Dove Medical Press Ltd Style Guide

A Guide to Consistent Editing

Table of contents
Introduction
Requirements
Copyediting
Content Editing
Dove Press queries
File handling and formatting overview
Abbreviations
Abstracts
Acknowledgments
Appendices
Author information
Affiliations
Correspondence
Names
Author queries (AQs)

Citations
Citation Names
Citation numbers
Other
Copyright
Disclosure
Figures
Fonts
Bold
Italic
Underline
Genera and species
Headings
Lists
Bullet Lists
In-text lists
Manufacturers and products
Manufacturers list
Alphabetical list

Numbers
Dates and times
Equations
Punctuation and symbols
Units of measurement
Punctuation
Abbreviations punctuation
Commas and semicolons
Endashes
Parentheses and brackets
Hyphenation
Quotation marks
Special symbols
Quotations
Long quotations
Short quotations
Spelling and grammar
Technical terms
US spelling

Supplementary materials
Tables and figures
Abbreviations, tables and figures
Citations, tables and figures
Formatting, tables and figures
Process, tables and figures

Introduction
This guide has been developed as a reference for editing Dove Medical Press
manuscripts. Please familiarize yourself with the topics contained, and refer within as
needed. The General requirements section is intended to give an introductory overview;
further details of certain points can be found in later sections.
The guide has been organized as much as possible for ease of use, and we welcome your
comments and suggestions on this matter.
Please note that our house style guidelines are a work in progress. Further, as with all
style guides, it cannot be totally comprehensive, and will be updated from time to time. If
you note any discrepancies or omissions, please alert us to these.

Resources
http://www.merriam-webster.com/
http://scholar.google.co.nz/
http://www.dovepress.com/
http://en.wikipedia.org/wiki/Main_Page
http://www.ncbi.nlm.nih.gov/pubmed/
http://www.ncbi.nlm.nih.gov/nlmcatalog/journals

Copyediting
Consistency and accuracy are especially important in scientific/medical papers.
Please ensure that all technical terms/abbreviations and other expressions are spelt and presented
consistently throughout a paper.
Google terms that you are unfamiliar with, or search in Google Scholar to see a terms usual use
in the medical/technical literature.
Wikipedia is very good at presenting the correct forms of terms; it is a good idea, however, to
cross-check against a general Internet search result.
Use Microsoft Words Find function to ensure all instances of a given
term/abbreviation/expression are the same. However, DO NOT perform a Replace all, as
corrections may not apply to text in the Reference section/proper names, etc.
All of our published papers are available online on our website, so you also can refer to recently
published papers for further guidance.

Content editing
All papers should have correct grammar, punctuation, and spelling, be able to be clearly
understood, and adhere to house preferences and formatting.
Outside of these requirements, matters of style are as per the author(s)s preference. It is not
necessary to polish a manuscript to perfection, and overediting should be avoided, as it can
cause offence and/or alter meanings, etc.
Where you cannot be absolutely sure of the meaning of some text, be sure to write a comment to
the author

eg, Dear author,

Please check that copyeditor has not changed your intended meaning
or a more specific query.
Where much or all of a paper has required a heavier level of content editing, it is acceptable to
write a more general comment to the author,
eg, Dear author,
Your paper has been edited for house style, grammar, and flow. Please check that your intended
meanings have not been changed..

Dove Press queries

Note these on your EDC report. Please be clear when indicating where the text/issue in question
can be found. Avoid using page numbers as referents, as these change after typesetting.
Please note that if you have a question for which you would like an answer, do not note on your
EDC report, but rather log in to live chat (begin message with "EDC") or send an email with
"EDC" in the subject.

Copyright
Please note any possible copyright issues on your EDC report.

Manuscript parts
All papers should comprise the following parts:
1. Paper type (eg, Review, Original Research, etc)
2. Recto running head (short title)
3. Verso running head (author name or names), formatted as one of the following: Jones (1
author); Jones and Smith (2 authors); Jones et al (more than 2 authors)

4. Title
5. Author names and affiliations
6. Corresponding author and postal details, including minimum postal address and email
address (phone and fax are optional)
7. Abstract
8. Keywords
9. Headings within the body of the paper (must be a heading for first paragraph of main text
(eg, Introduction)
10. Reference/author citations within the main text
11. Table and figure citations within the main text
12. Disclosure statement
13. References
14. Tables and table captions
15. Figures and figure captions

Notes
If there is no short title, create one and query the author (maximum 70 characters including
spaces).
If there are no keywords, select some and/or query the author (6-7, not already included in the
title).
Please note on your report/query author if you edit the title.

If there is no disclosure, add the following

Disclosure
The author(s) report(s) no conflicts of interest in this work.
and query the author to confirm.
Where there is a disclosure that does not cover all authors, add The other author(s) and
query the author to confirm.

Prelims
The layout of the prelims should be as shown below.
Note: If there is no short title for the running head, please devise one based on the paper title and
add an author query.
If the paper type seems incorrect, query this on your EDC report.

Heading levels
You may use any system of denoting heading levels that you wish, as long as it is clear.
Ensure headings are in sentence case, and are unnumbered.
Please DO NOT use Microsoft Styles.

Fonts and paragraph settings

Feel free to use any font, line spacing, etc, that you prefer. Some fonts dont convert so well,
changing the units of measure and introducing other errors. Checking the tracked changes before
you started editing should highlight these changes so you can check them.
Paragraphs should be indented, except the first paragraph under a heading (which should be leftaligned).

Tables and figures

Editable tables and figures and their corresponding captions should be moved to the END of the
main manuscript following the references, with author instructions (place Table 1 here or
similar) deleted.
Tables and figures MAY be edited as separate documents, but only where it is not possible to
append them to the main document.
Uneditable table and figure captions should be recreated (typed or copied and pasted) at the end
of the main document and edited. BUT do not edit material that you suspect may have been
reproduced or directly quoted.
Check that Tables and figures are cited in the main text, in numerical order.
Check that Figure parts (A), (B), etc, are all mentioned/explained in the captions. (These
individual parts do not need to be cited separately in the main text).

Typesetting
All of our papers are typeset exactly the same, so our typesetters are very familiar with our style.
We do not provide them with a marked-up manuscript but expect them to translate the order of
headings as per the sample papers. They have our style for tables, equations, etc, so these do not
need to be formatted during editing, except as indicated otherwise in this guide.

Abbreviations

Abbreviations for terms used 3+ times should be defined at first mention, followed by the
abbreviation in parentheses, then the abbreviation used thereafter.
eg, wild-type (WT) mice WT thereafter
The abstract, tables, and figures stand alone (ie, define abbreviations at first mention in each of
these; abbreviate where used 3+ times in each; etc).
Clinical trial names should be defined in full at the first mention.
eg The International Verapamil SR-Trandolapril Study (INVEST).
US, USA, and UK do not need to be spelt out.
No full stops in abbreviations (Dr, Mr, Prof, SD, eg, ie, etc).
"eg," "ie," should have commas after.
Do not use "don't," "can't."
Abbreviations may appear at the beginning of a sentence.
Gene/protein names do not need to be defined on first mention. If you are unsure whether an
abbreviation used is a gene/protein, then use the following query:
Dear author,
If this is not a gene/protein, then please provide the expansion for this abbreviation.
Thanks.
Elements on the periodic table do not need to be defined on first mention (eg, H, Cl, Au, Pb)
Common abbreviations (eg, those perhaps better known by their abbreviated terms) should be
explained at first mention, but can be used thereafter even if less than 3 instances
eg, DMEM, DAPI, SD, PBS, TEM, acronyms
or where the full name is very long.

Where an author has provided an abbreviation list, use this to fill in the abbreviations throughout
the text, then delete and put a note to the author.

Headings and titles

Headings may contain abbreviations that have already been defined. It is also okay to give a
definition IN a heading, though this is usually not preferred (and does not apply to the main
title).
Short titles may contain abbreviations.
The article title should NOT contain abbreviations, other than very obvious ones (eg, COPD for
an article in the International Journal of COPD), common ones (eg, mRNA), or ones that would
be too long to spell out (eg, MTT).

Hyphenated
Where first instance is as part of a hyphenated term, append hyphen to the parenthetical
abbreviation
eg, acute myocardial infarct (AMI)-associated ...

Species
Abbreviate genus name, WITH a full stop, after first mention
eg, Escherichia coli E. coli thereafter.
Where sp (species singular) or spp (species plural) are used, append with a full stop
eg, Canis spp.

Figures and tables

ALL abbreviations used in the figure, table, or caption should be explained, either within the
table/figure/caption or notes text, or all can appear in the separate Abbreviation note.
Abbreviations in the note may be listed in order of appearance or alphabetically, but the choice
should be consistent through the paper.
If the author has not provided abbreviation lists under the tables/figures, please add and/or query
these.

Format (captions)
eg, Figure 1 Range and distribution of grape berry sugars.
Notes: horizontal lines in the interior of the box are the median values. The height in a box is
equal to the interquartile distance, indicating the distribution for 50% of the data. Approximately
99% of the data fall inside the whiskers. The data outside these whiskers are indicated by vertical
lines.
Abbreviations: Suc, sucrose; Glu, glucose; Fru, fructose; B, bunch; H, Florida hybrid bunch; M,
muscadine.
or
eg, Table 1 Fold changes in the relative mRNA levels of inflammatory genes in the lungs of
animals at P1, P21, and P70 following treatment with saline (S) or lipopolysaccharides (L).
Notes:P1, P21, and P70 animals were treated with S or 0.25 mg/kg L for 2 hours. Relative
mRNA levels of inflammatory mediators in the lungs of these animals were measured by realtime RT-PCR (A) or semi-quantitative RT-PCR (B). Data were presented as fold changes in
relative mRNA levels of inflammatory genes between different treatment groups. *Represents
significant difference between the treatment groups (two-way ANOVA followed by Bonferroni
post-test).
Abbreviations: IL, interleukin; MCP-1, monocyte chemoattractant protein-1; MIP, macrophage
inflammatory protein; mRNA, messenger RNA; P, postnatal; RT-PCR, reverse transcription
polymerase chain reaction; TLR, toll-like receptor; TNF-, tumor necrosis factor-.

Abstracts
May appear as a single paragraph, with abstract as heading, or be broken into parts.
Keywords are included at the end.
Does not include references, manufacturer's details, or paragraphs (except where separated by the
headings).
Abbreviations are treated as separate from main text, so abbreviation rules apply as per main
text.

Format
Background: The controlled introduction of covalent linkages between dendrimer building
blocks leads to polymers of higher architectural order known as tecto-dendrimers. Because of the
few simple steps involved in their synthesis, tecto-dendrimers could expand the portfolio of
structures beyond commercial dendrimers, due to the absence of synthetic drawbacks (large
number of reaction steps, excessive monomer loading, and lengthy chromatographic separations)
and structural constraints of high-generation dendrimers (reduction of good monodispersity and
ideal dendritic construction due to de Gennes dense-packing phenomenon). However, the
biomedical uses of tecto-dendrimers remain unexplored. In this work, after synthesizing
saturated shell coreshell tecto-dendrimers using amine-terminated polyamidoamine (PAMAM)
generation 5 (G5) as core and carboxyl-terminated PAMAM G2.5 as shell (G5G2.5 tectodendrimers), we surveyed for the first time the main features of their interaction with epithelial
cells.
Methods: Structural characterization of G5G2.5 was performed by polyacrylamide gel
electrophoresis, matrix-assisted laser desorption time-of-flight mass spectrometry, and
microscopic techniques; their hydrodynamic size and Z-potential was also determined. Cellular
uptake by human epidermal keratinocytes, colon adenocarcinoma, and epidermal melanoma
(SK-Mel-28) cells was determined by flow cytometry. Cytotoxicity was determined by
mitochondrial activity, lactate dehydrogenase release, glutathione depletion, and

apoptosis/necrosis measurement.
Results: The resultant 60NaV saturated shell, 87,000-dalton G5G2.5 (mean molecular weight)
interacted with cells in a significantly different fashion in comparison to their building blocks
and to its closest counterpart, PAMAM G6.5. After being actively taken up by epithelial cells,
G5G2.5 caused cytotoxicity only on SK-Mel-28 cells, including depletion of intracellular
glutathione and fast necrosis that was manifested above 5 M G5G2.5. It cannot be discounted
that traces of LiCl within G5G2.5 were involved in such deleterious effects.
Conclusion: These preliminary results suggest that at concentrations that do not damage healthy
keratinocytes, G5G2.5 could display antimelanoma activity.
Keywords: coreshell tecto-dendrimers, SK-Mel-28 cells, oxidative stress
or
Abstract: Pulmonary hypertension is an area of growing interest in cardiology, respiratory, and
rheumatic diseases due to the increased treatment that is now available to ameliorate the disease
process and the improved survival with such medication. The most common cause of pulmonary
hypertension is secondary to congenital heart disease and the availability of a medication that is
widely used and familiar in clinical practice enables pediatricians to manage this condition.
However, there is much to be learned as regards the indications for this medication, for example,
in chronic lung disease, and perioperatively in congenital heart disease. It is not yet clear when
the therapy should commence, when the disease is mild or when it has progressed. This article
summarizes the current state of knowledge of disease therapy concentrating on the use of
sildenafil in the pediatric population.
Keywords: pulmonary hypertension, pediatric, sildenafil
Acknowledgment(s)
Note US spelling (not Acknowledgements).
May be singular or plural, as applicable.
Author name formats are as per authors preference (eg, names, initials only, titles ok, etc).

Generally placed after Conclusion.

Appendices
(See SUPPLEMENTARY MATERIALS)
Supplementary material(s) is the preferred heading.

Author Information
Affiliations
Include
department/section, institution/organization, town/city, state/province (if applicable), country
[NB: People's Republic of China, not China]
Do not include
Author positions/titles/qualifications
Post codes, street addresses, phone numbers, etc

Format
Separate affiliation parts with commas. Separate different affiliations with a semi-colon. Note no
end period.
If consecutive affiliations contain the same institution or location details, these may be
streamlined and separated by a comma,
eg, 1Department of Roses, 2Department of Camellias, Rose University, Roseland, NJ,
USA; 3Roses and Orchids Laboratories, Hamilton, ON, Canada; 4Department of Violets, Rose
University, Roseland, NJ, USA; 5Institute for the Advancement of Flowers, 6Institute de Fleurs,
Paris, France

The affiliations should appear in the author list in numbered order. AFFILIATIONS can be
reordered if the numbers are out of order in the author list but NEVER CHANGE THE
AUTHOR ORDER, OR ADD OR DELETE AUTHOR NAMES
If all authors have the same affiliation(s), numbering is not required.

Please query
City/state, etc, locations may be added, but query if you cannot be absolutely certain.
Seemingly same affiliations that have different format/wording/spelling, etc.
Authors that have the same last name and affiliation - are they related? If yes, what is the
relationship?

Correspon
dence
Authors may have no more than 2 corresponding authors.
Include
Name (check spelling against author list); postal address (check spelling against affiliation list),
including city/town, state/province, country; email address.
Tel and fax are optional BUT, if included, make sure they include country code (preceded by +,
eg, +1 for North America). A quick Google search will usually bring this up no problem.
Please group tel/fax numbers as country code, area code, then in groups of no more than 4
figures, separated by spaces.
eg, +61 7 2568 4578
Do not include

Author positions/titles/qualifications

Format
Correspondence: John Smith
Department of Lightbulbs, University of Lightland, 123 Sunshine Street, Lightland 54321,
Finland
Tel +61 7 3206 5548
Fax +61 7 5489 4653
Email john@lighty.light
Note colon before name only.

Names
NEVER CHANGE THE AUTHOR ORDER, OR ADD OR DELETE AUTHOR NAMES
(affiliation order can be changed instead, if necessary)

Format
First name(s)/Initial(s) Surname
eg,
John P Smith1,2,*
Daniel M Johnson Jr13
Lisa Jones1,3,*
*These authors contributed equally to this work. (*place after affiliations on its own line).
Note that * should not be superscript (appears in superscript position anyway).
Use superscript to include a note of author death (place after affiliations, below * note, if
applicable)

Dr Ernest Fotheringham Jones passed away on June 15, 2012.

The authors may also include a more personalized notice in the Acknowledgment section,
eg, The authors regret to advise of the passing of XXXX....

Please query
Authors that have the same last name and affiliation - are they related? If yes, what is the
relationship?
Do not include
Positions/titles/qualifications.
Symbols other than * for equally contributing author or for death . (Authors sometimes use * or
another symbol to indicate corresponding author[s]. In this case, please delete, and note on your
report).
Additional information, eg, retirement, should be moved to the acknowledgment section and
noted on your report.

Author queries (AQs)

Please write AQs as comments directly on the Word document. Make sure the comment highlight
encompasses all and only the relevant text.
Please keep AQs short, simple, and to the point, and begin with Dear author. Remember many
of our authors are English second-language (and/or are very busy): sometimes a simple yes/no
question or Please confirm XXX is best.

Note
Please DO NOT instruct the author to amend things or adhere to house style. It is only in
exceptional cases that the manuscript is returned to the author at this stage for changes to be

made. Usually the next time the author sees the manuscript, it has been typeset and is in pdf
form, and the author is not able to action any changes themselves.
Furthermore, authors would not necessarily have the time to nor the interest in changing their
papers to adhere to our house style; as such, we would have to copyedit all over again after their
amendments anyway.
In this light, please note that it is the copyeditors job to fix the paper to our house style as much
as possible, querying the author for specifics as necessary.
Please see the Requirements section and specific sections of this guide for what is expected of
your edit.

Citations
Names
In-text reference citations must be crosschecked against the reference list for spelling and format.
eg, Smith
Smith and Jones
Smith et al

Numbers
Reference numbers must appear in numerical order throughout the main text (does not include
tables/figures).
Check that no reference number citations are missing in the paper.
Citations to studies must have singular/plural agreement with reference numbers (ie, studies
requires more than one reference number; a study should have only one).
Reference numbers should be superscript, with no space after the preceding word/punctuation.

Separate individual numbers with a superscript comma (no spaces). Ranges of 3+ reference
numbers should have an endash.
Place reference numbers where most sensible (end of sentence; end of paragraph; end of
data/information cited; end of author name or names to which it refers, etc).
eg, Smith et al and Smith and Jones studied
Several studies, , have shown.
The study showed that[.].

Other
Websites, databases, etc, referred to in the text should be queried for publication details and
appear in the reference list instead (except where it is mentioned in passing, not backing up
information being presented, or similar).
Unpublished material should only appear in text, in parentheses (see REFERENCES).

Copyright
(see also QUOTATIONS)
In most cases, where an author is reproducing or adapting a previously published table or figure
even if they were the original author copyright permission will need to be obtained. This is
done either by Dove Press staff or the author.
Where a figure or table appears with any indication that material has been reproduced or adapted,
including citations/reference numbers, please note on your EDC report to Dove Press.
Quotations of more than 44 words also require copyright permission, if published material, or
consent if transcribed from an interview or similar. Again, please note on your EDC report.
Do not edit material that you suspect may have been reproduced or directly quoted.

Disclosure
EVERY paper must include a disclosure, and ALL authors must be included in the disclosure
text.
Heading is always singular.

Text
No disclosures
Use: The author(s) report(s) no conflicts of interest in this work.

Disclosures
Add: "The author(s) report no other conflicts of interest in this work" to the end of the listed
disclosures.

Mix of disclosures/no disclosures

Add: The other authors/Name or initials of author report(s) no conflict(s) of interest in this
work. or similar to the end.

Figures
(See TABLES AND FIGURES)

Fonts
Italic, bold, and underline should (generally) be used only in the circumstances outlined in this
section.

Bold

Column/row headings in tables.

Italic
Gene names, species/genus names, book titles, and statistical variables

Note
Genes and proteins can sometimes have the same names. So
DO NOT GUESS GENE NAMES. ALWAYS QUERY THE AUTHOR.

Statistical variables
All statistical variables are shown in italics.
P (probability) is always capital, italic; P-value has a hyphen.
P<0.05
t is always lowercase, italic; t-test with a hyphen.
Students t-test always has capital S.
F is always capital, italic; F-test with a hyphen.
df (degrees of freedom)
MannWhitney U statistic (also known as Wilcoxon rank sum test)
z score
r or r correlation coefficient (bivariate)
R or R correlation coefficient (multivariate)
chi-square test

Note
N or n for number is not shown in italics.

Underline
Certain nucleotides may be underlined in a sequence to indicate mutations or similar,
eg, CCGTTTCTCCCATAAGTTCTCCTGAAGAAGGTGTGGAAGTTGTGGAACGTGTT
If in doubt, query the author as to what these symbols may mean.
eg,

Dear author,
Please explain highlights, underline, and double underline in the table.

Genera and species

eg, Homo (genus) Homo sapiens (species).
Both are italicized.
The species should be abbreviated to have the genus as the first initial + full stop after first
mention.
eg, Staphylococcus aureus and Staphylococcus epidermis may be components of although S.
aureus is the more serious pathogen.
Use the abbreviations sp. (singular) and spp. (plural) whenever the word species appears after
the genus name. Note that, in this context, the genus name is always in full:

eg, because Staphylococcus spp. are.

because this Staphylococcus sp. is.

What about viruses?

A virus is not a species; a virus belongs to a species. Do not italicize a virus name when used
generically.
eg, The species West Nile virus is a member of the genus Flavivirus. The presence of West Nile
virus was confirmed in mosquitoes and dead crows.
Please query:
Dear author,
We are aware that a virus should be italicized and capitalized when used in a taxonomic sense,
but not when used generically. Please indicate when you refer to them in a taxonomic sense so
that we can ensure that it is presented correctly.

Headings
ALL headings should be sentence case (initial letter of first word and proper nouns, etc,
capitalized only) and non-numbered. This includes table/figure column/axis headings, main
article title, and all headings/subheadings throughout.
Use any font style you prefer to indicate heading levels. Please avoid changing authors heading
levels; query instead.
Abbreviations, italics, etc, may be included where required,
eg, Bioconjugates of PAMAM dendrimers with trans-retinal, pyridoxal, and pyridoxal phosphate
Headings may contain abbreviations that have already been defined. It is also okay to give a
definition IN a heading, though this is usually not preferred.
Please note the following plural/singular-only forms:
Acknowledgment(s)

Conclusion
Disclosure
Materials and methods
Must be a heading before the 1st paragraph of text after the keywords.
Where the author cites a section within their paper, enclose the heading in quotation marks, in
sentence case
eg, ...see "Endowment effect"
...in the "Endowment effect" section

Titles
The article title should NOT contain abbreviations, other than very obvious ones (eg, COPD for
an article in the International Journal of COPD), common ones (eg, mRNA), or ones that would
be too long to spell out (eg, MTT).
Short titles may contain abbreviations.

Lists
There are different options for lists, depending on the authors preference:
eg, 1. Numbered bullet lists
Bullet Lists
or even, if they want: 3) in-text numbered lists.

Bullet list

Indent bullet lists, and punctuate consistently throughout.

1. With each bullet a full sentence.
2. With a capital initial and a full stop at the end.
or,
1. The bullet list as one sentence;
2. with each bullet continuing the sentence;
3. until the end.
or,
eg, The bullet list as part of a main-text sentence:
1. like this;
2. with each bullet continuing the sentence;
3. until the end (which is the usual style for in-text lists).
or,
With each bullet
A separate fragment/clause
Not requiring closing punctuation

In-text lists
These generally appear as part of a sentence, so run on from the main text and punctuate
accordingly.

eg, CSA has several advantages over a single-dose spinal anesthesia and continuous epidural
anesthesia: 1) administration of local anesthetics in small incremental doses titrated to the
individual patients needs; 2) reduced requirements of local anesthetics and thus decreased
systemic toxic effects; 3) ensured cardiovascular stability; and 4) extended anesthesia by
supplemental application of spinal local analgesics when surgery is unexpectedly extended.

Manufacturers and products

(See separate document for list of common manufacturer names and locations)
Product manufacturer and software developer information should be given (name, location of
manufacturing headquarters).
Please search product and company names online: authors often have these misspelt or
incorrectly formatted.

Format
eg, using a BioMajesty JCA-6010/C analyzer (JEOL, Tokyo, Japan).
was analyzed (BioMajesty JCA-6010/C; JEOL, Tokyo, Japan).
using a JCA-6010/C analyzer from JEOL (Tokyo, Japan).
After first mention, give the company name only. This applies even for a different product by the
same company.

Note
For US companies, give name, city, state, and country,
eg, a pH 1.679 buffer solution (Sigma-Aldrich, St Louis, MO, USA).
For UK companies, give the town/city, not the county,
eg, (Malvern Instruments, Malvern, UK) not (Malvern Instruments, Worcestershire, UK)

For Canada, province is preferably included, and preferably abbreviated

eg, (Canadian Co-op, Hamilton, ON, Canada)
For China, please use People's Republic of China.

Please query
Any details that you add, change, or wish to query or dispute, as we want the authors to have
final responsibility for the correct information.
eg, We believe ... is correct... Please check this.
Please check and confirm...
We believe thatis the headquarters location of Please check this.
We believe...is now part of Please check this.

Parent/subsidiary companies
Subsidiary manufacturers and the like can be used instead of the parent company, where they
have their own corporate presence and the relevant details can be found. Note, however, that
sometimes manufacturers have been swallowed into another company, and, as such, are not
subsidiaries but part of a wider corporation.
There are a number of commonly cited companies that no longer exist; often, their products have
become a product line under a new or different company. Some examples include Gibco and
Invitrogen (Life Technologies, Carlsbad, CA) and SPSS software (then IBM Corporation,
Armonk, NY). However, if the author used an older version, the former manufacturer may still
be relevant. ALWAYS query the author.
Use the separate Manufacturers guide or search online to find details. However, you do not need
to spend too much time on this: if you cant quickly find the information you are seeking, ask the
author to provide it.

Products
Give the full manufacturer details at first mention of a brand name in the main text (not included
in abstract), then name only thereafter.
, , etc, should be used, when applicable, at first mention of a brand name (in each of main
text, tables/figures). Thereafter, it can continue to be used, or can be omitted (but be consistent
throughout the manuscript).
Query the author if you are not sure whether to use a symbol or not.

Shortcuts
= Alt 0169
= Alt 0153
= Alt 0174

Manufacturers list
Where a product or brand name is mentioned, the manufacturer's name and headquarters location
should be given as well.

Format Examples
...XRD 1622 (PerkinElmer, Waltham, MA, USA)...
...flat panel detector (XRD 1622; PerkinElmer, Waltham, MA, USA)...
...from PerkinElmer (Waltham, MA, USA)...
ie, city, state (if applicable), country

Alphabetical List

A
Abbott Laboratories, Abbott Park, IL, USA
Abbott Medical Optics Inc, Santa Ana, CA, USA
Adobe Systems Incorporated, San Jose, CA, USA
Agilent Technologies, Santa Clara, CA, USA
Alcon, Inc., Hnenberg, Switzerland
Alcon Laboratories, Inc., Fort Worth, TX, USA
Allergan, Inc., Irvine, CA, USA
AMAG Pharmaceuticals Inc., Lexington, MA, USA
American Type Culture Collection (ATCC), Manassas, VA, USA
Amgen Inc., Thousand Oaks, CA, USA
Applied Biosystems = product line of Thermo Fisher Scientific, Waltham, MA, USA
Astellas Pharma Inc., Tokyo, Japan
AST Products, Inc, Billerica, MA, USA
AstraZeneca plc, London, UK or Sdertlje, Sweden
ATCC = American Type Culture Collection (ATCC), Manassas, VA, USA
B
Bausch & Lomb Incorporated, Bridgewater, NJ, USA
Baxter International Inc., Deerfield, IL, USA
Bayer AG, Leverkusen, Germany
BD, Franklin Lakes, NJ, USA
BD Biosciences, San Jose, CA, USA
Bitplane, Zrich, Switzerland
Bio-Rad Laboratories Inc., Hercules, CA, USA
Boehringer Ingelheim, Ingelheim, Germany
Bristol-Myers Squibb, New York, NY, USA
Bruker AXS Inc., Madison, WI, USA
Bruker Corporation, Billerica, MA, USA
Bruker Optics Inc, Billerica, MA, USA
Bruker Optik GmbH, Ettlingen, Germany

C
Carl Roth GmbH + Co. KG, Karlsruhe, Germany
Carl Zeiss Meditec AG, Jena, Germany
Certara, St Louis, MO, USA
Cisco Systems, Inc., San Jose, CA, USA
Corning Incorporated, Corning, NY, USA
CSL Bhering, King of Prussia, PA, USA
D
Dako Denmark A/S, Glostrup, Denmark
Diagnostic Systems Laboratories, Webster, TX, USA
E
EIKO, Shawnee, KS, USA
Electron Microscopy Sciences, Hatfield, PA, USA
Eli Lilly and Company, Indianapolis, IN, USA
EMD Millipore, Billerica, MA, USA
Equitech-Bio Inc., Kerrville, TX, USA
EUSA Pharma, Oxford, UK (division of Jazz)
F
Fisher Scientific International, Inc. = Thermo Fisher Scientific, Waltham, MA, USA after May
2006
G
Gibco = product line of Thermo Fisher Scientific, Waltham, MA, USA
GE Healthcare Bio-Sciences AB, Uppsala, Sweden
GE Healthcare Bio-Sciences Corp., Piscataway, NJ, USA
GE Healthcare Europe GmbH, Freiburg, Germany
GE Healthcare Japan Corporation, Tokyo, Japan
GE Healthcare UK Ltd, Little Chalfont, UK
Genentech, Inc., South San Francisco, CA, USA

GlaxoSmithKline plc, London, UK

GraphPad Software, Inc., La Jolla, CA, USA
Guerbet, Villepinte, France
H
Hitachi Ltd., Tokyo, Japan
Hoffman-La Roche Ltd., Basel, Switzerland
HORIBA Ltd., Kyoto, Japan
I
IBM Corporation, Armonk, NY, USA
INTERSCIENCE, St Nom la Bretche, France
Invitrogen = Thermo Fisher Scientific, Waltham, MA, USA product line since Nov 2008
J
Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA
Janssen Pharmaceutica, Beerse, Belgium
Jazz Pharmaceuticals, Dublin, Ireland
JenKem Technology USA, Allen, TX, USA
JEOL, Tokyo, Japan
Johnson & Johnson, New Brunswick, NJ, USA
K
Kibron Inc, Espoo, Finland
L
Leica Microsystems, Wetzlar, Germany
Life Technologies = Thermo Fisher Scientific, Waltham, MA, USA
M
Malvern Instruments, Malvern, UK
Merck & Co., Inc., Whitehouse Station, NJ, USA
Merck KGaA, Darmstadt, Germany= EMD Millipore, Billerica, MA, USA

Merck Millipore, Billerica, MA, USA

Microsoft Corporation, Redmond, WA, USA
Millipore Corporation = EMD Millipore, Billerica, MA, USA
Molecular Devices LLC, Sunnyvale, CA, USA
N
Nikon Corporation, Tokyo, Japan
Nikon Instruments, Melville, NY, USA
Novartis International AG, Basel, Switzerland
NovaBay Pharmaceuticals, Inc., Emeryville, CA, USA
Novo Nordisk A/S, Bagsvrd, Denmark
O
Olympus Corporation, Tokyo, Japan
P
PANalytical, Almelo, the Netherlands
Pechiney Plastic Packaging Company, Chicago, IL, USA
PerkinElmer Inc., Waltham, MA, USA
Pfizer, Inc., New York, NY, USA
Pharsight Corporation, St Louis, MO, USA
Polysciences, Inc., Warrington, PA, USA
Proctor & Gamble Co., Cincinnati, OH, USA
Promega Corporation, Fitchburg, WI, USA
Q
Qiagen NV, Venlo, the Netherlands
R
Regeneron, Tarrytown, NY, USA
Roche = Hoffman-La Roche Ltd., Basel, Switzerland
R&D Systems, Inc., Minneapolis, MN, USA

S
Santa Cruz Biotechnology Inc., Dallas, TX, USA
Sanofi-Aventis or Sanofi, Bridgewater, NJ, USA
Sanofi S.A., Paris, France
Sarstedt AG & Co., Nmbrecht, Germany
SAS Institute Inc., Cary, NC, USA
Sigma-Aldrich Co., St Louis, MO, USA
Sigma Chemicals, Perth, Australia (seemingly not related to Sigma-Aldrich)
SPSS Inc., Chicago, IL, USA (Version 1-18) OR IBM product after July 28, 2009 (Version 19+)
StataCorp LP, College Station, TX, USA
T
Takeda Pharmaceutical Company Limited, Osaka, Japan
Thermo Fisher Scientific, Waltham, MA, USA (includes Thermo Scientific and Fisher Scientifc)
Thomas Scientific, Swedesboro, NJ, USA
U
V
Ventana Medical Systems, Inc., Tucson, AZ, USA
W
Wako Pure Chemical Industries, Ltd., Osaka, Japan
X
Y
Z

Numbers
Dates and times

eg, May 31, 2011 not 31 May, 2011

but May 2011 not May, 2011
12 pm, 4.45 am not 12.00 pm or 0445, etc

Equations
Equations should be indented, and numbered sequentially with the number in parentheses:

Equations do not need to be cited in the text, but, if they are, they should be cited in the text
without parentheses,
eg, in Equation 1.

Punctuation and symbols

Endash
Endash () should be used instead of hyphen (-) as a minus/negative sign and in number ranges
eg, 75, 10-, 2953
For a range that features negative integers, use to instead of the endash
eg, 75 to 10, not 7510

Hyphen
Use in P-value, t-test, etc, and to attach number to a unit when used as a compound adjective
eg, for 3 months but a 3-month trial.
EXCEPT where the unit is abbreviated:
eg, a 3 cm margin not a 3-cm margin

Miscellaneous
Commas in numerals of four or more digits
eg 5,000 and 10,000.
No full stops in abbreviations.
Number always before a decimal point
eg, 0.05 not .05
Use tilde (~) in front of numbers to mean approximately (or use the word) not c. or ca.
Ordinals should be in words in the main text,
eg, fifth, etc, not 5th
until 12 and after, eg, 12th.
This includes before units of measurement.

Statistical variables
All statistical variables are shown in italics.

P (probability) is always capital, italic; P-value has a hyphen.

P<0.05
t is always lowercase, italic; t-test with a hyphen.
Students t-test always has capital S.
F is always capital, italic; F-test with a hyphen.
df (degrees of freedom)
MannWhitney U statistic (also known as Wilcoxon rank sum test)
z score
r or r correlation coefficient (bivariate)
R or R correlation coefficient (multivariate)
chi-square test

Note
N or n for number is not shown in italics.

Special symbols
Please ensure that special symbols have been used instead of created alternatives
eg, times symbol () not lowercase letter x
not underlined < (<)
degree symbol () not superscript letter o (o)

Keyboard shortcuts
alt 541
ctrl minus (on num pad)

 alt 0215
alt 0176
alt 24
alt 25
alt 26
alt 27
alt 29

Units of measurement
Abbreviations
All units of measurement should be shown in their abbreviated form and do not need to be
defined at first mention in the text.
Time measurement units (year, month, day, hour, minute, second) should be written out in full in
the main text, but may appear abbreviated in figures, inside parentheses, etc.
Time measurement units can be abbreviated (eg, h for hour; min for minute; s for second) in the
following instances:
When used with other abbreviated units (eg, 90 mL/min/1.73 m)
When used with a prefix (eg, ms)
When used with a power (eg, kmh-1)
Be careful to make a distinction between milliseconds (ms) and meters multiplied by seconds
(ms).
The International System of Units should be used - this is based on the metric system.
http://en.wikipedia.org/wiki/SI
Exception: for molar concentration the SI unit is mol/m, but it is more commonly expressed as
mol/L or M.
A solution of concentration 1 mol/L is also denoted as "1 molar" (1 M).

Always use L for liter

eg, 12 mL
Prefixes for these units are shown in this figure:

Please note that um should be corrected to m, and mcg should be corrected to g.

Do not hyphenate values and units where the unit is abbreviated:
eg, a 3 cm margin not a 3-cm margin

Words and digits

Always use numerals when the number is followed by a unit of measurement (including time
units)
eg, in 2 mL phosphate-buffered solution for 2 hours.
Spell out numbers one through eleven when not followed by a unit of measurement
eg, It took 2 hours and 10 minutes to test the five patients.
Spell out a number and its unit of measurement where it appears at the beginning of a sentence,
or rephrase to avoid.
eg, Twenty-three months later, .

Number ranges
Always use an endash, not a hyphen.

% and C should be repeated in number ranges

eg, 21C35C not 2135C
32%99% not 3299%

Spacing
Leave a space between a number and its unit of measurement, except with degrees
Celsius/Fahrenheit andpercent.
eg, 21C not 21 C
35 mg not 35mg
75% not 75 %
No gap is needed between numbers and mathematical operators.
eg 693 mg/mL
110 cells/mL
No gap is needed between statistical variables and mathematical operators
eg P<0.05
n=3
A gap is needed between words (including abbreviations) and mathematical operators.
eg Odds ratio =9.75
BMI >20
BP <160 mmHg
Aged <25 years
<5 weeks
Mean standard deviation
Note: A formula is a type of equation that shows the relationship between different variables. In
this case there needs to be spaces between variables and mathematical operators for clarity, and

often this would be shown out of the main text - please see page on Equations for more
information.

Punctuation
Abbreviations
Do not use full stops in any abbreviations except for abbreviated genus names (eg, E. coli) and
for sp. and spp. (see ABBREVIATIONS main section for more info).
eg, ie, eg, etc, Mr, Bob B Smith
This rule does not apply to company names, eg Amgen Inc., Thousand Oaks, CA, USA.

Commas and semicolons

Always use the serial (Oxford) comma/semicolon (comma before final item in a list).
eg, red, white, and blue
Dont forget to use an extra and between items that necessarily belong together
eg, apples, chicken and beef stew, and chocolate "not" apples, chicken, beef, stew, and chocolate
"or " apples, chicken and beef stew, chocolate.
Use semicolons in a list when items are lengthy or confusing, or already contain commas.
Use a comma after adverbial phrases
eg, In addition,
Similarly,

Endashes
Use an endash () in date/number ranges, or to indicate a relationship (as in and or contribution
between) rather than a single compound of different items.
eg, MannWhitney test not Mann-Whitney test (which would indicate a single surname)
bloodbrain barrier (which would indicate a barrier between blood and brain) not blood-brain
barrier (a barrier made of blood and brain)
doctorpatient relationship not doctor-patient relationship (relationship between the two, not a
single person who is both doctor and patient)
prepost or pre/post (two different variables) not pre-post (a single compound variable)
JanuaryMay
Use a spaced endash to indicate a parenthetical statement like this.

Shortcut: Ctrl minus (on num pad)

Parentheses and brackets
Parentheses ( ), with brackets [ ] inside if necessary. If there is a third set of brackets then use { }
inside the [ [ ]] brackets.
Use a spaced endash to indicate a parenthetical statement like this.
Note that this rule applies to sentences only.
Never change equations because ({[ have different mathematical meanings.
Please query chemical names that use brackets/parentheses before changing, as sometimes these
are a part of the name and should not be modified.
In addition, [ [ ]] can be used to show a concentration of a chemical so please query when
changing.

Hyphenation
Compounds
Use hyphens in compound nouns and adjectives, etc, as per standard English usage. Please
consult a style manual if you are unsure of these rules.

Prefixes
Prefixes, eg, post, non, ex, should never stand alone. They will always be appended to the root
word, either with or without a hyphen (exception: post hoc).
Check Merriam-Webster dictionaries to see if the word is there:
eg, anti: http://www.merriam-webster.com/dictionary/antiaging
multi: http://www.merriam-webster.com/dictionary/multicomponent
non: http://www.merriam-webster.com/dictionary/non
post: http://www.merriam-webster.com/dictionary/posttreatment
For specialist/technical words not in the dictionary, the preference is nonhyphenated, except
where the meaning might be confusing. If youre not sure, use your best judgment (just make
sure your choice is used consistently throughout).
Always hyphenate before a capital letter
eg, non-European
post-TEM
Streamline different prefixes with the same root
eg, pre- and posttest results

Common words

antiaging
anticancer
antidepressant
anti-inflammatory
antitumor
bloodbrain barrier not blood-brain barrier
cost-effective
double-blind
follow-up
half-life
interindividual
interrater
intra-articulate
intraocular
intrarater
long-term
meta-analysis
multicenter
multidrug
noncomplementary
noncompliance
nonparticipant
nonresponder
off-duty (with noun)
on-duty (with noun)
perimenopause
placebo-controlled
post hoc
postischemic
postmenopause
posttest

posttreatment
premenopause
prepost or pre/post not pre-post
reassessment
single-center
sociodemographic
upregulate

Quotation marks
Use double quotation marks (with single inside if necessary).
Only punctuation belonging to the quote goes inside the quotation marks.
Quotations of more than 44 words should be indented, without quotation marks (and queried for
permission; see also COPYRIGHT and QUOTATIONS).

Special symbols
Always make sure to use special symbols
eg, not underlined >
(degrees) not superscript o
(multiplication) not lowercase x

Quotations
Do not edit quoted material, unless you can be absolutely sure it is a typographical error. Query
any changes or doubts with the author.
Where an ellipsis is given (ie, ), query the author as to whether or not it is a part of the original
quote,

eg, Dear author, Is this part of the original quote, or should it appear in square brackets to show
that it has been added?

Long quotations
Quotations more than 44 words require copyright permission/consent, so please note these on
your EDC report.
Quotations of 2.5 lines or more of normal text should be separated from the main text by line
spaces, block alignment, and indented left and right (dont worry about the accuracy of spacing,
as our typesetters will adjust this to our house style), without quote marks (with double quote
marks inside, where needed). The quotation text should also be a point size smaller than the main
text.
Indent new paragraphs within the quote as per usual for main text.
Indent preceding main text if it starts a new paragraph from the one before the quote, otherwise
left-align if it continues from the paragraph before the quote.

From published source

These quotations require referencing (if taken from a published work). Where provided, include
the superscript citation number at the end of the quote; otherwise, query the author. Note that the
actual reference information should appear in the reference list, and not with the quote.
Exemplar:

From unpublished source

Where the source is indicated, eg, patient number, include this in square brackets at the end of
the quote, after the punctuation:

Note no punctuation is required after the bracketed information.

Short quotations

Quotations less than 2.5 lines in the main text should run on from the main text, within double
quote marks (with single inside, where needed), with final punctuation inside the closing quote
mark.
In a list of quoted items with their own punctuation, eg, questions, punctuate outside the
quotation marks as well, except after the final item when it terminates the sentence:
eg, characterized by three questions: Where have we come from?; Where are we now?; and
Where are we going?
Where the paper cites numerous patient responses or similar throughout, all of these can be
indented, regardless of length (except where only a few words long).
Exemplar:

Published material
A quote from published material must be referenced and cited, with the superscript number
outside the closing quote mark. Copyright permission/consent is not required if the quote is 44
words or less.

Spelling & grammar

(for hyphenation see PUNCTUATION)

Technical terms
(NOTE capitals, punctuation, etc)
H NMR
affect (mood/feeling [subjective experience of])
apposed (to) (in proximity to/juxtaposition with)
bloodbrain barrier (BBB)
Bonferroni correction
Booles inequality
bid (twice daily)
chi-square test or chi-squared test or 2 test
cytochrome P450 (CYP/CYP450)
Descemet's membrane
Dulbeccos Modified Eagles Medium (DMEM)
EpsteinBarr virus
Fishers exact test

Global initiative for chronic Obstructive Lung Disease (GOLD)

half-life
handsearching (a manual page-by-page examination of the entire contents of a journal issue or
conference proceedings)
IL- [with hyphen, eg, IL-6] = interleukin (gene italicized, protein not italicized)
intraocular pressure (IOP)
KaplanMeier
lux or lx (measurement of light intensity)
MannWhitney
New Zealand White rabbits
non-small-cell lung cancer or non-small cell lung cancer (incorrect, but very commonly used this
way)
od (once daily)
P or P-value
Pearsons chi-squared test
Phase I/II/III clinical trial
phosphate-buffered saline (PBS)
postischemic
QT interval (empty abbreviation: name for the measure of time between the start of the Q wave
and the end of the T wave on an electrocardiogram)
sex (for biological gender, except where could be confused for the act of sex)
short hairpin RNA (shRNA)
small interfering RNA (siRNA)
Sprague Dawley (type of lab rat)
Students t-test
T-cell
the Netherlands
transmission electron microscope/microscopy (TEM)
Tukeys test
Tween 20/Tween 80
undegradable

visual analog scale (VAS)

Western blot
g (g in italics indicates the earth's gravitational acceleration used to indicate centrifuge
speed)
X-ray

US spelling
The following US spellings should be used in all instances EXCEPT in names/proper nouns.
Note that European countries and Canada usually (but not always) use UK spelling; Asian
countries vary. As such, always check names with UK spelling online and/or query the author.
For words not on the list, consult Merriam Webster http://www.merriam-webster.com/
acknowledgment(s)
aging
ameba
among not amongst
analog but dialogue, homologue
analyze
anemia
anesthetic
apnea
behavior
buildup (noun)
build up (verb)
catalog
celiac
center
cesarean
characterize
check not cheque

color
counseling/counselor
decision making but a decision-making problem
diarrhea
enroll/enrollment/enrolling
esophagus
estrogen
estrous (adjective)
estrus (noun)
etiology
fiber
glycemic
gray
gynecology
health care
hematoma
hematology
hemoglobin
hemorrhage
high school
homologue
judgment
labeled
liter (L)
magnetized
maneuver
meter
milliliter (mL)
millimeter
mold
no one

organization
orthopedic
pediatric
practice (verb and noun forms)
program/programmed
randomize
side effect
signaling
sulfur/sulfate
tire not tyre
toward not towards
traveler
trialled
tumor
well-being

Supplementary materials
Any supplementary materials/appendices, etc, should be headed Supplementary material(s).
Place this section after the main figures/tables in the manuscript.
Name figures and tables sequentially but separately as Figure S1, Table S1, etc. (These should
not be referred to as Supplementary Figure 1 or similar.)
Supplementary material should be cited in the main text, either as a whole (Supplementary
materials) or in parts (Figure S1, Table S1, etc). If cited in parts, make sure that each part is
mentioned in the main text, in order. If there is no reference at all to the Supplementary material,
please add a query to the author,
eg, Dear author,

Please cite the Supplementary material(s) somewhere in the main text.

Edit as per normal tables and figures. Any copyright issues should be queried and also noted on
the EDC report as per usual.
The Supplementary material must stand alone. Therefore, all references must be in a separate
reference list at the end of the material, even if these references are already in the main reference
list. In addition, main body tables or figures should not be mentioned.
If the material is not clearly a table or a figure, please query on your EDC report.
Very large Supplementary materials are often presented as a hyperlink in the final proof rather
than given in full in the article. If you receive instruction that we have removed the full
Supplementary materials, please check the following comment is on the proof:
Dear author,
We have not included the Supplementary materials here due to their length. Is this information
available somewhere online so that we can provide a link for readers?
If you do receive a very large Supplement or Appendix (ie, over 2400 words or comprising 8 or
more pages) and you have not received any special instructions from Dove Press, please do not
edit, but query with us first to ensure the material was not sent to you in error.

Questionnaires
Where an author has included questionnaires/surveys or similar, these should appear in the
Supplementary materials and be named as most appropriate (Figure/Table S1, S2, etc, or query
on your EDC report).
Treat this kind of material as you would a quotation; that is, edit only what you can be quite sure
is a typographical error. Remember that sometimes the material may have been translated into
English, and may represent the actual wording that was given to subjects. As such, please advise
the author whether you have/have not made changes,

eg, Dear author,

Is it okay to edit the questionnaire, or does it contain direct quotes?
or,
eg, Dear author,
We have changed XXX to YYY. Is that okay?
or if you are quite confident,
eg, Dear author,
We have edited the questionnaire for grammatical accuracy. Please confirm this is okay.

Tables and figures

Do not edit tables or figures that you suspect may have been reproduced or directly quoted.

Abbreviations
ALL abbreviations used in the figure, table, or caption should be explained, either within the
table/figure/caption or notes text, or all can appear in the separate Abbreviation note.
Abbreviations in the note may be listed in order of appearance or alphabetically, but the choice
should be consistent through the paper.
If the author has not provided abbreviation lists under the tables/figures, please add and/or query
these.

Citations
In-table/figure references
Crosscheck citations with the reference list as you would in-text citations.

If the author provides reference material in the table/figure but has not included it in the
reference list, these may be added to the end of the reference list (table/figure citations do not
need to appear in numbered order). Then, the table/figure itself should include the author(s)
name(s) and the superscript reference number.* Include a comment to the author that you have
done this as per house style. (Remove reference to the date, unless a timeline element seems
important. If in doubt, query the author.)
Remember
Smith one author
Smith and Jones two authors
Smith et al three authors
Reference numbers can appear instead in a separate column headed Reference or similar, if
provided by the author. In this case, do not superscript the numbers. Separate with
commas/endashes/no spaces as per superscript citations.

In-text figure/table numbers

Check that these are all cited in numbered order in the text.
Individual figure parts (eg, Figure 1A, B, etc) do not need to be cited in the text, so long as the
whole-figure citation (eg, Figure 1) appears as well. If only individual parts are being cited, then
all the parts should be cited.
Figure citations may appear in parentheses or as part of a sentence.

Format examples
Figure 1 shows
Figure 1A shows
Figure 1A and B shows
Figure 1AC shows
Figures 1 and 2

Figures 13
Figure 1; Table 2

Note
Tables should not be cited in parts. If the author has Table 1A and 1B, for example, the tables and
citations should be renumbered Table 1 and Table 2, respectively.

Formatting
Captions
eg, Figure 1 Range and distribution of grape berry sugars.
Notes: horizontal lines in the interior of the box are the median values. The height in a box is
equal to the interquartile distance, indicating the distribution for 50% of the data. Approximately
99% of the data fall inside the whiskers. The data outside these whiskers are indicated by vertical
lines.
Abbreviations: Suc, sucrose; Glu, glucose; Fru, fructose; B, bunch; H, Florida hybrid bunch; M,
muscadine.
or,
eg, Table 1 Fold changes in the relative mRNA levels of inflammatory genes in the lungs of
animals at P1, P21, and P70 following treatment with saline (S) or lipopolysaccharides (L)
Notes: P1, P21, and P70 animals were treated with S or 0.25 mg/kg L for 2 hours. Relative
mRNA levels of inflammatory mediators in the lungs of these animals were measured by realtime RT-PCR (A) or semi-quantitative RT-PCR (B). Data were presented as fold changes in
relative mRNA levels of inflammatory genes between different treatment groups. *Represents
significant difference between the treatment groups (two-way ANOVA followed by Bonferroni
post-test).
Abbreviations: IL,interleukin; MCP-1, monocyte chemoattractant protein-1; MIP, macrophage
inflammatory protein; mRNA, messenger RNA; P, postnatal; RT-PCR, reverse transcription

polymerase chain reaction; TLR, toll-like receptor; TNF-, tumor necrosis factor-.

Note
Figure parts should be labelled A, B, etc, to appear as (A), (B), etc, in the notes. The
corresponding note may come before or after the letter, as required, but do try to be consistent.
eg, Relative mRNA levels of inflammatory mediators in the lungs of these animals were
measured by real-time RT-PCR (A) or semi-quantitative RT-PCR (B).
or,
eg, Relative mRNA levels of inflammatory mediators in the lungs of these animals were
measured by (A) real-time RT-PCR or (B) semi-quantitative RT-PCR.
If needed, further parts should be indicated as (a), (b), etc.
When the figure part is being referred to as part of a sentence, keep each letter in separate
parentheses. When the figure parts are not read as part of the sentence, combine within same
parentheses.
eg, Original magnifications: 600 (A and C); 200 (B, D, FH); 400 (E).
but
The segments (F) and (G) are demonstrating serial sections.

Exemplars (from published papers)

Fonts
Bold may be used for headings within the table/figure, or to signify significant values (needs to
be explained in the Note section), otherwise use the same rules as per main text (italics only for
genes, genus/species names, book titles; no bold or underline, barring exceptional cases).

Headings
All titles and headings (eg, column/row headings) should be sentence case (capital first
letter/proper nouns only).

Symbols
Superscript symbols may be used in figures and tables. However, this can be confusing if
multiple symbols are used particularly if symbols are used to display statistical significance
(P<0.05), and also used to show the statistical method used (eg Bonferroni).

Please query
Dear author,
For showing statistical significance on the graphs or in the tables, we recommend using either of
the following:
*P<0.05
or
*P<0.05, ** P<0.01, *** P<0.001

Please advise whether any changes are required to your data.

Thanks

Process
Editable tables and figures and their corresponding captions should be moved to the END of the
main manuscript following the references, with author instructions (place Table 1 here or
similar) deleted.
Tables and figures MAY be edited as separate documents, but only where it is not possible to
append them to the main document.
Uneditable table and figure captions should be recreated (typed [where reasonable] or copied and
pasted) at the end of the main document and, unless subject to copyright, edited.
Check that tables and figures are cited in the main text, in numerical order.
Check that figure parts (A), (B), etc, are all mentioned/explained in the captions. (These
individual parts do not need to be cited separately in the main text).
(see also Tables and Figures -> Citations for more information about in-text table/figure
citations)