Beruflich Dokumente
Kultur Dokumente
Keywords
biomineralization; chitin; pearl oyster;
Pinctada fucata; Prismalin-14
Correspondence
H. Nagasawa, Department of Applied
Biological Chemistry, Graduate School of
Agricultural and Life Sciences, University of
Tokyo, 1-1-1 Yayoi, Bunkyo, Tokyo 113
8657, Japan
Fax: +81 3 5841 8022
Tel: +81 3 5841 5132
E-mail: anagahi@mail.ecc.u-tokyo.ac.jp
(Received 5 July 2007, revised 7 August
2007, accepted 8 August 2007)
doi:10.1111/j.1742-4658.2007.06036.x
Abbreviations
CBB, Coomassie Brilliant Blue; GY, Gly Tyr; NaCl Pi, 10 mM potassium phosphate, 150 mM NaCl; rPrismalin-14, recombinant Prismalin-14;
TFA, trifluoroacetic acid; TNaCl Tris, Tris-buffered saline containing 0.1% Tween 20.
5158
FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS
Results
From the characteristic amino acid sequence of Prismalin-14, the whole sequence of 105 amino acid residues was thought to be structurally divided into four
regions, the N-terminal acidic region, the Pro-Ile-TyrArg repeated region, the Gly Tyr (GY)-rich region
and the C-terminal acidic region. To clarify whether
the four regions are related to function, we prepared
ve recombinant peptides, recombinant rPrismalin-14,
DN, DNDC, PIYR and GY (Fig. 1). rPrismalin-14 has
a sequence consisting of N-terminal alanine and the
full sequence of natural Prismalinin-14 containing all
the four domains. DN has a sequence of natural Prismalin-14 from position 29105 containing the PIYR,
GY-rich and C-terminal regions. DNDC has a sequence of N-terminal alanine and natural Prismalin-14
from position 2097 containing the PIYR and
GY-rich regions. PIYR has a sequence of N-terminal
alanine and natural Prismalin-14 from position 150
Fig. 1. The sequence of each fragmentary peptide of Prismalin-14. Amino acid sequences of natural Prismalin-14 (A) and its related peptides
(BF) are shown. rPrismalin-14 has a sequence of N-terminal alanine and 105 amino acids of natural Prismalinin-14 containing all the four
domains (B). DN has a sequence of natural Prismalin-14 from position 29105 containing the PIYR, GY-rich and C-terminal regions (C). DNDC
has a sequence of N-terminal alanine and natural Prismalin-14 from position 2097 containing the PIYR and GY-rich regions (D). PIYR has a
sequence of N-terminal alanine and natural Prismalin-14 from position 150 containing the N-terminal and PIYR regions (E). GY has a
sequence of N-terminal alanine and natural Prismalin-14 from position 51105 containing the GY-rich and C-terminal regions (F). pQ represents pyroglutamic acid.
FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS
5159
bodies were solubilized in 1% SDS 10 mm dithiothreitol solution. Each solution showed a major peak on
the chromatogram of the rst reverse-phase HPLC.
The histidine-tag at the N-terminal part of each recombinant peptide was removed by treatment with BrCN.
The resulting peptides were further puried by the
second reverse-phase HPLC and were analyzed by
MALDI-TOF mass spectrometry. Figure 2B,C shows
the results of PIYR as a representative. The N-terminal amino acid sequence of each recombinant peptide
was identical to that predicted from the DNA
sequence (Table 1).
In the TOF mass spectra of rPrismalin-14, DNDC,
PIYR and GY, protonated molecular ion peaks were
observed at m z 11971.0, 8678.9, 9015.8, 6164.5 and
5899.9, respectively (Table 1). These values coincided
well with the theoretical values calculated from the
amino acid sequences of the peptides, including an
additional Ala located at the N-terminus. The Met residue of rPrismalin-14 at the translation starting site
B
C
Fig. 2. The expression and purification of each fragmentary peptide. (A) SDS PAGE of the soluble and insoluble fractions after cell breakage.
Lanes 1 and 2, soluble and insoluble fractions, respectively, of cells carrying an expression plasmid (pET 28b) without any insert. Lanes 3
and 4, soluble and insoluble fractions, respectively, of cells carrying an expression plasmid (pET 28b) containing the rPrismalin-14 insert.
Lanes 5 and 6, soluble and insoluble fractions, respectively, of cells carrying an expression plasmid (pProEX HTc) without any insert. Lanes 7
and 8, soluble and insoluble fractions, respectively, of cells carrying an expression plasmid (pProEX HTc) containing the DNDC insert. Lanes
9 and 10, soluble and insoluble fractions, respectively, of cells carrying an expression plasmid (pProEX HTc) containing the PIYR insert.
Lanes 11 and 12, soluble and insoluble fractions, respectively, of cells carrying an expression plasmid (pProEX HTc) containing the GY insert.
Arrows indicate the expressed peptides. (B) Reverse-phase HPLC elution profile of PIYR. Arrow indicates the purified PIYR peak. Concentration of acetonitrile is indicated by the dotted line. Other recombinant proteins, rPrismalin-14, DN, DNDC and GY were purified using the
same method. Details of the chromatographic conditions are given in Experimental procedures. (C) MALDI-TOF mass spectrum of PIYR.
The value of m z 6164.5 agreed well with that (6162.7) calculated from the PIYR sequence.
5160
FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS
rPrismalin-14
DNDC
PIYR
GY rich
DN
Observed mass
m z (M + H) +
Calculated
mass
N-terminal amino
acid sequence
11971.1
9015.8
6164.5
5899.9
8678.9
11976.5
9013.8
6162.7
5903.0
8677.2
AQYFFRGGDD
ANGYFGYFPR
AQYFFRGGDD
AYGYGYGGFN
FSYPIYRPIY
was removed in the E. coli cells, possibly by a methionine aminopeptidase. These results indicated that
rPrismalin-14, DNDC, PIYR and GY were correctly
translated. DN was obtained by tryptic digestion of
rPrismalin-14 using the method reported previously
[13]. A protonated molecular ion peak of DN was
observed at m z 8678.9 (Table 1). The N-terminal
amino acid sequence analysis of DN also assured its
structure (Table 1).
rP-14
N
NC
PIYR
GY
BSA
FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS
5161
(kDa)
94
67
43
30
20.1
14.4
5162
Discussion
Various organic matrices in calcium biominerals have
been identied from both proteins and cDNAs. However, functional studies of them have scarcely been
performed, although acidic nature is thought to be
important for interaction with calcium carbonate or
calcium ions. In this study, we aimed at clarifying the
function of partial sequences of a matrix protein,
Prismalin-14, in more detail. We analyzed the structurefunction relationships and examined immunohistochemical localization of Prismalin-14 in the
prismatic layer of the shell.
In the present study, for estimation of the ability of
Prismalin-14 and its related peptides to interact with
calcium carbonate we used the calcium carbonate precipitation assay rst developed by Wheeler et al. [25]
and later modied by Inoue et al. [26] for a small
scale. As was expected, the two acidic parts of Prismalin-14 were found to be responsible for interaction with
calcium carbonate, because the recombinant peptides
having the acidic parts showed inhibitory activity on
calcium carbonate precipitation. The inhibitory activity
in this in vitro assay simply means the ability of a
matrix protein to be able to bind to the surface of calcium carbonate microcrystals to inhibit crystal growth.
This interaction may reect calcication of the shell
in vivo. Acidic regions were present in many matrix
proteins from various biominerals. CAP-1 has an
Asp-rich region and a phosphoserine residue at the
C-terminal part, both of which are responsible for the
inhibitory activity on calcium carbonate precipitation
[27]. The Glu-rich region of osteonectin was found to
bind to hydroxyapatite, and the six consecutive Glu
sequence were bound to the hydroxyapatite strongly
[28]. Statherin has a phosphoserine residue and a GluGlu sequence in the N-terminal region, and this region
is thought to be interact with hydroxyapatite [29,30].
In the present study, the removal of Asp-rich regions
from Prismalin-14 reduced the inhibitory activity on
calcium carbonate precipitation, indicating that the
N- and C-terminal Asp-rich regions bind to calcium
carbonate crystals. As Prismalin-14 was also known to
bind calcium ions [13], these acidic regions may be
associated with the ability to bind calcium ion.
As Prismalin-14 was isolated from the insoluble fraction of organic matrices in the prismatic layer, Prismalin-14 was thought to bind to some insoluble organic
framework. Our recent study revealed the existence of
chitin, an insoluble polysaccharide, in the prismatic
layer of P. fucata [6], indicating that Prismalin-14
probably binds to chitin. In the chitin-binding
experiment, DNDC, which had no acidic regions
FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS
100 m
B
showed chitin-binding activity comparable to rPrismalin-14, indicating that the central region of Prismalin-14
is important for chitin binding. The central region has
two characteristic regions; the PIYR repeat and the
GY-rich region. The secondary structure prediction
revealed that the PIYR repeat forms the b-strand
structure. As the GY-rich sequence has been observed
in extracellular matrices such as keratin, the GY-rich
sequence of Prismalin-14 may also form the structural
motif termed the glycine loop. The glycine loop generally contributes to the elasticity and exibility of the
molecular conformation. The Rebers-Riddiford chitinbinding motif found in cuticle proteins and the
chitin-binding domain of chitinases are known to form
b-sheet structure to bind chitin. Therefore, we rst presumed that the PIYR repeat bound to chitin because
of its predicted b-strand structure, but actually the
GY-rich region was found to be responsible for chitin
binding. As the GY-rich sequence has never been
reported as a chitin-binding sequence, the GY-rich
region of Prismalin-14 may contain a novel chitinbinding motif.
From the chitin-binding ability and acid-insoluble
nature of rPrismalin-14, Prismalin-14 may be bound to
chitin in vivo. Our previous work revealed that the
organic framework including chitin remained insoluble
after decalcication with acetic acid [6]. In the immunohistochemical analysis of the acid-treated insoluble
material, the signal was observed along the framework.
100 m
Experimental procedures
Construction of expression plasmids
rPrismalin-14 was prepared as follows. Two oligonucleotide
primers were designed based on the nucleotide sequence of
the cDNA encoding Prismalin-14 [13]. The N-terminal primer (recom5: CCATGGGCTCGCTCTTCGACCCTTCG
TG) contained the NcoI site (italics) and an additional two
nucleotide residues (bold characters) to adjust the reading
frame. The C-terminal primers (recom3: GAATTCTTA
CCCGACCATCTGTACGGCTT) contained the EcoRI site
(italics) and a stop codon (bold characters). PCR was
performed with recom5 and recom3 using the plasmid
containing the Prismalin-14 cDNA as template. The
FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS
5163
5164
FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS
protein or BSA as a negative control (10 lg each) was dissolved in 20 lL of 0.1% NH4HCO3, and the resulting
solution was incubated with 1.5 mg of chitin (Wako) for
12 h at room temperature. After removal of the solution,
the insoluble material was washed twice with 200 lL of
distilled water. The residue was then successively washed
with 200 lL each of 0.2 m NaCl, and 1 m acetic acid.
Each washing was passed through a Sep-Pak Plus C18
environmental cartridge (Waters, Milford, MA), which was
eluted with 80% (v v) acetonitrile 0.05% TFA. Each eluate was concentrated. The nal residue was boiled in
30 lL of 2% SDS containing 20% 2-mercaptoethanol for
15 min and the supernatant was separated by centrifugation for 1 min at 10 000 g. Each eluate was subjected to
SDS PAGE on a 15% gel under reducing conditions. After
electrophoresis, the gel was stained with CBB (Nacalai).
Western blotting
Acetic acid-insoluble matrix proteins derived from the prismatic layer were solubilized in 1% SDS containing 10 mm
dithiothreitol, and an aliquot (3 lg) was separated by
SDS PAGE on a 15% polyacrylamide gel. The gel was
then electroblotted onto a polyvinylidene uoride membrane (Atto, Tokyo, Japan). The membrane was equilibrated with Tris-buffered saline (20 mm Tris HCl and
150 mm NaCl, pH 7.5) containing 0.1% Tween 20
(TNaCl Tris) for 10 min and incubated in a blocking solution (10% nonfat dried milk in TNaCl Tris) for 1 h at
room temperature. The membrane was washed three times
with TNaCl Tris each for 10 min and then incubated with
an anti-rPrismalin-14 serum at a dilution of 1 : 5000 (v/v)
in TNaCl Tris for 1 h at room temperature. As a control,
another membrane carrying the same matrix proteins was
immersed in a solution containing a preimmune serum at a
dilution of 1 : 3000 (v/v). After washing with TNaCl Tris
three times each for 10 min, the membranes were incubated
with goat anti-(rabbit IgG) linked with peroxidase (Funakoshi, Tokyo, Japan) diluted with the blocking solution
at 1 : 5000 (v/v) for 1 h at room temperature. The membranes were washed again in the same way described above.
Positive signals were visualized using enhanced chemilumi-
Immunohistochemistry
The decalcied prismatic layer of the shell was xed overnight in 10 mm phosphate buffer (pH 7.4) containing 4%
(w v) paraformaldehyde, dehydrated in ethanol and embedded in parafn (Kantokagaku, Tokyo, Japan). Crosssections (8 lm thick) were de-parafnized in gradient
concentrations of ethanol, then rehydrated in TNaCl Tris
containing 1% BSA, and incubated with an anti-rPrismalin-14 serum or a preimmune serum at a dilution of
1 : 5000 (v/v) in TNaCl Tris overnight at 4 C. The tissue
sections were then washed three times with TNaCl Tris
and incubated with goat anti-(rabbit IgG) linked with peroxidase (Funakoshi) diluted at 1 : 5000 (v/v) for 4 h at
room temperature. These tissue sections were then stained
with a diaminobenzidine substrate kit (Funakoshi) according to the manufacturers protocol. The sections were
washed with TNaCl Tris to stop the reaction, dehydrated
in ethanol, cleared in xylene and mounted with Bioleit
(Okenshoji, Tokyo, Japan). The sections were observed
with an optical microscope (Olympus, Tokyo, Japan).
Acknowledgements
We are grateful to Mr. S. Akera of Tasaki Shinju Co.
Ltd for providing us with Japanese pearl oyster shells
and to Mr. M. Hayashi of Fisheries Research Division,
Mie Prefectural Science and Technology Center, Japan,
for the kind gift of live pearl oysters. This work was
supported by a Grant-in-Aid for Scientic Research
(No. 17GS0311) from the Japan Society for the Promotion of Science (JSPS). M. Suzuki was supported by a
Research Fellowship of JSPS for young scientists.
References
1 Mann S (2002) Biomineralization, pp. 15. Oxford
University Press, London.
2 Nagasawa H (2004) Macromolecules and biominerals of
aquatic organisms. Thalassas 20, 1524.
3 Weiner S & Addadi L (1991) Acidic macromolecules of
mineralized tissues: the controls of crystal formation.
Trends Biochem Sci 16, 252257.
4 Levi-Kalisman Y, Falini G, Addadi L & Weiner S
(2001) Structure of the nacreous organic matrix of a
bivalve mollusk shell examined in the hydrated state
using cryo-TEM. J Struct Biol 135, 817.
5 Gotliv BA, Addadi L & Weiner S (2003) Mollusc shell
acidic proteins: in search of individual functions Chembiochem 4, 522529.
FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS
5165
6 Suzuki M, Sakuda S & Nagasawa H (2007) Identication of chitin in the prismatic layer of the shell and
chitin synthase from the Japanese pearl oyster, Pinctada
fucata. Biosci Biotechnol Biochem 71, 17351744.
7 Checa A (2000) A new model for periostracum and shell
formation in Unionidae (Bivalvia, Mollusca). Tissue
Cell 32, 405416.
8 Watabe N & Wilbur KM (1960) Inuence of the organic
matrix on crystal type in mollusks. Nature 188, 334.
9 Suzuki M, Nagasawa H & Kogure T (2006) Synthesis
and structure of hollow calcite particles Cryst Growth
Des 6, 20042006.
10 Miyamoto H, Miyashita T, Okushima M, Nakano S,
Morita T & Matsushiro A (1996) A carbonic anhydrase
from the nacreous layer in oyster pearls. Proc Natl Acad
Sci USA 93, 96579660.
11 Sudo S, Fujikawa T, Nagakura T, Ohkubo T, Sakaguchi K, Tanaka M, Nakashima K & Takahashi T (1997)
Structures of mollusc shell framework proteins. Nature
387, 563564.
12 Samata T, Hayashi N, Kono M, Hasegawa K, Horita C
& Akera S (1999) A new matrix protein family related
to the nacreous layer formation of Pinctada fucata.
FEBS Lett 462, 225229.
13 Suzuki M, Murayama E, Inoue H, Ozaki N, Tohse H,
Kogure T & Nagasawa H (2004) Characterization of
Prismalin-14, a novel matrix protein from the prismatic
layer of the Japanese pearl oyster (Pinctada fucata).
Biochem J 382, 205213.
14 Tsukamoto D, Sarashina I & Endo K (2004) Structure
and expression of an unusually acidic matrix protein of
pearl oyster shells. Biochem Biophys Res Commun 320,
11751180.
15 Zhang Y, Xie L, Meng Q, Jiang T, Pu R, Chen L &
Zhang R (2003) A novel matrix protein participating in
the nacre framework formation of pearl oyster, Pinctada fucata. Comp Biochem Physiol B 135, 565573.
16 Yano M, Nagai K, Morimoto K & Miyamoto H (2006)
Shematrin: a family of glycine-rich structural proteins
in the shell of the pearl oyster Pinctada fucata. Comp
Biochem Physiol B 144, 254262.
17 Liu HL, Liu SF, Ge YJ, Liu J, Wang XY, Xie LP,
Zhang RQ & Wang Z (2007) Identication and characterization of a biomineralization related gene PFMG1
highly expressed in the mantle of Pinctada fucata.
Biochemistry 46, 844851.
18 Marin F, Corstjens P, de Gaulejac B, de Vrind-De Jong E
& Westbroek P (2000) Mucins and molluscan calcication. Molecular characterization of mucoperlin, a novel
mucin-like protein from the nacreous shell layer of the
fan mussel Pinna nobilis (Bivalvia, pteriomorphia). J Biol
Chem 275, 2066720675.
19 Marin F, Amons R, Guichard N, Stigter M, Hecker A,
Luquet G, Layrolle P, Alcaraz G, Riondet C &
5166
20
21
22
23
24
25
26
27
28
29
30
FEBS Journal 274 (2007) 51585166 2007 The Authors Journal compilation 2007 FEBS