The structurefunction relationship analysis of Prismalin-14

from the prismatic layer of the Japanese pearl oyster,

Pinctada fucata
Michio Suzuki and Hiromichi Nagasawa
Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, University of Tokyo, Japan

Keywords
biomineralization; chitin; pearl oyster;
Pinctada fucata; Prismalin-14
Correspondence
H. Nagasawa, Department of Applied
Biological Chemistry, Graduate School of
Agricultural and Life Sciences, University of
Tokyo, 1-1-1 Yayoi, Bunkyo, Tokyo 113
8657, Japan
Fax: +81 3 5841 8022
Tel: +81 3 5841 5132
E-mail: anagahi@mail.ecc.u-tokyo.ac.jp
(Received 5 July 2007, revised 7 August
2007, accepted 8 August 2007)
doi:10.1111/j.1742-4658.2007.06036.x

The mollusk shell is a hard tissue consisting of calcium carbonate and

organic matrices. The organic matrices are considered to play important
roles in shell formation. We have previously identied a prismatic layerspecic protein named Prismalin-14, which consists of 105 amino acid residues and includes four structurally characteristic regions; a repeated
sequence of Pro-Ile-Tyr-Arg, a Gly Tyr-rich region and N- and C-terminal
Asp-rich regions. Prismalin-14 showed an inhibitory activity on calcium
carbonate precipitation and a calcium-binding ability in vitro. In this study,
we prepared some molecular species of recombinant proteins including
Prismalin-14 and its truncated proteins in an Escherichia coli expression
system to reveal a structurefunction relationship of Prismalin-14. The
results showed that the Gly Tyr-rich region was responsible for chitin
binding and was identied as a novel chitin-binding sequence. On the other
hand, both N- and C-terminal Asp-rich regions are related to inhibitory
activity on calcium carbonate precipitation in vitro. Immunohistological
observation revealed that Prismalin-14 was localized at the acid-insoluble
organic framework including chitin. All these results strongly suggest that
Prismalin-14 is a framework protein that mediates chitin and calcium carbonate crystals by using its acidic and chitin-binding regions.

Biominerals are hard tissues that consist mainly of

inorganic compounds. They are observed in many
organisms and their functions include maintenance of
the body structure, protection from enemies, magnetic
and gravity sensing and storage of minerals [1]. They
also contain a small amount of organic matrices that
are considered to play important roles in their formation. Various organic matrices have been identied
from various biominerals, e.g. bones, teeth, coccoliths,
otoliths, exoskeleton of crustaceans, seashells, eggshells
and bacterial magnetite [2]. Most of these matrices are
acidic and are supposed to be responsible for mineralization, in which they concentrate calcium ions, interact
specically with crystal surfaces to induce oriented

nucleation, intercalate into the crystal lattice itself, and

determine the mineral phase or function as a framework of biominerals [3].
The shell of the pearl oyster consists of two mineralized layers, the nacreous and prismatic layers. Both
layers are composed of calcium carbonate crystals and
organic matrices. Previous works on mollusk shells
showed that the major components of organic matrices
are chitin and Asp-rich calcium-binding proteins [46].
In the course of shell formation, the periostracum,
which is not mineralized and covers the external surface of the shell, is formed rst, and subsequently the
prismatic layer is formed on the periostracum. Finally,
the nacreous layer is formed on the prismatic layer [7].

Abbreviations
CBB, Coomassie Brilliant Blue; GY, Gly Tyr; NaCl Pi, 10 mM potassium phosphate, 150 mM NaCl; rPrismalin-14, recombinant Prismalin-14;
TFA, trifluoroacetic acid; TNaCl Tris, Tris-buffered saline containing 0.1% Tween 20.

5158

FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS

M. Suzuki and H. Nagasawa

The shell contacts with the mantle, which supplies the

two layers with inorganic ions and organic matrices
through the extrapallial uid.
Organic matrices from the mollusk shell were
thought to control morphology and polymorph of
CaCO3 crystals [8,9]. Many matrix proteins have been
identied from the Japanese pearl oyster shell. Nacrein
[10], MSI60 [11] and N16 [12] were identied from the
nacreous layer, and Prismalin-14 [13] and MSI31 [11]
were from the prismatic layer. The cDNAs encoding
Aspein [14], MSI7 [15], shematrin [16] and PFMG1
[17] were cloned from the mantle possibly related to
the formation of the shell. Various matrix proteins
were also identied from the nacreous or prismatic
layer of the shell of other species. Mucoperlin [18] was
identied from the nacreous layer of Pinna nobilis, and
Calprismin [19] was identied from the prismatic layer.
Lustrin A [20], Perlucin [21], Perlustrin [21], AP7 [22],
AP24 [22] and AP8 [23] were identied from the nacreous layer of the abalone. Among them, there are some
proteins whose functions have been estimated, but as a
whole little is known about the function of each matrix
protein in the calcication process. Nacrein is an
enzyme, carbonic anhydrase, that provides the shell
with bicarbonate ions and inhibits calcium carbonate
precipitation [24]. N16 and Prismalin-14 are thought
to be matrix proteins capable of interacting with
insoluble organic framework and calcium carbonate
in vitro.
We previously puried a matrix protein, Prismalin-14,
from the acid-insoluble fraction of the prismatic layer
of the Japanese pearl oyster, Pinctada fucata, and

Structurefunction relationship of Prismalin-14

determined the whole sequence consisting of 105

amino acid residues [13]. Prismalin-14 is an acidic protein (pI 3.8) and has an inhibitory activity on calcication, suggesting that Prismalin-14 is associated with
calcication of the prismatic layer. In this paper,
we examined the structurefunction relationship of
Prismalin-14 in terms of its inhibitory activity on
calcication and chitin-binding ability, using some
recombinant peptides related to Prismalin-14 together
with the localization of Prismalin-14 in the prismatic
layer by immunohistochemistry.

Results
From the characteristic amino acid sequence of Prismalin-14, the whole sequence of 105 amino acid residues was thought to be structurally divided into four
regions, the N-terminal acidic region, the Pro-Ile-TyrArg repeated region, the Gly Tyr (GY)-rich region
and the C-terminal acidic region. To clarify whether
the four regions are related to function, we prepared
ve recombinant peptides, recombinant rPrismalin-14,
DN, DNDC, PIYR and GY (Fig. 1). rPrismalin-14 has
a sequence consisting of N-terminal alanine and the
full sequence of natural Prismalinin-14 containing all
the four domains. DN has a sequence of natural Prismalin-14 from position 29105 containing the PIYR,
GY-rich and C-terminal regions. DNDC has a sequence of N-terminal alanine and natural Prismalin-14
from position 2097 containing the PIYR and
GY-rich regions. PIYR has a sequence of N-terminal
alanine and natural Prismalin-14 from position 150

Fig. 1. The sequence of each fragmentary peptide of Prismalin-14. Amino acid sequences of natural Prismalin-14 (A) and its related peptides
(BF) are shown. rPrismalin-14 has a sequence of N-terminal alanine and 105 amino acids of natural Prismalinin-14 containing all the four
domains (B). DN has a sequence of natural Prismalin-14 from position 29105 containing the PIYR, GY-rich and C-terminal regions (C). DNDC
has a sequence of N-terminal alanine and natural Prismalin-14 from position 2097 containing the PIYR and GY-rich regions (D). PIYR has a
sequence of N-terminal alanine and natural Prismalin-14 from position 150 containing the N-terminal and PIYR regions (E). GY has a
sequence of N-terminal alanine and natural Prismalin-14 from position 51105 containing the GY-rich and C-terminal regions (F). pQ represents pyroglutamic acid.

FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS

5159

Structurefunction relationship of Prismalin-14

M. Suzuki and H. Nagasawa

bodies were solubilized in 1% SDS 10 mm dithiothreitol solution. Each solution showed a major peak on
the chromatogram of the rst reverse-phase HPLC.
The histidine-tag at the N-terminal part of each recombinant peptide was removed by treatment with BrCN.
The resulting peptides were further puried by the
second reverse-phase HPLC and were analyzed by
MALDI-TOF mass spectrometry. Figure 2B,C shows
the results of PIYR as a representative. The N-terminal amino acid sequence of each recombinant peptide
was identical to that predicted from the DNA
sequence (Table 1).
In the TOF mass spectra of rPrismalin-14, DNDC,
PIYR and GY, protonated molecular ion peaks were
observed at m z 11971.0, 8678.9, 9015.8, 6164.5 and
5899.9, respectively (Table 1). These values coincided
well with the theoretical values calculated from the
amino acid sequences of the peptides, including an
additional Ala located at the N-terminus. The Met residue of rPrismalin-14 at the translation starting site

containing the N-terminal and PIYR regions. GY has

a sequence of N-terminal alanine and natural Prismalin-14 from position 51105 containing the GY-rich
and C-terminal regions. The articial alanine residue
at the N-terminus of Prismalin-14, DNDC, PIYR and
GY was due to the adjustment of codon frame. The
effect of this alanine residue on function was expected
to be small.
Expression and purification of rPrismalin-14,
DNDC, PIYR and GY, and preparation of DN
After Escherichia coli cells containing each expression
plasmid construct were cultured, harvested, and sonicated, soluble and insoluble fractions were obtained.
On the gel of SDS PAGE, candidate bands for rPrismalin-14, DNDC, PIYR and GY were detected only in
the insoluble fractions, but no corresponding band was
detected in the control cells carrying an expression
plasmid without an insert (Fig. 2A). The inclusion

B
C

Fig. 2. The expression and purification of each fragmentary peptide. (A) SDS PAGE of the soluble and insoluble fractions after cell breakage.
Lanes 1 and 2, soluble and insoluble fractions, respectively, of cells carrying an expression plasmid (pET 28b) without any insert. Lanes 3
and 4, soluble and insoluble fractions, respectively, of cells carrying an expression plasmid (pET 28b) containing the rPrismalin-14 insert.
Lanes 5 and 6, soluble and insoluble fractions, respectively, of cells carrying an expression plasmid (pProEX HTc) without any insert. Lanes 7
and 8, soluble and insoluble fractions, respectively, of cells carrying an expression plasmid (pProEX HTc) containing the DNDC insert. Lanes
9 and 10, soluble and insoluble fractions, respectively, of cells carrying an expression plasmid (pProEX HTc) containing the PIYR insert.
Lanes 11 and 12, soluble and insoluble fractions, respectively, of cells carrying an expression plasmid (pProEX HTc) containing the GY insert.
Arrows indicate the expressed peptides. (B) Reverse-phase HPLC elution profile of PIYR. Arrow indicates the purified PIYR peak. Concentration of acetonitrile is indicated by the dotted line. Other recombinant proteins, rPrismalin-14, DN, DNDC and GY were purified using the
same method. Details of the chromatographic conditions are given in Experimental procedures. (C) MALDI-TOF mass spectrum of PIYR.
The value of m z 6164.5 agreed well with that (6162.7) calculated from the PIYR sequence.

5160

FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS

M. Suzuki and H. Nagasawa

Structurefunction relationship of Prismalin-14

Table 1. N-terminal amino acid sequence and MALDI-TOF mass

spectral analyses of each recombinant peptide.

rPrismalin-14
DNDC
PIYR
GY rich
DN

Observed mass
m z (M + H) +

Calculated
mass

N-terminal amino
acid sequence

11971.1
9015.8
6164.5
5899.9
8678.9

11976.5
9013.8
6162.7
5903.0
8677.2

AQYFFRGGDD
ANGYFGYFPR
AQYFFRGGDD
AYGYGYGGFN
FSYPIYRPIY

was removed in the E. coli cells, possibly by a methionine aminopeptidase. These results indicated that
rPrismalin-14, DNDC, PIYR and GY were correctly
translated. DN was obtained by tryptic digestion of
rPrismalin-14 using the method reported previously
[13]. A protonated molecular ion peak of DN was
observed at m z 8678.9 (Table 1). The N-terminal
amino acid sequence analysis of DN also assured its
structure (Table 1).

Fig. 3. Inhibitory activity on calcium carbonate precipitation assay

for each truncated peptide. Changes in the turbidity of the assayed
solutions were followed. Diamond: 0.05% NH4HCO3 alone; cross:
2.0 lM DNDC; triangle: 2.0 lM DN; and square: 2.0 lM rPrismalin-14.
Results are expressed as means SEM (n 3).

rP-14

Inhibitory activity on calcium carbonate

precipitation in vitro
The inhibitory activity on the precipitation of calcium
carbonate from its supersaturated solution in vitro was
examined by the method of Inoue et al. [25]. The precipitation of calcium carbonate was monitored with a
spectrophotometer. To clarify the contribution of the
N- and C-terminal Asp-rich regions to inhibitory activity on calcium carbonate formation, rPrismalin-14,
DN, DNDC were subjected to the assay. rPrismalin-14
and DN inhibited precipitation of calcium carbonate
(Fig. 3). rPrismalin-14 almost completely inhibited it at
the nal concentration of 2.0 lm, whereas DN showed
lower activity and DNDC almost no inhibitory activity
at the same concentration. These results indicate that
the N- and C-terminal Asp-rich regions are responsible
for the inhibitory activity of Prismalin-14 in vitro.
Chitin-binding ability
Because Prismalin-14 was separated from the acidinsoluble matrices, Prismalin-14 was presumed to interact with chitin, an insoluble organic component of the
prismatic layer [6,13]. To examine the chitin-binding
ability of Prismalin-14, we performed an in vitro chitin-binding assay on rPrismalin-14 (Fig. 4). A solution
of rPrismalin-14 was incubated with powdered chitin,
and the insoluble material including chitin was successively washed with distilled water, 0.2 m NaCl, 1.0 m
acetic acid and 2% SDS in 20% 2-mercaptoethanol.
Each washing was applied to SDS PAGE. No band

N
NC
PIYR
GY
BSA

Fig. 4. Chitin-binding assay for each fragmentary peptide. Lane 1,

water-washings; lane 2, 0.2 M NaCl-washings; lane 3, 1.0 M acetic
acid-washings; lane 4, extract with SDS 2-mercaptoethanol. BSA
was used as a negative control.

was observed in the washing of water, 0.2 m NaCl or

1.0 m acetic acid, whereas the SDS-washing showed a
clear band. These results indicated that rPrismalin-14
was tightly bound to chitin.
Next, to identify the region responsible for chitin
binding in Prismalin-14, each truncated peptide was
examined for chitin-binding ability as described above
(Fig. 4). For DN, DNDC and GY, no bands were
observed in the washing of water, 0.2 m NaCl or 1.0 m
acetic acid, whereas the SDS-washings showed clear
bands as was observed for rPrismalin-14. In contrast,
for PIYR, the 1.0 m acetic acid-washing showed a clear
band, whereas the SDS-washing exhibited only a faint
band. Bands for BSA as a negative control were
observed in the water- and NaCl-washings but no bands
were observed in the acetic acid- or SDS-washings.
These results indicated that the GY-rich region is the
region held in common among the recombinants with a

FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS

5161

Structurefunction relationship of Prismalin-14

M. Suzuki and H. Nagasawa

high chitin-binding capacity; the ability of Prismalin-14

to bind chitin is therefore attributed to this region.
Immunohistochemistry
In western blot analysis, an anti-rPrismalin-14 serum
detected a major band with an apparent molecular
mass of 14 kDa corresponding to Prismalin-14 in the
matrix proteins from the prismatic layer of the shell,
although many bands were detected by Coomassie
Brilliant Blue (CBB) staining and no bands were
observed with a preimmune serum (Fig. 5). These data
veried the specicity of the anti-rPrismalin-14 serum.
Optical microscopic observation of the inner surface
of the decalcied prismatic layer from the upper view
revealed hexagonal structure (Fig. 6A). On the other
hand, the typical prismatic structure was observed
clearly on the cross-section. This wall-like structure
forms the insoluble hexagonal framework, whose constituent is chitin [6]. The anti-rPrismalin-14 serum immunostained the wall-like structure strongly (Fig. 6B),
whereas a preimmune serum did not (Fig. 6C). All
these data indicated that Prismalin-14 exists in the
insoluble organic framework and is bound to chitin in
the prismatic layer.

(kDa)
94
67
43

30

20.1

14.4

Fig. 5. Western blot analyses using an anti-rPrismalin-14 serum.

The extracts (30 lg) from the insoluble matrices of the prismatic
layer were applied to SDS PAGE and visualized by staining with
CBB (A). The same extracts (3 lg) as in (A) were applied to
SDS PAGE and visualized by western blotting with an anti-rPrismalin-14 serum (B) or a preimmune serum as a control (C).

5162

Discussion
Various organic matrices in calcium biominerals have
been identied from both proteins and cDNAs. However, functional studies of them have scarcely been
performed, although acidic nature is thought to be
important for interaction with calcium carbonate or
calcium ions. In this study, we aimed at clarifying the
function of partial sequences of a matrix protein,
Prismalin-14, in more detail. We analyzed the structurefunction relationships and examined immunohistochemical localization of Prismalin-14 in the
prismatic layer of the shell.
In the present study, for estimation of the ability of
Prismalin-14 and its related peptides to interact with
calcium carbonate we used the calcium carbonate precipitation assay rst developed by Wheeler et al. [25]
and later modied by Inoue et al. [26] for a small
scale. As was expected, the two acidic parts of Prismalin-14 were found to be responsible for interaction with
calcium carbonate, because the recombinant peptides
having the acidic parts showed inhibitory activity on
calcium carbonate precipitation. The inhibitory activity
in this in vitro assay simply means the ability of a
matrix protein to be able to bind to the surface of calcium carbonate microcrystals to inhibit crystal growth.
This interaction may reect calcication of the shell
in vivo. Acidic regions were present in many matrix
proteins from various biominerals. CAP-1 has an
Asp-rich region and a phosphoserine residue at the
C-terminal part, both of which are responsible for the
inhibitory activity on calcium carbonate precipitation
[27]. The Glu-rich region of osteonectin was found to
bind to hydroxyapatite, and the six consecutive Glu
sequence were bound to the hydroxyapatite strongly
[28]. Statherin has a phosphoserine residue and a GluGlu sequence in the N-terminal region, and this region
is thought to be interact with hydroxyapatite [29,30].
In the present study, the removal of Asp-rich regions
from Prismalin-14 reduced the inhibitory activity on
calcium carbonate precipitation, indicating that the
N- and C-terminal Asp-rich regions bind to calcium
carbonate crystals. As Prismalin-14 was also known to
bind calcium ions [13], these acidic regions may be
associated with the ability to bind calcium ion.
As Prismalin-14 was isolated from the insoluble fraction of organic matrices in the prismatic layer, Prismalin-14 was thought to bind to some insoluble organic
framework. Our recent study revealed the existence of
chitin, an insoluble polysaccharide, in the prismatic
layer of P. fucata [6], indicating that Prismalin-14
probably binds to chitin. In the chitin-binding
experiment, DNDC, which had no acidic regions

FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS

M. Suzuki and H. Nagasawa

Structurefunction relationship of Prismalin-14

100 m
B

Fig. 6. Immunohistochemical observation of

insoluble organic framework of the prismatic
layer by using an anti-rPrismalin-14 serum. (A)
The shell of P. fucata and the prismatic layer
(an inserted picture). (B) The cross-section
stained with the antiserum. (C) Staining with
a preimmune serum. Scale bar 100 lm.

showed chitin-binding activity comparable to rPrismalin-14, indicating that the central region of Prismalin-14
is important for chitin binding. The central region has
two characteristic regions; the PIYR repeat and the
GY-rich region. The secondary structure prediction
revealed that the PIYR repeat forms the b-strand
structure. As the GY-rich sequence has been observed
in extracellular matrices such as keratin, the GY-rich
sequence of Prismalin-14 may also form the structural
motif termed the glycine loop. The glycine loop generally contributes to the elasticity and exibility of the
molecular conformation. The Rebers-Riddiford chitinbinding motif found in cuticle proteins and the
chitin-binding domain of chitinases are known to form
b-sheet structure to bind chitin. Therefore, we rst presumed that the PIYR repeat bound to chitin because
of its predicted b-strand structure, but actually the
GY-rich region was found to be responsible for chitin
binding. As the GY-rich sequence has never been
reported as a chitin-binding sequence, the GY-rich
region of Prismalin-14 may contain a novel chitinbinding motif.
From the chitin-binding ability and acid-insoluble
nature of rPrismalin-14, Prismalin-14 may be bound to
chitin in vivo. Our previous work revealed that the
organic framework including chitin remained insoluble
after decalcication with acetic acid [6]. In the immunohistochemical analysis of the acid-treated insoluble
material, the signal was observed along the framework.

100 m

The colocalization of chitin and Prismalin-14 strongly

indicates that Prismalin-14 is bound to chitin in the
prismatic layer.
Based on the ndings described above, we consider
the process of prismatic layer formation as follows.
Prismalin-14 is secreted from the mantle epithelial cells
to extrapallial uid [13], and taken up into the prismatic layer. The central part including the GY-rich
region may bind to chitin, and N- and C-terminal
Asp-rich regions possibly bind to calcium carbonate
crystals or serve as a nucleation site. The calcium carbonate crystals then grow to form the prismatic layer
of the shell.

Experimental procedures
Construction of expression plasmids
rPrismalin-14 was prepared as follows. Two oligonucleotide
primers were designed based on the nucleotide sequence of
the cDNA encoding Prismalin-14 [13]. The N-terminal primer (recom5: CCATGGGCTCGCTCTTCGACCCTTCG
TG) contained the NcoI site (italics) and an additional two
nucleotide residues (bold characters) to adjust the reading
frame. The C-terminal primers (recom3: GAATTCTTA
CCCGACCATCTGTACGGCTT) contained the EcoRI site
(italics) and a stop codon (bold characters). PCR was
performed with recom5 and recom3 using the plasmid
containing the Prismalin-14 cDNA as template. The

FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS

5163

Structurefunction relationship of Prismalin-14

M. Suzuki and H. Nagasawa

amplied PCR products were cloned into a pCR2.1-TOPO

plasmid (Invitrogen), and the nucleotide sequence of a
desired PCR product was checked. Subsequently, the Prismalin-14 insert was released from the pCR2.1-TOPO
plasmid by NcoI EcoRI digestion, and then ligated into
the NcoI EcoRI site of an expression plasmid pET 28b
(Invitrogen, Carlsbad, CA).
DNDC was prepared in the following way. Two oligonucleotide primers were designed based on the nucleotide
sequence of the Prismalin-14 cDNA. The N-terminal primer
(center5:
CCATGGGCTCGCTCTTCGACCCTTCGTG)
contained the NcoI site (italics) and an additional two nucleotide residues (bold characters) to adjust the reading frame.
The C-terminal primers (center3: GAATTCTTACCCGAC
CATCTGTACGGCTT) contained the EcoRI site (italics)
and a stop codon (bold characters). PCR using center5 and
center3, cloning and construction of an expression plasmid
were performed using the same method as for rPrismalin-14
except with an expression plasmid pProEX HTc, which has
a sequence encoding a His-tag located at the N-terminal
part. Expression plasmids for PIYR and GY peptide fragments were prepared as described above using primer sets of
recom5 and PIYR3: GAATTCTTAGAATGGTCTTATG
ATTTGAGGAT, and, GYrich5: CCATGGCATACGGCTA
TGGGTATGGCGG and recom3, respectively.

Expression of recombinant proteins in E. coli

E. coli, BL21(DE3) cells (Stratagene, La Jolla, CA) were
transformed with each expression plasmid with the insert
and selected on LB plates containing kanamycin
(30 lgmL)1) or ampicillin (50 lgmL)1). Bacterial cells from
a single colony were grown at 37 C overnight in an LB medium containing the same antibiotics, and the culture then
diluted 50-fold with the same medium. The diluted culture
was incubated at 37 C for 2 h, and then isopropyl thio-bd-galactoside (Nacalai, Kyoto, Japan) was added to the culture to a nal concentration of 1 mm. After incubation for
another 2 h, bacterial cells were harvested by centrifugation
and suspended in 1 20 culture volume of phosphate-buffered
saline (NaCl Pi; 10 mm potassium phosphate, 150 mm NaCl,
pH 7.5) containing 0.02% (w v) lysozyme (Wako, Osaka,
Japan). The cells were disrupted by sonication and centrifuged at 10 000 g for 10 min with M150-IV (Sakuma, Tokyo,
Japan). The supernatant was removed, and the pellet was
suspended in NaCl Pi. Both the supernatant and the suspended insoluble material were subjected to 15%
SDS PAGE under reducing conditions.

Japan) with a 20-min linear gradient of 2060% acetonitrile

in 0.05% triuoroacetic acid (TFA) at a ow rate of
1.0 mLmin)1. The puried samples were freeze-dried and
dissolved in a 0.1% NH4HCO3 aqueous solution.

Removal of the His-tag

DNDC, PIYR and GY having a His-tag (20 lg each) were
separately dissolved in an aqueous solution of 70% formic
acid. BrCN (Nacalai) was added into the solution to a nal
concentration of 1%, and the resulting solution was stirred
gently at room temperature for 15 h to remove the His-tag.
Each of DNDC, PIYR and GY without a His-tag was
puried by RP-HPLC on a Capcell Pak C18 column
(2.0 250 mm; Shiseido, Tokyo, Japan) with a 28-min
linear gradient of 2048% acetonitrile in 0.05% TFA at a
ow rate of 0.2 mLmin)1. The puried samples were freezedried and dissolved in a 0.1% NH4HCO3 aqueous solution.

Tryptic digestion of rPrismalin-14 for preparation

of DN
Tryptic digestion was performed by the some method as
described previously [13]. In brief, rPrismalin-14 (5 lg) was
dissolved in 300 lL of 2 m urea 1% NH4HCO3. To this
solution, 1 lg of trypsin (Sigma, St. Louis, MO) was
added. The mixture was incubated for 18 h at 37 C with
shaking, and 200 lL of 1 m HCl was added to stop the
digestion. The digest was separated by RP-HPLC using the
same column and the same conditions as used for the separation of the His-tag removed proteins. The puried samples were freeze-dried and dissolved in a 0.1% NH4HCO3
aqueous solution.

Assessment of inhibitory activity on calcium

carbonate precipitation
The inhibitory activity of the recombinant proteins on calcium carbonate precipitation from its supersaturated solution was assessed according to the method of Inoue et al.
[26], which was modied from that of Wheeler et al. [25]
for a small scale. In brief, the formation of calcium carbonate precipitates was followed by the turbidity of the solution containing 100 lL of 20 mm NaHCO3 (pH 8.7) and
10 lL of the sample solution in the same solution, after
100 lL of 20 mm CaCl2 was added to the solution. The turbidity of the solution was measured every minute for 5 min
by the absorbance at 570 nm with a spectrophotometer
(U-2000 A, Hitachi, Tokyo, Japan).

Purification of the recombinant proteins

The recombinant peptides recovered as a pellet were solubilized in 1% SDS 10 mm dithiothreitol solution at 80 C for
4 h, and were puried by RP-HPLC on a PEGASIL-300
C4P column (4.6 250 mm; Senshu Kagaku, Tokyo,

5164

Assessment of chitin-binding activity

A chitin-binding assay was done as described by Inoue
et al. [26] with some modications. Each recombinant

FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS

M. Suzuki and H. Nagasawa

protein or BSA as a negative control (10 lg each) was dissolved in 20 lL of 0.1% NH4HCO3, and the resulting
solution was incubated with 1.5 mg of chitin (Wako) for
12 h at room temperature. After removal of the solution,
the insoluble material was washed twice with 200 lL of
distilled water. The residue was then successively washed
with 200 lL each of 0.2 m NaCl, and 1 m acetic acid.
Each washing was passed through a Sep-Pak Plus C18
environmental cartridge (Waters, Milford, MA), which was
eluted with 80% (v v) acetonitrile 0.05% TFA. Each eluate was concentrated. The nal residue was boiled in
30 lL of 2% SDS containing 20% 2-mercaptoethanol for
15 min and the supernatant was separated by centrifugation for 1 min at 10 000 g. Each eluate was subjected to
SDS PAGE on a 15% gel under reducing conditions. After
electrophoresis, the gel was stained with CBB (Nacalai).

Preparation of an antiserum against rPrismalin-14

About 300 lg rPrismalin-14 emulsied with complete Freunds adjuvant were injected into a rabbit at every injection.
Injections were performed once every 2 weeks for 2 months.
The rabbit was immunized by intradermal routes. One week
after the last injection, the rabbit was exsanguinated under
anesthesia. The serum was prepared and stored at ) 80 C.
A preimmune serum was obtained before injection. Guidelines formulated by the Ministry of Agriculture, Forestry
and Fisheries of Japan were followed for the care and use of
animals.

Western blotting
Acetic acid-insoluble matrix proteins derived from the prismatic layer were solubilized in 1% SDS containing 10 mm
dithiothreitol, and an aliquot (3 lg) was separated by
SDS PAGE on a 15% polyacrylamide gel. The gel was
then electroblotted onto a polyvinylidene uoride membrane (Atto, Tokyo, Japan). The membrane was equilibrated with Tris-buffered saline (20 mm Tris HCl and
150 mm NaCl, pH 7.5) containing 0.1% Tween 20
(TNaCl Tris) for 10 min and incubated in a blocking solution (10% nonfat dried milk in TNaCl Tris) for 1 h at
room temperature. The membrane was washed three times
with TNaCl Tris each for 10 min and then incubated with
an anti-rPrismalin-14 serum at a dilution of 1 : 5000 (v/v)
in TNaCl Tris for 1 h at room temperature. As a control,
another membrane carrying the same matrix proteins was
immersed in a solution containing a preimmune serum at a
dilution of 1 : 3000 (v/v). After washing with TNaCl Tris
three times each for 10 min, the membranes were incubated
with goat anti-(rabbit IgG) linked with peroxidase (Funakoshi, Tokyo, Japan) diluted with the blocking solution
at 1 : 5000 (v/v) for 1 h at room temperature. The membranes were washed again in the same way described above.
Positive signals were visualized using enhanced chemilumi-

Structurefunction relationship of Prismalin-14

nescence with a lumino image analyzer, LAS-1000 Plus

(Fuji Film, Tokyo, Japan) according to the manufacturers
instructions.

Immunohistochemistry
The decalcied prismatic layer of the shell was xed overnight in 10 mm phosphate buffer (pH 7.4) containing 4%
(w v) paraformaldehyde, dehydrated in ethanol and embedded in parafn (Kantokagaku, Tokyo, Japan). Crosssections (8 lm thick) were de-parafnized in gradient
concentrations of ethanol, then rehydrated in TNaCl Tris
containing 1% BSA, and incubated with an anti-rPrismalin-14 serum or a preimmune serum at a dilution of
1 : 5000 (v/v) in TNaCl Tris overnight at 4 C. The tissue
sections were then washed three times with TNaCl Tris
and incubated with goat anti-(rabbit IgG) linked with peroxidase (Funakoshi) diluted at 1 : 5000 (v/v) for 4 h at
room temperature. These tissue sections were then stained
with a diaminobenzidine substrate kit (Funakoshi) according to the manufacturers protocol. The sections were
washed with TNaCl Tris to stop the reaction, dehydrated
in ethanol, cleared in xylene and mounted with Bioleit
(Okenshoji, Tokyo, Japan). The sections were observed
with an optical microscope (Olympus, Tokyo, Japan).

Acknowledgements
We are grateful to Mr. S. Akera of Tasaki Shinju Co.
Ltd for providing us with Japanese pearl oyster shells
and to Mr. M. Hayashi of Fisheries Research Division,
Mie Prefectural Science and Technology Center, Japan,
for the kind gift of live pearl oysters. This work was
supported by a Grant-in-Aid for Scientic Research
(No. 17GS0311) from the Japan Society for the Promotion of Science (JSPS). M. Suzuki was supported by a
Research Fellowship of JSPS for young scientists.

References
1 Mann S (2002) Biomineralization, pp. 15. Oxford
University Press, London.
2 Nagasawa H (2004) Macromolecules and biominerals of
aquatic organisms. Thalassas 20, 1524.
3 Weiner S & Addadi L (1991) Acidic macromolecules of
mineralized tissues: the controls of crystal formation.
Trends Biochem Sci 16, 252257.
4 Levi-Kalisman Y, Falini G, Addadi L & Weiner S
(2001) Structure of the nacreous organic matrix of a
bivalve mollusk shell examined in the hydrated state
using cryo-TEM. J Struct Biol 135, 817.
5 Gotliv BA, Addadi L & Weiner S (2003) Mollusc shell
acidic proteins: in search of individual functions Chembiochem 4, 522529.

FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS

5165

Structurefunction relationship of Prismalin-14

M. Suzuki and H. Nagasawa

6 Suzuki M, Sakuda S & Nagasawa H (2007) Identication of chitin in the prismatic layer of the shell and
chitin synthase from the Japanese pearl oyster, Pinctada
fucata. Biosci Biotechnol Biochem 71, 17351744.
7 Checa A (2000) A new model for periostracum and shell
formation in Unionidae (Bivalvia, Mollusca). Tissue
Cell 32, 405416.
8 Watabe N & Wilbur KM (1960) Inuence of the organic
matrix on crystal type in mollusks. Nature 188, 334.
9 Suzuki M, Nagasawa H & Kogure T (2006) Synthesis
and structure of hollow calcite particles Cryst Growth
Des 6, 20042006.
10 Miyamoto H, Miyashita T, Okushima M, Nakano S,
Morita T & Matsushiro A (1996) A carbonic anhydrase
from the nacreous layer in oyster pearls. Proc Natl Acad
Sci USA 93, 96579660.
11 Sudo S, Fujikawa T, Nagakura T, Ohkubo T, Sakaguchi K, Tanaka M, Nakashima K & Takahashi T (1997)
Structures of mollusc shell framework proteins. Nature
387, 563564.
12 Samata T, Hayashi N, Kono M, Hasegawa K, Horita C
& Akera S (1999) A new matrix protein family related
to the nacreous layer formation of Pinctada fucata.
FEBS Lett 462, 225229.
13 Suzuki M, Murayama E, Inoue H, Ozaki N, Tohse H,
Kogure T & Nagasawa H (2004) Characterization of
Prismalin-14, a novel matrix protein from the prismatic
layer of the Japanese pearl oyster (Pinctada fucata).
Biochem J 382, 205213.
14 Tsukamoto D, Sarashina I & Endo K (2004) Structure
and expression of an unusually acidic matrix protein of
pearl oyster shells. Biochem Biophys Res Commun 320,
11751180.
15 Zhang Y, Xie L, Meng Q, Jiang T, Pu R, Chen L &
Zhang R (2003) A novel matrix protein participating in
the nacre framework formation of pearl oyster, Pinctada fucata. Comp Biochem Physiol B 135, 565573.
16 Yano M, Nagai K, Morimoto K & Miyamoto H (2006)
Shematrin: a family of glycine-rich structural proteins
in the shell of the pearl oyster Pinctada fucata. Comp
Biochem Physiol B 144, 254262.
17 Liu HL, Liu SF, Ge YJ, Liu J, Wang XY, Xie LP,
Zhang RQ & Wang Z (2007) Identication and characterization of a biomineralization related gene PFMG1
highly expressed in the mantle of Pinctada fucata.
Biochemistry 46, 844851.
18 Marin F, Corstjens P, de Gaulejac B, de Vrind-De Jong E
& Westbroek P (2000) Mucins and molluscan calcication. Molecular characterization of mucoperlin, a novel
mucin-like protein from the nacreous shell layer of the
fan mussel Pinna nobilis (Bivalvia, pteriomorphia). J Biol
Chem 275, 2066720675.
19 Marin F, Amons R, Guichard N, Stigter M, Hecker A,
Luquet G, Layrolle P, Alcaraz G, Riondet C &

5166

20

21

22

23

24

25

26

27

28

29

30

Westbroek P (2005) Caspartin and calprismin, two

proteins of the shell calcitic prisms of the Mediterranean
fan mussel Pinna nobilis. J Biol Chem 280, 3389533908.
Shen X, Belcher AM, Hansma PK, Stucky GD &
Morse DE (1997) Molecular cloning and characterization of lustrin A, a matrix protein from shell and pearl
nacre of Haliotis rufescens. J Biol Chem 272,
3247232481.
Weiss IM, Kaufmann S, Mann K & Fritz M (2000)
Purication and characterization of perlucin and perlustrin, two new proteins from the shell of the mollusc
Haliotis laevigata. Biochem Biophys Res Commun 267,
1721.
Michenfelder M, Fu G, Lawrence C, Weaver JC,
Wustman BA, Taranto L, Evans JS & Morse DE
(2003) Characterization of two molluscan crystal-modulating biomineralization proteins and identication of
putative mineral binding domains. Biopolymers 70,
522533.
Fu G, Valiyaveettil S, Wopenka B & Morse DE (2005)
CaCO3 biomineralization: acidic 8-kDa proteins isolated
from aragonitic abalone shell nacre can specically
modify calcite crystal morphology. Biomacromolecules 6,
12891298.
Miyamoto H, Miyoshi F & Kohno J (2005) The carbonic anhydrase domain protein nacrein is expressed in
the epithelial cells of the mantle and acts as a negative
regulator in calcication in the mollusc Pinctada fucata.
Zool Sci 22, 311315.
Wheeler AP, George JW & Evans CA (1981) Control
of calcium carbonate nucleation and crystral growth
by soluble matrix of oyster shell. Science 212,
13971398.
Inoue H, Ozaki N & Nagasawa H (2001) Purication
and structural determination of a phosphorylated peptide with anti-calcication and chitin-binding activities
in the exoskeleton of the craysh, Procambarus clarkii.
Biosci Biotechnol Biochem 65, 18401848.
Inoue H, Ohira T & Nagasawa H (2007) Signicance of
the N- and C-terminal regions of CAP-1, a cuticle calcication-associated peptide from the exoskeleton of the
craysh, for calcication. Peptides 28, 566573.
Fujisawa R, Wada Y, Nodasaka Y & Kuboki Y (1996)
Acidic amino acid-rich sequences as binding sites of
osteonectin to hydroxyapatite crystals. Biochim Biophys
Acta 1292, 5360.
Schlesinger DH & Hay DI (1977) Complete covalent
structure of statherin, a tyrosine-rich acidic peptide
which inhibits calcium phosphate precipitation
from human parotid saliva. J Biol Chem 252, 1689
1695.
Saitou N & Nei M (1987) The neighbor-joining method:
a new method for reconstructing phylogenetic trees.
Mol Biol Evol 4, 406425.

FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS