Aquatic Toxicology 177 (2016) 125135

Contents lists available at ScienceDirect

Aquatic Toxicology
journal homepage: www.elsevier.com/locate/aquatox

Assessment of gold nanoparticle effects in a marine teleost (Sparus

aurata) using molecular and biochemical biomarkers
M. Teles a, , C. Fierro-Castro a , P. Na-Phatthalung b , A. Tvarijonaviciute c , T. Trindade e ,
A.M.V.M. Soares d , L. Tort a , M. Oliveira d
a

Department of Cell Biology, Physiology and Immunology, Universitat Autnoma de Barcelona, 08193 Barcelona, Spain
Department of Microbiology and Excellent Research Laboratory on Natural Products, Faculty of Science and Natural Product Research Center of
Excellence, Prince of Songkla University, Hat Yai, Songkhla 90112, Thailand
c
Department of Medicine and Animal Surgery, Universitat Autnoma de Barcelona, 08193 Barcelona, Spain
d
Department of Biology & CESAM, University of Aveiro, 3810-193 Aveiro, Portugal
e
Department of Chemistry & CICECO, University of Aveiro, 3810-193 Aveiro, Portugal
b

a r t i c l e

i n f o

Article history:
Received 24 December 2015
Received in revised form 13 April 2016
Accepted 21 May 2016
Available online 24 May 2016
Keywords:
Gold nanoparticles
Fish
Transcriptional levels
Biochemical
Integrated biomarker response

a b s t r a c t
Gold nanoparticles (AuNP) are increasingly employed in a variety of applications and are likely to
be increasing in the environment, posing a potential emerging environmental threat. Information on
possible hazardous effects of engineered nanoparticles is urgently required to ensure human and environmental safety and promote the safe use of novel nanotechnologies. Nevertheless, there is a lack of
comprehensive knowledge on AuNP effects in marine species. The present study aimed to assess AuNP
effects in a marine teleost, Sparus aurata, by combining endpoints at different biological levels (molecular and biochemical). For that purpose, sh were exposed via water for 96 h to 4, 80 and 1600 g L1 of
AuNP (40 nm) coated with citrate or polyvinylpyrrolidone (PVP). Results revealed a signicant impact of
AuNP-PVP in the hepatic expression of antioxidant, immune and apoptosis related genes. Total oxidative
status was increased in plasma after exposure to the lowest concentration of AuNP-PVP, although without altering the total antioxidant capacity. Furthermore, AuNP did not induce signicant damage in the
liver since the activity of neither hepatic indicator (aspartate aminotransferase and alkaline phosphatase)
increased. Overall, the present study demonstrated that AuNP, even with a biocompatible coating is able
to alter oxidative status and expression of relevant target genes in marine sh. Another important nding
is that effects are mainly induced by the lowest and intermediate concentrations of the PVP coated AuNP
revealing the importance of different coatings.
2016 Elsevier B.V. All rights reserved.

1. Introduction
The novel characteristics specic to engineered nanoparticles
(NP) have led to many exciting new applications. Given the increasing widespread production and uses of NP, their entry into water
bodies is expected, making coastal environments potential impact
zones due to the high population and industrial density in these
areas (Lapresta-Fernndez et al., 2012). Consequently, there is
also a risk of NP to human and environmental health (Hansen
et al., 2011). Nevertheless, despite the recommendations for critical
assessment of European Union and United States policies, compre-

Corresponding author.
E-mail address: mteles0@gmail.com (M. Teles).
http://dx.doi.org/10.1016/j.aquatox.2016.05.015
0166-445X/ 2016 Elsevier B.V. All rights reserved.

hensive knowledge on environmental effects of NP is still scarce,

resulting in high uncertainty in risk estimation. This gap is partly
due to poor physical and chemical characterization of NP and lack
of systematic studies employing endpoints related to their mode of
action (Shaw and Handy, 2011). Hence, though inclusion of NP in
the Water Framework Directive has been an issue of debate, with no
clear guidelines existing regarding their release into water (Hansen
et al., 2011).
Among the most used NP, gold NP (AuNP) have been employed
in high technology applications such as organic photovoltaics, electronic conductors and catalysis, sensory probes, drug delivery and
recently in water remediation and aquaculture practices (Rather
et al., 2011). Their widespread use has placed them as an emerging environmental threat and led to their inclusion in OECD list of
representative manufactured nanomaterials (OECD, 2010). A basic

126

M. Teles et al. / Aquatic Toxicology 177 (2016) 125135

prerequisite for using AuNP is their non-toxic and biocompatible

nature for in vitro and in vivo environments, which is an assumption based on the properties of bulk gold that is chemically inert
(Alkilany and Murphy, 2010). However, it was recently demonstrated that gold nanorods are able to pass from the water column
to the marine food-web, having the capacity to bioaccumulate and
induce physiological and biochemical effects (Ferry et al., 2009;
Lapresta-Fernndez et al., 2012). Despite this, data on AuNP ecotoxicity to aquatic organisms are scarce and most studies deal
with regulatory testing in freshwater species using standardized
acute toxicity assays (Lapresta-Fernndez et al., 2012; Truong et al.,
2013). In marine species, studies have been mainly performed with
bivalves, which are able to incorporate, and bioaccumulate AuNP,
displaying DNA damage, oxidative stress and increased expression
of antioxidant genes (Garca-Negrete et al., 2013; Joubert et al.,
2013; Volland et al., 2015). To the authors knowledge, a single
study has, so far, assessed effects of waterborne exposure to AuNP
(AuNP-citrate) to an estuarine sh, Pomatoschistus microps, but at
a salinity of 18. P. microps, exposed for 96 h to 0.2 mg L1 of 5 nm
Au-NP-citrate, incorporated gold and displayed a decreased predatory performance at 20 C although the same was not observed at
25 C (Ferreira et al., 2016). To the best of our knowledge no data
are available on AuNP effects in marine sh at higher salinities.
Hence, the present study will focus on one of the most commercially
important sh species (shery and aquaculture), the gilthead sea
bream (Sparus aurata L.), widespread in Atlantic and Mediterranean
coastal waters. It is a top predator and one of the most consumed
sh in south Europe. Furthermore, S. aurata has already proved its
suitability as a bioindicator in toxicity testing (Del Valls et al., 1998;
Teles et al., 2005; Zena et al., 2015).
Over-generation of reactive oxygen species (ROS) and depletion of antioxidant defenses, with consequent oxidative damage
to cellular macromolecules, has been hypothesized as a possible
explanation for AuNP toxicity (Lapresta-Fernndez et al., 2012;
Tedesco et al., 2010a; Tedesco et al., 2010b), although, in some
cases, expression of oxidative stress-related genes has not been
affected by AuNP (Dedeh et al., 2015). Nonetheless, the assessment
of the balance between overall oxidant and antioxidant defenses
can be a valuable tool for evaluating the potential damaging effects
of AuNP on sh. The assessment of this balance, by using plasma
biomarkers, can be performed without the sacrice of animals,
providing an additional advantage for both ethical and economic
reasons. In this regard, esterase activity (EA) can be used as a
promising non-specic biomarker of exposure to environmental
contaminants. Total oxidant status (TOS) reects the total oxidant
species and it is a valuable tool in the diagnosis of different pathologies (Erel, 2005). On the other hand, TAC (total antioxidant capacity)
reects the global antioxidant status of the organism and it is a
marker of the combined effects of the different antioxidants.
The analysis of mRNA levels of target genes, assessed with RTqPCR (reverse transcriptase-quantitative real time PCR), has been
used in studies focusing on the modes of action of contaminants,
providing insights into the transcriptional networks and affected
signaling (Kloas et al., 2009). Moreover, the transcriptional analysis allows the detection of early warning signs of possible damaging
effects, since changes at the molecular level occur prior to manifestations at higher levels of biological organization. Nevertheless, to
our knowledge, there are no studies concerning AuNP effects at the
molecular level in marine sh.
The present study aimed to evaluate AuNP effects on S. aurata.
For that purpose, sh were exposed to AuNP with different surface coating (citrate and polyvinylpyrrolidone, PVP). The selection
of these two surface coatings was based on their applications in different areas of research and different stability in high ionic strength
media (Barreto et al., 2015). AuNP possessing a layer of citrate
ions has been shown to have a high rate of cellular uptake com-

pared to conjugated ones, due to the adsorption of serum proteins

onto their surface (Chen et al., 2013). PVP has been widely used as
a capping/reducing/nucleating agent due to its stabilizing ability,
biocompatibility and solubility in various polar solvents (Behera
and Ram, 2014).
The stability of four housekeeping genes on S. aurata liver
was analyzed in order to determine the most appropriate set of
housekeeping genes for RT-qPCR data analysis. In order to obtain
information on the AuNP modes of action, the transcriptional levels of target genes associated with antioxidant defenses, immune
system, cell-tissue repair and apoptosis were measured in the
liver. Biochemical biomarkers related to oxidative stress and liver
health status were determined in plasma. Plasma reects the overall physiological status of the animal and has been widely used
to diagnose health status in situations of inappropriate feeding,
chronic pathology or stress conditions that do not necessarily lead
to manifestation of clinical symptoms (Prez-Snchez et al., 2013).
Liver is the target organ for the majority of xenobiotics having an
important role for their metabolism and storage, as well as for the
redox metabolism (Prieto et al., 2006). In this regard, these two
biological samples were considered candidates for the detection of
early warning signs of possible damaging effects of AuNP. Finally, an
integrated biomarker approach analysis, combining the biomarkers
at the molecular and biochemical levels, was performed to identify
early-warning signs of AuNP toxicity.

2. Materials and methods

2.1. Test organisms
Gilthead sea bream (S. aurata) specimens of 9 0.5 g
(mean standard deviation) mass were acquired from an aquaculture in the North of Spain. Once in the laboratory, sh were
acclimated to laboratory conditions for three weeks in 250 L
aquaria containing aerated and ltered (Eheim lters) articial
saltwater (ASW; Ocean Fish, Prodac) at a salinity of 35, under a
photoperiod of 12 h light:12 h dark, at a temperature of 20 1 C.
Fish were handfed daily with a commercial sea bream diet (Sorgal,
Portugal) at a ratio of 1 g per 100 g of sh. Food was withheld 48 h
before the beginning of the bioassay. All experimental procedures
involving sh were carried out according to the 3 R principles
of Animal Experimentation following Portuguese legislation
(authorization N421/2013 of the legal authority Direco Geral de
Veterinria) that agrees with the International Guiding Principles
for Biomedical Research Involving Animals (EU 2010/63). All
animal handling was performed with accredited researchers.

2.2. Gold nanoparticle synthesis and characterization

Prior to AuNP synthesis, all glass material was washed with aqua
regia and later rinsed thoroughly with ultrapure water. AuNP of
approximately 40 nm were prepared by reduction of HAuCl4 by
citrate, as described by Lekeufack et al. (2010). After synthesis,
all citrate-coated AuNPs (AuNP-citrate) were centrifuged (Sorvall
Lynx 4000, Thermo) to remove impurities and resuspended in ultrapure water. The nal concentration of AuNP-citrate present in the
suspension was determined based on their absorption spectra and
sizes (Liu et al., 2007; Paramelle et al., 2014). AuNP-citrate were
coated with a PVP layer and quantied as described in Barreto
et al. (2015). Characterization of AuNPs was performed by UVvis
spectrophotometry (Cintra 303, GBC Scientic) and dynamic light
scattering (DLS), assessing hydrodynamic size and zeta potential (Zetasizer Nano ZS, Malvern) and by transmission electron
microscopy (Hitachi, H9000 NAR).

M. Teles et al. / Aquatic Toxicology 177 (2016) 125135

127

Table 1
Sequences and efciencies of primers used for quantitative real-time PCR analysis in the liver of Sparus aurata.
Gene name

Acronym

Genbank ID

Forward

Reverse

Efciency
(%)

Elongation factor-1
18 S ribosomal RNA gene
-Actin
Glyceraldehyde 3-phosphate
dehydrogenase
Superoxide dismutase [Mn]
Catalase
Glutathione peroxidase 1
Glutathione peroxidase 4
Glutathione-S-transferase3
Peroxiredoxin 6
Metallothionein
Transferrin
Glutathione reductase
Interleukin 1
Interleukin 10
Tumor necrosis factor-
Cyclooxygenase 2
Heat-shock protein 70
Glucose-regulated protein,
75 kDa
Caspase 3
Bcl-2 associated X protein

EF1
18S
-Actin
GADPH

AF184170
AY993930
X89920
DQ641630

CCCGCCTCTGTTGCCTTCG
GCATTTATCAGACCCAAAACC
TCCTGCGGAATCCATGAGA
TGCCCAGTACGTTGTTGAGTCCAC

CAGCAGTGTGGTTCCGTTAGC
AGTTGATAGGGCAGACATTCG
GACGTCGCACTTCATGATGCT
CAGACCCTCAATGATGCCGAAGTT

99.7
97.8
99.7
102.6

SOD2
CAT
GPx1
GPx4
GST3
PRDX6
MT
TF
GR
IL1
IL10
TNF
COX2
HSP70
GRP75

JQ308833
JQ308823
DQ524992
AM977818
JQ308828
GQ252684
U93206
JF309047
AJ937873
AJ277166
JX976621
AJ413189
AM296029
EU805481
DQ524993

CCTGACCTGACCTACGACTATGG
TGGTCGAGAACTTGAAGGCTGTC
GAAGGTGGATGTGAATGGAAAAGATG
TGCGTCTGATAGGGTCCACTGTC
CCAGATGATCAGTACGTGAAGACCGTC
AGAGACAAGGACGGAATGC
CTCTAAGACTGGAACCTG
CAGGACCAGCAGACCAAGTT
TGTTCAGCCACCCACCCATCGG
GGGCTGAACAACAGCACTCTC
AACATCCTGGGCTTCTATCTG
CAGGCGTCGTTCAGAGTCTC
GAGTACTGGAAGCCGAGCAC
AATGTTCTGCGCATCATCAA
TCCGGTGTGGATCTGACCAAAGAC

AGTGCCTCCTGATAT TTCTCCTCTG
AGGACGCAGAAATGGCAGAGG
CTGACGGGACTCCAAATGATGG
GTCTGCCAGTCCTCTGTCGG
CTGCTGATGTGAGGAATGTACCGTAAC
TGTGGCGACCTTCTTCTG
GGGCAGCATGAGCAGCAG
TGGTGGAGTCCTTGAAGAGG
GCGTGATACATCGGAGTGAATGAAGTCTTG
TTAACACTCTCCACCCTCCA
TGTCCTCCGTCTCATCTG
CTGTGGCTGAGAGGTGTGTG
GATATCACTGCCGCCTGAGT
GCCTCCACCAAGATCAAAGA
TGTTTAGGCCCAGAAGCATCCATG

100.8
101.1
100.1
100.2
98.8
99.5
102.6
99.6
97.6
99.5
98.8
99.3
99.7
100.8
100

CASP3
BAX

EU722334
AM963390

CTGATCTGGATGGAGGCATT
CAACAAGATGGCATCACACC

AGTAGTAGCCTGGGGCTGTG
TGAACCCGCTCGTATATGAAA

89
100.4

Based on the results obtained by Barreto et al. (2015) with similar AuNPs, and the recognition that intensity and position of the
surface plasmon resonance peaks of AuNPs are related to the size,
shape and colloidal stability (Pereira et al., 2014), an assay stability
test was performed by mixing AuNP suspensions (15 mg L1 ) with
ASW in separate tanks, in a ratio of 1:1. surface plasmon resonance
was analyzed after 0, 24 and 96 h. The ASW used to maintain aquatic
organisms in the laboratory has been used to perform toxicity tests
with a variety of compounds. ASW was prepared by dissolving the
salt in reverse osmosis water until reaching a salinity of 35.

2.3. Fish bioassay

The bioassay generally followed sh acute OECD bioassays. All
glass material was washed with acid (HNO3 10%) and rinsed in
ultrapure water before the experiments. Test solutions (4, 80 and
1600 g L1 ) of AuNP were prepared by dilution of the stock solutions in articial saltwater (35 g L1 ). The tested concentrations
include one, below a predicted environmental value (including
water and soil of 6.13 g L1 ; Garca-Negrete et al., 2013) and in
the same order of magnitude of the lowest concentrations tested
in studies with bivalves (Garca-Negrete et al., 2013; Tiede et al.,
2009), with 20 fold increases. Ten sh were randomly distributed
throughout duplicate 80 L experimental tanks containing 50 L of
test solution (5 sh per tank), at 1 g of sh per L of test solution,
for 96 h. During the test, photoperiod, temperature and aeration
conditions were similar to those used in the acclimation period.
Food was withheld during the bioassay. After checking sh mortality and water temperature, salinity, conductivity, pH and dissolved
oxygen in the aquaria, 80% of the test media was carefully changed
every 24 h, to reduce the build-up of metabolic residues. At the
end of the exposure period, seven sh were anesthetized with tricaine methane sulphonate (MS222), and blood quickly collected
from the posterior cardinal vein with heparinized syringes. After
blood sampling, sh were euthanized by spinal section and the liver
was excised, frozen in liquid nitrogen and stored at 80 C. Plasma
was isolated by centrifugation at 10,000g min for 3 min (Megafuge
8R, Thermo Heraeus) and stored at 80 C until analyses.

2.4. RNA extraction and complementary DNA (cDNA) synthesis

Total RNA was extracted from the liver using TRI Reagent
(Sigma). The concentration and quality of the RNA were measured
using a NanoDropND-1000 Spectrophotometer (Thermo Fisher Scientic, USA). An aliquot of RNA was run on a 1% agarose gel and
post-stained with ethidium bromide to verify the RNA integrity.
Reverse transcription (RT), to generate cDNA, was performed using
1 mg of total RNA, denatured 70 C, 10 min, Oligo dT15 primer
(Promega) and SuperScriptTM III Reverse Transcriptase enzyme
(Invitrogen), in presence of the recombinant ribonuclease inhibitor
RNaseOUTTM (Invitrogen) in a nal volume of 20 L. The resultant cDNA was stored at 20 C until use. All procedures were
performed following the manufacturers protocols.
2.5. Transcriptional analysis
The GenBank identication, primer sequences and efciencies
are shown in Table 1. This set of genes included markers of: antioxidant status, specically genes encoding glutathione peroxidase
1 and 4 (GPx1, GPx4), superoxide dismutase [Zn] (SOD2), glutathione reductase (GR), catalase (CAT), glutathione S-transferase
3 (GST3), peroxiredoxin 6 (PRDX6) and metallothionein (MT); celltissue repair, including heat-shock protein 70 (HSP70) and glucose
regulated protein-75 (GRP75); innate immune function, such as
interleukin 1, tumor necrosis factor- (TNF), cyclooxygenase 2
(COX2), interleukin 10 (IL10) and transferrin (TF); and apoptosis,
namely Bcl-2 associated X protein (BAX) caspase 3 (CASP3). Efciency of the amplication was determined for each primer pair
using serial 5-fold dilutions of pooled cDNA. The efciency was calculated as E = 10 (1/s) where s is the slope generated from the serial
dilutions, when Log dilution is plotted against CT (threshold cycle
number) (Pfaf, 2001).
RT-qPCR was performed using iTaqTM Universal SYBR Green
Supermix (Bio-Rad). Reactions were assembled according to manufacturers instructions with individual 20 L reactions consisting
of 10 L SYBR Green PCR master mix (2x), 200 nM primers and
2 L of cDNA template. All reactions were run in the Bio-Rad
CFX384 Real-Time PCR Detection System (Bio-Rad Laboratories,
USA), under the protocol: 95 C for 5 min, 40 cycles of 95 C for

128

M. Teles et al. / Aquatic Toxicology 177 (2016) 125135

2.7. Biochemical analysis

Fig. 1. a) UVvis spectra of citrate coated gold nanoparticles (AuNP-citrate); b)

Transmission electron microscopy image AuNP-citrate; c) UVvis spectra of PVP
coated gold nanoparticles (AuNP-PVP); scanning electron microscopy image of
AuNP-PVP.

30 s, 58 C for 30 s, followed by melting curve to verify the amplication of a single product. All samples were run in triplicate. The
expression data obtained from three independent biological replicates were used to calculate the threshold cycle (Ct) value. After
checking for primers efciency, RT-qPCR analysis of all the individual samples was determined following the same protocol described
above.

TOS was measured as previously described (Erel, 2005). The

method is based on the reaction that the ferric ion makes a colored complex with xylenol orange in an acidic medium. The color
intensity, which was measured spectrophotometrically at 560 nm
(Olympus Diagnostica, GmbH) using 800 nm as the reference, is
related to the total amount of oxidant molecules present in the sample. The assay is calibrated with hydrogen peroxide and the results
are expressed in terms of micromol hydrogen peroxide equivalent
per litre (molH2 O2 Equiv L1 ). Intra- and inter-assay coefcient of
variation (CV) were below 3% and 5%, respectively.
TAC was determined as described elsewhere (Erel, 2004). The
method used was based on 2,2 -azinobis-(3-ethylbenzothiazoline6-sulfonate) decolorization by antioxidants according to their
concentrations and antioxidant capacities. The color change
was measured as a change in light absorbance at 660 nm.
For the process, the assay was calibrated with 6-hydroxy2,5,7,8-tetramethylchroman-2-carboxylic acid (R)-(+)-6-hydroxy2,5,7,8-tetramethylchroman-2-carboxylic acid (Erel, 2004), and the
activity was expressed as mmol L1 . Intra- and inter-assay CV were
below 6% and 7%, respectively.
EA was measured in plasma using p-nitrophenyl acetate as substrate (Haagen and Brock, 1992). The reaction was monitored at
405 nm. The nonenzymatic hydrolysis of phenyl acetate, which was
based on the hydrolysis rate in the absence of sample, was subtracted from the total hydrolysis rate. EA is reported in UI mL1 .
Intra- and inter-assay CV were below 9% and 10%, respectively.
Oxidative stress index (OSI) was calculated as the percent ratio
of TOS to TAC. OSI (arbitrary units) = TOS (mol H2 O2 Eq.L1 )/TAC
(mmol Trolox Eq.L1 ) (Esen et al., 2015).
Aspartate aminotrasferase (AST) and alkaline phosphatase (ALP)
activities were determined using commercially available kits
(Olympus Systems Reagents; Olympus life and Material Science
Europe GmbH, Hamburg, Germany) following manufacturers indications. Intra- and inter-CV were below 10% in all cases.
All parameters were determined with an automatic analyzer
(Olympus Diagnostica, GmbH).

2.8. Integrated biomarker response (IBR)

2.6. Normalization strategy
Accurate normalization is an absolute prerequisite for correct
analysis of RT-qPCR data. The most commonly used normalization strategy involves standardization to a single constitutively
expressed control gene. In recent years, it has become clear that
the expression of the housekeeping genes can change, for example
between tissues, developmental stages and experimental conditions. Thus, the expression stability of the potential housekeeping
gene should be evaluated in each experimental assay (Andersen
et al., 2004). In the present study, we used the NormFinder application to evaluate the most appropriate housekeeping gene among
four (-actin, elongation factor-1 EF1; 18 S ribosomal RNA gene
18S, and glyceraldehyde 3-phosphate dehydrogenase GADPH).
This application is based on an algorithm for identifying the most
appropriate normalization gene among a set of candidates. A ranking according to the expression stability of each gene in a given
sample set and experimental design is performed. Intra- and intergroup variation calculations are another feature of this program
(Andersen et al., 2004). According to NormFinder results, the expression of the target genes was normalized using the best combination
of two housekeeping genes. Relative gene expression was calculated with the Ct method including the PCR efciencies of the
target and housekeeping gene according to Pfaf (2001).

The selected endpoints were combined into one general index

termed IBR (Beliaeff and Burgeot, 2002), allowing evaluation of
the integrated response of all biomarkers. Considering that the
results, directly dependent on the number of biomarkers in the
set, obtained values were presented divided by n, as suggested by
Broeg and Lehtonen (2006). Results of data standardization procedure needed for IBR calculation were presented in experimental
conditions star plots.

2.9. Statistical analysis

Results are expressed as mean SE (standard error). A statistical data analysis was done using SPSS software 22 (SPSS Inc, IBM,
IL, USA). The assumptions of normality and homogeneity of data
were veried. One-way analysis of variance (one-way ANOVA) was
performed in order to assess signicant effects of the two types of
AuNP. This analysis was followed by post-hoc Tukey test to signal
signicant differences between groups (Zar, 1999). Statistically signicant differences between groups are denoted with: * vs. control
(**P < 0.01 and *P < 0.05);  AuNP coating (AuNP-citrate vs. AuNPPVP; P < 0.01 and P < 0.05).

M. Teles et al. / Aquatic Toxicology 177 (2016) 125135

129

Fig. 2. Transcript levels of housekeeping genes of all experimental groups (n = 7) in the liver of Sparus aurata. Boxes indicated the 25/75 percentiles and the median is marked
with a bold line.

Fig. 3. Transcriptional levels of antioxidant-related genes in the liver of Sparus aurata after 96 h exposure to gold nanoparticles coated with citrate (AuNP-citrate; open
bars) or gold nanoparticles coated with PVP (AuNP-PVP; closed bars) in water. Normalization was done to the best combination of the two housekeeping genes (-Actin and
GADPH). The horizontal line originating at y = 1 denote the control group against which the expression was normalized. Values represent the means S.E. (n = 7 per group).
Differences were determined by two-way ANOVA followed by Tukeys test. Statistically signicant differences between groups are: * vs. control (**P < 0.01 and *P < 0.05); 
vs. AuNP-PVP (P < 0.01 and P < 0.05).

3. Results
3.1. AuNP characterization
AuNP synthesized for the present study were characterized in
ultrapure water immediately after synthesis. The AuNP-citrate displayed a round shape (Fig. 1), and an average size of 37 nm and
polydispersity index of 0.3. The zeta potential of these particles
in ultrapure water displayed a medium value of 44.5 mv. After
coating with a PVP layer, AuNP displayed an average total size of
50 nm with a polydispersity index of 0.2. With the PVP coating, the
zeta potential was altered to 17 mv. In the articial seawater, contrary to AuNP-citrate, that immediately displayed a change in color
to light blue, AuNP-PVP displayed no detectable color alterations.
The UVvis spectra revealed that AuNP-citrate lost the characteristic plasmon absorption within a few minutes whereas AuNP-PVP
maintained the peak position and intensity throughout the 96 h
period. The DLS data revealed that AuNP-citrate, in ASW, formed
agglomerates/aggregates with sizes up to 600 nm in the rst 24 h
with no considerable variation within 96 h, whereas AuNP-PVP
maintained the same size range of approximately 50 nm.
3.2. Molecular responses
In the present study, the variation of each housekeeping gene
in the liver of S. aurata, control or exposed to AuNP (Fig. 2), was
assessed prior to the analysis of the target genes. According to
NormFinder calculations the stability values of the candidate housekeeping genes were: 0.014 for -actin, 0.018 for EF1, 0.026 for
18 S and 0.024 for GADPH. The most stable gene was -actin, and

thus this gene was considered the best gene to be used in RT-qPCR
data analysis. The best combination of two-genes was -actin and
GADPH, with a stability value of 0.014. Considering that multiple
housekeeping gene approaches are recommended as normalization strategy (Urbatzka et al., 2013), in this study, the combination
of -actin and GADPH was used for the calculations.
Concerning the expression of target genes associated with
antioxidant defenses, we found a signicant increase in mRNA
abundance of GPx1, CAT and GST3 in the liver of S. aurata after 96 h
exposure to 4 and 80 g L1 AuNP-PVP when compared to the control group. Furthermore, GPx1, CAT and GST3 mRNA levels were
also signicantly higher the groups exposed to 4 and 80 g L1
AuNP-PVP when compared to the groups exposed to the same
concentrations of AuNP-citrate (Fig. 3). GPx4 presented increased
mRNA abundance in the groups exposed to 4 g L1 of both AuNPcitrate and AuNP-PVP. However, SOD2 and PRDX6 mRNA levels
were at control levels for all tested conditions. GR transcriptional
levels were increased only in the group exposed to 4 g L1 AuNPPVP when compared to the control group. MT mRNA abundance
was signicantly increased in 4 and 80 g L1 AuNP-PVP exposed
groups when compared to the control group. Furthermore, MT transcriptional levels were increased in group exposed to 80 g L1
AuNP-PVP when compared to AuNP coated with citrate.
With respect to immune genes, TF showed increased mRNA
abundance for 4 and 80 g L1 AuNP-PVP when compared to control (Fig. 4). IL10 mRNA levels increased for 4 g L1 AuNP-PVP
(vs. control or AuNP-citrate groups). IL1, TNF and COX2 mRNA
abundance were unaltered, as were HSP70 and GRP75, associated with cell/tissue repair (Fig. 5). In terms of genes associated
with apoptosis (Fig. 6), BAX mRNA levels increased for 4 g L1

130

M. Teles et al. / Aquatic Toxicology 177 (2016) 125135

Fig. 4. Transcriptional levels of immune-related genes in the liver of Sparus aurata after 96 h exposure to gold nanoparticles coated with citrate (AuNP-citrate; open bars)
or gold nanoparticles coated with PVP (AuNP-PVP; closed bars) in water. Normalization was done to the best combination of the two housekeeping genes (-Actin and
GADPH). The horizontal line originating at y = 1 denotes the control group against which the expression was normalized. Values represent the means S.E. (n = 7 per group).
Differences were determined by two-way ANOVA followed by Tukeys test. Statistically signicant differences between groups are: * vs. control (**P < 0.01 and *P < 0.05); 
vs. AuNP-PVP (P < 0.01 and P < 0.05).

Fig. 5. Transcriptional levels of cell tissue repair-related genes in the liver of Sparus
aurata after 96 h exposure to gold nanoparticles coated with citrate (AuNP-citrate;
open bars) or gold nanoparticles coated with PVP (AuNP-PVP; closed bars) in water.
Normalization was done to the best combination of the two housekeeping genes (Actin and GADPH). The horizontal line originating at y = 1 denotes the control group
against which the expression was normalized. Values represent the means S.E.
(n = 7 per group). Differences were determined by two-way ANOVA followed by
Tukeys test. Statistically signicant differences between groups are: * vs. control
(**P < 0.01 and *P < 0.05);  vs. AuNP-PVP (P < 0.01 and P < 0.05).

Fig. 6. Transcriptional levels of apoptosis-related genes in the liver of Sparus aurata

after 96 h exposure to gold nanoparticles coated with citrate (AuNP-citrate; open
bars) or gold nanoparticles coated with PVP (AuNP-PVP; closed bars) in water. Normalization was done to the best combination of the two housekeeping genes (-Actin
and GADPH). The horizontal line originating at y = 1 denotes the control group against
which the expression was normalized. Values represent the means S.E. (n = 7 per
group). Differences were determined by two-way ANOVA followed by Tukeys test.
Statistically signicant differences between groups are: * vs. control (**P < 0.01 and
*P < 0.05);  vs. AuNP-PVP (P < 0.01 and P < 0.05).

AuNP-PVP (vs. control or AuNP-citrate groups). CASP3 showed a

signicant upregulation in the liver of S. aurata after exposure to 4,
80 g L1 AuNP-PVP (vs. control or AuNP-citrate). Moreover, CASP3
was upregulated in the group exposed to the highest concentration
of AuNP-citrate (1600 g L1 ). The overall S. aurata mRNA response
prole to AuNP is presented in Fig. 7, represented as a heatmap.

more alterations in S. aurata than citrate coated. Accordingly,

IBR data conrms that AuNP-PVP are inducing more alterations
in S. aurata and rank AuNP, according to detected effects as
80 g L1 AuNP-PVP > 4 g L1 AuNP-PVP > 16000 g L1 AuNPPVP > 4 g L1 AuNP-PVP > 16000 g L1 AuNP-citrate > 4 g L1
AuNP-citrate >80 g L1 AuNP-citrate.

3.3. Biochemical responses

4. Discussion

After exposure to 4 g L1 AuNP-PVP a signicant increase in

plasma TOS was observed, when compared to the control group.
Moreover, OSI index was signicantly increased for the same
condition (Fig. 8). TAC and EA activity showed no statistically signicant changes among study groups. AST activity was signicantly
decreased for 80 and 1600 g L1 AuNP-PVP compared to control,
while ALP activity was unaltered in the plasma of sh (Fig. 9).

The characterization of AuNP in the test media support the

data obtained by Barreto et al. (2015) in terms of behavior
of AuNP-citrate and AuNP-PVP in ASW. AuNP-citrate immediately agglomerated/aggregated whereas AuNP-PVP maintained its
characteristics during the experimental assay (96 h). These data
suggest that AuNP-PVP remain available in the water column for
a longer period, whereas AuNP-citrate, in the mg L1 range will
only temporarily be available tending to agglomerate/aggregate
and precipitates become visible in the tanks within 24 h. The characterization of AuNP in low concentrations as used in the present
study can be extremely challenging considering that no information can be obtained by the surface plasmon resonance absorption
and other techniques like DLS are not feasible (Garcia-Negrete et al.,
2015). Furthermore, EM observation may also be problematic due
to sample preparation requirements associated with the low num-

3.4. Integrated biomarker response index (IBR)

To perform an integrated evaluation of the AuNP effects in
S. aurata data were standardized and then an IBR index was
calculated and presented as a star plot (Fig. 10). The highest
IBR values were found for AuNP-PVP, particularly for 4 and
80 g.L1 , which emphasize that this particular coating induced

M. Teles et al. / Aquatic Toxicology 177 (2016) 125135

131

Fig. 9. Aspartate aminotrasferase (ALP) and alkaline phosphatase (AST) activities in

the plasma of Sparus aurata after 96 h exposure to gold nanoparticles coated with
citrate (AuNP-citrate; open bars) or gold nanoparticles coated with PVP (AuNP-PVP;
closed bars) in water. Values represent the means S.E. (n = 7 per group). Differences
were determined by two-way ANOVA followed by Tukeys test. Statistically significant differences between groups are: * vs. control (**P < 0.01 and *P < 0.05);  vs.
AuNP-PVP (P < 0.01 and P < 0.05).

Fig. 7. Overall S. aurata mRNA response prole to AuNP represented as a heatmap.

SOD2 (superoxide dismutase [Mn]), CAT (catalase), GPx1, GPx4 (glutathione peroxidase
1 and 4), GST3 (glutathione-S-transferase 3), PRDX6 (peroxiredoxin 6), MT (metallothionein), TF (transferrin), GR (glutathione reductase), IL1 (interleukin 1), IL10
(interleukin 10), TNF (tumor necrosis factor-), COX2 (cyclooxygenase 2), HSP70 (heatshock protein 70), GRP75 (glucose-regulated protein, 75 kDa), CASP3 (caspase 3), BAX
(Bcl-2 associated X protein).

ber of particles and high number of salt crystals that may be found
in the samples. In the study of Garca-Negrete et al. (2013) with
ASW the authors were able to observe by EM that AuNP-citrate, at
low concentrations (in the range of low g L1 ) forms agglomerates that may dissociate easily. This water-resistant nature at low
concentrations can be considered expectable taking into account
the lower probability of particles to collide.
The transcriptional levels of genes encoding the antioxidant
enzymes assessed in the liver of S. aurata exposed to AuNP via water
demonstrated that the low and intermediate concentrations of
AuNP-PVP induced a signicant overexpression of hepatic GPx, CAT,
GST3, GR and MT, whereas AuNP-citrate induced almost no effects.
The increase in the mRNA levels of the antioxidant-related genes
showed that AuNP-PVP induced an activation of the antioxidant
system in the liver of S. aurata to cope with the potential oxidative
stress generated by AuNP exposure. The increase in mRNA levels
of MT, suggests a possible MT involvement in the detoxication of
AuNP, since MT gene promoter region contains not only genetic
elements involved in oxidative stress response, but also sequences
thought to be responsive to metals (Haq et al., 2003). Overall,
our results indicated that AuNP-PVP activates the transcriptional
machinery in S. aurata liver, leading to de novo synthesis of antioxidant enzymes. In sh, the majority of studies have been performed
in freshwater sh, such as Danio rerio (zebrash) (Bar-Ilan et al.,
2009; Geffroy et al., 2012). In one of these studies, the authors
did not nd differences in the expression of antioxidant genes in

Fig. 8. Total oxidative status (TOS), total antioxidant capacity (TAC), esterase activity (EA) and oxidative stress index (OSI) in the plasma of Sparus aurata after 96 h exposure
to gold nanoparticles coated with citrate (AuNP-citrate; open bars) or gold nanoparticles coated with PVP (AuNP-PVP; closed bars) in water. Values represent the means S.E.
(n = 7 per group). Differences were determined by two-way ANOVA followed by Tukeys test. Statistically signicant differences between groups are: * vs. control (**P < 0.01
and *P < 0.05);  vs. AuNP-PVP (P < 0.01 and P < 0.05).

132

M. Teles et al. / Aquatic Toxicology 177 (2016) 125135

Table 2
Summary of main gold nanoparticle effects on estuarine/marine species after exposure via water.
Reference

Species

Coating

Size (nm)

Conc.

Time

Tissuea

Main effectb

Tedesco et al. (2008)

Mytilus edulis

Citrate

13

750 ppb

24 h

DG, G, H, M

Tedesco et al. (2010a,b)

Mytilus edulis

Citrate

15

750 ppb

24 h

DG, G, M

Tedesco et al. (2010a,b)

Mytilus edulis

DDAB

5.3

750 ppb

24 h

DG, G, H, M

Pan et al. (2012)

Scrobicularia plana

Citrate

5, 15, 40

100 g L1

16 d

Whole body

Joubert et al. (2013)

Scrobicularia plana

Citrate

5, 15, 40

100 g L1

16 d

DG, G

Garca-Negrete et al. (2013)

Volland et al. (2015)

Ruditapes philippinarum
Ruditapes philippinarum

Citrate
Citrate

21
20

6, 30 g L1
0.75 g L1

28 d

DG, G
DG, G

Increased oxidative stress (DG)

and CAT (DG, M); Increased
ubiquination (G, DG) and
carbonylation (G). No LMS
damage.
Decreased GSH/GSSG ratio;
decreased protein thiol group;
No LPO; No changes on
thioredoxin reductase activity.
Increased oxidative stress and
cytotoxixity; Decreased
Thiol-containing proteins;
Decreased LMS (H).
Increased MT; Increased CAT,
SOD, GST and AChE; Impaired
burrowing behavior; No LPO.
Increased perinuclear space;
Increased swollen nuclei;
Decreased heterochromatin.
No LPO.
Increased GPx, CAT, LPO (DG);
Increased SOD (G). Increased
expression in GPx, MT and
TNF genes (DG).

DG: digestive gland; G: gills; H: hemolymph/hemocyte; M: mantle.

CAT: catalase; LMS: lysosomal membrane stability; GSH: glutathione; GSSG: glutathione disulphide; LPO: lipid peroxidation; MT: metallothionein; SOD: superoxide
dismutase; GST: glutathione-S-transferase; AChE: acetylcholinesterase; GPx: glutathione peroxidase; TNF: tumor necrosis factor-.
b

zebrash exposed to AuNP-citrate for 20 days (Dedeh et al., 2015).

In bivalves, studies have shown that AuNP induced an increase in
the activity/gene expression of antioxidant enzymes/genes encoding antioxidant enzymes, including MT (Joubert et al., 2013; Pan
et al., 2012; Tedesco et al., 2010a; Volland et al., 2015) (Table 2).
Under present experimental conditions AuNP did not induce
changes in the expression of HSP70 or GRP75, indicating an absence
of cellular stress strong enough to induce de novo synthesis of these
cell chaperones. The activation of the antioxidant defense-related
genes in conjugation with the already available pool of HSP might
have been sufcient to counteract the oxidative stress induced by
AuNP-PVP. Previous studies showed that mice injected with 20 nm
AuNP have increased HSP70 protein levels in brain after 72 h of
injection. However, this study is in mammals and the mode of
administration does not represent an environmentally occurring
exposure route for sh (Siddiqi et al., 2012).
In order to clarify the immunotoxicity of AuNP in S. aurata,
expression of some genes related to the innate immune function
in sh were also evaluated. The present ndings showed unaltered
transcriptional levels of IL1, TNF and COX2, concomitantly with
an upregulation of the anti-inammatory cytokine IL10. Thus, we
suggest that IL10 may be limiting the formation of IL1 and TNF,
giving protection against the oxidative stress induced by AuNP, as
previously suggested in mammals (Bourdi et al., 2002). Bourdi et al.
(2002) proposed that anti-inammatory cytokines protect the liver
against acetaminophen toxicity by attenuating iNOS induction and
avoiding the increase in pro-inammatory cytokines in mice.
TF mRNA levels were increased in the present study after
exposure to the lowest AuNP-PVP, suggesting that AuNP have an
iron-dependent intracellular mechanism in sh. TF encodes for a
protein with a primary role in maintaining proper iron concentrations in the blood. Furthermore, TF is able to transport other
metals like cadmium or zinc. Our results are in agreement with
previous ndings showing that Gadus morhua exposed to mercurycontaminated sediments (Olsvik et al., 2011) have increased TF gene
expression. Taking altogether we propose TF gene as a molecular
biomarker of S. aurata exposure to AuNP.

The expression of genes related to the apoptotic pathway,

namely the pro-apoptotic BAX and the executioner, CASP3, both
were increased in response to AuNP-PVP. Moreover, it should be
highlighted that CASP3 is the only gene that presents changes after
exposure to the highest concentration of AuNP-citrate. Present
results revealed an activation of the apoptotic machinery in the
liver of S. aurata after AuNP exposure via water, as previously
observed in the brain of rats after 72 h injection with AuNP (Siddiqi
et al., 2012).
TOS levels in plasma reect overall oxidative status. In the
present study, the lowest concentrations AuNP-PVP induced an
increase in TOS, which reects a situation of possible oxidative
stress if antioxidant defenses are not effective. This result reinforces the hypothesis that the possible mechanism of AuNP toxicity
is through the generation of ROS (Lapresta-Fernndez et al., 2012;
Volland et al., 2015). For TOS we observed a non-monotonic concentration response curve, which is a major nding since low
concentrations potentially found in the environment induce effects
in a marine sh species. Under present exposure conditions, TAC
activity was unaltered indicating that the overall antioxidant capacity was not depleted due to the oxidative stress generated by
AuNP-PVP, corroborating previous nding in mussels exposed to
copper (Franco et al., 2016). Thus, it seems that S. aurata was able
to counteract the increased oxidant status. Despite the increased
TOS and OSI, the unaltered levels of TAC suggest that the animals
efciently maintain the production of antioxidants that may be
translocated from liver, as previously suggested by Oliveira et al.
(2008) in Liza aurata exposed to pollutants. In the present study,
EA was also unaltered after exposure to AuNP, suggesting that this
enzyme is not involved in the protection against oxidative effects
generating by AuNP-PVP, also corroborating the study of Franco
et al. (2016) with mussels exposed to metals.
Present results do not point out to liver injury induced by
AuNP exposure, since ALP activity was unaltered and AST activity decreased after AuNP-PVP exposure. This nding may be due to
an increased liver antioxidant capacity, as it was previously suggested that some nutrients with hepato-protective effects increase
liver antioxidant capacity preventing lipid peroxidation, which is

M. Teles et al. / Aquatic Toxicology 177 (2016) 125135

Fig. 10. Integrated biomarker response (IBR) and assessed endpoint star plots for
each experimental condition. SOD2 (superoxide dismutase [Mn]), CAT (catalase), GPx1,
GPx4 (glutathione peroxidase 1 and 4), GST3 (glutathione-S-transferase 3), PRDX6 (peroxiredoxin 6), MT (metallothionein), TF (transferrin), GR (glutathione reductase), IL1
(interleukin 1), IL10 (interleukin 10), TNF (tumor necrosis factor-), COX2 (cyclooxygenase 2), HSP70 (heat-shock protein 70), GRP75 (glucose-regulated protein, 75 kDa),
CASP3 (caspase 3), BAX (Bcl-2 associated X protein), TOS (total oxidative status), TAC
(total antioxidant capacity), EA (esterase activity), ALP (aspartate aminotransferase)
and AST (alkaline phosphatase) activities.

reected by decreased AST and ALP activity levels (Panigrahi et al.,

2010). To our knowledge, the only study looking at these parameters after AuNP exposure, was performed in rats orally fed with
AuNP-citrate (10 nm) during 21 days. The authors found increased
levels of ALP and AST activities in plasma suggesting that AuNP
adversely affects hepatocytes.
The present research revealed that AuNP-PVP induced the
majority of the observed effects. If on the one hand this might be
considered an unexpected nding if we contemplate that PVP coating is considered safer and more biocompatible than citrate (Min
et al., 2009), the dissimilar behavior in seawater leads to a lower
presence of AuNP-citrate in the water column, whereas AuNP-PVP

133

stability make them more dispersible and likely to be more incorporated by organisms present in the water column like sh (Barreto
et al., 2015). After sh uptake, AuNP properties can also change
inside the body, since blood contains proteins and electrolytes
that can change NP characteristics. For example, it was previously
demonstrated that gold nanorods aggregated when mixed with
mouse blood. However, when these nanorods were coated with
poly(ethylene) glycol, the aggregation was prevented (Eghtedari
et al., 2009). Our ndings support the proposition that the toxicity of NPs is dependent on various properties of the particles,
including size, shape and surface functionalization (Garca-Negrete
et al., 2013; Tedesco et al., 2010a). Thus, further studies are recommended in order to assess absorption, biodistribution, metabolism
and elimination processes of the two forms of AuNP in S. aurata.
Another important nding of this study was that changes in mRNA
transcriptional levels of antioxidant related-genes occurred at the
tested low and intermediate concentrations of AuNP-PVP. This
result clearly reveals a non-monotonic dose response curve, in
which low doses of AuNP caused a greater impact than high doses,
a pattern of response frequently found for endocrine disrupting
chemicals (Lagarde et al., 2015). Nonetheless, the interpretation of
the data obtained in the present study should also consider that
changes at the molecular level may not strictly correlate with protein levels, despite the relevant information provided. Thus, further
studies should assess effects at protein levels, as well as endpoints
with more obvious reexes at the population level, such as alterations on behavior (e.g. swimming performance).
The IBR index is frequently used to diminish the degree of uncertainty on the interpretation of results although the information
provided by this index should be carefully interpreted taking into
account that the same importance is given to all included biomarkers, regardless of their nature. In the present study, IBR clearly
signaled AuNP-PVP as inducing more effects, mainly at 80 g L1 .
Nonetheless, it must be highlighted that the information obtained
by IBR resulted from the incorporation of all data in the calculations
and thus, is highly inuenced by the higher number of oxidative
stress related biomarkers.
In summary, our study provides information on the molecular
mechanisms underpinning modes of action of AuNPs in a marine
sh cultured in all Mediterranean area. AuNP-PVPs exert a higher
inuence on the transcriptional response and plasma biochemical parameters than AuNP-citrate. AuNP-PVPs are able to generate
oxidative stress, as reected by increased TOS but the increased
mRNA levels of genes encoding antioxidant enzymes together with
lack of decreased TAC found after AuNP challenge suggest that sh
are able to compensate for the disturbance. AuNPs were not able
to induce a pro-inammatory reaction in liver, possibly due to the
protective effect of the antioxidant enzymes and anti-inammatory
cytokine. Despite the increased expression of some apoptosisrelated genes, liver was not damaged by AuNPs as the hepatic
health indicators did not increase in plasma. Taken together, we
propose the use of TOS, GPx, CAT and MT as important biochemical/molecular biomarkers to be used in future AuNP monitoring
studies.

Acknowledgements
This research was supported through the COMPETE Operational Competitiveness Program and national funds through FCT
Foundation for Science and Technology, under the project
NANOAu Effects of Gold Nanoparticles to Aquatic Organisms (FCTPTDC/MAR-EST/3399/2012) (FCOMP-01-0124-FEDER029435); CESAM: UID/AMB/50017/2013 and by the Plan Nacional
de Investigacin, Government of Spain (AGL2013-48835-C22-R).; M.T. and M.O. have a post-doctoral fellowships from

134

M. Teles et al. / Aquatic Toxicology 177 (2016) 125135

FCT (SFRH/BPD/85107/2012 and SFRH/BPD/109219/2015, respectively) supported by the European Social Fund and national funds
from the Ministrio da Educaco e Cincia (POPH QREN Tipologia 4.1) of Portugal. A.T. have a post-doctoral fellowshisp Juan de
la Cierva supported by the Ministerio de Economia y Competitividad, Spain. J.C. Balasch is thankfully acknowledged for the graphic
design of the gures.

References
Alkilany, A.M., Murphy, C.J., 2010. Toxicity and cellular uptake of gold
nanoparticles: what we have learned so far? J. Nanopart. Res. 12, 23132333.
Andersen, C.L., Jensen, J.L., rntoft, T.F., 2004. Normalization of real-time
quantitative reverse transcription-PCR data A model-based variance
estimation approach to identify genes suited for normalization, applied to
bladder and colon cancer data sets. Cancer Res. 64, 52455250.
Bar-Ilan, O., Albrecht, R.M., Fako, V.E., Furgeson, D.Y., 2009. Toxicity assessments of
multisized gold and silver nanoparticles in zebrash embryos. Small 5,
18971910.
Barreto, A., Luis, G.L., Giro, A.V., Trindade, T., Soares, A.M.V.M., Oliveira, M., 2015.
Behavior of colloidal gold nanoparticles in different ionic strength media. J.
Nanopart. Res. 17, 113.
Behera, M., Ram, S., 2014. Inquiring the mechanism of formation, encapsulation,
and stabilization of gold nanoparticles by poly(vinyl pyrrolidone) molecules in
1-butanol. Appl. Nanosci. 4, 247254.
Beliaeff, B., Burgeot, T., 2002. Integrated biomarker response: a useful tool for
ecological risk assessment. Environ. Toxicol. Chem. 21, 13161322.
Bourdi, M., Masubuchi, Y., Reilly, T.P., Amouzadeh, H.R., Martin, J.L., George, J.W.,
Shah, A.G., Pohl, L.R., 2002. Protection against acetaminophen-induced liver
injury and lethality by interleukin 10: role of inducible nitric oxide synthase.
Hepatology 35, 289298.
Broeg, K., Lehtonen, K.K., 2006. Indices for the assessment of environmental
pollution of the Baltic Sea coasts: integrated assessment of a multi-biomarker
approach. Mar. Pollut. Bull. 53, 508522.
Chen, H., Dorrigan, A., Saad, S., Hare, D.J., Cortie, M.B., Valenzuela, S.M., 2013.
In vivo study of spherical gold nanoparticles: inammatory effects and
distribution in mice. PLoS One 8, 18.
Dedeh, A., Ciutat, A., Treguer-Delapierre, M., Bourdineaud, J.P., 2015. Impact of gold
nanoparticles on zebrash exposed to a spiked sediment. Nanotoxicology 9,
7180.
Del Valls, T.A., Blasco, J., Sarasquete, C., Forja, J.M., Gomez-Parra, A., 1998.
Evaluation of heavy metal sediment toxicity in littoral ecosystems using
juvenile of the sh Sparus aurata. Ecotoxicol. Environ. Saf. 41, 157167.
Eghtedari, M., Liopo, A.V., Copland, J.A., Oraevsky, A.A., Motamedi, M., 2009.
Engineering of hetero-functional gold nanorods for the in vivo molecular
targeting of breast cancer cells. Nano Lett. 9, 287291.
Erel, O., 2004. A novel automated direct measurement method for total antioxidant
capacity using a new generation, more stable ABTS radical cation. Clin.
Biochem. 37, 277285.
Erel, O., 2005. A new automated colorimetric method for measuring total oxidant
status. Clin. Biochem. 38, 11031111.
Esen, R., Aslan, M., Kucukoglu, M.E., Ckman, A., Yakan, U., Sunnetcioglu, M., Selek,
S., 2015. Serum paraoxonase activity total thiols levels, and oxidative status in
patients with acute brucellosis. Wien Klin. Wochenschr. 127, 427433.
Ferreira, P., Fonte, E., Soares, M.E., Carvalho, F., Guilhermino, L., 2016. Effects of
multi-stressors on juveniles of the marine sh Pomatoschistus microps gold
nanoparticles, microplastics and temperature. Aquat. Toxicol. 170, 89103.
Ferry, J.L., Craig, P., Hexel, C., Sisco, P., Frey, R., Pennington, P.L., Fulton, M.H., Scott,
I.G., Decho, A.W., Kashiwada, S., Murphy, C.J., Shaw, T.J., 2009. Transfer of gold
nanoparticles from the water column to the estuarine food web. Nat.
Nanotechnol. 4, 441444.
Franco, L., Romero, D., Garca-Navarro, J.A., Teles, M., Tvarijonaviciute, A., 2016.
Esterase activity (EA), total oxidant status (TOS) and total antioxidant capacity
(TAC) in gills of Mytilus galloprovincialis exposed to pollutants: analytical
validation and effects evaluation by single and mixed heavy metal exposure.
Mar. Pollut. Bull. 102, 3035.
Garca-Negrete, C.A., Blasco, J., Volland, M., Rojas, T.C., Hampel, M.,
Lapresta-Fernndez, A., Jimnez de Haro, M.C., Soto, M., Fernndez, A., 2013.
Behaviour of Au-citrate nanoparticles in seawater and accumulation in bivalves
at environmentally relevant concentrations. Environ. Pollut. 174, 134141.
Garcia-Negrete, C.A., Jimenez de Haro, M.C., Blasco, J., Soto, M., Fernandez, A., 2015.
STEM-in-SEM high resolution imaging of gold nanoparticles and bivalve
tissues in bioaccumulation experiments. Analyst 140, 30823089.
Geffroy, B., Ladhar, C., Cambier, S., Treguer-Delapierre, M., Brethes, D.,
Bourdineaud, J.P., 2012. Impact of dietary gold nanoparticles in zebrash at
very low contamination pressure: the role of size, concentration and exposure
time. Nanotoxicology 6, 144160.
Haagen, L., Brock, A., 1992. A new automated-method for phenotyping arylesterase
(EC 3112) based upon inhibition of enzymatic-hydrolysis of 4-nitrophenyl
acetate by phenyl acetate. Eur. J. Clin. Chem. Clin. Biochem. 30, 391395.
Hansen, S.F., Ganzleben, C., Baun, A., 2011. Nanomaterials and European water
framework directive. Eur. J. Law Technol. 2 (3), ISSN 2042-115X.

Haq, F., Mahoney, M., Koropatnick, J., 2003. Signaling events for metallothionein
induction. Mutat. Res. 533, 211226.
Joubert, Y., Pan, J.-F., Buffet, P.E., Pilet, P., Gilliland, D., Valsami-Jones, E.,
Mouneyrac, C., Amiard-Triquet, C., 2013. Subcellular localization of gold
nanoparticles in the estuarine bivalve Scrobicularia plana after exposure
through the water. Gold Bull. 46, 4756.
Kloas, W., Urbatzka, R., Opitz, R., Wrtz, S., Behrends, T., Hermelink, B., Hofmann,
F., Jagnytsch, O., Kroupova, H., Lorenz, C., Neumann, N., Pietsch, C., Trubiroha,
A., Van Ballegooy, C., Wiedemann, C., Lutz, I., 2009. Endocrine disruption in
aquatic vertebrates. Ann. N. Y. Acad. Sci. 1163, 187200.
Lagarde, F., Beausoleil Belcher, C.S.M., Belzunces, L.P., Emond, C., Guerbet, M.,
Rousselle, C., 2015. Non-monotonic dose-response relationships and endocrine
disruptors: a qualitative method of assessment. Environ. Health 14, 115.
Lapresta-Fernndez, A., Fernndez, A., Blasco, J., 2012. Nanoecotoxicity effects of
engineered silver and gold nanoparticles in aquatic organisms. Trends Anal.
Chem. 32, 4059.
Lekeufack, D.D., Brioude, A., Mouti, A., Alauzun, J.G., Stadelmann, P., Coleman, A.W.,
Miele, P., 2010. Core-shell Au@(TiO2, SiO2) nanoparticles with tunable
morphology. Chem. Commun. 46, 45444546.
Liu, X., Atwater, M., Wang, J., Huo, Q., 2007. Extinction coefcient of gold
nanoparticles with different sizes and different capping ligands. Colloids Surf.
B 58, 37.
Min, Z., Baoxiang, W., Zbigniew, R., Zhaohui, X., Jon Otto, F., Xiaofeng, Y., Steinar, R.,
2009. Minute synthesis of extremely stable gold nanoparticles.
Nanotechnology 20, 505606.
OECD, 2010. Series on the safety of manufactured nanomaterial No. 27. (2010). List
of manufactured nanomaterials and list of endpoints for phase one of the
sponsorship programme for the testing of manufactured nanomaterials:
revision. ENV/JM/MONO(2010)46.
Oliveira, M., Pacheco, M., Santos, M.A., 2008. Organ specic antioxidant responses
in golden grey mullet (Liza aurata) following a short-term exposure to
phenanthrene. Sci. Total Environ. 396, 7078.
Olsvik, P.A., Bratts, M., Lie, K.K., Goksyr, A., 2011. Transcriptional responses in
juvenile Atlantic cod (Gadus morhua) after exposure to mercury-contaminated
sediments obtained near the wreck of the German WW2 submarine U-864,
and from Bergen Harbor, Western Norway. Chemosphere 83, 552563.
Prez-Snchez, J., Borrel, M., Bermejo-Nogales, A., Benedito-Palos, L., Saera-Vila, A.,
Calduch-Giner, J.A., Kaushik, S., 2013. Dietary oils mediate cortisol kinetics and
the hepatic mRNA expression prole of stress-responsive genes in gilthead sea
bream (Sparus aurata) exposed to crowding stress. Implications on energy
homeostasis and stress susceptibility. Comp. Biochem. Physiol. D: Genomics
Proteomics 8, 123130.
Pan, J.F., Buffet, P.-E., Poirier, L., Amiard-Triquet, C., Gilliland, D., Joubert, Y., Pilet, P.,
Guibbolini, M., Risso de Faverney, C., Romo, M., Valsami-Jones, E., Mouneyrac,
C., 2012. Size dependent bioaccumulation and ecotoxicity of gold
nanoparticles in an endobenthic invertebrate: the tellinid clam Scrobicularia
plana. Environ. Pollut. 168, 3743.
Panigrahi, A., Kiron, V., Satoh, S., Watanabe, T., 2010. Probiotic bacteria
Lactobacillus rhamnosus inuences the blood prole in rainbow trout
Oncorhynchus mykiss (Walbaum). Fish Physiol. Biochem. 36, 969977.
Paramelle, D., Sadovoy, A., Gorelik, S., Free, P., Hobley, J., Fernig, D.G., 2014. A rapid
method to estimate the concentration of citrate capped silver nanoparticles
from UVvisible light spectra. Analyst 139, 48554861.
Pereira, S.O., Barros-Timmons, A., Trindade, T., 2014. Biofunctionalisation of
colloidal gold nanoparticles via polyelectrolytes assemblies. Colloid Polym. Sci.
292, 3350.
Pfaf, M.W., 2001. A new mathematical model for relative quantication in
real-time RT-PCR. Nucleic Acids Res. 29, e45.
Prieto, A.I., Jos, A., Pichardo, S., Moreno, I., Camean, A.M., 2006. Differential
oxidative stress responses to microcystins LR and RR in intraperitoneally
exposed tilapia sh (Oreochromis sp.). Aquat. Toxicol. 77, 314321.
Rather, M.A., Sharma, R., Aklakur, M., Ahmad, S., Kumar, N., Khan, M., Ramya, V.L.,
2011. Nanotechnology: a novel tool for aquaculture and sheries
development: a prospective mini-review. Fish. Aquacult. J. 2011, FAJ16.
Shaw, B.J., Handy, R.D., 2011. Physiological effects of nanoparticles on sh: a
comparison of nanometals versus metal ions. Environ. Int. 37, 10831097.
Siddiqi, N., Abdelhalim, M., El-Ansary, A., Alhomida, A., Ong, W., 2012.
Identication of potential biomarkers of gold nanoparticle toxicity in rat
brains. J. Neuroinamm. 9, 123.
Tedesco, S., Doyle, H., Redmond, G., Sheehan, D., 2008. Gold nanoparticles and
oxidative stress in Mytilus edulis. Mar. Environ. Res. 66, 131133.
Tedesco, S., Doyle, H., Blasco, J., Redmond, G., Sheehan, D., 2010a. Exposure of the
blue mussel, Mytilus edulis, to gold nanoparticles and the pro-oxidant
menadione. Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 151, 167174.
Tedesco, S., Doyle, H., Blasco, J., Redmond, G., Sheehan, D., 2010b. Oxidative stress
and toxicity of gold nanoparticles in Mytilus edulis. Aquat. Toxicol. 100,
178186.
Teles, M., Pacheco, M., Santos, M.A., 2005. Sparus aurata L. liver EROD and GST
activities, plasma cortisol, lactate, glucose and erythrocytic nuclear anomalies
following short-term exposure either to 17 beta-estradiol (E2) or E2 combined
with 4-nonylphenol. Sci. Total Environ. 336, 5769.
Tiede, K., Hassellv, M., Breitbarth, E., Chaudhry, Q., Boxall, A.B.A., 2009.
Considerations for environmental fate and ecotoxicity testing to support
environmental risk assessments for engineered nanoparticles. J. Chromatogr. A
1216, 503509.

M. Teles et al. / Aquatic Toxicology 177 (2016) 125135

Truong, L., Tilton, S.C., Zaikova, T., Richman, E., Waters, K.M., Hutchison, J.E.,
Tanguay, R.L., 2013. Surface functionalities of gold nanoparticles impact
embryonic gene expression responses. Nanotoxicology 7, 192201.
Urbatzka, R., Galante-Oliveira, S., Rocha, E., Castro, L.F.C., Cunha, I., 2013.
Normalization strategies for gene expression studies by real-time PCR in a
marine sh species, Scophthalmus maximus. Mar. Genomics 10, 1725.
Volland, M., Hampel, M., Martos-Sitcha, J., Trombini, C., Martnez-Rodrguez, G.,
Blasco, J., 2015. Citrate gold nanoparticle exposure in the marine bivalve

135

Ruditapes philippinarum: uptake, elimination and oxidative stress response.

Environ. Sci. Pollut. Res. 22, 1741417424.
Zar, J.H., 1999. Biostatistical Analysis, fourth edition. Prentice Hall, New Jersey.
Zena, R., Speciale, A., Calabr, C., Cal, M., Palombieri, D., Saija, A., Cimino, F.,
Trombetta, D., Lo Cascio, P., 2015. Exposure of sea bream (Sparus aurata) to
toxic concentrations of benzo[a]pyrene: possible human health effect.
Ecotoxicol. Environ. Saf. 122, 116125.