of
blastocyst formation
• one-cell biopsy results in a significantly lower diagnositic efficiency
• live birth delivery rates were not statistically different for one- and
two-cell biopsy
• RECOMMANDATION: diagnosis of only 1 cell
requires a robust PGD protocol