Molecular Microbiology (2009) 73(3), 419433

doi:10.1111/j.1365-2958.2009.06779.x
First published online 7 July 2009

Activation and repression of a sN-dependent promoter

naturally lacking upstream activation sequences
mmi_6779 419..433

Odil Porra,1,2 Vicente Garca-Gonzlez,1,2

Eduardo Santero,1,2 Victoria Shingler3 and
Fernando Govantes1,2*
1
Centro Andaluz de Biologa del Desarrollo, Universidad
Pablo de Olavide/CSIC, Carretera de Utrera, Km. 1.
41013 Sevilla, Spain.
2
Departamento de Biologa Molecular e Ingeniera
Bioqumica, Universidad Pablo de Olavide, Carretera
de Utrera, Km. 1. 41013 Sevilla, Spain.
3
Department of Molecular Biology, Ume University,
901 87 Ume, Sweden.

Summary
The Pseudomonas sp. strain ADP protein AtzR is a
LysR-type transcriptional regulator required for activation of the atzDEF operon in response to nitrogen
limitation and cyanuric acid. Transcription of atzR is
directed by the sN-dependent promoter PatzR, activated by NtrC and repressed by AtzR. Here we use
in vivo and in vitro approaches to address the mechanisms of PatzR activation and repression. Activation
by NtrC did not require any promoter sequences
other than the sN recognition motif both in vivo and
in vitro, suggesting that NtrC activates PatzR in an
upstream activation sequences-independent fashion.
Regarding AtzR-dependent autorepression, our in
vitro transcription experiments show that the concentration of AtzR required for repression of the PatzR
promoter in vitro correlates with AtzR affinity for its
binding site. In addition, AtzR prevents transcription
from PatzR when added to a preformed E-sNPatzR
closed complex, but isomerization to an open
complex prevents repression. Gel mobility shift and
DNase I footprint assays indicate that DNA-bound
AtzR and E-sN are mutually exclusive. Taken together,
these results strongly support the notion that AtzR
represses transcription from PatzR by competing
with E-sN for their overlapping binding sites. There

Accepted 18 June, 2009. *For correspondence. E-mail fgovrom@

upo.es; Tel. (+34) 954 977877; Fax (+34) 954 349376. Present
address: Oryzon Genomics, Josep Samitier 1-5, 08028 Barcelona,
Spain.

2009 The Authors

Journal compilation 2009 Blackwell Publishing Ltd

are no previous reports of a similar mechanism for

repression of sN-dependent transcription.

Introduction
The alternative s factor sN, also known as s54, is ubiquitous among bacteria. RNA polymerase loaded with sN
(E-sN) displays features unlike any other form of the
holoenzyme. Transcription by E-sN is initiated at promoters with conserved elements around positions -24 and
-12 that differ substantially from the usual -35 and -10
boxes in promoters recognized by members of the s70
family. E-sN readily binds DNA at this type of promoter
regions to form a binary closed complex. However, the
sN-bearing holoenzyme is unable to elicit DNA strand
separation at the promoter to form an open complex.
Because of this defect, all sN-dependent promoters are
subjected to positive regulation by a member of a family
of bacterial transcriptional activators known as enhancerbinding proteins (EBPs) (Kustu et al., 1989; Morett and
Segovia, 1993; Buck et al., 2000).
Enhancer-binding proteins are modular proteins
harbouring an N-terminal regulatory domain involved
in signal response, a highly conserved catalytic central
domain with ATPase activity and a DNA-binding
C-terminal domain featuring a helixturnhelix motif.
EBPs bind to DNA over 80 bp upstream from the E-sN
recognition elements they control, at sites known as
enhancer-like elements or upstream activation sequences
(UAS) (Kustu et al., 1989). An EBP bound to its cognate
UAS contacts promoter-bound E-sN via formation of a
spontaneous or protein-induced DNA loop at the intervening sequences. Interaction of an EBP with E-sN results
in isomerization to an open complex in a reaction that
requires ATP hydrolysis by the conserved central domain
of the EBP. The structure and function of EBPs and the
molecular mechanisms behind sN-dependent promoter
activation have been thoroughly reviewed elsewhere
(Morett and Segovia, 1993; Buck et al., 2000; Zhang
et al., 2002; Studholme and Dixon, 2003; Schumacher
et al., 2006; Wigneshweraraj et al., 2008). In addition to
positive control, a handful of sN-dependent promoters
are subjected to negative control by regulatory proteins
other than their cognate EBPs. Interestingly, in the few
characterized examples, repression appears to occur via

420 O. Porra et al.

an anti-activation mechanism in which the repressor

prevents productive interactions between the EBP and
RNA polymerase (Feng et al., 1995; Martin-Verstraete
et al., 1995; Wang et al., 1998; Mao et al., 2007).
LysR-type transcriptional regulators (LTTRs) represent
the most abundant family of transcriptional regulatory proteins in bacteria. LTTRs are typically encoded by genes
adjacent and divergent from the promoters they activate.
Most proteins in this family repress their own transcription.
Activation and autorepression are exerted from a single
asymmetrical binding site located within the divergent promoter region. LTTR binding sites contain a palindromic
recognition element, harbouring the consensus T-N11-A,
designated the repressor binding site or RBS. The RBS is
normally centred at position -65 relative to the activated
promoter transcription start site, and often overlaps the
repressed promoter. The RBS is considered the major
sequence determinant for LTTR binding, and is required
for both activation and repression. A second sequence
element, the activator binding site or ABS, is located
between the RBS and the activated promoter. The ABS is
an accessory element for DNA binding, but it is strictly
required for activation. Many mechanistic details on transcriptional activation by several members of the LTTR
family have been revealed over the last 15 years, and
a general model for inducer-dependent activation, the
sliding dimer model, has been proposed (reviewed by
Schell, 1993; Tropel and van der Meer, 2004). In contrast,
the phenomenon of autorepression has received little
attention, and it is generally assumed that LTTR binding
to the strong RBS element is sufficient for repression
(Schell, 1993).
AtzR is an LTTR involved in activation of the cyanuric
acid utilization operon atzDEF of Pseudomonas sp. ADP
in response to cyanuric acid and nitrogen limitation. AtzR
is encoded in a monocistronic operon divergently transcribed from atzDEF (Martinez et al., 2001). The PatzR
promoter is one of the rare examples of sN-dependent
promoters subjected to both positive and negative control.
PatzR is activated by the nitrogen limitation-responsive
EBP NtrC, and repressed by AtzR irrespective of the
presence of cyanuric acid (Garca-Gonzlez et al., 2005).
The role of NtrC and the signalling cascade for nitrogen
limitation have been extensively characterized in enterobacteria (Merrick and Edwards, 1995; Arcondeguy et al.,
2001; Reitzer and Schneider, 2001; Reitzer, 2003). NtrC
is an archetypical activator of sN-dependent promoters
that binds to UAS elements located far upstream from
the E-sN recognition element. However, no sequence
resembling the proposed Pseudomonas putida NtrC
binding motif (Hervs et al., 2008) is present at the divergent atzRatzDE promoter region, and we have shown
that deletion of all sequences upstream from the E-sN
recognition element has no effect on NtrC-dependent

activation of PatzR in vivo, suggesting that NtrC does not

require any specific sequences upstream from the promoter to activate atzR transcription (Porra et al., 2007).
We have also shown that AtzR binds a single site at
the divergent atzRatzDEF promoter region. The AtzR
binding site contains a typical RBS, centred at position
-65 relative to the atzDEF transcriptional start, which
overlaps the sN-dependent PatzR promoter. We have
characterized the function of the RBS as the major determinant for high-affinity DNA binding of AtzR that is essential for both activation and autorepression, and our work
has revealed an important role for the ABS in negative
autoregulation (Porra et al., 2007).
The present work focuses on the mechanisms of
transcriptional regulation at the PatzR promoter. Here, we
explore further the requirement of cis-acting sequences
for NtrC-dependent activation of PatzR and dissect the
interplay between E-sN, AtzR and their respective recognition sites at the atzR promoter region. Our results
strongly suggest that AtzR represses atzR transcription by
competing with E-sN for DNA binding to effectively diminish E-sN occupancy of the PatzR promoter. We propose
that this mechanism is an adaptation to the fact that the
atzR promoter region lacks a UAS for NtrC, which makes
NtrC-dependent activation inefficient and thus dependent
on a high occupancy rate of the PatzR promoter by E-sN.

Results
Activation of the PatzR promoter does not require
upstream or downstream sequences
In contrast to most sN-promoters, the PatzR promoter
region lacks any sequences resembling the UAS consensus for its cognate EBP, NtrC. In addition, a PatzR
lacZ fusion lacking all DNA sequences upstream from the
-24/-12 E-sN recognition element was still induced in
response to nitrogen limitation in a similar fashion to
a wild-type fusion (Porra et al., 2007), indicating that
NtrC binding to upstream sequences is not required for
PatzR activation in vivo. Because the PatzRlacZ fusions
contain 139 bp downstream from the atzR transcriptional start site, it is feasible that an enhancer-like element
may be located in this region, as described for other
sN-dependent promoters (Belitsky and Sonenshein, 1999;
Jyot et al., 2002). To test this possibility, transcriptional
fusion plasmids pMPO232, containing the full-length atzR
promoter region (positions -250 to +139), and pMPO237,
containing a minimal PatzR promoter that includes only
the -24/-12 E-sN recognition boxes and the transcriptional start site (positions -27 to +1), were constructed
(Fig. 1). Both plasmids, along with the empty transcriptional fusion vector (pMPO234), were transferred to
P. putida KT2442 and its DntrC derivative MPO201 by

2009 The Authors

Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 419433

Complex regulation of a sN-dependent promoter 421

Fig. 1. Fusion constructs and in vitro transcription templates used in this work.
A. Sequence of the atzRatzDEF promoter region with the end-points of the PatzR inserts in the different constructs indicated by bent arrows.
Conserved positions of the PatzR promoter are underlined, boxes indicate the location of the RBS (shaded) and the proposed ABS (open)
and an asterisk denotes the PatzR transcriptional start site.
B. Schematic of the atzRatzDEF promoter region, indicating the extension of the sequence included in the transcriptional fusion plasmids
(solid bars) and in vitro transcription templates (shaded bars). Co-ordinates are relative to the transcriptional start of atzR. Solid arrows
indicate the location of the PatzR and PatzDEF promoters. Bent arrows denote the atzDEF and atzR transcriptional start points. Shaded
and open boxes represent the RBS and the proposed ABS respectively.

mating, and expression was monitored by means of

b-galactosidase assays (Table 1).
Expression from the wild-type atzR promoter region
in pMPO232 was low in cells grown under nitrogen sufficiency, and was significantly increased (14-fold) in
nitrogen-limited medium. This result is consistent with the
previously observed induction of PatzR under nitrogen
limitation (Garca-Gonzlez et al., 2005; Porra et al.,
2007). Expression from the minimal PatzR promoter in
pMPO237 was somewhat lower (twofold) in ammoniumcontaining medium. Nevertheless, an induction ratio comparable to that in the full-length construct (10-fold) was
observed with this construct under nitrogen limitation.
Low, unregulated activity was obtained with the trans-

criptional fusion vector pMPO234 under both growth

conditions. Expression from both PatzRlacZ fusions was
decreased similarly (seven- to eightfold) when assayed
in the DntrC mutant MPO201 grown on serine, while
the basal expression levels obtained in ammoniumcontaining medium were largely unaffected, indicating
that NtrC is responsible for nitrogen limitation-responsive
activation with both constructs. Analysis of certain E-sNdependent promoters in plasmid constructs has been
shown to lead to enhanced UAS-independent activation
that may overrule the need for weak UAS elements
(Drummond et al., 1983). To rule out the possibility that
this phenomenon is an artefact due to the use of plasmidborne fusions, two plasmids were constructed (pMPO166

Table 1. Expression of PatzRlacZ transcriptional fusions.

Nitrogen source

Fusion plasmid

PatzR promoter
fragmenta

P. putida genetic
background

Ammonium
Serine
b-Galactosidase activity

pMPO234
pMPO232

None
-250 to +139

pMPO237

-27 to +1

Wild type
Wild type
DntrC
Wild type
DntrC

156 33
447 92
444 45
254 31
249 11

138 15
6190 662
880 134
2590 316
336 26

a. Co-ordinates are relative to the atzR transcriptional start site. Values are b-galactosidase activity (Miller units) of exponentially growing cultures,
and represent the average and standard deviation of at least three independent measurements.

2009 The Authors

Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 419433

422 O. Porra et al.

and pMPO167) that harbour the wild-type and minimal

PatzR promoters fused to lacZ between the ends of the
Tn7 transposon. These plasmids, which are not replicative in P. putida, were used to insert the fusions at the Tn7
insertion site in the chromosome of P. putida KT2442 and
its DntrC mutant derivative MPO201. Expression from
both fusions was low in nitrogen excess and was induced
under nitrogen limitation (seven- and fivefold in the wildtype and minimal promoter respectively) in the wild-type
strain (Fig. S1). However, induction was not observed
in the DntrC background, thus confirming the results
obtained with plasmid-borne fusions. Taken together,
these results strongly suggest that NtrC binding to a specific recognition element either upstream or downstream
from the PatzR promoter is not required in vivo for
activation.
To test NtrC-dependent activation of PatzR further,
in vitro transcription was performed using P. putida E-sN
reconstituted from purified core RNA polymerase and sN.
A P. putida NtrC derivative bearing the D55E and S161F
substitutions was used as the activator. These mutations
correspond to D54E and S160F in Escherichia coli
NtrC, which render the protein constitutively active, thus
bypassing the requirement for NtrB-dependent phosphorylation (Klose et al., 1993). The constitutive phenotype of
NtrCD55E,S161F was verified in vivo by testing activation of
the Klebsiella pneumoniae PnifLA promoter (A.B. Hervs
et al., submitted). Supercoiled plasmids containing PatzR
promoter fragments cloned in vector pTE103, which
efficiently terminates transcription at the strong T7 terminator, were used as templates.

Activation of PatzR by NtrCD55E,S161F was assessed in

multiround in vitro transcription assays using pMPO156
(designated PatzR-wt), harbouring the complete PatzR
promoter region from -239 to +25 as a template (Fig. 1).
Initially, the effect of a range of NtrCD55E,S161F concentrations on transcription from the PatzR-wt template was
tested. Transcription was not detected in the absence of
NtrCD55E,S161F. However, increasing amounts of a specific
transcript were obtained as the NtrCD55E,S161F concentration was increased from 1.25 to 5 mM (Fig. 2A). These
results indicate that unphosphorylated NtrCD55E,S161F can
activate transcription from the PatzR promoter in vitro,
consistent with its constitutive phenotype. To test the
effect of upstream sequences on in vitro activation of
PatzR, transcription from the PatzR-wt template was
compared with that from plasmid pMPO162 (designated
PatzR-Dmin), which harbours the promoter fragment
between positions -29 and +25 (Fig. 1). For these
assays, an NtrCD55E,S161F concentration of 2.5 mM was
chosen, as it was shown above that the response of the
promoter was not saturated at this concentration of the
activator.
Transcription from the PatzR-wt or PatzR-Dmin templates was not detected in the absence of activator.
Similar levels of specific transcripts of indistinguishable
sizes were obtained with both constructs in reactions containing NtrCD55E,S161F (Fig. 2B), indicating that the PatzR
promoter can be similarly activated by NtrC regardless of
the presence of upstream sequences. These results are
consistent with our in vivo observations and indicate that
sequences between -29 and +25 are sufficient for PatzR
Fig. 2. Analysis of PatzR activation in vitro.
A. Multiround in vitro transcription from the
wild-type (PatzR-wt) promoter region in
the presence of 0, 1.25, 2.5 and 5 mM
NtrCD55E,S161F.
B and C. Multiround in vitro transcription from
the wild-type (PatzR-wt) and minimal
(PatzR-Dmin) PatzR promoter regions in the
presence of 2.5 mM NtrCD55E,S161F(B) or 5 mM
C-DmpR-His (C). Top: Images of the scanned
gels. Bottom: The average of the values
obtained with PatzR-wt in the presence of
NtrCD55E,S161F was set as 1. Transcript levels
are expressed relative to this value. Bars
represent the average and standard deviation
of four independent measurements.

2009 The Authors

Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 419433

Complex regulation of a sN-dependent promoter 423

activation in vitro. As an additional control, similar reactions were performed using histidine-tagged C-DmpR
(C-DmpR-His) as the activator (Fig. 2C). C-DmpR-His
is a truncated variant of the DmpR activator for the
sN-Po promoter of the P. putida CF600 phenol utilization
pathway (Shingler, 2003). C-DmpR-His lacks its cognate
N-terminal regulatory domain and C-terminal DNAbinding domain, and is consequently constitutively active
but can only activate transcription from solution. As shown
above with NtrCD55E,S161F, transcription was strictly dependent on the addition of C-DmpR-His, and similar transcription levels were obtained from the PatzR-wt or PatzRDmin templates, indicating that efficient activation of
PatzR may be achieved in the absence of DNA binding.
Taken together, our in vivo and in vitro results are fully
consistent with the notion that the atzR promoter region
does not contain any sequence determinants for specific
NtrC binding. However, although activation by C-DmpRHis occurs necessarily from solution, it would be premature to conclude that NtrC can also activate transcription
without the aid of DNA binding (as opposed to activation
from weak or non-specific sites). Thus, the similar activation levels obtained with both proteins may be the result
of two different mechanisms, which may be explained on
the basis of differences in affinity for the closed complex,
oligomerization rate, ATPase activity or other properties.
AtzR represses PatzR transcription in vitro
AtzR represses atzR transcription in vivo upon binding to
a site that overlaps PatzR (Porra et al., 2007). In order to
test AtzR autorepression in vitro, multiround transcription
reactions were performed in the presence of histidinetagged AtzR (AtzR-His6). In these assays, increasing
concentrations of AtzR-His6 were incubated with set
concentrations of E-sN, ATP and the PatzR-wt template plasmid pMPO156. NtrCD55E,S161F was subsequently
added to the reactions to allow open complex formation
prior to the addition of NTPs (see Experimental procedures for details). A clear AtzR-His6 concentrationdependent decrease of PatzR activity was observed,
indicating that AtzR efficiently represses PatzR transcription in vitro (Fig. 3A and C). The AtzR-His6 concentration
required for 50% repression was around 20 nM, which is
in the range of the observed Kd of AtzR-His6 for its binding
site at the atzRatzDE promoter region (34 nM) (Porra
et al., 2007).
Previous work has shown that deletion of sequences
upstream from -50, which eliminates most of the proposed ABS region, provokes a threefold increase in the
apparent dissociation constant (Kd) of AtzR for the PatzR
promoter region. AtzR failed to repress a PatzRlacZ
fusion bearing this deletion in vivo. However, this effect
was suppressed when the intracellular concentration of

Fig. 3. Analysis of AtzR autorepression in vitro. Multiround in vitro

transcription from the wild-type promoter (PatzR-wt, A and C) and
the ABS-deleted variant (PatzR-DABS, B and C) in the presence
of 5 mM NtrC and 0240 nM AtzR-His6.
A and B. Images of the scanned gels.
C. Average values of the transcript levels from at least three
independent experiments plotted against the concentration of AtzR.
The values obtained in the absence of AtzR were set as 100%.
Transcript levels are expressed relative to this value. Error bars
represent standard deviation.

AtzR was artificially increased, suggesting that the repression defect of the deleted promoter region is a consequence of decreased binding affinity for AtzR (Porra
et al., 2007). To test this hypothesis directly, multiround
in vitro transcription was also performed on template
plasmid pMPO161 (designated PatzR-DABS), which
lacks all sequences upstream from -50 (see Fig. 1).
AtzR-His6 concentration-dependent repression was also
observed with the PatzR-DABS template, but a three- to
fourfold higher AtzR-His6 concentration than with the
wild-type template was required to achieve 50% repression levels (Fig. 3B and C). The extent of this increase
in repressor concentration is similar to, and apparently
compensates, the decrease in binding affinity of AtzR for
the mutant promoter (Porra et al., 2007). Taken together,
our previous and current results strongly support the
notion that the ABS has a role in repression that correlates
with its contribution to the overall affinity of AtzR for the
atzRatzDE promoter region.

2009 The Authors

Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 419433

424 O. Porra et al.

Isomerization to the open complex prevents AtzR

repression
The in vitro transcription experiments above indicate
that AtzR can efficiently repress the PatzR promoter
in vitro. To explore the mechanism of repression further,
we wondered whether AtzR might be able to exert a
similar repressing effect on preformed E-sNPatzR open
complexes. To test this possibility, additional in vitro transcription experiments were performed in which the order
of addition of the regulatory proteins was inverted. Reactions were set up in which NtrCD55E,S161F was pre-incubated
with E-sN, ATP and the PatzR-wt template plasmid
(i.e. conditions that allow open complex formation)
(Johansson et al., 2008) prior to a challenge with increasing concentrations of AtzR. In parallel, reactions were also
set up as in Fig. 3, with increasing concentrations of AtzR
pre-incubated with E-sN, ATP and the PatzR-wt template
plasmid (i.e. closed complex formation conditions), prior
to subsequent addition of NtrCD55E,S161F to allow open
complex formation. The results (Fig. 4A) clearly show that
the AtzR concentration-dependent inhibition of transcript
formation was severely curtailed when NtrCD55E,S161F was
added to the reactions prior to AtzR, suggesting that open
complex formation prevents AtzR-dependent repression.
An alternative interpretation of the data above is also
possible, namely that the presence of NtrC may suffice
to render the promoter insensitive to repression due to
interactions with E-sN or DNA, regardless of its ability to
promote isomerization to the open complex. To distinguish

between these two possibilities two additional sets of

in vitro transcription reactions were performed. In the first
set, E-sN was pre-incubated with the PatzR-wt template
and NtrCD55E,S161F. ATP was then added, thus allowing
open complex formation, and the complex was subsequently challenged with increasing AtzR-His6 concentrations prior to the addition of NTPs. In the second set, the
ATP addition step was omitted, thus preventing isomerization to an open complex. The closed complex was
challenged with AtzR-His6, and then ATP was added to
allow isomerization prior to the addition of NTPs (Fig. 4B).
Challenging a preformed E-sNPatzR closed complex
resulted in a clear AtzR-His6 concentration-dependent
decrease in transcript production from the PatzR
promoter. The magnitude of the repression effect was
similar to that observed in the experiments in which AtzR
was present from the beginning, indicating that AtzR can
prevent transcription from the PatzR promoter regardless
of the prior binding of E-sN (Fig. 4A and B). However,
repression was not observed when open complexes were
formed before addition of AtzR. These results confirm that
isomerization to an open complex protects PatzR from
AtzR-dependent repression. Because NtrC was present
in the initial mix in both sets of reactions, the protective
effect is likely a consequence of the isomerization
process, rather than the mere presence of the activator.
Our results are consistent with a repression model in
which AtzR acts on the early steps of the initiation
pathway to prevent either closed complex formation or
isomerization to the open complex.

Fig. 4. Analysis of the influence of open

complex formation on AtzR autorepression
in vitro. Multiround in vitro transcription of the
PatzR-wt template in the presence of 5 mM
NtrC and 0240 nM AtzR-His6. Isomerization
to open complexes was triggered by the
addition of NtrC to templates pre-incubated
with E-sN and ATP (A) or by the addition of
ATP to templates pre-incubated with E-sN and
NtrC (B). Open complexes were formed
before (top) or after (centre) the addition of
AtzR. Average values of the transcript levels
from three independent experiments plotted
against the concentration of AtzR (bottom).
The values obtained in the absence of AtzR
were set as 100%. Transcript levels are
expressed relative to this value. Error bars
represent standard deviation.

2009 The Authors

Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 419433

Complex regulation of a sN-dependent promoter 425

AtzR competes with E-sN for overlapping binding sites

We have shown above that PatzR repression occurs
during the initial steps of transcription initiation prior to the
isomerization step. Overlapping of the AtzR binding site
and the -24 element of the promoter and the fact that the
magnitude of repression correlates with binding affinity of
AtzR for its site strongly suggest that repression may
occur by direct competition between AtzR and E-sN for
DNA binding. To test this hypothesis further, gel mobility
shift analysis was performed with purified AtzR-His6 and
P. putida E-sN using the wild-type PatzR promoter region
as a probe. To promote DNA binding by both proteins,
buffer conditions were similar to those used for in vitro
transcription. The results are depicted in Fig. 5.
As previously shown (Porra et al., 2007), addition of
AtzR-His6 to the PatzR promoter region probe resulted
in the appearance of a retarded band, indicative of AtzR
binding (Fig. 5A). In addition, a second, lower mobility
band was observed at higher AtzR-His6 concentrations.
This is likely due to the change in binding buffer, as this
AtzR-His6 preparation yielded a single complex in our
routinely used buffer (Porra et al., 2007). E-sN retarded
the PatzR promoter probe to produce a single very slowly
migrating band, consistent with the high molecular weight
of the RNA polymerase holoenzyme. Yet, smearing of
the radiolabel signal along the lane suggests that the
E-sNPatzR closed complex may not be very stable in our
electrophoretic conditions (Fig. 5B). Remarkably, addition
of AtzR-His6 to a preformed E-sNPatzR closed complex

Fig. 5. Gel mobility shift assay of E-sN and AtzR at the atzR
promoter region. E-sN concentration, when present, was 150 nM
(lanes 69) and AtzR-His6 concentrations were 0 (lanes 1, 5 and
6), 40 (lanes 2 and 7), 80 (lanes 3 and 8) and 160 nM (lanes 4
and 9). Closed arrowheads denote the AtzRDNA complexes.
An open arrowhead denotes the E-sNDNA complex.

Fig. 6. DNase I footprint of E-sN and AtzR at the atzR promoter

region. E-sN concentration, when present, was 220 nM (lanes 25)
and AtzR-His6 concentrations were 0 (lanes 1 and 2), 100 (lane 3),
200 (lane 4) and 400 nM (lanes 5 and 6). The RBS and the ABS
are represented by open boxes and a hatched box respectively.
The -24 and -12 elements of PatzR are shown by closed boxes.
Co-ordinates indicated are relative to the atzR transcriptional start.
E-sN- and AtzR-protected regions are represented by a black and a
grey bar respectively. Stars denote hypersensitive positions due to
E-sN and asterisks denote hypersensitive positions due to AtzR.

resulted in the gradual substitution of the E-sN-containing

retarded band by the faster-migrating AtzRPatzR
complexes. A supershifted lower mobility band consistent with a ternary AtzRE-sNPatzR complex was not
observed, strongly suggesting that AtzR and E-sN binding
to the PatzR promoter region are mutually exclusive.
Since E-sN binding to the PatzR promoter region
appears to be unstable in the gel mobility shift assays
above, we sought to obtain further support for this model
using independent experimental evidence. To achieve this
goal, DNase I footprinting was performed with AtzR-His6
and E-sN using the top strand-labelled PatzR promoter
region as a probe (Fig. 6). AtzR-His6 continuously protected a 27 bp region encompassing the RBS and
spanning positions -41 to -14 relative to the atzR transcriptional start site. Additional discontinuous protection

2009 The Authors

Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 419433

426 O. Porra et al.

was observed in the ABS region between positions -71

and -42, and two sets of hypersensitive bands, indicative
of DNA bending, occurred around positions -54 and -44.
Despite the fact that AtzR forms two complexes in gel shift
assays in these conditions (Fig. 5), the footprinting pattern
was identical to that observed in the original binding buffer
(Porra et al., 2007). On the other hand, E-sN protected a
continuous region spanning positions -40 to -2, with
hypersensitive bands at positions -42, -41, -35 and -33.
Addition of increasing amounts of AtzR-His6 to a binding
reaction containing PatzR-bound E-sN resulted in the
gradual substitution of the E-sN polymerase footprint with
that of AtzR. This result strongly suggests that AtzR competes with E-sN for binding to the PatzR promoter region.
Inversion of the order of addition of AtzR-His6 and E-sN
resulted in a mirror image of the previous result: the footprinting pattern of AtzR was gradually substituted by that
of E-sN (data not shown), suggesting that both proteins
undergo fast exchange at the PatzR promoter to reach
an equilibrium that is a function of their concentrations
in the binding reaction. Taken together, our results support
a model in which AtzR represses the PatzR promoter
by diminishing promoter occupancy by E-sN via competition for a binding site that overlaps the sN recognition
element.

Discussion
The conserved mechanism of sN-dependent promoter
activation represents a well-established paradigm in
bacterial gene expression (Kustu et al., 1989; Buck et al.,
2000; Wigneshweraraj et al., 2008). While all sNdependent promoters are subjected to positive regulation,
a few of them are also targets for negative control that
invariably operates by tampering with the activation
mechanism (Rojo, 1999; 2001). In the present work, we
present evidence that positive and negative regulation of
the sN-dependent promoter PatzR occur by mechanisms
that represent a major departure from the established
models, but have probably co-evolved to optimize regulatory efficiency.
Our results show that P. putida NtrC does not require
any specific sequences other than the E-sN recognition
motif to stimulate transcription from the atzR promoter
in vivo, from a plasmid or inserted in the P. putida chromosome, or in vitro (Table 1, Fig. 2, Fig. S1). UAS elements have been shown to contribute to activation via two
different mechanisms: tethering the EBP to increase its
local concentration in the vicinity of the regulated promoter (Buck and Cannon, 1989; Wedel et al., 1990), and
promoting oligomerization that is required for ATPase
activity (Wyman et al., 1997; Porter et al., 1993).
However, it has long been known that DNA binding of
EBPs is not a strict requirement for transcriptional activa-

tion (Reitzer and Magasanik, 1986; Ninfa et al., 1987),

Several EBP derivatives lacking their DNA binding determinants have been shown to activate transcription in vivo
and in vitro, albeit higher protein concentrations in vitro
and overproduction in vivo were usually required (Huala
and Ausubel, 1989; Huala et al., 1992; Berger et al., 1994;
1995; Xu et al., 2004). A few examples of other naturally
occurring sN-dependent promoters lacking a functional
UAS have been documented (Schmitz et al., 1988; Wu
et al., 1999; Martnez et al., 2004; Burtnick et al., 2007).
Whether these promoters are activated by their EBPs
from solution or bound to low-affinity binding sites that
may occur elsewhere in the DNA molecules used has
not been resolved. However, the recent findings that
Helicobacter pylori FlgR (Brahmachary et al., 2004) and
Rhodobacter sphaeroides FleT (Poggio et al., 2005)
activate sN-dependent transcription in vivo despite the
fact that they lack the conserved C-terminal DNA-binding
domain reinforce the notion that certain sN-dependent
promoters can be activated by EBPs in solution under
physiological conditions. A number of sequences encoding putative EBPs that lack a DNA-binding domain have
been found in several bacterial genomes (Beck et al.,
2007; Brahmachary et al., 2004) including that of P. putida
KT2440 (Cases et al., 2003) suggesting that this may not
be such an unusual phenomenon.
Upstream activation sequence-independent activation
is fostered by high occupancy of the promoter by E-sN
(Buck and Cannon, 1989; Morett and Buck, 1989;
Hoover et al., 1990). PatzR appears to be a strong
sN-dependent promoter, as evidenced by its strong similarity to the consensus E-sN recognition motif (CGGCACN5-TTGCT versus TGGCAC-N5-TTGCA). High similarity
to the consensus, with strict conservation of the central
GGCAC-N5-TTGA core of the sN-dependent promoter
consensus, has been shown at the UAS-independent
Rhizobium leguminosarum hupF P3 (Martnez et al.,
2004), Klebsiella oxytoca nasR (Wu et al., 1999) and
Borrelia burgdoferi rpoS (Burtnick et al., 2007) promoters. In addition, the fact that closed complex formation is
readily detected by DNase I footprinting assays also supports the notion that PatzR is a strong E-sN binding site
(Fig. 5). Similarity to the consensus and production of a
detectable DNase I footprint have been shown to correlate with high E-sN occupancy and increased UASindependent activation (Morett and Buck, 1988; 1989;
Hoover et al., 1990).
A recent paper (Bernardo et al., 2009) has shown
that P. putida E-sN has a higher affinity for sN-dependent
promoters than its E. coli counterpart, resulting in more
robust transcriptional activation in vivo and in vitro. As
discussed above, this trait is predicted to favour UASindependent activation in P. putida. Two sets of observations suggest that this may indeed be the case. First, we

2009 The Authors

Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 419433

Complex regulation of a sN-dependent promoter 427

have observed that the PatzR promoter fails to respond to

nitrogen limitation in E. coli. However, it is activated normally in a P. putida strain in which the E. coli ntrC coding
sequence is precisely inserted in the chromosome in lieu
of its P. putida counterpart, thus indicating that E. coli NtrC
is not inherently defective for activation at this promoter
(V. Garca-Gonzlez and F. Govantes, unpubl. results).
Second, deletion analyses performed in our laboratory
on several P. putida NtrC- and sN-dependent promoters
showed substantial levels of activation after removal of
the cognate enhancer-like elements (A.B. Hervs, I.
Canosa, A.I. Platero and F. Govantes, unpubl. results).
Since a high concentration of the activator has also been
shown to contribute to UAS-independent activation (Ninfa
et al., 1987; Popham et al., 1989; Schneider et al., 1991;
Molina-Lopez and Santero, 1999; Brahmachary et al.,
2004), the above results are also compatible with unusually high NtrC levels in P. putida. However, our attempts to
obtain a rigorous estimation of the intracellular NtrC concentration in P. putida have been so far unsuccessful. The
contribution of E-sN and NtrC to the apparently high rate of
UAS-independent activation in P. putida NtrC-dependent
promoters will be pursued further in the future.
The main drawback of UAS-independent activation is
the loss of promoter specificity (Beck et al., 2007). Since
NtrC supports UAS-independent activation of PatzR, it
may similarly activate other sN-dependent P. putida promoters in a UAS-independent fashion. However, as high
occupancy of the promoter by E-sN is required for efficient
activation from solution, a weaker promoter, in combination with strong binding sites for a specific activator and/or
dependence on IHF, could ensure the fidelity of activation
(Buck and Cannon, 1989; Morett and Buck, 1989; Hoover
et al., 1990). Conversely, another negative consequence
of the mechanism of PatzR activation could be the crossactivation by other EBPs. Our in vitro transcription experiments have demonstrated that the isolated central
domain of DmpR can activate the PatzR promoter in vitro
(Fig. 2). In addition, we have observed that PatzR can
be activated in vivo by NifA and XylR when these EBPs
are expressed at high levels from plasmids in E. coli
(V. Garca-Gonzlez and F. Govantes, unpubl. results).
Notwithstanding the artificial nature of the conditions in
these experiments, we consider it plausible that promiscuous activation of PatzR in response to non-cognate
physiological cues may occur. In this regard, the fact
that nitrogen limitation also modulates AtzR activity in
activation of the atzDEF promoter (Garca-Gonzlez
et al., 2005) may be envisioned as a safety mechanism to
prevent unwanted synthesis of the cyanuric acid degradative enzymes should sufficient AtzR be produced under
nitrogen-sufficient conditions (also see below).
Like most members of the LysR family (Schell, 1993;
Tropel and van der Meer, 2004), AtzR represses its

own synthesis (Garca-Gonzlez et al., 2005). Our results

show that repression of the PatzR promoter takes place
prior to the formation of the open complex (Fig. 4) and that
AtzR and E-sN binding to the atzR promoter region are
mutually exclusive (Fig. 5). Accordingly, we propose that
AtzR prevents open complex formation by competition
with E-sN for binding to their overlapping recognition
elements. Although a mechanism of repression based on
competition with RNA polymerase for DNA binding has
been largely suggested for other LTTRs (Ostrowski and
Kredich, 1991; Schell, 1993; Kovacikova and Skorupski,
2001), this is the first time experimental evidence supporting this hypothesis has been provided. In addition, our
previous and present results indicate that integrity of the
ABS is critical for efficient autorepression. The defect in
repression provoked by a deletion of most of the ABS is
suppressed by increasing AtzR concentration both in vivo
(Porra et al., 2007) and in vitro (Fig. 3), indicating that
the role of the ABS in repression is a consequence of its
contribution to the affinity of AtzR for its binding site. The
observed correlation between the magnitude of repression and the affinity of the regulator for its binding site is
an expected outcome of the mechanism of autorepression, given the fact that AtzR is present in the cell at a very
low concentration when produced from its own feedbackregulated promoter (Porra et al., 2007). A similar contribution of the ABS to the binding affinity has also been
observed in the case of CatR binding site at catRcatBC
promoter region in P. putida (Parsek et al., 1992) and the
IlvY binding site at ilvYilvC promoter region in E. coli
(Wek and Hatfield, 1988). A role for the ABS in autorepression has been demonstrated for E. coli OxyR and
Bacillus subtilis GltC (Toledano et al., 1994; Belitsky et al.,
1995), albeit in both cases the ABS actually overlaps the
-35 box of the repressed promoters, a situation that does
not occur with PatzR.
The PatzR promoter is unusual in that it is a
sN-dependent promoter subjected to negative control.
Only a few examples of negatively regulated sNdependent promoters have been reported thus far and, in
all cases, repression has been proposed to occur via an
anti-activation mechanism (i.e. by interfering with the activation process). At the dctA promoter, the cAMP receptor
protein (CRP) from E. coli appears to interact with E-sN
to lock the closed complex in a conformation that is less
susceptible to activation by DctD (Wang et al., 1998). An
alternative model in which DNA bending by the repressor
hinders productive interactions between the UAS-bound
EBP and the E-sN has been proposed for repression
of E. coli glnAp2 by CRP (Mao et al., 2007), downregulation of the B. subtilis levanase operon by CcpA
(Martin-Verstraete et al., 1995) and autorepression by
the Klebsiella aerogenes LTTR Nac (Feng et al., 1995).
In contrast, AtzR prevents transcription from PatzR by

2009 The Authors

Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 419433

428 O. Porra et al.

competing with E-sN for DNA binding. This is the first time
that a repressor affecting the capability of E-sN to bind
its recognition sequences has been described for a
sN-dependent promoter. This unusual strategy may be a
consequence of the fact that NtrC does not bind specifically to any sequences within the atzR promoter region. In
this scenario, other possible mechanisms based on interference with DNA binding of the activator or DNA looping
would not be suitable. However, because high occupancy
of the promoter by the RNA polymerase is critical for
activation from solution, competing with E-sN for DNA
binding appears to be a viable and appropriate mechanism to efficiently repress transcription.
Autorepression of LTTRs is proposed to be a mechanism to avert wasteful expenditure of energy by keeping
synthesis of the regulatory proteins at a low rate (Schell,
1993). Indeed, we have previously shown that even when
induced under nitrogen limitation conditions, AtzR is produced in vivo in limiting amounts that are still sufficient
for physiological regulation of the cyanuric acid degradative operon atzDEF (Garca-Gonzlez et al., 2005; Porra
et al., 2007). Similarly. the decrease in PatzR promoter
occupancy by E-sN caused by competition with AtzR may
also minimize the amount of AtzR synthesized by crossactivation by other EBPs present in the cell. Thus, nitrogen regulation of AtzR activity and autorepression may be
means to compensate for the potential non-specific activation of the cyanuric acid utilization pathway ensued by
cross-activation of PatzR by other EBPs.

Experimental procedures
Bacterial strains and growth conditions
Bacterial strains used in this work and their relevant
genotypes are summarized in Table 2. Minimal medium
containing 25 mM sodium succinate as the sole carbon
source was used for in vivo gene expression analysis
(Mandelbaum et al., 1993). Nitrogen sources were ammonium
chloride or L-serine (1 g l-1). LuriaBertani (LB) medium
was used as rich medium (Sambrook et al., 2000). Liquid
cultures were grown in culture tubes or flasks with shaking (180200 r.p.m.) at 30C or 37C (for P. putida or
E. coli strains respectively). For solid media, Bacto-Agar
(Difco, Detroit, Michigan) was added to a final concentration of 18 g l-1. Antibiotics and other additions were used,
when required, at the following concentrations: ampicillin
(100 mg l-1), kanamycin (20 mg l-1), carbenicillin (500 mg l-1),
rifampicin (10 mg l-1), chloramphenicol (15 mg l-1) and
(X-gal)
5-bromo-4-chloro-3-indoyl-b-D-galactopyranoside
(25 mg l-1). All reagents were purchased from Sigma-Aldrich.

Plasmid and strain construction

Plasmids and oligonucleotides used in this work are summarized in Table 2. All DNA manipulations were performed
according to standard procedures (Sambrook et al., 2000).

Plasmid DNA was transferred to E. coli and P. putida strains

by transformation (Inoue et al., 1990) or by triparental mating
(Espinosa-Urgel et al., 2000). E. coli DH5a was used as a
host in all cloning procedures.
The broad-host-range lacZ transcriptional fusion vector
pMPO234 was constructed by cloning a BamHISacI fragment from pRS415 containing the lacZ transcriptional fusion
junction and the 5 end of lacZ into BamHI- and SacI-digested
pMPO200. To obtain the atzRlacZ transcriptional fusion
plasmid pMPO232, pMPO104 was cleaved with EcoRI and
BamHI and the resulting ~0.4 kb fragment containing the
complete atzRatzDE promoter region was then ligated into
EcoRI- and BamHI-treated pMPO234. The deleted derivative
pMPO237 was constructed using the overlapping oligonucleotides PatzR-EcoRI and PatzR-BglII. Primers were mixed
and allowed to anneal by heating for 5 min at 85C and then
cooling down slowly to room temperature. The resulting
duplex, which harbours overhanging ends compatible with
EcoRI and BamHI, was cloned into EcoRI- and BamHIdigested pMPO234.
Plasmids pMPO166 and pMPO167 harbouring atzRlacZ
fusions ready to integrate in the P. putida chromosome were
constructed by excising an EcoRISalI fragment containing
the atzRlacZ fusion from pMPO232 or pMPO237, respectively, and cloning into NotI-linearized pBK-miniTn7-WGm
(Koch et al., 2001). Orientation of lacZ transcription towards
the Tn7R end was tested by PCR. Integration of the fusions
in pMPO166 and pMPO167 at the Tn7 insertion site in
P. putida KT2442 and MPO201 was performed by electroporation of each plasmid, along with the Tn7 helper plasmid
pUX-BF13 in the desired strains, essentially as described
(Koch et al., 2001). Correct integration was tested by PCR
using primers Tn7-GlmS and Tn7R109.
The in vitro transcription template plasmid pMPO156
harbouring PatzR was constructed by PCR amplification
of the atzRatzDE promoter region with primers atzR-EBam
and atzR-BEco using pMPO104 as a template. The PCR
product was cleaved with EcoRI and BamHI and ligated into
pTE103 digested with the same enzymes. The deleted
derivatives pMPO161 and pMPO162 were constructed
similarly: PCR was performed using primers del-ABS and
atzR-BEco, with plasmids pMPO121 or pMPO122, respectively, as templates. The EcoRIBamHI fragments of the
PCR products were then cloned into EcoRI- and BamHIcleaved pTE103.

b-Galactosidase assays
Steady-state b-galactosidase assays were used to examine
the expression of atzRlacZ fusions in P. putida KT2442 and
MPO201. Pre-inocula of bacterial strains harbouring the relevant plasmids were grown to saturation in minimal medium
under nitrogen-sufficient conditions (ammonium chloride,
1 g l-1) and cells were then diluted in minimal medium containing the appropriate nitrogen sources (1 g l-1 ammonium
chloride for nitrogen excess, 1 g l-1 L-serine for nitrogen
limitation). Diluted cultures were shaken for 1624 h to midexponential phase (OD600 = 0.250.5). Growth was then
stopped and b-galactosidase activity was determined from
SDS- and chloroform-permeabilized cells as previously
described (Miller, 1992).

2009 The Authors

Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 419433

Complex regulation of a sN-dependent promoter 429

Table 2. Bacterial strains, plasmids and oligonucleotides used in this work.

Bacterial strains
E. coli DH5a
E. coli NCM631
P. putida KT2442
P. putida MPO201
Plasmids
pBK-miniTn7-WGm
pIZ227
pMPO104
pMPO121
pMPO122
pMPO135
pMPO156
pMPO161
pMPO162
pMPO166
pMPO167
pMPO200
pMPO202
pMPO232
pMPO234
pMPO237
pRK2013
pRS415
pTE103
pUX-BF13
pVI903
pVI645
Oligonucleotides
atzR-BEco
atzR-EBam
del-ABS
FP-SalI
oligo-UP
PatzR-BglII
PatzR-EcoRI
Seq-ClaI
Tn7-GlmS
Tn7R109

Phenotype/genotype

Reference/source

f80dlacZDM15 D(lacZYA-argF)U169 recA1 endA1 hsdR17 (rk- mk+) supE44 thi-1

gyrA relA1
hsdS gal lDE3:lacI lacUV5:gen1(T7 RNA polymerase) Dlac linked to Tn10
mt-2 hsdR1 (r - m+) Rifr
mt-2 hsdR1 (r - m+) Rifr DntrC::Tcr

Hanahan (1983)

Delivery plasmid for Tn7 transposase-dependent chromosomal insertion. Gmr

pACYC184 containing lacI q and the T7 lysozyme gene. Cmr
atzRlacZ translational fusion in pMPO200 carrying the sequence between positions
-250 and +139. Apr
atzRlacZ translational fusion in pMPO200 carrying the sequence between positions
-50 and +139. Apr
atzRlacZ translational fusion in pMPO200 carrying the sequence between positions
-29 and +139. Apr
pET23b plasmid derivative overexpressing AtzR-His6. Apr
pTE103 harbouring atzR promoter sequences between positions -239 and +25. Apr
pTE103 harbouring atzR promoter sequences between positions -29 and +25. Apr
pTE103 harbouring atzR promoter sequences between positions -50 and +25. Apr
atzRlacZ transcriptional fusion in pBK-miniTn7-WGm carrying the sequence between
positions -250 and +139 between the Tn7 ends. Gmr Apr
atzRlacZ transcriptional fusion in pBK-miniTn7-WGm carrying the sequence between
positions -27 and +1 between the Tn7 ends. Gmr Apr
Broad-host-range lacZ translational fusion vector, based on pBBR1MCS-4. Apr
atzDlacZ translational fusion in pMPO200 bearing the sequence between positions
-475 and +152. Apr
atzRlacZ transcriptional fusion in pMPO234 carrying the sequence between positions
-250 and +139. Apr
Broad-host-range lacZ transcriptional fusion vector, based on pMPO200. Apr
atzRlacZ transcriptional fusion in pMPO234 carrying the sequence between positions
-27 and +1. Apr
Helper plasmid in conjugation. Kmr Tra+
lacZ transcriptional fusion vector, based on pBR322. Apr
Vector for in vitro transcription assays. Apr
Helper plasmid providing the Tn7 transposase proteins for chromosomal insertion. Apr
cIts/lPL-rpoN expression plasmid for purification of P. putida KT2440 sN
PT7-C-dmpR-His expression plasmid for purification of C-DmpR-His

Govantes et al. (1996)

Franklin et al. (1981)
Garca-Gonzlez et al. (2005)
Koch et al. (2001)
Govantes et al. (1996)
Garca-Gonzlez et al. (2005)
Porra et al. (2007)
Porra et al. (2007)
Porra et al. (2007)
This work
This work
This work
This work
This work
Garca-Gonzlez et al. (2005)
Garca-Gonzlez et al. (2005)
This work
This work
This work
Figurski and Helinski (1979)
Simons et al. (1987)
Elliott and Geiduschek (1984)
Bao et al. (1991)
Johansson et al. (2008)
Johansson et al. (2008)

Sequence (5 to 3)
AGAGATGGATCCTATCGCTGACG
GATCCGAATTCCTGTGGCAAGG
TATCAGGGTTATTGTCTCAT
TCGACCAAGGCGATTAAGTTGGGTA
GTATTCCAGATCCTGGACGC
GATCTCATGCGAGTCAAAGCAAGATCGGTGCCG
ATTCGGCACCGATCTTGCTTTGACTCGCATGA
CGATGTAATGAAGAAAGCGT
AATCTGGCCAAGTCGGTGAC
CAGCATAACTGGACTGATTTCAG

Co-ordinates indicated in plasmid descriptions are relative to the atzR transcriptional start. Oligonucleotide positions altered from the original
sequences are underlined.

Protein purification
AtzR-His6 was purified from the overproducing strain
NCM631 harbouring pMPO135 and pIZ227 by nickel affinity
chromatography as previously described (Porra et al.,
2007). NtrCD55E,S161F, purified by a salting-out procedure using
ammonium sulphate as the precipitating agent, was a kind
gift of A.B. Hervs (A.B. Hervs et al., submitted). Native
P. putida core RNA polymerase, sN, and C-DmpR-His were
gifts from member of V. Shinglers laboratory and were purified by previously established protocols (Johansson et al.,
2008). In brief, P. putida KT2440 core RNA polymerase

was purified from cellular extracts by sequential Polymin P

precipitation, DNA agarose chromatography and Mono Q
ion exchange chromatography as described for E. coli core
RNA polymerase (Hager et al., 1990). Native P. putida sN was
overproduced in an E. coli rpoN mutant strain from the cIts/
lPL promoter of pVI903 and subsequently purified by the
procedure of Cannon et al. (1996). The C-DmpR-His fusion
protein, consisting of a methionine residue followed by residues L219 to G496 of DmpR fused to the peptide SHHHHHH,
was expressed from the PT7 promoter of pVI645 and purified
by nickel affinity chromatography as previously described for
other His-tagged DmpR derivatives (Wikstrom et al., 2001).

2009 The Authors

Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 419433

430 O. Porra et al.

In vitro transcription
Multiround in vitro transcription reactions were performed in
a final volume of 20 ml containing 35 mM Tris-acetate, pH 7.9;
70 mM potassium acetate; 20 mM ammonium acetate; 5 mM
magnesium acetate; 1 mM DTT; 10% glycerol; 250 mg l-1
BSA; 20 nM E-sN and 0.5 mg of supercoiled plasmid template
containing PatzR. Open complex formation was stimulated
by the addition of NtrCD55E,S161F or C-DmpR-His and 4 mM ATP
and incubation for 1020 min at 30C. In repression experiments, AtzR (0240 nM) was added either before or after the
formation of open complex and subsequently incubated with
the reaction mixture for the same time as NtrCD55E,S161F. After
incubation, a mixture of ATP, GTP, CTP (final concentration
0.4 mM each), UTP (0.07 mM) and [a-32P]-UTP (0.33 mM,
Amersham) was added to initiate multiround in vitro
transcription. Re-initiation was prevented after 5 min by the
addition of heparin (0.1 mg ml-1 final concentration), and
5 min later the reactions were terminated by adding 5 ml of
stop/loading buffer (150 mM EDTA, 1.05 M NaCl, 14 M urea,
3% glycerol, 0.075% xylene cyanol and 0.075% bromophenol
blue). Samples were run on a 5% polyacrilamide-urea denaturing gel in Tris-borate-EDTA buffer at room temperature.
Transcripts were visualized with a Typhoon 9410 scanner
and analysed using the ImageQuant software (Amersham).

70 mM potassium acetate; 20 mM ammonium acetate; 2 mM

magnesium acetate; 1 mM calcium chloride; 1 mM DTT; 10%
glycerol; 100 mg ml-1 salmon sperm DNA; 250 mg ml-1 BSA),
containing 20 ng of the radiolabelled probe and 3 ml (220 nM
final concentration) of E-sN in a reaction volume of 10 ml. After
10 min incubation at room temperature, 0400 nM AtzR
was added, the mixture was incubated for an additional
10 min and partial digestion of the DNA was initiated by the
addition of 1 ml of an empirically determined dilution (typically
10-2 to 10-3) of a DNase I stock solution (10 U ml-1, Roche
Diagnostics). Incubation was continued for 30 additional
seconds and reactions were stopped by the addition of 5 ml
of stop buffer (1.5 M sodium acetate, pH 5.2; 130 mM EDTA;
1 mg ml-1 salmon sperm DNA; 2.4 mg ml-1 glycogen). DNA
was subsequently ethanol precipitated, re-suspended in 5 ml
of loading buffer (0.125% bromophenol blue, 0.125% xylene
cyanol, 20 mM EDTA, 95% formamide) and separated by
gel electrophoresis on a 6% polyacrylamide-6 M urea denaturing sequencing gel. A sequencing reaction was performed
with the Sequenase 2.0 kit (USB) using primer Seq-ClaI and
was run in parallel as a size marker. Gels were processed
and analysed as described above for in vitro transcription
assays.

Acknowledgements
Gel mobility shift assays
Probes for gel mobility shift assays were obtained by PCR
amplification using pMPO202 as the template and primers
pair oligo-UP and FP-SalI. The PCR products were subsequently digested with ClaI and gel purified. DNA fragments
were strand-specifically labelled by filling in 5 overhanging
ends using the Klenow fragment in a reaction mixture
containing [a-32P]-dCTP. Unincorporated nucleotides were
removed using the MSB Spin PCRapace kit (Invitek).
Binding reactions were performed in binding buffer
(35 mM Tris-acetate, pH 7.9; 70 mM potassium acetate;
20 mM ammonium acetate; 2 mM magnesium acetate; 1 mM
calcium chloride; 1 mM DTT; 10% glycerol; 100 mg ml-1
salmon sperm DNA; 250 mg ml-1 BSA), containing 20 ng of
the radiolabelled probe and 3 ml (150 nM final concentration)
of E-sN, or an equivalent volume of dilution buffer (10 mM
Tris-HCl; 100 mM NaCl; 0.1 mM EDTA; 0.1 mM DTT; 50%
glycerol), in a reaction volume of 18 ml. After 10 min incubation at room temperature, 2 ml (0160 nM final concentration)
of AtzR was added and the mixture was incubated for
an additional 10 min. Reactions were stopped with 4 ml of
loading buffer [0.125% w/v bromophenol blue, 0.125% w/v
xylene cyanol, 10 mM Tris HCl (pH 8), 1 mM EDTA, 30%
glycerol] and samples were separated on a 5% polyacrylamide native gel in Tris-borate-EDTA buffer at 4C. Gels were
dried in a dryer DrygelSr SE1160 (Hoeffer) and analysed as
described above.

DNase I footprinting
Probes for DNase I footprinting were obtained as shown
above for gel mobility shift assays. Binding reactions were
performed in binding buffer (35 mM Tris acetate, pH 7.9;

We thank Ana B. Hervs (CABD, Universidad Pablo de

Olavide), Linda U.M. Johansson, Lisandro M.D. Bernardo
and Eleonore Skrfstad (Ume University) for purified
proteins; Sydney Kustu (University of California, Berkeley)
for critical reading of the manuscript; Guadalupe Martn
and Nuria Prez for technical help; and all members of
the Santero and Shingler laboratories for their insights and
helpful suggestions. This work was supported by Grants
BIO2004-01354 and BIO2007-63754 (Ministerio de Educacin y Ciencia, Spain), fellowships from the I3P (CSIC/
Ministerio de Educacin y Ciencia, Spain) and FPU
(Ministerio de Educacin y Cultura, Spain) programmes,
awarded to O.P. and V.G.-G., respectively, and a short-term
EMBO fellowship awarded to O.P. to visit the laboratory
of VS.

References
Arcondeguy, T., Jack, R., and Merrick, M. (2001) P(II) signal
transduction proteins, pivotal players in microbial nitrogen
control. Microbiol Mol Biol Rev 65: 80105.
Bao, Y., Lies, D.P., Fu, H., and Roberts, G.P. (1991) An
improved Tn7-based system for the single-copy insertion
of cloned genes into the chromosomes of Gram-negative
bacteria. Gene 109: 167168.
Beck, L.L., Smith, T.G., and Hoover, T.R. (2007) Look,
no hands! Unconventional transcriptional activators in
bacteria. Trends Microbiol 15: 530537.
Belitsky, B.R., Janssen, P.J., and Sonenshein, A.L. (1995)
Sites required for GltC-dependent regulation of Bacillus
subtilis glutamate synthase expression. J Bacteriol 177:
56865695.
Belitsky, B.R., and Sonenshein, A.L. (1999) An enhancer
element located downstream of the major glutamate

2009 The Authors

Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 419433

Complex regulation of a sN-dependent promoter 431

dehydrogenase gene of Bacillus subtilis. Proc Natl Acad

Sci USA 96: 1029010295.
Berger, D.K., Narberhaus, F., and Kustu, S. (1994) The
isolated catalytic domain of NIFA, a bacterial enhancerbinding protein, activates transcription in vitro: activation is
inhibited by NIFL. Proc Natl Acad Sci USA 91: 103107.
Berger, D.K., Narberhaus, F., Lee, H.S., and Kustu, S. (1995)
In vitro studies of the domains of the nitrogen fixation
regulatory protein NIFA. J Bacteriol 177: 191199.
Bernardo, L.M., Johansson, L.U., Skrfstad, E., and Shingler,
V. (2009) s54-promoter discrimination and regulation by
ppGpp and DksA. J Biol Chem 284: 828838.
Brahmachary, P., Dashti, M.G., Olson, J.W., and Hoover,
T.R. (2004) Helicobacter pylori FlgR is an enhancerindependent activator of s54-RNA polymerase holoenzyme.
J Bacteriol 186: 45354542.
Buck, M., and Cannon, W. (1989) Mutations in the RNA
polymerase recognition sequence of the Klebsiella
pneumoniae nifH promoter permitting transcriptional activation in the absence of NifA binding to upstream activator
sequences. Nucleic Acids Res 17: 25972612.
Buck, M., Gallegos, M.T., Studholme, D.J., Guo, Y., and
Gralla, J.D. (2000) The bacterial enhancer-dependent
sigma(54) (sigma(N)) transcription factor. J Bacteriol 182:
41294136.
Burtnick, M.N., Downey, J.S., Brett, P.J., Boylan, J.A., Frye,
J.G., Hoover, T.R., and Gherardini, F.C. (2007) Insights
into the complex regulation of rpoS in Borrelia burgdorferi.
Mol Microbiol 65: 277293.
Cannon, W., Missailidis, S., Austin, S., Moore, M., Drake, A.,
and Buck, M. (1996) Purification and activities of the
Rhodobacter capsulatus RpoN (sigma N) protein. Mol
Microbiol 21: 233245.
Cases, I., Ussery, D.W., and de Lorenzo, V. (2003) The s54
regulon (sigmulon) of Pseudomonas putida. Environ Microbiol 5: 12811293.
Drummond, M., Clements, J., Merrick, M., and Dixon, R.
(1983) Positive control and autogenous regulation of the
nifLA promoter in Klebsiella pneumoniae. Nature 301:
302307.
Elliott, T., and Geiduschek, E.P. (1984) Defining a bacteriophage T4 late promoter: absence of a -35 region. Cell
36: 211219.
Espinosa-Urgel, M., Salido, A., and Ramos, J.L. (2000)
Genetic analysis of functions involved in adhesion of
Pseudomonas putida to seeds. J Bacteriol 182: 23632369.
Feng, J., Goss, T.J., Bender, R.A., and Ninfa, A.J. (1995)
Repression of the Klebsiella aerogenes nac promoter.
J Bacteriol 177: 55355538.
Figurski, D.H., and Helinski, D.R. (1979) Replication of an
origin-containing derivative of plasmid RK2 dependent on
a plasmid function provided in trans. Proc Natl Acad Sci
USA 76: 16481652.
Franklin, F.C., Bagdasarian, M., Bagdasarian, M.M., and
Timmis, K.N. (1981) Molecular and functional analysis of
the TOL plasmid pWWO from Pseudomonas putida and
cloning of genes for the entire regulated aromatic ring meta
cleavage pathway. Proc Natl Acad Sci USA 78: 7458
7462.
Garca-Gonzlez, V., Govantes, F., Porra, O., and Santero,
E. (2005) Regulation of the Pseudomonas sp. strain ADP

cyanuric acid degradation operon. J Bacteriol 187: 155

167.
Govantes, F., Molina-Lpez, J.A., and Santero, E. (1996)
Mechanism of coordinated synthesis of the antagonistic
regulatory proteins NifL and NifA of Klebsiella pneumoniae.
J Bacteriol 178: 68176823.
Hager, D.A., Jin, D.J., and Burgess, R.R. (1990) Use of Mono
Q high-resolution ion-exchange chromatography to obtain
highly pure and active Escherichia coli RNA polymerase.
Biochemistry 29: 78907894.
Hanahan, D. (1983) Studies on transformation of Escherichia
coli with plasmids. J Mol Biol 166: 557580.
Hervs, A.B., Canosa, I., and Santero, E. (2008) Transcriptome analysis of Pseudomonas putida in response to nitrogen availability. J Bacteriol 190: 416420.
Hoover, T.R., Santero, E., Porter, S., and Kustu, S. (1990)
The integration host factor stimulates interaction of RNA
polymerase with NIFA, the transcriptional activator for
nitrogen fixation operons. Cell 63: 1122.
Huala, E., and Ausubel, F.M. (1989) The central domain of
Rhizobium meliloti NifA is sufficient to activate transcription
from the R. meliloti nifH promoter. J Bacteriol 171: 3354
3365.
Huala, E., Stigter, J., and Ausubel, F.M. (1992) The central
domain of Rhizobium leguminosarum DctD functions
independently to activate transcription. J Bacteriol 174:
14281431.
Inoue, H., Nojima, H., and Okayama, H. (1990) High
efficiency transformation of Escherichia coli with plasmids.
Gene 96: 2328.
Johansson, L.U., Solera, D., Bernardo, L.M., Moscoso, J.A.,
and Shingler, V. (2008) Sigma(54)-RNA polymerase
controls sigma(70)-dependent transcription from a nonoverlapping divergent promoter. Mol Microbiol 70: 709
723.
Jyot, J., Dasgupta, N., and Ramphal, R. (2002) FleQ, the
major flagellar gene regulator in Pseudomonas aeruginosa, binds to enhancer sites located either upstream or
atypically downstream of the RpoN binding site. J Bacteriol
184: 52515260.
Klose, K.E., Weiss, D.S., and Kustu, S. (1993) Glutamate
at the site of phosphorylation of nitrogen-regulatory protein NTRC mimics aspartyl-phosphate and activates the
protein. J Mol Biol 232: 6778.
Koch, B., Jensen, L.E., and Nybroe, O. (2001) Apanel of
Tn7-based vectors for insertion of the gfp marker gene
or for delivery of cloned DNA into Gram-negative bacteria
at a neutral chromosomal site. J Microbiol Methods 45:
187195.
Kovacikova, G., and Skorupski, K. (2001) Overlapping
binding sites for the virulence gene regulators AphA, AphB
and cAMP-CRP at the Vibrio cholerae tcpPH promoter. Mol
Microbiol 41: 393407.
Kustu, S., Santero, E., Keener, J., Popham, D., and Weiss, D.
(1989) Expression of sigma 54 (ntrA)-dependent genes is
probably united by a common mechanism. Microbiol Rev
53: 367376.
Mandelbaum, R.T., Wackett, L.P., and Allan, D.L. (1993)
Mineralization of the s-triazine ring of atrazine by stable
bacterial mixed cultures. Appl Environ Microbiol 59: 1695
1701.

2009 The Authors

Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 419433

432 O. Porra et al.

Mao, X.J., Huo, Y.X., Buck, M., Kolb, A., and Wang, Y.P.
(2007) Interplay between CRP-cAMP and PII-Ntr systems
forms novel regulatory network between carbon metabolism and nitrogen assimilation in Escherichia coli. Nucleic
Acids Res 35: 14321440.
Martinez, B., Tomkins, J., Wackett, L.P., Wing, R., and Sadowsky, M.J. (2001) Complete nucleotide sequence and
organization of the atrazine catabolic plasmid pADP-1 from
Pseudomonas sp. strain ADP. J Bacteriol 183: 56845697.
Martnez, M., Brito, B., Imperial, J., and Ruiz-Argeso, T.
(2004) Characterization of a new internal promoter (P3) for
Rhizobium leguminosarum hydrogenase accessory genes
hupGHIJ. Microbiology 150: 665675.
Martin-Verstraete, I., Stulke, J., Klier, A., and Rapoport, G.
(1995) Two different mechanisms mediate catabolite
repression of the Bacillus subtilis levanase operon.
J Bacteriol 177: 69196927.
Merrick, M.J., and Edwards, R.A. (1995) Nitrogen control in
bacteria. Microbiol Rev 59: 604622.
Miller, J.H. (1992) A Short Course in Bacterial Genetics: A
Laboratory Manual. Cold Spring Harbor, NY: Cold Spring
Harbor Laboratory Press.
Molina-Lopez, J.A., and Santero, E. (1999) An artificial
enhancer with multiple response elements stimulates
prokaryotic transcriptional activation medicated by various
regulatory proteins. Mol Gen Genet 262: 291301.
Morett, E., and Buck, M. (1988) NifA-dependent in vivo protection demonstrates that the upstream activator sequence
of nif promoters is a protein binding site. Proc Natl Acad Sci
USA 85: 94019405.
Morett, E., and Buck, M. (1989) In vivo studies on the interaction of RNA polymerase-s54 with the Klebsiella pneumoniae and Rhizobium meliloti nifH promoters. The role of
NifA in the formation of an open promoter complex. J Mol
Biol 210: 6577.
Morett, E., and Segovia, L. (1993) The sigma 54 bacterial
enhancer-binding protein family: mechanism of action
and phylogenetic relationship of their functional domains.
J Bacteriol 175: 60676074.
Ninfa, A.J., Reitzer, L.J., and Magasanik, B. (1987) Initiation
of transcription at the bacterial glnAp2 promoter by purified
E. coli components is facilitated by enhancers. Cell 50:
10391046.
Ostrowski, J., and Kredich, N.M. (1991) Negative autoregulation of cysB in Salmonella typhimurium: in vitro interactions of CysB protein with the cysB promoter. J Bacteriol
173: 22122218.
Parsek, M.R., Shinabarger, D.L., Rothmel, R.K., and Chakrabarty, A.M. (1992) Roles of CatR and cis,cis-muconate
in activation of the catBC operon, which is involved in
benzoate degradation in Pseudomonas putida. J Bacteriol
174: 77987806.
Poggio, S., Osorio, A., Dreyfus, G., and Camarena, L. (2005)
The flagellar hierarchy of Rhodobacter sphaeroides is controlled by the concerted action of two enhancer-binding
proteins. Mol Microbiol 58: 969983.
Popham, D.L., Szeto, D., Keener, J., and Kustu, S. (1989)
Function of a bacterial activator protein that binds to
transcriptional enhancers. Science 243: 629635.
Porra, O., Garca-Jaramillo, M., Santero, E., and Govantes,
F. (2007) The LysR-type regulator AtzR binding site: DNA

sequences involved in activation, repression and cyanuric acid-dependent repositioning. Mol Microbiol 66: 410
427.
Porter, S.C., North, A.K., Wedel, A.B., and Kustu, S. (1993)
Oligomerization of NTRC at the glnA enhancer is required
for transcriptional activation. Genes Dev 7: 22582273.
Reitzer, L. (2003) Nitrogen assimilation and global regulation
in Escherichia coli. Annu Rev Microbiol 57: 155176.
Reitzer, L.J., and Magasanik, B. (1986) Transcription of glnA
in E. coli is stimulated by activator bound to sites far from
the promoter. Cell 45: 785792.
Reitzer, L., and Schneider, B.L. (2001) Metabolic context and
possible physiological themes of sigma(54)-dependent
genes in Escherichia coli. Microbiol Mol Biol Rev 65: 422
444.
Rojo, F. (1999) Repression of transcription initiation in
bacteria. J Bacteriol 181: 29872991.
Rojo, F. (2001) Mechanisms of transcriptional repression.
Curr Opin Microbiol 4: 145151.
Sambrook, J., Russell, D.W., and Russell, D. (2000) Molecular Cloning, a Laboratory Manual. Cold Spring Harbor,
NY: Cold Spring Harbor Laboratory Press.
Schell, M.A. (1993) Molecular biology of the LysR family of
transcriptional regulators. Annu Rev Microbiol 47: 597
626.
Schmitz, G., Nikaido, K., and Ames, G.F. (1988) Regulation
of a transport operon promoter in Salmonella typhimurium:
identification of sites essential for nitrogen regulation. Mol
Gen Genet 215: 107117.
Schneider, B.L., Shiau, S.P., and Reitzer, L.J. (1991) Role of
multiple environmental stimuli in control of transcription
from a nitrogen-regulated promoter in Escherichia coli with
weak or no activator-binding sites. J Bacteriol 173: 6355
6363.
Schumacher, J., Joly, N., Rappas, M., Zhang, X., and Buck,
M. (2006) Structures and organisation of AAA+ enhancer
binding proteins in transcriptional activation. J Struct Biol
156: 190199.
Shingler, V. (2003) Integrated regulation in response to
aromatic compounds: from signal sensing to attractive
behaviour. Environ Microbiol 5: 12261241.
Simons, R.W., Houman, F., and Kleckner, N. (1987)
Improved single and multicopy lac-based cloning vectors
for protein and operon fusions. Gene 53: 8596.
Studholme, D.J., and Dixon, R. (2003) Domain architectures
of s54-dependent transcriptional activators. J Bacteriol 185:
17571767.
Toledano, M.B., Kullik, I., Trinh, F., Baird, P.T., Schneider,
T.D., and Storz, G. (1994) Redox-dependent shift of
OxyRDNA contacts along an extended DNA-binding site:
a mechanism for differential promoter selection. Cell 78:
897909.
Tropel, D., and van der Meer, J.R. (2004) Bacterial
transcriptional regulators for degradation pathways of aromatic compounds. Microbiol Mol Biol Rev 68: 474500.
Wang, Y.P., Kolb, A., Buck, M., Wen, J., OGara, F., and
Buc, H. (1998) CRP interacts with promoter-bound s54 RNA
polymerase and blocks transcriptional activation of the
dctA promoter. EMBO J 17: 786796.
Wedel, A., Weiss, D.S., Popham, D., Droge, P., and Kustu, S.
(1990) A bacterial enhancer functions to tether a trans-

2009 The Authors

Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 419433

Complex regulation of a sN-dependent promoter 433

criptional activator near a promoter. Science 248: 486

490.
Wek, R.C., and Hatfield, G.W. (1988) Transcriptional activation at adjacent operators in the divergent-overlapping ilvY
and ilvC promoters of Escherichia coli. J Mol Biol 203:
643663.
Wigneshweraraj, S., Bose, D., Burrows, P.C., Joly, N.,
Schumacher, J., Rappas, M., et al. (2008) Modus operandi
of the bacterial RNA polymerase containing the s54
promoter-specificity factor. Mol Microbiol 68: 538546.
Wikstrom, P., ONeill, E., Ng, L.C., and Shingler, V. (2001) The
regulatory N-terminal region of the aromatic-responsive
transcriptional activator DmpR constrains nucleotidetriggered multimerisation. J Mol Biol 314: 971984.
Wu, S.Q., Chai, W., Lin, J.T., and Stewart, V. (1999) General
nitrogen regulation of nitrate assimilation regulatory gene
nasR expression in Klebsiella oxytoca M5al. J Bacteriol
181: 72747284.
Wyman, C., Rombel, I., North, A.K., Bustamante, C., and
Kustu, S. (1997) Unusual oligomerization required for

activity of NtrC, a bacterial enhancer-binding protein.

Science 275: 16141616.
Xu, H., Gu, B., Nixon, B.T., and Hoover, T.R. (2004)
Purification and characterization of the AAA+ domain
of Sinorhizobium meliloti DctD, a s54-dependent transcriptional activator. J Bacteriol 186: 34993507.
Zhang, X., Chaney, M., Wigneshweraraj, S.R., Schumacher,
J., Bordes, P., Cannon, W., and Buck, M. (2002) Mechanochemical ATPases and transcriptional activation. Mol
Microbiol 45: 895903.

Supporting information
Additional supporting information may be found in the online
version of this article.
Please note: Wiley-Blackwell are not responsible for the
content or functionality of any supporting materials supplied
by the authors. Any queries (other than missing material)
should be directed to the corresponding author for the article.

2009 The Authors

Journal compilation 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 419433

Supporting information
Activation and repression of a N-dependent promoter naturally lacking
upstream activation sequences
Odil Porra, Vicente Garca-Gonzlez, Eduardo Santero, Victoria Shingler and
Fernando Govantes*

Centro Andaluz de Biologa del Desarrollo, Universidad Pablo de Olavide/CSIC, and

Departamento de Biologa Molecular e Ingeniera Bioqumica, Universidad Pablo de
Olavide. Department of Molecular Biology, Ume University, 901 87 Ume, Sweden.

Current address: Oryzon Genomics. Josep Samitier 1-5. 08028 Barcelona, Spain

*Corresponding author.
Address: Centro Andaluz de Biologa del Desarrollo. Universidad Pablo de Olavide. Carretera de Utrera,
Km. 1. 41013 Sevilla, Spain. Telephone: +34-954 977877. Fax: +34-954 349376. E-mail: fgovrom@upo.es

Figure S1. Expression of PatzR-lacZ transcriptional fusions inserted in the P. putida

chromosome. PatzR-lacZ fusions harboring the wild-type or minimal atzR promoter
region were inserted in P. putida KT2442 (wild-type) and MPO201 (ntrC) using the Tn7
transposition functions. Expression was measured as -galactosidase activity from
cultures grown in nitrogen excess (open bars), or nitrogen limitation (solid bars). Bars
represent the average and standard deviation of at least three independent
measurements.