1

MOL.BIOLOGY
In a eukaryotic gene, one of the introns is mutated at the 3' end as shown:
Normal: 5'...TTTCCCACCCTTAG 3'
Mutant: 5'...TTTCCCACCCTTCG 3'
Which of the following processes is this mutation most likely to affect?
A. Capping
B. Hybridization
C. Polyadenylation
D. Splicing
E. Transcription
Explanation:
The correct answer is D. The 3' end of a eukaryotic intron contains a splice acceptor site, with an invariant AG
just before the end of the intron. This sequence is highly conserved, as it is essential for correctly recognizing
and splicing out the intervening sequences, or introns, from the nascent RNA transcript prior to transport out of
the nucleus. At the 5' end of the intron is an equally important GT (GU in RNA) sequence that is also necessary
for splicing (splice donor site).
Capping (choice A) occurs almost immediately after synthesis of the first 30 nucleotides or so. The triphosphate
of GTP condenses with the available 5' diphosphate on the growing RNA chain to form a "cap" recognized
during protein synthesis that also protects the RNA from degradation.
Hybridization (choice B) is the process by which two molecules of nucleic acid anneal to each other based on
nucleotide base-pairing. Alteration of one nucleotide in the intervening sequence shown will produce only very
minor effects on hybridization.
In the polyadenylation process (choice C), an AAUAAA sequence near the 3' end of the RNA transcript is
recognized, the RNA is cleaved by an endonuclease, then a poly-A polymerase adds 100 to 200 adenylate
residues to the RNA. Failure to recognize this sequence would result in failure of polyadenylation.
Transcription (choice E), the process by which DNA is "read" to yield RNA via the actions of RNA polymerase,
should not be affected by the mutation.

In order to determine the location of the HexA gene, somatic cell hybrids between mouse and human cells were

2
produced. The presence or absence of the HexA gene was determined by Southern blotting the DNA from the hybrids
with a probe specific for the gene. The data is summarized in the table above. Pluses and minuses below each of the
chromosome numbers denotes the presence or absence of that chromosome from the indicated hybrid. On which
chromosome is the gene for HexA found?
A. 2
B. 5
C. 8
D. 10
E. 15
F. 17
G. 21
H. X
Explanation:
The correct answer is E. In order to analyze this data, you must look for the chromosome that matches exactly with the
presence of the HexA gene. Hybrid I has HexA activity and chromosomes 1, 5, 7, 8, 9, 10, 12, 14, 15, 18, 19, 20, 22,
and the X chromosome. Hybrid III also has HexA activity and chromosomes 4, 6, 8, 11, 12, 13, 15, 16, 21, 22, and X.
Doing this for all of the hybrids that have HexA activity, you can determine that only chromosome 15 appears in all of
the hybrids that have the enzyme activity. Therefore, HexA must be found on chromosome 15.

Which of the following agents inhibits eukaryotic protein synthesis?

A. Chloramphenicol
B. Cycloheximide
C. Erythromycin
D. Puromycin
E. Streptomycin
F. Tetracycline
Explanation:
The correct answer is B. All of the drugs listed inhibit protein synthesis, but only cycloheximide affects eukaryotic,
rather than prokaryotic, ribosomes. Because of this, cycloheximide can be used as an anti-neoplastic agent,
while the others can be used as antibiotics. The mechanism of action of antibiotics is an exam favorite, so here is
a useful table for this type of question:
Site of block
Antibiotics
Ribosomal peptidyl transferase
Chloramphenicol (choice A)
Translocation

3
Erythromycin (choice C)
Elongation
Puromycin (choice D)
Initiation
Streptomycin (choice E), Tetracycline (choice F)
A patient at a specialty clinic is undergoing evaluation for liver disease. Although the cause of the liver
dysfunction is not known, the doctor suspects that the patient has a deficiency of a liver enzyme resulting from a
novel deletion of the gene for the enzyme. Which of the following tools of molecular genetics would be most useful
for studying this gene?
A. cDNA library
B. Fluorescence-activated cell sorting (FACS)
C. Genomic library
D. Plasmids
E. Southern blotting
Explanation:
The correct answer is E. Deletions are routinely detected by two methods: Southern blotting (using a probe from
either a cDNA or genomic library) or polymerase chain reaction (PCR) using primers specific for the gene. Both
of these techniques will show size changes that will allow the investigator to determine the size of the deletion.
Deletions may sometimes be detected by using restriction enzymes; for example, the loss of a normally present
restriction site may indicate deletion of the DNA in the vicinity of that site.
A cDNA library (choice A) is synthesized from the mRNA of a cell using the enzyme reverse transcriptase. It is
used to study the DNA and mRNA from which proteins are transcribed.
FACS (fluorescence-activated cell sorting; choice B) uses antibodies coupled to fluorescent markers to
determine cell surface molecules of whole cells. It is very useful for determining the stage of development or
activation of cells, but does not tell you anything about the DNA.
A genomic library (choice C) is the chromosomal sequence of a gene, including its coding and non-coding
regions. It is synthesized directly from the DNA of a cell and is used to study both the coding regions and the
areas such as promoters, enhancers, and introns of a gene.
Plasmids (choice D) are extrachromosomal, independently replicating circular pieces of DNA that are found in
bacteria. They often contain antibiotic resistance genes. The are used in molecular biology to insert genes into
bacteria for expression.

Histones can bind DNA tightly because they have a high isoelectric point. This is due to an enrichment in the
amino acid
A. aspartate
B. glycine
C. lysine
D. proline

4
E. tyrosine
Explanation:
The correct answer is C. Histones are enriched in the amino acids lysine and arginine. They are positively
charged and bind tightly to DNA, which is negatively charged from phosphate groups.
Proline (choice D) and glycine (choice B) are neutral, aliphatic amino acids. Aspartate (choice A) is negatively
charged. Tyrosine (choice E) is a neutral, aromatic amino acid.

A patient who has never had chickenpox wants to visit her sister, whose daughter currently has the disease. In
order to determine if she has antibodies to the varicella zoster virus, which of the following tests could be
performed?
A. ELISA
B. Northern blot
C. PCR reaction
D. Southern blot
E. Subtractive hybridization
Explanation:
The correct answer is A. An enzyme-linked immunosorbent assay (ELISA) would be used to determine antibody
levels to a particular virus. Viral protein is bound to a microtiter plate and the patient's serum serially diluted
across the plate. If specific antibodies for the virus are present, they bind to the virus. The amount of bound
antibody is quantitated, using an enzyme-coupled reaction that produces a visible pigment in proportion to the
amount of bound antibody. A similar test is used to determine exposure to HIV.
Northern blots (choice B) are used to determine RNA levels in a cell.
PCR reactions (choice C) are useful in amplifying small pieces of DNA for sequencing, cloning, or microsatellite
DNA mapping.
Southern blots (choice D) are used to study genomic DNA.
Subtractive hybridization (choice E) is a technique used to identify tissue or organ specific genes by
"subtracting" out RNA from a closely related cell type, leaving behind the RNAs from genes that are transcribed
only in that cell type.

A woman trying to get pregnant has a sister whose child has an autosomal recessive disease characterized by
dysfunction of mucus-secreting cells. As a result, this child has abnormally thick mucus that tends to precipitate
into dense plugs that obstruct the pancreatic ducts, bronchi, and bronchioles, as well as the bile ducts. Which of
the following tests could be performed to determine if this woman and her husband are carriers of this disease?
A. Northern blot
B. PCR and sequencing

5
C. Southern blot
D. Western blot
Explanation:
The correct answer is B. The disease described is cystic fibrosis, which phenotypically presents with meconium
ileus, deficiencies of pancreatic enzymes, pulmonary obstruction and infection leading to progressive
pulmonary damage and ultimate respiratory failure. The most frequent mutation in this autosomal recessive
disorder is a small deletion of a phenylalanine at position 508. An amplification of this region using PCR can be
done and then that portion sequenced to see how it compares to the normal sequence.
Northern blot (choice A) is used to determine RNA levels inside a cell and would not help us determine if this
person is a carrier.
Southern blots (choice C) are used to study genomic DNA on a gross level and could not be used to see a
single base-pair deletion.
Western blots (choice D) are used to look for the presence or absence of a particular protein, but since the
protein is produced, though defective, this technique would not give the information needed.

A patient presents with retinoblastoma. He has a single tumor in one eye. What test could be used to determine
whether this is a heritable or sporadic tumor?
A. DNA footprinting
B. Fluorescence-activated cell sorting (FACS)
C. Northern blotting
D. PCR
E. Western blotting
Explanation:
The correct answer is D. Forty percent of retinoblastomas are heritable; the child inherits one mutant allele
through the germline and a somatic mutation in the other allele occurs, resulting in the loss of function of that
gene. This leads to tumor development, often with multiple tumors in both eyes. Penetrance, however, is not
complete, since the second mutation is a chance event. Sixty percent of retinoblastomas are sporadic; both
alleles are inactivated by somatic mutation. Because this is a rare event, tumors usually are in only one eye and
present at a later age.
To detect a mutation in the Rb gene and differentiate between heritable and sporadic cases of retinoblastoma,
PCR is the most appropriate technique of the choices given. Using the appropriate primers, a deletion can be
detected as a change in size of the DNA band amplified. In heritable cases, one chromosome will show the
altered length from the deletion or the translocation in any cell in the body. In sporadic retinoblastoma, samples
isolated from anywhere other than the tumor should have two normal alleles.
DNA footprinting (choice A) is a protocol used to detect specific protein binding to DNA molecules by comparing
the fragmentation patterns of DNA bound with the protein of interest vs. unbound DNA following digestion with
DNase I. If the bound protein protects against DNase I digestion, the position of the protein on the DNA can be
deduced by the loss of the characteristic fragment.
FACS (choice B) uses antibodies coupled to fluorescent markers to determine cell surface molecules on whole

6
cells. It is very useful for determining the stage of development or activation of cells, but does not give you any
insight into the DNA.
Northern blotting (choice C), the RNA counterpart to Southern blotting, will determine the size and abundance of
mRNA of a specific gene in a given sample of RNA. RNA is not able to be cleaved by restriction enzymes the way
the DNA can; however, RNA molecules for different proteins are of different lengths. The sample is separated by
agarose gel electrophoresis, transferred to a nitrocellulose membrane, and probed with a specific, labeled
probe. This will be exposed to film and the bands will appear, revealing the size and the abundance of specific
mRNAs.
Western blotting (choice E) is the protein counterpart of Southern and Northern blotting. Proteins are isolated
from the cell type of interest and separated by size on a polyacrylamide gel, then transferred to a nitrocellulose
membrane. The filter is then incubated with antibodies that specifically react with the protein of interest, then it is
incubated with a labeled antibody (e.g., radioactive) that reacts with the first antibody. After this has been
washed off, the membrane is exposed to film and bands characteristic of the protein being studied will appear.
This is useful to determine whether a protein is present or absent in a patient or if it is the wrong size, indicating
an error in the DNA for this protein.

During DNA replication, which of the following enzymes produces a short strand of RNA complementary to the
template DNA with a free 3'-OH end?
A. DNA ligase
B. Polymerase I
C. Polymerase III
D. Primase
E. Topoisomerase
Explanation:
The correct answer is D. The primer molecule required by DNA polymerase is a short strand of RNA (4-10
bases) complementary to the template strand of the DNA molecule. The primer is synthesized by a specific RNA
polymerase known as primase. The growing end of the RNA primer is a free 3'-OH group. The primase does not
itself require a primer for initiation of nucleotide synthesis.
DNA ligase (choice A) catalyzes the formation of a phosphodiester bond between the 3'-OH of one fragment of
DNA and the 5'-monophosphate group of an adjacent DNA fragment.
Polymerase I (choice B) catalyzes the polymerization of nucleotides and also functions in processing and repair
mechanisms.
Polymerase III (choice C) is a part of a multiprotein complex and is the major replicating enzyme in E. coli.
Topoisomerases (choice E) produce swivel points in the DNA molecule that relieve the strain induced by the
replication fork. These enzymes cut and reseal the DNA.

HbNl: AAGUAUCACUAAGCUCGC
HbCr: AAGAGUAUCACUAAGCUCGCUUUC ... UAU UAA
Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the
presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal β-globin

7
chain. The normal sequence of the β-globin gene (HbNl) and the sequence of the HbCr β-chain are
presented above. Which of the following would account for the development of HbCr?
A. A frameshift mutation resulted in the deletion of several amino acid residues in the β-chain
B. A mutation in the stop codon resulted in elongation of the β-chain
C. A point mutation resulted in the insertion of a stop codon in the β-chain
D. A two base pair addition resulted in the elimination of a stop codon in the β-chain
E. A two base pair deletion resulted in truncation of the β-chain
Explanation:
The correct answer is D. Looking at the coding segment of the normal β-gene of hemoglobin, one should
read the information codon by codon, as follows:
AAG
UAU
CAC
UAA
GCU
CGC
1
2
3
4
5
6
The normal β-globin gene has a stop codon (UAA) at the 4th position, therefore the last 2 codons (GCU and
CGC) are not translated and do not code for amino acid residues found in the protein. Comparing this information
to the coding segment of the mutated β-gene of hemoglobin Cranston, one would notice the following:
AAG
AGU
AUC
ACU
AAG
CUC
GCU
UUC
...UAU
UAA
1
2
3
4
5
6
7
8
...etc
The insertion of two base pairs (AG) results in a frameshift mutation that eliminates the stop codon at position 4,
thereby causing the addition of amino acids normally not translated in the hemoglobin β-chain of the child.

8
Since the chain is now too long, this destabilizes the tetrameric conformation of hemoglobin.
A frameshift mutation resulting in deletion of several amino acids (choice A) is wrong, since such a mutation would
have inserted a stop codon (UAA, UGA or UAG) before position 4.
A mutation in the stop codon (choice B) would have resulted in a longer-than-normal β-globin gene, but the
information given does not indicate any changes in the stop codon at position 4. Interestingly, a chain elongation
by mutation in the stop codon exists and is known as hemoglobin Constant Spring, affecting the α-chain of
hemoglobin.
A point mutation (choice C) is the result of a single base pair change, which is not the case here. A point mutation
resulting in the insertion of a new stop codon is called a nonsense mutation, and it would result in a
shorter-than-normal protein.
A two base pair deletion (choice E) is not evidenced by the coding sequence given in the stem. It would also cause
a frameshift in the reading frame with the possible result of a longer or shorter protein, most likely with abnormal
function due to the change in primary structure (amino acid sequence).
Strategy note: Since the hemoglobin Cranston β-chain is clearly longer than the normal β-chain, choices
A, C, and E, which would produce a shorter chain, can be eliminated immediately.

Cloning of a new eukaryotic gene was followed by insertion and ligation of the gene in an expression vector. The
protein translated from this gene was then studied on a western blot, and probed with 32P-DNA, yielding a
positive result. These findings eliminate which of the following substances as a candidate for the likely gene
product?
A. CREB
B. Protein kinase A
C. RNA polymerase
D. SP-1
E. Steroid receptor
Explanation:
The correct answer is B. The stem suggests that the protein isolated is a DNA-binding protein, since the probing
was done with a DNA probe and not an antibody. Protein kinase A is an enzyme that phosphorylates other
proteins rather than interacting with DNA, and therefore would give a negative result with a DNA probe. Protein
kinase A is a cAMP-dependent kinase.
CREB (choice A) stands for cAMP response element binding protein. This is a type of DNA-binding protein,
which importantly links levels of the second messenger of numerous receptors (glucagon, adenosine, some
5-HT, ADH, TSH, etc.) with expression of critical proteins.
RNA polymerase (choice C) is the key enzyme responsible for transcription of DNA into RNA. Transcription is
under promoter region control. Within a promoter, a critical TATAA sequence is found at -25 and is the
essential recognition site for the enzyme RNA polymerase.
SP-1 (choice D) is a transcription factor with a zinc finger motif that controls gene expression in mammalian
cells. It is said to function as a "housekeeping" factor, allowing other crucial enzymes involved with transcription
to operate optimally.
Steroid receptors (choice E) also belong to the superfamily of zinc finger DNA-binding proteins. These
characteristic fingers, where zinc is bound to a pair of Cys and a pair of His, allow intimate interaction of the

9
protein with major grooves in the DNA molecule. Such interaction is responsible for controlling gene expression
and in turn, for assuring a steroid response in the eukaryotic cell. An example would be cortisol and the
induction of the enzyme phosphoenolpyruvate carboxykinase, resulting in increased hepatic gluconeogenesis
and therefore hyperglycemia.

A 2-year-old boy is undergoing an eye examination due to an abnormal light reflex his right eye, causing a so-called
"cat eye." A whitish elevation of the retina is observed and invasion of the optic nerve by the tumor has begun. His
family history is significant for osteosarcoma in his father. He has a sister who is asymptomatic. HindIII digestion of
a
PCR fragment of interest from a 180 kb gene located on the proximal half of the long arm of chromosome
13demonstrates two different alleles (shown on the Southern blot below).
Father
Mother
Daughter
Son
Band Size
_______
________
_________
________
2.1Kb
_________
_______

1.8Kb
__________

.1.5Kb

Which of the following is the best conclusion that can be derived from the given information?
A. The daughter inherited a 1.5 kb fragment from her mother
B. The daughter will develop the tumor
C. The disease is associated with the 2.1 kb fragment
D. The disease shows an autosomal dominant pattern
E. The mother was affected, but the tumor regressed spontaneously
Explanation:
The correct answer is C. An early sign of retinoblastoma is the so-called cat's eye sign. Familial retinoblastoma is
most often bilateral, so this case would be unusual. Spontaneous regression is common; however, predisposition
to other cancers, particularly osteosarcoma, has been noted. A specific deletion has been identified at 13q14. The
retinoblastoma gene encodes a large protein that binds DNA and probably has a regulatory function on cell
growth. The son is affected; his DNA pattern is to have 2.1 kb restriction fragments. Both parents have contributed
to his DNA pattern. The best conclusion is therefore that the disease characterized by a 2.1 kb fragment.
The daughter inheriting a 1.5 kb fragment from her mother (choice A) is wrong since the mother does not have a
1.5 kb restriction fragment. She received it from her father.
The daughter will not develop the tumor (compare with choice B) based on the information given. In familial
retinoblastoma, loss of function of both alleles of the gene results in the disease (homozygous deletion). The
daughter is heterozygous for the trait and therefore will not develop the disease.
The pattern of inheritance (choice D) is best described as autosomal (transmission from both males and females)
recessive (skipped a generation). There is not enough information given to know if this is definitely autosomal
recessive and, therefore, this cannot be the best answer. Interestingly, retinoblastoma does not have to be

10
familial, since it can also occur as a somatic mutation in the tumor suppressor gene Rb-1.
Spontaneous regression of a tumor in the mother (choice E) is very unlikely. Although the tumor can regress
spontaneously, the eye appearance can not be missed. Further, based on a recessive pattern requiring the 2.1
kb bands to be present, the mother appears as heterozygous for the trait.

A researcher is trying to identify a specific protein within a mixture. He subjects the mixture to gel electrophoresis
and then transfers the separation to nitrocellulose filters. The filters are incubated with antibody to the specific
protein and the excess antibody is washed off. The antibody-protein complex is then incubated with a
radiolabeled protein that binds to the antibody. Autoradiography is performed to detect the presence of the
protein. This technique represents
A. Northern blotting
B. Southern blotting
C. Southwestern blotting
D. Western blotting
Explanation:
The correct answer is D. The technique described is Western blotting. Western blots are used to identify a
specific protein that may be present in very small concentrations in a complex protein mixture. This technique is
used to confirm the presence of anti-HIV antibodies in the serum of infected patients. Note that the ELISA test
(enzyme-linked immunoabsorbent assay), which measures the amount of HIV antibody present, is used initially
to detect the presence of anti-HIV antibody. All patients with positive ELISAs are further evaluated with the
Western blot, to rule out false-positive results. The Western blot, because it is based on an initial
electrophoretic separation, gives additional information about the molecular weight of the suspected HIV protein
that makes the identification more accurate.
Northern blotting (choice A) utilizes DNA-RNA hybridization to determine the size and abundance of RNA for a
specific gene. A RNA sample is subjected to electrophoresis and transferred to a nitocellulose filter. The filter's
RNA is exposed to a labeled DNA probe that will bind to its RNA complement. The labeled DNA-RNA hybrid can
be visualized upon exposure to film.
Southern blotting (choice B) utilizes DNA-DNA hybridization. The technique is similar to Northern blotting, but
instead of a labeled RNA probe, a labeled DNA probe is used. This test can be used to determine the
epidemiological relatedness of different bacterial biotypes, such as the strains of S. aureus that produce
toxic-shock syndrome.
Southwestern blotting (choice C) involves DNA-protein interactions. A protein sample is subjected to
electrophoresis, transferred to a filter, and exposed to labeled DNA.

14

11
A researcher isolates total RNA from cultured cells. She then subjects the RNA sample to electrophoresis,
separating the different species of RNA on the basis of molecular weight. In the gel depicted above, transfer RNA
(tRNA) most likely corresponds to
A. band A
B. band B
C. band C
D. band D
E. band E
F. band F
Explanation:
The correct answer is F. tRNAs are the smallest species of RNA, thus they migrate the farthest when subjected to
electrophoresis.
The largest molecules are in the messenger (mRNA) and heterogeneous nuclear RNA (hnRNA) classes. Most
ribosomal RNA (rRNA) is synthesized from a 45S precursor, which is cleaved into 5.8 and 28S rRNAs. A 5S rRNA
is synthesized separately.

An 8-year-old boy is brought to a dermatology clinic by his parents. They note that his skin is extremely sensitive
to sunlight and his chart indicates that he has had multiple melanomas removed over his lifetime. This patient
likely has
A. a defect in AP endonuclease
B. a defect in excision repair of ultraviolet-damaged DNA
C. been exposed to pyrimidine analogs
D. defective proofreading
E. deletion of his helicase gene
Explanation:
The correct answer is B. This patient has xeroderma pigmentosum, an autosomal recessive trait. This disease is
characterized by an extreme sensitivity to sunlight, skin changes, and a predisposition to malignancy. The
disease results from a defective excision repair mechanism for UV-damaged DNA.
A defect in the AP endonuclease (choice A) leads to ataxia-telangiectasia, characterized by hypersensitivity to
ionizing radiation, dilated blood vessels, and lymphomas.
Pyrimidine analogs (choice C), such as 5-fluorodeoxyuridine, inhibit thymidylate synthase, an enzyme critical for
DNA synthesis. Insertion of these analogs stops elongation of the DNA chain; therefore, they are useful as
chemotherapeutic agents.
Defective proofreading (choice D) would affect DNA replication in all body tissues, not just those exposed to UV.
Helicases (choice E) are enzymes responsible for unwinding the DNA before DNA replication can begin. Helicase

12
abnormalities would affect DNA replication in all body tissues, not just those exposed to UV.

16

A young man recently died during surgery under general anesthesia. Symptoms prior to his death included muscle
spasms, hyperthermia, acidosis, and cardiac arrest. His family history is significant for his father dying under similar
conditions and an aunt having survived the same complications during a hip replacement surgery. He is survived by
his wife, a son, and a daughter. DNA has been isolated from family members and a Southern blot of restriction
fragments from a specific region of chromosome 19 reveals the following pattern:

Band Size
12 kb

Father
.

Mother
____

11Kb

_____

9Kb

_____

7Kb

______

____

Daughter

Son

_____

____

Paternal Grandfather
_______

_____
_____

______

Which of the following conclusions can reasonably be drawn from these data?
A. The 11 kb band from the father carries the probable mutation and his children will not be affected
B. The 7 kb band carries the probable mutation and the son should not undergo general
anesthesia with halothane
C. The 9 kb band carries the probable mutation and the daughter should not receive succinylcholine as a
neuromuscular relaxant
D. The disease is X-linked recessive, so the daughter will not develop life-threatening side-effects during
general anesthesia
E. The transmission of the disease is via mitochondrial inheritance, so the son will be unaffected
Explanation:
The correct answer is B. The history suggests an autosomal dominant disorder (the father died, the grandfather
and an aunt suffered similar conditions). Limited information through 3 generations shows no skipping of
generations (dominance), and a affected female confirms the autosomal transmission. The symptoms of
hyperthermia, muscle spasm, autonomic and electrolyte disturbances during general anesthesia, and the
pedigree argue for a diagnosis of malignant hyperthermia. In this disorder, a mutation in the ryanodine
receptor-gated calcium channel of the sarcoplasmic reticulum of skeletal muscle leads to increased sensitivity to
halothane and depolarizing agents. In an autosomal dominant pattern, one defective allele is sufficient to develop
the trait. The father can pass on an 11 kb, a 9 kb or a 7 kb band to his children, whereas the mother can pass on
a 12 kb or a 9 kb band. The DNA pattern of the father and grandfather can be compared, and the likely restriction
fragment involved in the inheritance of malignant hyperthermia is the 7 kb band.
The 11 kb band from the father (choice A) does not carry the defective allele, since the grandfather did not share
that same banding pattern: the only similarity between the father and his own father is the 7 kb band. However, if
the statement had been true, then his children would not have a risk of malignant hyperthermia, because they do

13
not carry the allele.
The 9 kb band does not appear to carry the defective allele (choice C), however, if it did, the daughter would have
a major risk of developing malignant hyperthermia when succinylcholine was used as a neuromuscular blocking
agent, because it is a depolarizing drug.
The disease is not X-linked recessive (choice D) because an aunt had a similar problem, but was resuscitated. If it
were X-linked, only males would be affected, so the daughter would not be affected.
Mitochondrial inheritance (choice E) would be inconsistent with the observed transmission of the defective allele
from males to their offspring.

A 2-month-old, breast-fed baby that was normal at birth begins to develop GI problems and cirrhosis of the liver.
Molecular analysis indicates a normal amount of galactose-1-phosphate uridyl transferase (GALT) mRNA, but no
observable enzyme activity. Which of the following would be the best possible explanation for this?
A. Gene deletion
B. Nonsense mutation
C. Premature transcription termination sequence in the DNA
D. Promoter mutation
E. RNA splicing mutation
Explanation:
The correct answer is B. A nonsense mutation is a mutation in the DNA that leads to a premature stop codon
when the mRNA is being translated into protein. The mRNA would be transcribed correctly, but when the protein
was being translated, it would be stopped prematurely, leading to a truncated protein.
A gene deletion (choice A) would result in either the absence of mRNA or mRNA of a different size, both of
which would be apparent by Northern blot analysis.
A premature transcription termination sequence in the DNA (choice C) might result in premature termination of
the mRNA chain, leading to a diminished or absent message.
A promoter mutation (choice D) in the DNA, if it caused the gene in question to be less actively transcribed
would result in a diminished amount of message.
An RNA splicing mutation (choice E) would result in the production of an mRNA molecule of a different size,
which would be apparent on Northern blot.

Folate plays a role in single-carbon unit transfer in the synthesis of nucleotides. Which of the following
nucleotides require folate for synthesis?
A. Adenosine, cytosine, and uracil
B. Adenosine, guanine, and thymidine
C. Adenosine, guanine, and uracil
D. Cytosine, thymidine, and uracil

14
E. Guanine, thymidine, and uracil
Explanation:
The correct answer is B. Folate is involved in the transfer of carbons 2 and 8 of the purine nucleus (affecting
adenosine and guanosine) and the 5-methyl group of thymidine. This means that folate is required for
synthesis of 3 of the 4 nucleic acid bases of DNA and 2 of the 4 nucleic acid bases in RNA. It is thus no wonder
that folate deficiency has effects on so many tissues with high mitotic rate. Megaloblastic changes analogous to
those seen in erythrocytes and their precursors can also be seen in other cells produced by bone marrow
(neutrophil, eosinophil, basophil, and macrophage as well as megakaryocyte lines) and in epithelia throughout
the body, including skin, mucous membranes such as the mouth and vagina (where the changes can be seen
on Pap smear), stomach and intestinal linings, and cells from lung or liver. Similar megaloblastic changes are
observed throughout the body when cobalamin (vitamin B12) deficiency is present, since cobalamin plays a
role in methionine synthesis, which is the source of the one-carbon unit "active-formate." Cobalamin is also
involved in the conversion of methylmalonic acid to succinic acid and is required to maintain the integrity of
nerve cells via an unknown biochemical pathway.

19
γ15N-labeled glutamine is fed to an experimental animal. Following a period of several days, the animal is
sacrificed and total nucleic acids are isolated. The nucleic acids are subjected to alkaline hydrolysis, and the
resulting nucleoside monophosphates are separated. If a sample of adenosine monophosphate obtained in this
manner were analyzed, the 15N label would be found in which of the positions represented above?
A. 1 only
B. 1 and 2
C. 2 only
D. 2 and 3
E. 3 only
F. 3 and 4
G. 4 only
H. 4 and 5

15
I. 5 only
Explanation:
The correct answer is D. The nitrogens labeled 2 and 3 are both derived from the γ-amino group of
glutamine. The nitrogen labeled 1 is derived from glycine, the nitrogens labeled 4 and 5 are derived from
aspartate.

After amplification of exon 9 of the LDL receptor gene using PCR, a scientist employs RFLP analysis with
Southern blotting to identify a point mutation in codon 408. This mutation has resulted in the missense mutation
of GTG (Val) to GTA (Met):
Normal: CTGGTGCAA
Mutant: CTGGTACAA
Exon 9: 222 bp
NlaIII is a restriction enzyme recognizing the short palindrome GTAC, which is not present in the normal exon 9.
The researcher digests the amplified exon 9 with this enzyme, then subjects it to Southern blotting with a probe
directed against the entire amplified region. Which of the following banding patterns would most likely be found in
an individual heterozygous for the mutation described?
A. One thick band of 222 bp
B. Three bands of 180, 32 and 10 bp
C. Three bands of 222, 126 and 96 bp
D. Two thick bands of 126 and 96 bp
E. Two bands of 444 and 222 bp
Explanation:
The correct answer is C. The point mutation has resulted in the introduction of the palindrome recognized by
NlaIII, GTAC. Enzymatic digestion of the amplified 222 bp mutated exon 9 should therefore result in two
fragments, of combined mass 222. Digestion of the normal 222 bp amplified exon should not result in
fragmentation, and it should remain a 222 bp fragment. A heterozygote individual has one normal allele of the
LDL receptor gene and one mutated allele. Digestion of the PCR-amplified exon 9 should therefore result in 3
different restriction fragments: the 222 bp normal allele, and the fragmented mutant allele. Note that 126 and
96 add up to 222.
One thick band at 222 (choice A) would be expected in an homozygous normal individual, both alleles
remaining intact after NlaIII digestion. The thickness of the band only shows the abundance of the restriction
fragment of that size.
Three bands of 180, 32 and 10 bp (choice B) would indeed indicate digestion by the restriction enzyme.
However, the lack of 222 bp restriction fragment would rule out the presence of a normal allele. Also note that
since the sum of the three fragments is 222, it would indicate the presence of 2 restriction sites for the enzyme,
which is not compatible with the information given.
Two bands of 126 and 96 bp (choice D) would be the pattern expected from a homozygous individual for the
mutated allele. The thickness of the band reflects the abundance of restriction fragment of that size.

16
Two bands of 444 and 222 bp (choice E) would be very difficult to interpret. A fragment that is larger than the
original amplified material could not be created by enzyme digestion.