Legal Medicine 12 (2010) 8489

Contents lists available at ScienceDirect

Legal Medicine
journal homepage: www.elsevier.com/locate/legalmed

Evaluation of a new experimental kit for the extraction of DNA from bones
and teeth using a non-powder method
Tetsushi Kitayama a,*, Yoshinori Ogawa a, Koji Fujii a, Hiroaki Nakahara a, Natsuko Mizuno a,
Kazumasa Sekiguchi a, Kentaro Kasai a, Noriko Yurino b, Takahide Yokoi b, Yoshiya Fukuma b,
Kenji Yamamoto b, Takahito Oki c, Hideki Asamura c, Hirofumi Fukushima d
a

First Department of Forensic Science, National Research Institute of Police Science, Chiba 277-0882, Japan
Hitachi Software Engineering Co., Ltd., Tokyo 140-0002, Japan
Department of Legal Medicine, Shinshu University School of Medicine, Nagano 390-8621, Japan
d
National Research Institute of Police Science, Chiba 277-0882, Japan
b
c

a r t i c l e

i n f o

Article history:
Received 17 August 2009
Received in revised form 22 December 2009
Accepted 27 December 2009
Available online 27 January 2010
Keywords:
DNA extraction
Bone
Powder
Decalcication
Second extraction
Forensic

a b s t r a c t
An experimental DNA extraction kit (new kit) was recently developed to extract DNA from degraded skeletal remains without the need for powdering the samples. We compared the utility of the new kit with
the conventional phenol/chloroform method using real-time quantitative PCR and multiplex STR analysis. The new kit yielded large amounts of DNA from a compact bone fragment compared with the conventional phenol/chloroform method. We were able to extract sufcient DNA for STR analysis from 75% (3 of
4) and 60% (3 of 5) of the un-powdered tooth and bone samples, respectively, using the new kit. We were
able to perform mini-STR analysis of the remaining samples using DNA extracted with the new kit. Furthermore, we successfully performed mitochondrial DNA sequencing of every sample. The new kit simplies the DNA extraction procedure as it does not require powdering samples. Decreasing the number of
procedural steps in DNA extraction will be benecial in controlling DNA contamination in laboratories.
Our results suggest that the new kit may be used for the simple, simultaneous extraction of DNA from
multiple samples.
2010 Elsevier Ireland Ltd. All rights reserved.

1. Introduction
In many instances, tooth or bone samples are the only source of
DNA for individual and kinship identication from degraded human remains [13]. The bacterial degradation of soft tissues (blood
samples, muscle tissue) occurs in a relatively short period of time.
In contrast, tooth and bone tissues are generally more stable [4,5].
However, not all tooth and bone samples contain sufcient
amounts or quality of genomic DNA for short tandem repeat
(STR) analysis. Furthermore, the state of DNA preservation and
the presence of substances that inhibit PCR often varies between
samples [4,6].
The contamination of forensic samples with exogenous human
DNA, because of mishandling during recovery or processing, remains an issue in many analyses [79]. For this reason, the use
of carefully sampled compact bone as a source material for DNA
extraction is preferable because it minimizes the chances of exogenous contamination that can lead to misidentication [10].
* Corresponding author. Address: 6-3-1 Kashiwanoha, Kashiwa, Chiba 277-0882,
Japan. Tel.: +81 4 7135 8001; fax: +81 4 7133 9159.
E-mail address: tetsushik@nrips.go.jp (T. Kitayama).
1344-6223/$ - see front matter 2010 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.legalmed.2009.12.004

Research on forensic DNA extraction is problematic as endogenous DNA is generally present in small amounts and in various levels of degradation [11,12]. Extraction techniques that can retrieve
as much DNA as possible from teeth and bones are of considerable
utility. Given this, a number of techniques have been published, all
of which aim to maximize DNA yields [1315]. The majority of
conventional methods for DNA extraction from tooth and bone
samples are designed to use powdered tissue. These methods rely
on grinding the samples into a ne powder to produce higher
yields [16]. However, greater level of sample manipulation increases the risk for contamination, particularly when processing
a number of samples simultaneously. In general, laboratory contamination has been controlled by limiting the number of DNA
extractions performed simultaneously. Recently, a new experimental DNA extraction kit (Hitachi Software Engineering, Tokyo,
Japan) was developed to extract DNA from hard tissues without
powdering. The technique was successfully applied to extract
DNA from a number of 60-year old Japanese skeletal remains found
buried in Russian territory since the end of World War II [17]. The
new kit uses commonly applied protocols for bone DNA extraction,
namely decalcication and proteolysis, and contains reagents necessary for DNA extraction. The new kit was expected to simplify

85

T. Kitayama et al. / Legal Medicine 12 (2010) 8489

the extraction procedures and therefore facilitate simultaneous

extractions of multiple samples. We evaluated the utility of the
new kit by comparing DNA yields against the conventional phenol/chloroform method [18]. In addition, we examined the effects
of sample size and decalcication condition on DNA yields using
the new kit. Furthermore, we performed STR analysis and mitochondrial DNA (MtDNA) sequencing using DNA extracted with
the new kit.
2. Materials and methods
2.1. Samples
We selected ve human bones and four human teeth originating from different individuals in various states of preservation,
ranging in age from 0.54 years post-mortem (Table 1).
2.2. Pre-treatment of samples
2.2.1. Compact bone
The external and internal surfaces of the samples were removed
using a dental drill to eliminate possible contamination from exogenous DNA and inhibitory substances. The samples were then
washed once with detergent, three times with 1% (w/v) sodium
hypochlorite solution, three times with sterilized water, and once
with ethanol. Following the ethanol wash, the samples were dried
in a chamber at 56 C for 2 h. Each air-dried bone sample was separated into bone fragments similar in shape and approximately
equal sized (ca. 0.5 g) using a dental cutting disc. These bone fragments were then divided into three groups (based on size) for DNA
extraction: (1) ca. 0.5 g fragments, (2) ca. 0.1 g fragments similar in
shape and approximately equal sized (created by further slicing of
the 0.5 g fragments) for the purpose of comparing DNA yields, and
(3) ne powder (created by grinding the 0.5 g fragments using a
Multi-bead shocker: Yasui Kikai Co. Ltd, Osaka, Japan). To reduce
stochastic variation, we extracted DNA from each sample, originating from one bone, in triplicate for each method.
2.2.2. Cancellous bone and tooth samples
We removed dirt and tissue residues on the surface of the cancellous bone and tooth samples using a dental drill. Several of the
teeth were then cut into two pieces and the dental pulp was removed using a dental needle. One half of the tooth was then
ground to powder and extracted using the conventional phenol/
chloroform method. We extracted DNA from the remaining half

using the new kit. In addition, we extracted DNA from the remaining uncut teeth using the new kit.

2.3. DNA extraction

2.3.1. Conventional phenol/chloroform DNA extraction procedure
DNA was extracted from the three treatment groups following
the methods outlined in previously published protocols [4,18],
with slight modications. A sample (ca. 0.5 g) was decalcied in
10 ml 0.5 M EDTA (pH 8.0) at 56 C with gentle agitation overnight.
After centrifugation, the supernatant was discarded and the
remaining decalcied pellet was washed twice with sterilized
water and once with TNE buffer consisting of 10 mM Tris (pH
8.0), 100 mM NaCl, and 1 mM EDTA. The pellet was digested by
incubation at 56 C with gentle agitation for 3 h in 3 ml solution
consisting of 10 mM Tris (pH 8.0), 100 mM NaCl, 0.5% SDS, and
0.5 mg/ml proteinase K.
After centrifugation, the DNA in the supernatant was extracted
three times with phenol, once with phenol/chloroform/isoamyl
alcohol, and once with chloroform/isoamyl alcohol. The aqueous
phase was added to a centrifugal lter device (Amicon Ultra 4, Millipore, Billerica, MA, USA) and concentrated by centrifugation. The
concentrated solution was then washed twice with 1 ml TE buffer
containing 10 mM TrisHCl (pH 8.0) and 0.1 mM EDTA, and re-concentrated to a nal volume of 50100 ll.

2.3.2. The new experimental kit DNA extraction procedure

We extracted DNA from the three treatment groups following
the protocol in the new kit. Briey, bone samples (ca. 0.5 g) were
soaked in a 50 ml tube containing 30 ml Solution A at 23 C with
gentle agitation overnight. We then added 1.8 ml Solution B to
the tube containing Solution A and the decalcied sample. The
mixture was gently agitated at 37 C for 2 h then centrifuged.
Following this, we discarded the supernatant and added 400 ll
Solution C and 50 ll Proteinase K (20 mg/ml) to the sample.
The mixture was incubated at 56 C with gentle agitation for
3 h. The supernatant was transferred to a tube containing
500 ll phenol, gently mixed, and centrifuged. The aqueous phase
was transferred to a new tube containing an equal volume of
Buffer AL (QIAamp DNA Mini Kit, QIAGEN, Hilden, Germany)
and ethanol. The mixture was then puried using a silica membrane (QIAamp DNA Mini Kit, QIAGEN, Hilden, Germany), following the manufacturers protocol. The puried DNA was eluted in
50 ll TE buffer.

Table 1
Quantity of human genomic DNA recovered using the new kit and results of the STR analysis.
Sample Sample type
code

B1
B2
B3
B4
B5
T1
T2
T3
T4

Femur (compact bone)

Femur (compact bone)
Femur (compact bone)
Femur (compact bone)
Costa (cancellous
bone)
Tooth (half size)
Tooth (half size)
Tooth (whole size)
Tooth (whole size)

Time

Number
of
amples

The average quantity

Standard Number of loci
of DNA per gram
deviation with defected alleles
of starting material (ng)
Identilers
MiniFilers
(%)
(%)

Mitochondrial
DNA
sequencing

Estimated
postmortem
time (years)

Elapsed time from

recovery (stored at
room
temperature)

2.5
1.5
4
1
2

1
1
4
8
18

3
3
3
3
1

2.90
6.49
12.05
1.75
0.00

0.39
1.03
8.74
0.87

100
100
100
56
0

100
100

Successful
Successful
Successful
Successful
Successful

1
0.5
0.5
1

4
3
3
2

1
1
1
1

56.88
10.47
1.67
8.42

100
100
19
100

100

Successful
Successful
Successful
Successful

86

T. Kitayama et al. / Legal Medicine 12 (2010) 8489

2.3.3. Re-extraction following initial DNA extraction with the new

experimental kit
During each extraction step beginning with homogenized bone
powder, a large amount of the starting material is dissolved during
Proteinase K digestion leaving relatively little un-dissolved tissue
regardless of which extraction procedure is used. In contrast, a
large portion of the sample remains un-dissolved following digestion of bone fragments using both methods. This tissue likely
contains a signicant amount of genomic DNA which can subsequently be extracted. Following the proteinase K digestion step
during the new kit DNA extraction procedure, we washed the
un-dissolved material 3 times with a 1% (w/v) sodium hypochlorite
solution, three times with sterilized water, and once with ethanol.
The tissue was then dried at 56 C for 2 h. The un-dissolved sample
was then re-extracted following the procedure for the new kit, outlined above. We repeated this step two additional times so that
each sample was subject to four extractions. To reduce stochastic
variation, each extraction was performed in triplicate.

of 95 C for 5 s, 55 C for 15 s, and 72 C for 15 s. Following amplication, we immediately performed a melting curve analysis by
measuring the uorescence during a temperature transition from
60 C to 95 C at 0.2 C/s. We used ten-fold serial dilutions of
K562 (from 10 ng/ll to 1 pg/ll) (Promega, Madison, WI, USA) to
generate the standard curve.
2.5. STR Typing
We performed multiplex PCR using an AmpFlSTR Identiler PCR
Amplication Kit (Applied Biosystems, Foster City, CA, USA) for STR
analysis. We amplied up to 1 ng (calculated based on the results of
quantitative PCR using D17-207 primer pairs) of the genomic DNA
recovered from each sample following the manufacturers instructions. In some instances an insufcient amount of genomic DNA
was recovered or the initial STR analysis indicated the presence of
PCR inhibitory substances. In these cases we performed multiplex
PCR using the AmpFlSTR MiniFiler PCR Amplication Kit (Applied
Biosystems), following the manufacturers recommendations.

2.3.4. Effects of decalcication condition on the new experimental kit

A large portion of the sample remains un-dissolved after digestion of the bone fragments. To evaluate the decalcifying conditions
used in the kit protocol, we extracted DNA from the bone fragments after modifying the decalcifying temperature in solution A
from 23 C to 37 or 56 C.

We conducted MtDNA sequencing of the HV1 region following

the methods outlined in a prior study [22] using DNA from each
extraction.

2.4. DNA quantication

3. Results

Each DNA extract was subject to real-time DNA quantication

for amplication of the human specic DNA sequence D17Z1
(a 207 bp fragment), based on previously published protocols
[1921] with slight modications. We used the following primer
sequences: forward primer D17-207F ATCCCCGAGTTGAACTTTCC
and reverse primer D17-207R AAACTGCGCTCTCAAAAGGA. We
performed real-time quantitative PCR amplication using the
Smart Cycler II system (Cepheid, Sunnyvale, CA, USA) in a 25 ll
reaction mixture containing 1 SYBR Premix Ex Taq (Takara Bio,
Shiga, Japan), 200 nM of each primer, and 2 ll template DNA solution. The thermal prole was: 95 C for 10 s followed by 30 cycles

We did not nd any evidence of contamination in any of the

extraction blanks in both the STR and MtDNA analysis.

2.6. MtDNA sequencing

3.1. Effect of extraction method on DNA yields and STR analysis

The extraction procedure used in the new kit yielded higher
amounts of DNA per g of starting material (Sample B1: 0.5 g fragments derived from the femur) compared with the conventional
phenol/chloroform method (Fig. 1A). There was no signicant difference in the amount of DNA extracted per g of starting material
(Sample B1: 0.5 g powder) between the conventional phenol/

Fig. 1. Effect of extraction method and pre-treatment on DNA recovery from the B1 sample. (A) Comparison of the quantity of DNA extracted per g of bone fragment using the
new kit and the conventional phenol/chloroform method (starting tissue weight ca. 0.5 g). (B) Comparison of the quantity of DNA extracted per g of bone powder using the
new kit and the conventional phenol/chloroform method (starting tissue weight ca. 0.5 g). (C) Effect of bone fragment size on the quantity of DNA extracted per g of bone
tissue using the new kit (starting tissue weight ca. 0.5 g). (D) Effect of the decalcifying temperature on the quantity of DNA extracted per g of bone fragment in solution A
using the new kit (starting tissue weight ca. 0.5 g).

T. Kitayama et al. / Legal Medicine 12 (2010) 8489

chloroform DNA extraction procedure and the new kit DNA extraction procedure (Fig. 1B). We were not able to recover sufcient
genomic DNA from each 0.5 g bone fragment derived from the B1
sample for Identiler STR analysis using the conventional phenol/
chloroform method (data not shown). Conversely, the new kit produced an increased yield of genomic DNA from B1 sample fragments, and generated a full prole in the Identiler STR analysis
(Table 1).
3.2. Effects of sample size and decalcication temperature using the
new experimental kit
3.2.1. Effect of sample size when using the new experimental kit
The amount of genomic DNA per g of starting material was positively correlated with a decrease in the size of the bone fragments
from the B1 sample (Fig. 1C).
3.2.2. Effects of decalcication condition on the new experimental kit
The yield of genomic DNA tended to increase as the decalcifying
temperature increased (Fig. 1D).
3.3. Re-extraction
We recovered sufcient amounts of genomic DNA for Identiler
STR analysis from each DNA re-extraction from a femur bone fragment (B2) sample (Fig. 2).
3.4. Sample variation
To reduce individual variation because of differences in the state
of endogenous DNA preserved in every sample, we extracted DNA
from multiple samples (B3, B4, B5, T1, T2, T3, and T4) (Table 1).
DNA extraction was performed only once from each sample of cancellous bone and tooth because of the limited amount of sample
material. DNA yields and the results of the STR analysis are shown
in Table 1. We performed Identiler STR analysis using ca. 0.6 ng
of genomic DNA recovered in each extraction from the halved tooth
(T1) piece using the new kit and the conventional phenol/chloroform method as a template. The levels of PCR amplication

Fig. 2. Comparison of the quantity of DNA extracted from a single bone fragment
(B2) during the 1st, 2nd, 3rd, and 4th extraction procedures using the new kit. The
average weight of the starting material was 0.56, 0.44, 0.28, and 0.16 g, respectively.

87

inhibition were higher in the DNA extract recovered using the

conventional phenol/chloroform method than using the new kit
(Fig. 3).

4. Discussion
We compared the quantity of genomic DNA extracted from
bone fragments derived from the same bone sample between the
new kit and the conventional phenol/chloroform method. In this
study, we cut compact bones into fragments similar in shape (ca.
0.5 g) using a dental cutting disc for the purpose of evaluating
the utility of the new kit by comparing DNA yields against the conventional phenol/chloroform method and to examine the effects of
sample size and decalcication condition on DNA yields using the
new kit. In fact, this step of manipulation can be omitted in actual
case work if a bone sample is small enough to be soaked in Solution
A contained in a tube. Using the new kit, we were able to extract
sufcient amounts of genomic DNA for STR analysis without powdering the bone tissue. In contrast, the conventional phenol/chloroform method did not yield sufcient amounts of DNA for STR
analysis. Increasing the decalcication temperature and reducing
the size of the bone fragment resulted in higher DNA yields using
the new kit. However, increasing the decalcication temperature
may induce further damage or degradation to DNA [16,23]. The
condition of the bones should be used as a guide to the temperature used during decalcication. The amount of genomic DNA extracted from a bone fragment tended to vary when compared
with those samples taken from the pooled bone powder derived
from the same bone (data not shown). Variations in DNA yield
from larger bone fragments may be attributed to heterogeneity
within a bone, and are inevitable [24,25]. Extraction from smaller
bone fragments resulted in an increase in DNA yields (Fig. 1C). Furthermore, the amount of genomic DNA recovered during the second extraction was higher than following the rst extraction
(Fig. 2). As a result of decalcication and Proteinase K digestion,
the remaining un-dissolved bone fragment is smaller and lighter
than the initial fragment. Given that smaller fragments appear to
result in higher DNA yields, we hypothesize that the smaller size
of the fragment following Proteinase K digestion is responsible
for the higher yield during the second extraction. DNA yields
may also have been inuenced by the surface condition of the bone
following Proteinase K digestion.
To estimate the degree of sample digestion during the rst
extraction step using the new kit, the un-dissolved bone fragment
was washed and re-digested with Solution C and Proteinase K
(without a second decalcication step). This additional extraction
yielded only trace amounts of genomic DNA (data not shown). Previous reports have shown that total demineralization of the bone
powder leads to total dissolution of the samples [13,26]. Thus, it
is likely that only the decalcied region of the samples was
dissolved during Proteinase K digestion. Given this, improvements
in the decalcifying procedure are likely needed to obtain large
amounts of DNA from a bone fragment in a single extraction. The
decalcifying protocols in the new kit, using solution A and solution
B, resulted in a higher DNA yield than from conventional protocols
using EDTA. This suggests that solutions A and B are more efcient
than the regents that are conventionally used for bone
demineralization.
The new kit yielded sufcient amounts of genomic DNA for STR
analysis from several samples without powdering. Furthermore,
the samples (e.g. whole tooth) remained physically intact after
the extraction and therefore retained their morphological evidential value. However, the weight of the un-dissolved whole teeth
(T3 and T4) was slightly lower following the extraction procedure.
The quantity and quality of endogenous genomic DNA varies

88

T. Kitayama et al. / Legal Medicine 12 (2010) 8489

Fig. 3. Comparison of inhibitory effects on Identiler STR analysis detected in the T1 sample using the new kit and the conventional phenol/chloroform method. The amount
of template DNA used for STR analysis was ca. 0.6 ng.

between each sample because of differences in the exposure of the

bone to environmental insults. Despite this, we were able to successfully amplify each of the DNA extracts using the Identiler or
MiniFiler kits, which are designed for reduced-amplicon length
STR (Table 1) [27,28]. The ability to obtain a full or partial prole
reects the difference in the quantity and quality of the DNA and
PCR inhibitory substances. The amount of endogenous genomic
DNA preserved in samples of tooth and bone tend to decrease as
elapsed time increases, as shown in the B5 sample. In addition,
not every sample contains sufcient DNA for the Identiler analysis. This results in a partial prole, as shown in the B4 and T3 samples. The amount of genomic DNA recovered from the T1 samples
was greater when compared with those of other samples extracted
using the new kit. We hypothesize that the greater amount of
genomic DNA extracted from the T1 sample was derived from
the odontoblast cells in the dental pulp cavity. This likely occurred
because of inadequate removal of the remaining dental pulp. We
were able to remove the PCR inhibitory substances that were copuried with large amounts of DNA from the T1 sample using
the new kit DNA extraction procedure, but not using the conventional method (Fig. 3).
Most conventional methods for the extraction of DNA from
bone and tooth samples rely on the use of ground powder samples
to produce higher DNA yields. However, since airborne contamination can be caused by bone powder, highly stringent contamination control measures must be included when handling bone
powder. We believe that the possibility of laboratory contamination increases, particularly when processing a number of bone
samples simultaneously, such as in mass fatality incidents. Thus,
the ideal extraction protocol would allow for the extraction of
DNA from bones and tooth with the minimum risk of airborne contamination and would also be simple enough to allow automation
of the process using robotic platforms for high throughput DNA
extraction. Our results suggest that the new kit meets these
requirements. The kit allows the simple extraction of DNA from

larger bone fragments or whole teeth without powdering and also

is ideally suited for use in the automation of simultaneous processing of multiple samples. Thus, we believe that the kit is useful for
examiners of all levels of experience who want to perform DNA
analysis from skeletal remains.
References
[1] Clayton TM, Whitaker JP, Maguire CN. Identication of bodies from the scene
of a mass disaster using DNA amplication of short tandem repeat (STR) loci.
Forensic Sci Int 1995;76:715.
[2] Holland MM, Cave CA, Holland CA, Bille TW. Development of a quality, high
throughput DNA analysis procedure for skeletal samples to assist with the
identication of victims from the World Trade Center attacks. Croat Med J
2003;44:26472.
[3] Alonso A, Martin P, Albarran C, Garcia P, Fernandez de Simon L, Jesus Iturralde
M, et al. Challenges of DNA proling in mass disaster investigations. Croat Med
J 2005;46:5408.
[4] Hochmeister MN, Budowle B, Borer UV, Eggmann U, Comey CT, Dirnhofer R.
Typing of deoxyribonucleic acid (DNA) extracted from compact bone from
human remains. J Forensic Sci 1991;36:164961.
[5] Lassen C, Hummel S, Herrmann B. Comparison of DNA extraction and
amplication from ancient human bone and mummied soft tissue. Int J
Legal Med 1994;107:1525.
[6] Perry 3rd WL, Bass WM, Riggsby WS, Sirotkin K. The autodegradation of
deoxyribonucleic acid (DNA) in human rib bone and its relationship to the time
interval since death. J Forensic Sci 1988;33:14453.
[7] von Wurmb-Schwark N, Heinrich A, Freudenberg M, Gebuhr M, Schwark T. The
impact of DNA contamination of bone samples in forensic case analysis and
anthropological research. Leg Med 2008;10:12530.
[8] Kemp BM, Smith DG. Use of bleach to eliminate contaminating DNA from the
surface of bones and teeth. Forensic Sci Int 2005;154:5361.
[9] Anderung C, Persson P, Bouwman A, Elburg R, Gotherstrom A. Fishing for
ancient DNA. Forensic Sci Int Genet 2008;2:1047.
[10] Zehner R. Foreign DNA in tissue adherent to compact bone from tsunami
victims. Forensic Sci Int Genet 2007;1:21822.
[11] Holland MM, Fisher DL, Mitchell LG, Rodriquez WC, Canik JJ, Merril CR, et al.
Mitochondrial DNA sequence analysis of human skeletal remains:
identication of remains from the Vietnam War. J Forensic Sci
1993;38:54253.
[12] Hoff-Olsen P, Mevag B, Staalstrom E, Hovde B, Egeland T, Olaisen B. Extraction
of DNA from decomposed human tissue An evaluation of ve extraction
methods for short tandem repeat typing. Forensic Sci Int 1999;105:17183.

T. Kitayama et al. / Legal Medicine 12 (2010) 8489

[13] Loreille OM, Diegoli TM, Irwin JA, Coble MD, Parsons TJ. High efciency DNA
extraction from bone by total demineralization. Forensic Sci Int Genet
2007;1:1915.
[14] Rohland N, Hofreiter M. Ancient DNA extraction from bones and teeth. Nat
Protoc 2007;2:175662.
[15] Parsons TJ, Huel R, Davoren J, Katzmarzyk C, Milos A, Selmanovic A, et al.
Application of novel mini-amplicon STR multiplexes to high volume
casework on degraded skeletal remains. Forensic Sci Int Genet 2007;1:1759.
[16] Rohland N, Hofreiter M. Comparison and optimization of ancient DNA
extraction. Biotechniques 2007;42:34352.
[17] Fukushima H, Oki T, Asamura H, Ota Masao, Nagasaki K, Fukuma Y, editors.
DNA extraction without powdering from bone and teeth. Proceedings of 18th
International Symposium on Human Identication; 2007 Oct 1-4; Hollywood,
CA. Madison: Promega; 2007.
[18] Imaizumi K, Noguchi K, Shiraishi T, Sekiguchi K, Senju H, Fujii K, et al. DNA
typing of bone specimens the potential use of the proler test as a tool for
bone identication. Leg Med 2005;7:3141.
[19] Waye JS, Willard HF. Structure, organization, and sequence of alpha satellite
DNA from human chromosome 17: evidence for evolution by unequal
crossing-over and an ancestral pentamer repeat shared with the human X
chromosome. Mol Cell Biol 1986;6:315665.
[20] Mizuno N, Kitayama T, Fujii K, Nakahara H, Yoshida K, Sekiguchi K, et al. A
forensic method for the simultaneous analysis of biallelic markers identifying

[21]

[22]

[23]

[24]

[25]
[26]
[27]

[28]

89

Y chromosome haplogroups inferred as having originated in Asia and the

Japanese archipelago. Forensic Sci Int Genet 2010;4:739.
Nakahara H, Fujii K, Mizuno N, Yoshida K, Kasai K. Evaluations of DNA
quantication methods for forensic biological samples. Jpn J Forensic Sci Tech
2007;12:1326.
Sekiguchi K, Imaizumi K, Fujii K, Mizuno N, Ogawa Y, Akutsu T, et al.
Mitochondrial DNA population data of HV1 and HV2 sequences from Japanese
individuals. Leg Med 2008;10:2846.
Evison MP, Smillie DM, Chamberlain AT. Extraction of single-copy nuclear DNA
from forensic specimens with a variety of postmortem histories. J Forensic Sci
1997;42:10328.
Salamon M, Tuross N, Arensburg B, Weiner S. Relatively well preserved DNA is
present in the crystal aggregates of fossil bones. Proc Natl Acad Sci USA
2005;102:137838.
Pbo S, Poinar H, Serre D, Jaenicke-Despres V, Hebler J, Rohland N, et al.
Genetic analyses from ancient DNA. Annu Rev Genet 2004;38:64579.
Hagelberg E, Clegg JB. Isolation and characterization of DNA from
archaeological bone. Proc Biol Sci 1991;244:4550.
Tsukada K, Takayanagi K, Asamura H, Ota M, Fukushima H. Multiplex short
tandem repeat typing in degraded samples using newly designed primers for
the TH01, TPOX, CSF1PO, and vWA loci. Leg Med 2002;4:23945.
Butler JM, Shen Y, McCord BR. The development of reduced size STR amplicons as
tools for analysis of degraded DNA. J Forensic Sci 2003;48:105464.