Sie sind auf Seite 1von 7

Penaeus

(Litopenaeus)
TUMXLv9.8 sequence

vannamei

microsatellite

GenBank: AF360113.1
GenBank Graphics
>gi|19850532|gb|AF360113.1| Penaeus (Litopenaeus) vannamei microsatellite
TUMXLv9.8 sequence
GATCTATTGAGCACTGTCATAATATTTTGTATCTGCTGAGCACTGTCATAATATTTTGTATCTATTGAGC
ACCGTCATAATATTTTGTATCTACTGAGCACTGTCATAATATTTTGTATCTATTGAGCACTGTCATAATA
TTTTGTATCTACTGAGCACTGTCATAATATTTTGTATCAATTGAATACTGTCATAATATTTTGAATCTAT
TGAGCACTGTCATAATATGTTGTATCTAGTGACACCAATACCTTTGTCACCGCCAAGTCACAGGCACCAA
CACCGCTTACCAAACGGTCTGAATCAAAGATTACCTCAGTGCCAACGGTGGAGCTGAAGGTGGAGTTGTC
GAAGTCCCACTCGACGCAAGGCTCCTCTTCGACCTGGCCCGAGGACGAGTTCAGCACGAAGTAACTGCAC
TCGGGTCTGGCGGAGAGAGTGGGGGGGGGGG

Sequences
producing
significant
alignments:
Penaeus
(Litopenaeus)
vannamei
microsatellite
TUMXLv9.8 sequence

83
3

21
92

100
%

0.
0

100
%

AF3601
13.1

Oreochromis mossambicus TAUT mRNA for taurine


transporter, complete cds

GenBank: AB033497.1
GenBank Graphics
>gi|11191965|dbj|AB033497.1| Oreochromis mossambicus TAUT mRNA for
taurine transporter, complete cds
GGAACACTATACATAGTCGCAGCCATGAAGGAAATCATGGCACAAAAAGAGAAGCTTCAATGTCTGAAGG
ACTTTCACAAGGACACTCTGAAACCTTCACCAGGGAAGAGCCCAGGTACGAGACCTGAGGATGAGGCAGA
AGGCAAAGCTCCTCAGAGGGAGAAGTGGGCCAGTAAGCTCGACTTTGTCCTGTCCGTGGCCGGAGGCTTT
GTCGGATTAGGAAACGTCTGGCGCTTCCCTTACCTTTGTTATAAAAATGGTGGCGGTGCATTTCTTATCC
CTTACTTCATCTTCCTTTTCGGGGGTGGTCTGCCGGTGTTCTTCCTGGAAGTCGCGCTGGGCCAGTACAC
CTCTGAGGGAGGGATCACCTGCTGGGCTAAGCTCTGCCCCATCTTTACTGGTATTGGCTATGCCTCTATC
GTGATCGTGTCTCTACTAAACATCTACTACATTGTGATCTTGGCCTGGGGACTCTACTACCTGTTTCAGT
GCTTTCAGCCCGAGCTCCCCTGGGCAAAGTGCAAGCAGCCTTGGAACACAGAGCACTGTGTAGAGGACAC
AGTGCGCAAGAACAAGACCCTTTGGCTGGCAGCCAACGCTACCAACTTTACCTCCCCCGTCACCGAGTTC
TGGGAACGCAACGTCCTAAGCATCTCCACTGGAATTGAAGACATAGGGCCCCTGAAGTGGGACCTAGCAC
TGTGTCTCCTGGCAGTGTGGGTCATCTGCTTTTTCTGCATCTGGAAGGGAGTCAAGTCCACAGGGAAAGT
GGTGTATATAACAGCAACTTTCCCATTTGTCATGCTGATTGTACTGCTGGTGCGTGGCGTGACTCTTCCT
GGAGCCAGAGAAGGGATCAAATTTTACCTTTACCCTAACGTAACCCGCCTACAAGATCCAGAGGTGTGGA
TTGATGCAGGAACCCAGATTTTCTTCTCCTATGCCATTTGCCTGGGCGCCATGACGTCACTGGGGAGCTA
CAACAAGTACAAATACAACTGCTACAGGGACTGTTTGCTGCTGGGAGGCCTCAACAGCGGTACCAGTTTT
GTGTCTGGCTTCGCAATATTTTCCGTCCTGGGCTTCATGGCACAAGAACAAGGGGTGGACATTGCCGATG
TGGCAGAGTCAGGTCCTGGCTTGGCCTTCATTGCCTACCCTAAAGCTGTGTCCATGATGCCACTGCCAAC
CCTGTGGGCCATTCTCTTCTTCATCATGCTGCTGCTTCTGGGCCTTGACAGCCAGTTTGTTGAAGTGGAA
GGTCAGATCACCTCTATTGTGGATCTGTATCCAGCCGTCCTCAGGAAAGGTTATCGGCGAGAGATCTTCA
TAGCTGTGATGTGTTTCATGAGCTATCTCCTGGGACTCGCCATGGTGACAAAAGGTGGCATGTATGTGTT
CCAGCTCTTTGACTACTATGCAGCCAGTGGTGTGTGCCTTTTGTGGGTTGCGTTCTTTGAATGCATTGCT
GTAGCCTGGGTTTATGGAGTCGATAACTTCTATGATGCAGTTGAGGATATGATTGGCTACAGACCAAACC
CATGGATGAAATGGAGCTGGTCCATAATCACTCCTGTCCTCTGCATGGGCTGTTTTGTCTTCTCACTGGT
GAAGTACAAGCCATTGACCTATAACAAGGTGTATGAGTACCCTGACTGGGCCATTGGTCTGGGCTGGATT
TTGGCCCTGTCCTCCATGATCTGCATCCCAATGGTGATGGTCATCAAGATCTTGCAGTCTGAGGGACCTC
TGATTGAGAGGATCAAAGCAGTGGCAGCCCCAGCAAAGTCAGGCGTGAGCTCCCGCCCGAAAGAATACAA
CTTGAAGGGCAGCGAGCTGACACAGCCCCTGGACCCAAATGGGAACAATGGCTTAATCAAGCCCACCCAC
ACCATTGTAGAAACAATGATGTGAGCGCTCTCTGTGAGAGGAATAAGATTGATGTGCTTTCTGTGGTATC

ATATTTGCTAACTTTAGTAGGTTTACATTGTCCGGTATATTCACGTTAGAGATAGTCTGGTTTGATTTCT
ATGAAGAGGGTTTTATTATTGTATTTTATTTTTCTTGTGATTTTTTTTTTTTCTTCATTTTTTTACTATA
TTGATATTGTTGTTGTTACAGTTGTTGTTGCTGTAGTTGGCACTGATCTCAGTTTGGGCAGTATTTCGAG
ATAAAACATTTTAAATGTTTACTACCTTTCTGTTGATTCCGGAAAGATGAGGAATTTGCTTTTTTTTTTG
CCAGCGCTATAGAAGAAAAGAGGAAATTCTCACTTTTCACGTTGTTAAATAAACTAAATGAGTAATTAAC
TGCAAAAAAAGGTGGAAGGTGTCACGTGATTGTGACGGTCTTGTTGTACTGACTTCTAATTTTTATGTCA
TTTTATGCCACAATGAAATGAATGTACCTCCGCTTGCGGCGGAAGCCAGTCACCGACATCTCTCAGAAAA
CATATCCATGACATTTTGAGCAGCAATATGCAGTGTATAGAGTAAATCTTGCTTGACAACTTTTAAGTTA
CAAGTTGGTCTTGGCCAAATACTGTGAGAAATGCCTTTTTAAGACGATCCATCCTGAAAGCAGTTGAGAT
AAAATAAGAGAAAACGACAGGTAGGAAATAAAAAAAGGGGGGGGGAACAAGGGAAGTGGCATTTTTAGAG
TATTTGTACACTGCCTGTGTGACTACTATAGTCAGTACCAGTGCATTTATTGAAACCTCTCTTTGCACTT
TATATGTTGTTTCACCTTTATTGTAGTGTGTTTTTATTGTTGCAGAGTATCGCAGCTACATTTGCAACAC
ATTTCAGGAGAAACTATTTTTAGCTTCTAACTTTTTGAAATTGTAAACTTTGATATGAGGTATCTAGTTG
TCTCTTGAGACGATGACAGAATAGAAAGTAGAAACTTACCATCAGATATTCAGATTTCTCATTGTTAGTG
GGATCTGTGAGAACATCACTCAGAAGCGTTAGTTTTTACTAAACCGCCTGACAGCTCTCTCCGTTGTGCT
TTCAGCAGCAGGTGCGCTCTGCAGAACGACCACTGGAGTCTGGCTTTTAATTCAGTTGTATTTGAGAGAT
TATGTGTAGAATTTTAATTGTTTGTAAATCACATATGCCTTTTTGTATCAATTTTATACTGCACATCATC
TGAACACCATCACTGATTCATTATTTTAATCAAAGCTCACCAATGTGTTTCGCTACATGTCAGTTATCGT
GAGCCCGGATTTGCACATTCCGGGTGCAATATTCAGTGAAGCGGTGGCGTAGTCTAATCATACGTAATGC
ATAACAAAGAAACAACTTGCAATAGTTCAGTGCAACTTCTTGAGGATTGTTTTCCTGAAGCATGTGTAGG
AGCCACCACCGTACCCTGCTGCTTTCTCCTTTTAAAAAATTGCAATGTGGAATTTTAAATGTACCAAAGT
ATTTTTGTCTCACAGTTTTTCCCTTTGAGATGCACATTGCATCATTTCTATATAGATTAAATAAACATAT
TTTTCTTTG

Haliotis rufescens fertilization protein mRNA, complete


cds

GenBank: L36552.1
GenBank Graphics
>gi|604524|gb|L36552.1|HLTFEPR Haliotis rufescens fertilization protein
mRNA, complete cds
ATCATCATCTAATATCATCAATCAGGCTTGGAAAGCAAAGGAAACAGTATGAGGTCTTTGGTGCTTCTCT
GTGTTTTGCTGATGGCAATATGTGCGGCGGACAAAAAATCCACGGTCTCGAAGGAAAATGCAGCCGCAAT
GAAGGTAGCGATGATAAAGTTTTTGGATTCGAGGACGGATAGATTCAAAAAACGCATTGAGAAGATTGGA
TATCCAATAACCCCTCCGCAATATACAACTCTACTATACTACAACAGAGAGAGATTGATGGATTGGTGCC
ATAACTACGTTGAAGTATCCAAAAAGATTATATTGTTGGGAGGTAACAAATTAAATAAGAAGAACTTCGC
TAGGATGGGTCGAATCATTGGCTGGAAAAACCAGTGGATTTTGAAAAGGAGGCAATGGCACATGGTCAGA
GTGATGAGGCGCTATAAAGCTTCTGCAATAGCTAAAAAGATCGTCGCCATGAAAGTTGCTGACCTACCCT
GTAACTAGCTGTGATGCGGTAACTCACCCCCCCCCCTGAGTCCCTGACAGTTTCGCCATTACACCGAGGA
ACCAGTAATGAGAGACTTCACAACACCTAATGTATTTGTCAGAAATTAAACAAAACTATCT

Macrobrachium rosenbergii anti-lipopolysaccharide


factor (ALF) mRNA, complete cds

GenBank: JQ364961.1
GenBank Graphics
>gi|379135489|gb|JQ364961.1| Macrobrachium rosenbergii antilipopolysaccharide factor (ALF) mRNA, complete cds
ATGAAAGTGTCTGTTGTCTTCAGCGTCGTGATGGTTGGGGTGATGACGTCATCGTTACTTCCCACTTGTG
AAGCTCAGGGTTGGGAAGCTGTGGCGGCTGCTGTTGCCGAAAAGATCGCTGGTCTCTGGGTGGACGACCA
AATGGTATTCTTGGGGCACACGTGTCAGTACAGCGTTAATCCTAAAATCAAACGGTTTGAGCTCTACTTC
AAGGGCCGGATGTGGTGCCCAGGATGGACTACTATCAGAGGAGAAGCTGAGACTCGCAGCCGATCTGGCG
TCGTTACCAAAACAACCCAAGACTTCGTCAGGAAAGCCTTCCAGTCCGGCATCGTAACTGAGGAGCAAGC
AAGGGTCTGGCTTAACTCTAAATAGAAAAAAGTTGTCCAGCTTCCTCCAAGAATATTCCTCTCTTCATAA
GACGATCATCAGGTTTCATTTCTCATATATTAATCCAGATGCTTCCCTTTCTGAATGTTACTCAACGGCA
CAATCAAGAGGCCACTGGATATACATACTTCATTACATTTACTTCCTGGAAACAGGAATTCACTTATAAC
CTGCCTCTACCCACGAGTTGAACTTGTTATAGAGCCCGCTCGTCTCGGTGTCCTCACCAAAAGTGGTATT
CAACATGAGACTGTTTTTAAATAAAATTACCTACTGGTCAAAAAAAAAAAAAAAAAAAAA

Poecilia reticulata mitochondrial nd2 gene for NADH


dehydrogenase subunit 2, partial cds, haplotype: LAR1

GenBank: AB257849.1
GenBank Graphics
>gi|116642500|dbj|AB257849.1| Poecilia reticulata mitochondrial nd2 gene
for NADH dehydrogenase subunit 2, partial cds, haplotype: LAR1
CTACTATTTGCTAGCATCTCTAATGCATTCCTCACCGGAGAGTGGGACATTCTACAAACCCCTAATACCC
TTACTTCTTCACTAATTACCCTAGCCCTTGCCATAAAAATTGGACTTGCCCCCCTTCACAGCTGAATACC
AGAAGTAATACAAGGCTTAAGCCTACTTAATGGATTAATTCTATCCACTTGACAAAAACTTGCCCCCCTT
TACCTCATCTACCAAATTCAACCAACCAACTCCAACATTTTTATTACCCTAGGACTTCTATCCATTATTG
TGGGGGGGTGAGGGGGATTTAACCAAGTACAACTCCGAAAAATCCTAGCATACTCTTCAATTGCCCACTT
AGGGTGAATAATTTTAATTCTTTCATTCGCACCTCCACTAGCCCTACTCACAATCCTAATTTATCTCCTA
ATAACCTTCTCACTATTTTCTTCTTTTATATTAACCCGAACCACACACATCAACTCTCTAGCCACTACAT
GGGCCAAAATCCCAATTCTAACCATCTCAACCCCCCTAGTCCTATTATCCCTAGGAGGATTGCCCCCTCT
TACAGGATTTATACCAAAATGACTTATTCTCCAA

Artemia sp. p21 ras-like protein gene, partial cds

GenBank: M27887.1
GenBank Graphics
>gi|161175|gb|M27887.1|SHRRASPA Artemia sp. p21 ras-like protein gene,
partial cds
GGAGGAGTTGGTAAAAGTGCCCTTACTATCCAGTTGATTCAAAATCATTTTGTAGATGAATATGACCCAA
CAATTGAAGATTCGTATCGACAGCAAGTTGTAATTGATGGCGAAACCTGTCTTCTTGATATTCTTGACAC
AGCTGGTCAAGAAGAATATAGTGCCATGCGAGATCAGTACATGAGGACAGGTGAAGGATTCCTCCTTGTG
TTTGCTGTAAATAATGCAAAATCATTTGAAGATATTAGTGCATATAGAGAACAAATCAAACGGGTTAAAG
ATGCAGAAGAAGTGCCAATGGTTTTGGTTGGAAATAAATGTGATTTGCCAACACGTGCAGTTGACATGAG
CCAAGCAAGAGAAGTGGCAAGACAATATGGTATCCCTTTTGTAGAAACCTCGGCTAAAACTCGTATGGGT
GTAGACGATGGTTTTTACACGTTAGTCAGAGAAATTAAAAAAGACAAAATGAAGAAAGGTAACAGTTCAA
GACGCGGGCGAAGCGGACGGAAGCAGCTTAAGTGCTCAATACTTTAATGCTTAGAGAAATAGTGAATCTA
TACAATCAGAATTTTTTTATGATTAATTTTACTATTCGACAAAGCACAAAGCACAAAGCCTAATTATCTG
ACAGACCAAACATCGTGTTTTTGTGATATTGTCAGTTTTTTTTTAGATTTGTTTTGCTATTACTTTGCTG
TCTTTAATGATGCGGAGCAGAAATTCTTGATTAAATGTTCACAGTTGTGTTATTTCTAAATTTTTTGGGG
GAAGAATTATGCTCCTCTTTTTACTTCATCATTTTTTATTCCACTTTAATCAAATTCGAAACAAAATGTG
TTTG