Sie sind auf Seite 1von 324

Distance Learning Programmes Division (DLPD)

KVPY

Kishore Vaigyanik Protsahan Yojana (KVPY)

Question Paper Booklet


(Year 2007 to 2014)

Stream-SB+2 for Class-XII

INDEX
CLASS-XII

S. NO.

PAGE NO.
KVPY TEST PAPER FOR STREAM-SB+2

1.

Year-2007

1-16

2.

Year-2008

17-31

3.

Year-2009

32-46

4.

Year-2010

47-67

5.

Year-2011

68-84

6.

Year-2012

85-100

7.

Year-2013

101-116

8.

Year-2014

117-130
HINTS & SOLUTIONS

1.

Year-2007

131-151

2.

Year-2008

152-171

3.

Year-2009

172-195

4.

Year-2010

196-218

5.

Year-2011

219-236

6.

Year-2012

237-253

7.

Year-2013

254-272

8.

Year-2014

273-283

15RDLP

Copyright reserved
All right reserved. Any photocopying, publishing or reproduction of full or any part of this study material is strictly prohibited.
This material belongs to only the enrolled student of RESONANCE. Any sale/resale of this material is punishable under law.
Subject to Kota Jurisdiction only

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2007
Time : 3Hr.

1.

Max. Marks : 160

In Year 2007, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90),Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2008
Time : 3Hr.

1.

Max. Marks : 160

In Year 2008, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90), Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2009
Time : 3Hr.

1.

Max. Marks : 160

In Year 2009, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90), Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2010
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2011
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2012
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

YEAR-2007 (KVPY-STREAM-SB+2)
PART-I (1 Mark)
MATHEMATICS
1.

The coefficient of x4 in the expansion of (x1/2 x2/3) is :


(A) 0
(B) 7
(C) 35

z
2.

The number of complex number z such that


(A) 2

3.

(B) 4

z
z = 1 and | z | = 1 is :
(C) 6

(D) 8

35 37
Let A be an invertible 2 2 real matrix. If A1 =
then det (12A) equals :
41 43

(A) 1728

4.

(D) 35

Given

(B) 1

n 1

n 1

(D) 1/2

(C) 4 6 1

(D) 2/6

2
: the value of
6

1 3 5 ... ( 2n 1)

(C) 12

23 3 3 ..... n3

(A) 22/3

is :

(B) 42 /3

5.

If the slope of one of the lines represented by 4ax2 + xy + 4y2 = 0 is the square of the other then a equals:
(A) 1/8
(B) 1/4
(C) 1/4
(D) 1/8

6.

Let A and B be two points on the parabola y = 2x2 + x 2 such that the origin is the midpoint of the line
segment joining A to B. The length of AB is :
(A) 2

(B) 3

(C) 2 3

(D) 2 2

7.

The triangle formed by x-axis, y - axis and the line 3x + 4y + c = 0 has inradius 1. Then the value of |c| is :
(A) 12
(B) 7
(C) 5
(D) 1

8.

Let p, q and r denote the lengths of the sides QR, PR and PQ of a triangle PQR respectively. Then
pcos2(R/2) + rcos2(P/2)
(A) equals q

(C) equals
9.

pqr
4

(B) equals

pqr
2

(D) cannot be determined with the given data

The number of solutions of the equation : 3cos2 xsin2 x sin4 x cos2 x = 0 in the interval [0, 2] is :
(A) 8
(B) 4
(C) 6
(D) 3
CLASS-XII_STREAM-SB+2_PAGE # 1

1
sin1 (1/4) then 64sin + 64cos 8sec 8cose + tan + cot equals :
2
(A) 8
(B) 4
(C) 0
(D) 1

10.

If =

11.

Let

lim
1
1
1
2
n
L = x 0 x sin x x sin 2 .... x sin n


x
x
Then
(A) L does not exist
(C) L = 0
12.

(B) L = 1
(D) L = 1

Let f (x) be a function defined on [0, 2] by :

x 3
for x 1

f(x) = 2
ax bx c for x 1
where a, b and c are constants such that f(x) has second derivative at x = 1. Then a equals :
(A) 6
(B) 3
(C) 6
(D) 3
13.

If the function f(x) = x3 3ax2 + b is strictly increasing derivative for x > 0, then which of the following is
always true ?
(A) a can take any real value
(B) a 0
(C) a < 0

(D) a 0
3

14.

The value of the integral :

xcos 2 x xdx where [x] denotes the largest integer not exceeding x is :
1

(A) 6

15.

16.

(B) 1/6

(D) 6/

1
{(2n + 1) (2n + 2) ------- (2n + n)}1/n, then nlim
f(n) equals :

n
(A) 4/e
(B) 27/ 4e
(C) 27 e/4
If f(n) =

(D) 4e

If V1, V2, V3 are unit vectors such that V1 + V2 + V3 = 0 then V1 V2 :


(A) equals

(B) equals 3/2

(C) can be any value in the interval (0,2)

17.

(C) /6

(D) can be any value in the interval (3/2, 3 )

A fair coin is tossed five times. If the out comes are 2 heads and 3 tails (in some order), then what is the
probability that the fourth toss is a head ?
(A)

1
4

(B)

2
5

(C)

1
2

(D)

3
5

18.

The number of three element subsets of {1, 2 ......10} sum of whose elements is even is :
(A) 50
(B) 60
(C) 70
(D) 90

19.

Suppose x, y are positive real numbers such that 2 log (x 2y) = logx + logy. Then value of
(A) 1

(B)

3
2

(C)

2
3

x
is :
y

(D) 4

CLASS-XII_STREAM-SB+2_PAGE # 2

20.

Let x,y and z be positive integers such that gcd(x, y, z) = 1 : x < y < z and x2 + y2 = z2. Then which of the
following is always true ?
(A) 2 does not divide x
(B) 2 does not divide z(x + y)
(C) 4 divides x + y + z
(D) 8 does not divide x + y + z

PHYSICS
21.

A block of mass m sliding down an incline at constant speed is initially at a height h above the ground.
The coefficient of kinetic friction between the incline is . If the mass continues to slide down the incline
at a constant speed, the energy dissipated by friction by the time the mass reaches the bottom of the
incline is (A) mgh/
(B) mgh
(C) p mgh/sin 0
(D) mgh sin 0

22.

The energy required to remove both electrons from the helium atom in its ground state is 79.0 eV. The
energy required to ionize helium (i.e. to remove one electron) is (A) 24/6 eV
(B) 39.5 eV
(C) 51.8 eV
(D) 54.4 eV

23.

A proton moves in the +ve z- direction after being accelerated from rest through a potential difference V.
The proton then passes through a region with uniform electric field E in the +x direction and a uniform
magnetic field B in the + y-direction, but the protons trajectory is not affected. If the experiment is
repeated using a potential difference of 2V, the proton will be (A) deflected in the +ve x- direction
(B) deflected in the ve x-direction
(C) deflected in the +ve y- direction
(D) deflected in the ve y- direction

24.

The displacement (y) of an electric wave as a function of position (x) and time (l) is given by :
y = cosx sint + cos2x sin2t
where the units of x and r are metre (m) and of time, second (s). The equation describes.
(A) a monochromatic (i.e. of fixed wavelength) wave traveling along the positive x-direction with speed 1
ms1.
(B) a traveling wave along the positive x-direction with speed 1 ms1, that is a supper position of two
harmonic waves.
(C) a stationary monochromic wave of wavelength 2 metre and angular frequency 1s1
(D) a superposition of two stationary waves of wavelengths 2 metre and metre and equal amplitudes.

25.

Two polaroids are placed 90 to each other and the transmitted intensity is zero. One more polaroid is
placed between them bisecting the angle between them. Let l be the intensity of light just after the first
polaroid. The fraction of l transmitted by the system is (A) 0

(B)

1
4

(C)

1
2

(D)

1
8

26.

A hydrogen gas filled ballon left free in a fast but uniformly moving bus (with closed doors and windows, so
not air currents) rises and touches against the ceiling of the bus. If the bus slow down quickly with uniform
retardation of magnitude
(A) The ballon displace in the direction of motion of the bus.
(B) The ballon displaces opposite to the direction of motion of the bus.
(C) The ballon remains where it was before.
(D) The ballon displaces along to the vertical determined by the ratio /g.

27.

Blamer lines of deuterium atoms, compared to those of hydrogen atom, are observed to be of (A) higher frequency
(B) higher wavelength
(C) same wavelength but reduced intensity
(D) same wavelength and intensity

CLASS-XII_STREAM-SB+2_PAGE # 3

28.

Cv
The isothermal bulk modulus of an ideal gas is - ( = C )
v
(A) P

29.

(B) P

(D)

2 1 P

Unpolarized light is incident at a plane interface from medium 1 to medium 2. With refractive indies 1 and
2 respectively. The angle of incidence l for which the reflected ray is totally plane polarized is -

2
(A) tan1
1
30.

(C) ( 1) P

2
(B) sin1
1

1
(C) sin1
2

1
(D) tan1
2

The velocity v of waves on the surface of a pool of liquid is given by the formula
(A) v2 =

g 2

(B) v2 =

g 2

(C) v2 =

g
2

(D) v2 =

1
g

( wavelength : g acceleration due to gravity : surface tension : : density)

31.

A statelite orbits around the earth at a distance r from the centre of the earth. Taking the zero of gravitational potential energy at infinity (K.E. and P.F. mean kinetic energy and potential energy respectively)
(A) Etotal = K.E. + P.E. = O
(B) Etotal = K.E.
(C) Etotal =

1
P.E.
2

(D) K.E. = P.E.

32.

When the armature coil in a motor rotates in a magnetic field, a back emf developes opposing the
applied potential v, causing a net current I in the coil. If R is the resistance the coil, the mechanical power
output of the motor is (A) I2R
(B) I
(C) VI
(D) VI + I2R

33.

A ball rolling on the floor of a uniformly moving train comes to a stop due to friction after traveling a
distance d, losing its initial kinetic energy k into heat H. For an outside observer on the ground, suppose
the same quantities have values d1, k1 and H1 respectively. Then
(A) K = K ; H = H ; d = d
(B) K K ; H = H ; d d
(C) K = K ; H H ; d = d

34.

(D) K K ; H H ; d d

A body is projected horizontal on the top of the Mount Everest with speed much greater than

2gr ,

where r is the distance of the projection point from the centre of the earth and g is the acceleration due to
gravity there. The trajectory of the body will be a (A) straight line
(B) parabola
(C) hyperbola
(D) ellipse
35.

Consider two stars A and B having equal radii but different surface temperature. The surface temperature
of A is 4000 K while that of B is 40000K. Which of the following statement is false ?
(A) A is less luminous than B.
(B) A emits more light at infrared wavelengths than it does at ultraviolet wavelength.
(C) B emits more light at ultraviolet wavelength than it does at infrared wavelength.
(D) In a given infrared wavelength bond, A emits more light than B.

CLASS-XII_STREAM-SB+2_PAGE # 4

36.

Four stars A, B, C and and X are moving with velocities as shown with respect to the interstellar medium.
An observer on a planet of the star X measures the frequencies v of the same spectral line in stars A, B
and C and finds : (Ignore planetary velocity in comparison to stellar velocities)

2v

v
(A) VA < VB > VC

37.

38.

C
2v
(B) VA < VC < VB

(C) VB < VC < VA

(D) VC < VB < VA

1
The pressure P of an ideal gas is related to mean squared speed V 2 by the relation, P = n m V 2 .
3
Where n is the number density and m is the mass of a molecule of the gas. For a mixture of non-reactive
ideal gases 1,2, ---------- this equation becomes
(A) P =

1
(n + n2 + ----) (m1 + m2 + -----) V 2
3 1

(B) P =

1
(n m + n2m2 + -----) V 2
3 1 1

(C) P =

1
(n m + n2m2 + ------) V12 V22 .....
3 1 1

(D) P =

1
1
n1 m1 V12 +
n m V 2 + ---3
3 2 2 2

Figure shows two graphs (X) and (Y) related to a charged conducting sphere of radius a and charge Q

+Q

(A) X represents potential versus distance (from the centre) graph while Y represents electric field versus
distance graph.
(B) Y represents potential versus distance graph while X represents electric field versus distance graph
(C) Both graphs show that potential and electric field are continuous throughout.
(D) Both graphs show that potential and electric field have continuous first order derivatives.

CLASS-XII_STREAM-SB+2_PAGE # 5

39.

Figure below show a charge disribution of three charge q, 2q and q located along the y-axis with the
charge 2q at centre and the other charges symetrically placed about it :

q
y
x
2q
q
The electric field along the x axis. for large x compared to the size of the distribution, varies as :
(A)
40.

1
x

(B)

(C)

x2

(D)

x3

1
x4

In a double silt experiment, two identical point sources S1 and S2 are placed on the line perpendicular to
the two slits P and Q as shown. (The figure is not to scale). The screen is placed for away compared to
the distance between the slits).

S2

S21
Screen

/////////////////////////////

When only S1 is switched on, there is an interference pattern with a peak intensity Ii. When only S2 is
switched on, there is an interference pattern with peak intensity I2 (2 < I1). When both S1 and S2 are
switched on.
(A) there will be a uniform intensity on the screen
(B) the intensity on the screen will vary from I1< I2 to I1 + I2
(C) the intensity on the screen will vary from 0 to ( 1 2 )2.
(D) the intensity on the screen will vary from 0 to (I1 + I2).

CHEMISTRY
41.

The pH of a 0.1M solution of a weak monoprotic acid having a degree of dissociation of 0.1 in water, is(A) 4.4
(B) 4.0
(C) 2.4
(D) 2.0

42.

An ambidentate ligand is (A) NO2


(B) ClO4

43.

(C) NO2

A molecule with a trigonal pyramidal structure is (A) H3O+


(B) NH4+
(C) BF3

(D) NH3
(D) CO32

44.

A molecule whose molar specific heat at high temperature assuming ideal behaviour is 9R. is
(A) C6H6
(B) NH3
(C) B2H6
(D) CH4

45.

The solubility of the hydroxide of Be, Mg, Ba and Ca in water follows the order
(A) Be > Mg > Ca > Ba
(B) Mg > Be > Ca > Ba
(C) Ca > Ba > Mg > Be
(D) Ba > Ca > Mg > Be

CLASS-XII_STREAM-SB+2_PAGE # 6

46.

The energy required to remove an electron from an isolated atom in the gas phase follows the order.
(A) C > B > Be > Li
(B) C > Be > B > Li
(C) B > C > Be > Li
(D) Be > Li > B > C

47.

The dipole moment of BeF2 is (A) 1.5 D


(B) 1.0 D

(C) 0.0 D

(D) 1.8 D

A non-planar compound is (A) [Ni(CN)4]2


(B) [NiCl4]2

(C) [PtCl4]2

(D) BCl3

48.

49.

Mass of a liquid is weighed correct to three decimal place and its volume is measured correct to one
decimal place. The density of the liquid calculated from the above data will be correct to
(A) three decimal place (B) two decimal place (C) one decimal place (D) four decimal place

50.

According to Bohrs theory, the angular momentum of the electron in the ground state of the hydrogen
atom is (A) 0
(B) 1
(C) 2
(D) 3

51.

Geometrical isomerism is not exhibited by -

(A)

(B)

Cl

Br

(C)

(D)

CO2H

52.

The acid strength of o-nitrophenol (I), m-nitrophenol (II) and p-nitrophenol (III) follows the order.
(A) I < II = III
(B) II < I < III
(C) III < I < II
(D) I < II < III

53.

In the polymerization of alkene by Zieglar-Natta reaction,the catalyst and the co-catalyst, respectively
are (A) TiCl4 and AlCl3
(B) Ti (III) and Et3Al
(C) Ti(Et)4 and Al(III)
(D) TiCl2 and Et3Al

54.

Saponification of oils gives


(A) Glycerol and alkali salts of fatty acids
(B) Glyceric acid and long chain alcohols

55.

(B) Glyceraldehyde and alkali salts of fatty acids


(D) Ethylene glycol and alkali salts of fatty acids

The expected order of boiling points of I - IV would be (I)

(II)

(III)

(IV)

(A) I < II < IV < III


(C) IV < III < II < I

(B) III < IV < II < I


(D) IV < II < III < I

56.

Azobenzene will be obtained as a major product when nitrobenzene is treated with


(A) Sn and HCl
(B) Raney Nickel/H2
(C) Zn/NaOH
(D) Pb-C/H2

57.

The order of nucleophilicity of halides is :


(A) I > Br > Cl > F
(C) Cl > Br > I > F

58.

(B) F > Br > Cl > I


(D) F > Cl > Br > I

The compound that will give lactide on heating is (A) CH3CH2CH(OH)COOH


(B) CH3CH2CH(NH2)COOH
(C) CH3CH(OH)CH2COOH
(D) CH3CH(NH2)CH2COOH

CLASS-XII_STREAM-SB+2_PAGE # 7

59.

A compound that shows a distinct colour change on treatment with alcoholic ferric chloride is (A) Anisole
(B) Aspirin
(C) Salicylic acid
(D) Methyl benzoate

60.

The order of increasing stability of carbanions in compound I-IV is -

(I)

(II) H3CO

(III) O2N

CH2

CH2

CH2

(IV) H3C

CH2

(A) III, IV, I, II

(B) IV, II, I, III

(C) III, I, IV, II

(D) II, IV, I, III

BIOLOGY
61.

Exclusion of the thymus, the primary lymphoid organs in mammals, results in severe immunodeficiency.
This due to the absence of the following in the peripheral circulation.
(A) All nature leucocytes
(B) Mature T and B cells
(C) Mature T cells
(D) Mature B cells

62.

Which of the following organelle of a mammalian cell has the genetic material transferred only from the
mother to her offspring ?
(A) Nucleus
(B) Mitochondria
(C) Endoplasmic reticulum
(D) Centrosome

63.

Water contaminated with Vibrio cholerae can be made potable


(A) By boiling alone
(B) By passing through filter
(C) By treating with chloride
(D) By freezing the water

64.

A patient suffering from splenomegaly undergoes splenectomy. Which of the following processes will be
affected ?
(A) RBC production will be stopped
(B) Removal of old RBC will be impaired
(C) Decreases in antibody production
(D) Generation of B cells will be stopped

65.

During exercise when body temperature rises, the skin capillaries dilate and receive more blood resulting
in increased heat loss. Which of the following is NOT associated with the maintenance of the body
temperature in general ?
(A) Exocrine and apocrine sweat glands.
(B) Release of bradykinin, a potent vasodilating peptide
(C) Sebum secretion from sebaceous glands
(D) Sub-cutancous fat

66.

In which of the following digestive juice are DNase and RNase found ?
(A) Gastric juice
(B)Intestinal juice
(C) Saliva
(D) Pancreatic juice

CLASS-XII_STREAM-SB+2_PAGE # 8

67.

Which of the following is NOT considered as a function of Liver ?


(A) Synthesis of vitamins
(B) Production of heat
(C) Regulation of blood sugar
(D) Stimulation of peristalsis

68.

The hypersensitive reaction in response to a type I allergen which produces characteristic symptoms is
described as allergic response. Which of the following immunoglobulin is mostly involved in this type of
cellular response ?
(A) IgA
(B) IgM
(C) IgD
(D) IgE

69.

Which of the following is NOT considered as a cause of lung carcinoma ?


(A) Cigarette smoking
(B) Atmospheric pollution
(C) Vitamin A deficiency
(D) Airborne pollens

70.

If the blood group of father is A and that of mother is B . The blood group of their child could be (A) A or B or AB
(B) AB only
(C) A or B or AB or O
(D) A or B only

71.

Certain gases in the atmosphere known as green house gas which absorbs and emits heat and contribute to global warming. Which of the following gases is not considered in the list of gases known to have
green house effect ?
(A) Carbon dioxide (CO2)
(B) Chlorofluorocarbons (CFC)
(C) Ozone (O3)
(D) Nitrous oxide (NO)

72.

Which of the following hormones would supress inflammation caused by injury ?


(A) Glucocorticoid
(B) Progesterone
(C) Thyroxin
(D) Insulin

73.

Many aquatic plants float on water during day time but sink during night because (A) During day evaporation of water increases the density of the impure water of the reservoir whereas
during night condensation of atmosphere moisture into the reservoir decreases the density of water.
(B) Accumulation of gaseous oxygen in plants makes them buoyant during day time. The oxygen is used
up during night making them heavier
(C) Lipid synthesis increases during dar time making them buoyant and the lipids are used up during the
night.
(D) Accumulation of starch by the end of the day makes them heavier and they sink into the water during
night time.

74.

If the husband is Rh+ and the wife is Rh.


(A) The couple cannot be children
(B) The couples first child may be born but they are not likely to have their second child without medical
intervention.
(C) Their first foetus will not survive but the subsequent ones will
(D) The couples reproductive life will be normal

75.

Maximal level of DNA replication in a mammalian cell occurs during.


(A) GI phase
(B) M phase
(C) S phase

76.

(D) G2 phase

Many blue green algae can be used as bio-fertilizers because .


(A) Their photosynthetic ability results in production of hydrocarbons used by the plant
(B) They reduce atmospheric nitrogen to nitrogenous compounds
(C) They serve as food for the beneficial microorganisms in soil
(D) They are toxic to the plant pests

CLASS-XII_STREAM-SB+2_PAGE # 9

77.

Which of the following oxidizes ammonia to nitrogen ?


(A) Nitrosomonas during day and night
(B) Nitosomonas only during day
(C) Rhizobium during day and night
(D) Rhizobium only during day

78.

Bioluminescence involves the emission of light from biological systems. The energy source for this light
is primarily.
(A) Heat
(B) Chemical
(C) Magnetic
(D) Photosynthesis

79.

The volume of blood pumped out by ventricle during each beat is known as stroke volume. If a healthy
adult has a pulse rate of 72 and stroke volume of 70 ml, then the cardiac output is.
(A) 70 ml/min.
(B) 72 ml/min
(C) 5040 ml/min
(D) 140 ml/min

80.

Fats provide more energy than carbohydrates because (A) Fats contain higher percentage of C and H and lower percentage of O than carbohydrates
(B) Fats gets readily oxidized than carbohydrates
(C) Fats contain higher percentage of O than C
(D) Fats can be absorbed readily by our bodies than carbohydrates

PART-II (2 Mark)
MATHEMATICS
81.

If a, b, and c are nonzero real numbers such that ab = 2 (a + b), bc = 3( b + c) and ca = 4 (c + a) then the
value of 5a + 7b + c is :
(A) 18
(B) 72
(C) 108
(D) 120

82.

Let and be nonzero real roots of the quadratic equation x2 + ax + b = 0 and + , + and
be the roots of the equation x4 + ax3 + cx2 + dx + e = 0. Then which of the following statement is
false?
(A) a = 0
(B) c = 0
(C) d = 0
(D) e = 0

83.

A point P lies on the line y = 2x in the first quadrant. Another point Q lies on the line y = 3x in the first
quandrant. Suppose QP is perpendicular to the line y = 2x and QP = 5. The distance of P from the origin
is :
(A) 7 5

84.

(B) 1/2

(D) 39

B
C
cot
is :
2
2

(C) 1/3

(D) 3

Let ABCD be a square. E and F be points on AC such that AE = EF = FC = AC/3. Then tan (EBF) equals :
(A) 3/4

86.

(C) 35

In a triangle ABC, if b + c = 3a , then the value of cot


(A) 2

85.

(B) 25

(B) 1 / 3

(C)1/2

(D) 1/3

An open box is constructed by netting squares of side length x from each the corners and of a square
sheet of side length equal to 2007. Then the sides are folded up to form a box. The volume of the resulting
box is maximum when x equals :
(A) 669
(B) 669/2
(C) 2007/2
(D) 2007/4

CLASS-XII_STREAM-SB+2_PAGE # 10

87.

The coordinates (x0,y0) of the point on the line y = x + 2 which is closed to the parabola y2 = 4x is :
(A) (0, 2)
(B) (1/2, 5/2)
(C) (5/2, 9/2)
(D) (1, 3)

88.

A polynomial p(x) = x4 + ax3 + bx2 + cx + d has roots

2 , e and and no other roots. Let I =

p( x )dx
2

and J =

p(x)dx . Then :
e

(A) I and J must have opposite signs


(B) I and J can be both positive but not both negative
(C) I and J can be both negative but not both positive
(D) we do not have enough information to compare the signs of I and J.
89.

Let z1, z2 and z3 be three complex numbers on the unit circle |z| =1. Then |z1z2 + z2z3 + z3z1| equals :
2
2
2
(A) z1 z 2 z 3

(C)

90.

(B) z1 z 2 z3

1
z z z3 z 2 z 3 z1 z 3 z1 z 2
2 1 2

(D)

1 2
z1 z 22 z 32 z1z 2 z 2 z3 z3 z1
2

All the inner angles of a - 7 gon are obtuse, their sizes in degree being distinct integers divisible by 9.
What is the sum (in degree) of the largest two angles ?
(A) 300
(B) 315
(C) 330
(D) 335

PHYSICS
91.

A cylinder of mass M and the radius R has a radially dependent density. The cylinder starts from rest and
rolls without slipping down an inclined plane of height H. At the bottom of the plane its translational speed
is (8gH/7)1/2. The rotational inertia of the cylinder is (A)

1
MR2
2

(B)

3
MR2
4

(C)

7
MR2
8

(D) MR2

92.

If a 66 cm long air column closed at one resonates at a frequency 625 Hz, the number of other possible
frequencies for resonance less than 1 kHz will be :
(A) 8
(B) 5
(C) 7
(D) 3

93.

A copper pendulum of period T0 on the ground is taken down a mine shaft to a depth d. If the thermal
expansion co-efficient of copper is (C1) and the temperature in the mine is C higher than on the

T
ground, the period changes to T. where the ratio T is given (in te first order by)
0

1
d

(A) 1 1
2
R

(B) (1 + ) 1
R

(C) (1 + ) 1
R

1
d

(D) 1 1
2
2R

(R is radius of the earth lgnore variation in density of the earths crust)

CLASS-XII_STREAM-SB+2_PAGE # 11

94.

A parallel monochromatic beam of yellow light ( = 6 107m) Next to be central bright maximum, the
angle of the first minimum in the diffraction pattern (with respect to the initial direction of the beam) is
approximately.
(A) 17
(B) 37
(C) 0
(D) 8.5

95.

In an oscillating LC circuit with negligible resistance, at a certain instant, energy is fully stored in the
capacitor. The least time it takes for the energy to be equally shared between the capacitor and the
inductor is (A)

96.

LC
4

(B)

(C)

LC
2

(D)

LC
4

A parallel plate capacitor has a plate separation d and plate area A. An u charged metal salb of thickness
a is inserted midway between the plates. The capacitance of the device is
(A) infinite

97.

LC

(B) zero

(C)

0 A
d

(D)

0 A
da

The vertical motion of a huge piston in a machine is approximately simple harmonic with a frequency f. A
block of mass m is placed on the piston. The maximum amplitude Amax of the pistons simple harmonic
motion that is possible, for the block and the piston to remain together, is given by (max : maximum
speed)
(A)

(B)

4 2 f 2

mg
f2

(C)

g
f2

2max
(D)
g

98.

In a certain region of space, electric field is along the positive z direction throughout. The field is, however,
non-uniform ; its magnitude increases uniformly along the positive z-direction at the rate of 105NC1m1.
The force and torque experienced by a system having a total dipole moment of 107 C m in the negative
z-direction are (A) 102 N in the negative z-direction ; torque = 0
(B) 102 N in the positive z-direction torque = 0
(C) Force = 0 ; torque = 102 Nm so as to decreases potential energy.
(D) Force = 102 N in the negative Z-direction, torque = 10-2 Nm so as to decrease the potential energy

99.

In one model of an atom, a positively charged point nucleus of charge Ze is surrounded by a uniform
density of negative charge up to a radius R. The atom as a whole is neutral. In this model the electric field
at a distance r from the nuelus is given by Ze r
(A) E(r) = 4
3 r <R
0 R
Ze
= 4 r 2 r > R
0
Zer

(B) E(r) =

4 0R 3

r<R

=0r>R
Ze 1
r
(C) E(r) = 4 2 3 r < R
r
R

0
=0
r>R
Ze
(D) E(r) = 4 r 2
0

1 , for all r
R

CLASS-XII_STREAM-SB+2_PAGE # 12

100.

A particular ideal gas is supplied 10.61 J of heat at a constant pressure of 1.01 105 Pa. If the volume of
the gas increases by 3 105 m3 , the gas consists of
(A) monatomic molecules.
(B) diatomic molecules.
(C) polyatomic molecules.
(D) a mixture of mono and diatomic molecules.

CHEMISTRY
101.

Optically pure 3-bromopent-1-ene upon addition of 1 mole of Br2 produces a tribromo compound. The
number of stereoisomers in the product is (A) 2

102.

(B) 4

(C) 6

(D) 3

The plot that is not valid for an ideal gas where P is the pressure and V is the volume of the gas, is -

(A) PV

(B) PV

1/V

(C)

(D)

1/P

103.

The volume of 0.1M acetic acid (pKa = 4.76) that should be added to 10ml of 0.2M sodium acetate
solution to prepare a buffer solution of pH 4.91 is (A) 14.2 ml

104.

(B) 4.0 ml

(C) 20.0 ml

(D) 70.0 ml

A hydrated salt of a bivalent metal when heated strongly produces a mixture of gases which when
bubbled through Ba(OH)2 solution produces a white solid. This solid on treatment with dilute HCl
dissolves a part of the solid leaving another part insoluble which is filtered. The filtrate on treatment with
Br2 water slowly precipitates another white solid, which is not soluble in HCl. The gas mixtures are (A) CO2 and CO

105.

(B) SO3 and SO2

(C) SO3 and CO2

(D) SO2 and CO

An electron is accelerated from rest through a potential (V) and then diffracted on a Ni crystal to
measure its wavelength (). The wavelength is related to V as (A) V

(B) 1/V

(C) V1/2

(D) 1/V1/2

CLASS-XII_STREAM-SB+2_PAGE # 13

106.

A dilute aqueous solution of a polymer of known molecular weight shows an elevation of boiling point of
water by 0.052 K. The molar boiling point elevation constant of water is 0.52 K kg mol1. Using these data(A) it is possible to calculate the relative lowering of vapour pressure of water and the magnitude of
freezing point depression, but not the osmotic pressure at 300 K.
(B) it is possible to calculate the relative lowering of vapour pressure of water, but neither the magnitude
of freezing point depression nor the osmotic pressure at 300K.
(C) it is possible to calculate the relative lowering of vapour pressure but neither the magnitude of freezing
point depression nor the osomotic pressure at 300 K.
(D) it is possible to calculate the relative lowering of vapour pressure and the osmotic pressure at 300K
but not the magnitude of freezing point depression.

107.

An organic compound fused with metallic sodium dissolves in water and the solution is divided into two
parts. One part is treated with FeSO4, boiled and filtered. In the filtrate addition of FeCl3 does not
produce any precipitate. To the other part, addition of sodium nitro prusside produces violet color. The
organic compound contains.

108.

(A) only nitrogen

(B) both bromine and nitrogen

(C) only sulphur

(D) both sulphur and nitrogen

The main product III obtained in the following reaction sequence is -

NH2

(CH3CO)2O

Me

Br2/CH3COOH

II

H2O/H

NH2

NHCOCH3

(A)

(B)
Me

Br

Me

Br

NH2

NHCOCH3

(C)

(D) Me
Br

109.

III

Br

A water droplet spreads on a clean gold surface. The droplet, however, does not spread onto a gold
surface which is pre-treated with a dilute solution of hexanethiol [CH3 (CH2)5-SH] and washed with
excess water. This is because (A) chemisorption of hexanethiol on gold surface renders it hydrophilic
(B) chemisorption of hexanethiol onto gold surface renders it hydrophobic
(C) physisorption of hexanethiol onto gold surface renders it hydrophobic
(D) physisorption of hexanethiol onto gold surface renders it hydrophilic.

110.

Ir (CO)Cl (PPh3) when reacts with O2, the oxidation state and coordination number of Iridium, respectively,
become.
(A) +1 and 5

(B) + 2 and 5

(C) + 4 and 6

(D) + 3and 6

CLASS-XII_STREAM-SB+2_PAGE # 14

BIOLOGY
111.

If our body fluid were alcohol instead of water, which of the following would happen to our body temperature if everthing else in the body remains the same (A) Temperature control would be maintained as well as it happens now
(B) We will maintain a constant temperature of 37C
(C) Fluctuations of body temperature will be more since alcohol has a lower specific heat capacity
(D) We will feel feverish all the time

112.

A gene has two alleles A and a with a frequency of p and q respectively the genotypic frequencies would
have the proportion :
(A) (p + q)2 = 1
(B) p2 q2 1
(C) pq = 1/2
(D) (p q)2 = 1

113.

At low concentrations sodium ions are good for the heart, but excess of the same results in hypertension
or high blood pressure. This is because.
(A) The balance between Na and K ions is destroyed
(B) Blood becomes thicker with excess of Na+ ions
(C) Na+ ions narrow down the artery
(D) Water retention in kidneys increases with excess Na ions and heart requires to pump more

114.

When Edward Jenner inoculated Joseph with the cow pox pustules from a milkmaid, the small boy did
not get small pox because (A) Pustules contained lgG against small pox which gave passive immunity to Joseph
(B) Pustules contained IFN which killed the small pox virus
(C) Pustules contained cow pox virus which gave protection against small pox
(D) Pustules contained immune cell which gave protection against small pox

115.

Camoulflage and Mimicry are adaptations in animals. Which of the following statement is NOT correct ?
(A) Camouflaging represents the ability of the animal to blend with surrounding.
(B) Mimicry means one specie imitates or resembles another species to gain some benefit.
(C) Mimicry helps to escape from predators
(D) Camouflaging is only meant for desert animals.

116.

Heparin secreted by the mast cells present in the inner walls of the blood vessels is known to inhibit blood
coagulation. Which of the following statement is NOT correct ?
(A) It help neutralizing the action of thrombin
(B) It prevents conversion of prothrombin to thrombin
(C) It prevents conversion of fibronogen to fibrin
(D) It was originally isolated from liver cells

117.

During winter, frost often kills plants because.


(A) It leads to crystallization of cellular water
(B) Low temperature decreases the rates of catabolic pathways to an extent that the energy produced is
inadequate to sustain life
(C) Low temperatures decreases the rate of anabolism to an extent that the rate of ATP production is far
lower than the rate of ATP consumed
(D) The water in soil is frozen and the roots are unable to transport it to various parts of the plant

CLASS-XII_STREAM-SB+2_PAGE # 15

118.

If the two genes A and B on a chromosome are located next to each other (A) Chances of crossing over between them are very low
(B) Chances of crossing over between them are very high
(C) The two genes serve as single unit when it comes to accumulation of mutations within them
(D) Then of the two genes one has to be nonfunctional gene for the crossover to occur in between the two

119.

Contractile vacuoles in amoeba


(A) Accumulate water and burst upon fusion with the cell membrane releasing water from the cell
(B) Are organelles that accumulate nutrients
(C) Are responsible for locomotion of amoeba
(D) Provide a surface for attachment of ribosomes

120.

During the course of intensive exercise, muscle fatigue occurs because.


(A) During exercise entire deposit of glucose is converted to CO2 and H2O
(B) O2 deficiency results in accumulation of lactic acid in the muscles
(C) O2 deficiency results in accumulation of citric acid in the muscles
(D) Excessive utilization of glucose results excessive production of acetyl Co A which is not fully utilized
by the TCA cycle (Krebs cycle).

*****

CLASS-XII_STREAM-SB+2_PAGE # 16

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2007
Time : 3Hr.

1.

Max. Marks : 160

In Year 2007, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90),Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2008
Time : 3Hr.

1.

Max. Marks : 160

In Year 2008, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90), Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2009
Time : 3Hr.

1.

Max. Marks : 160

In Year 2009, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90), Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2010
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2011
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2012
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

YEAR-2008 (KVPY-STREAM-SB+2)
PART-I (1 Mark)
MATHEMATICS
1.

The equation z2 = z , where z is a complex number, has


(A) 4 solution
(B) 2 solution
(C) no solution
(D) infinitely many solutions

10

2.

x 1
x 1

is :
The coefficient of the term independent of x in the expansion of 2 / 3
1/ 3
x 1 x x 1/ 2
x
(A) 35

3.

(B) 70

(C) 105

If no two of the real numbers a, b, c are equal and


(A) abc = 1

(B) a + b + c = 1

(D) 210

a a2

a3 1

b b2

b3 1

c3 1

c c

= 0, then :

(C) a + b + c = 0

(D) ab + bc + ca = 0

4.

If the slopes of one of the lines represented by ax2 6xy + y2 = 0 is the square of the other for some
positive value of a, then a is
(A) 1
(B) 2
(C) 4
(D) 8

5.

The number of distinct points common to the curves x2 + 4y2 = 1 and 4x2 + y2 = 4 is
(A) 0
(B) 1
(C) 2
(D) 4

6.

An ellipse has its major axis equal to the diameter of a circle and the area of the ellipse is one-third the
area of the circle. The eccentricity of the ellipse is :
(A)

7.

9.

(B)

2
3

(C)

2 2
3

(D)

1
3

Two perpendicular chords AB and CD of a circle meet at P. If PA = 2, PB = 18 and PC = 4, then the


diameter of the circle is :
(A)

8.

2
3

5 17
2

(B) 5 17

(C) 20

The value of cos 5 + cos 10 + cos 15 + .......+ cos 355 is


(A) 0
(B) 1
(C) 1

(D) 10 5

(D) 71 cos 5arc

In a square ABCD, points P on BC and Q on CD are such that AP = 4, PQ = 3 and QA = 5. The area of
ABCD is
(A)

256
15

(B) 16

(C)

256
17

(D)

256
18

CLASS-XII_STREAM-SB+2_PAGE # 17

10.

In a triangle ABC, AD bisects A. Suppose AC = 2, BD = 2, DC = 1. The value of cos B is


(A)

11.

12.

6
7

(B)

7
8

(C)

8
9

(D)

9
10

The sides of a triangle are 9x + 1, 6x + 2, 3x + 3, where x is a positive integer. If the area is also an integer,
the number of admissible values of x in the set {1, 2, 3........., 20} is :
(A) 3
(B) 4
(C) 6
(D) 12

f (1 h)
Suppose f is a real function defined on R and hlim
exists. Then :
0
h
(A) f is not continuous at 1
(B) f is not continuous at 1 but not differentiable at 1
(C) f is differentiable at 1
(D) f is differentiable at 0

13.

14.

Consider the following statements :


(I) The derivative of an odd differentiable function is always even.
(II) If f(x) is differentiable at a point x0 and g(x) is not differentiable at x0, then f(x) g(x) is not differentiable
at x0.
Which of the following is true ?
(A) I and II are both true
(B) I is true and II is false
(C) I is false and II is true
(D) I and II are both false

sin[ x ]
, if [ x ] 0

If f(x) = [ x ]
. (Here [x] denotes the integer part of x.) Then xlim
f(x)
0
0,
if [ x ] 0
(A) is 1

15.

(B) is 0

Let f : [0, ) R be defined by f(x) = x


(A) [ 1/2, )
x

16.

Let f(x) =

(B) [0, )

x . Then the range of f is

(C) { 1/4, )

(D) R

(B) ( 2, 1)
1

18.

The value of

(A)

x +

(D) does not exist

e (t 1)(t 2) dt .Then f(x) decreases in the interval

(A) ( , 2)
17.

(C) is sin 1

(C) (1, 2)

(D) (2, )

x | x |3 / 2 dx is :

4
7

(B)

4
5

(C)

4
3

(D) 0

Let fn(x) = log log ....log(x), where log is repeated n times. Then

x f ( x)f (x)......f
1

(A) f11(x) + c

1dx

10 ( x )

(B)

is equal to :

f11( x )
c
11

(C) 10f10(x) + c

(D) 11f11(x) + c

CLASS-XII_STREAM-SB+2_PAGE # 18

19.

The least value of x12 + x22 + x32 where x1, x2, x3 are real numbers satisfying x1 + 2x2 + 3x3 = 4 is
8
(A)
(B) 1
(C) 4
(D) 2
7

20.

A coin is tossed until one observes a sequence of exactly three tails. The probability that the experiment
comes to an end at 7-th toss is .
(A)

7
128

(B)

1
128

(C)

1
32

(D)

5
128

PHYSICS
21.

Super cooled steam suddenly freezes to water. In this process,


(A) entropy of the system (steam) decreases, but entropy of the universe increases
(B) entropy of the system as well as entropy of environment decreases
(C) entropy of the system as well as entropy of the environment increases
(D) entropy of the system increases but entropy of the environment decreases

22.

Isothermal compressibility of a substance is defined as :


=

1 V

V P T

where the derivative is taken keeping T constant.


V : Volume
P : Pressure
T : Temperature
For an ideal gas, equals
(A) R (Gas constant)
(B) P
(C) P1
(D) P ( is the ratio of specific heats at constant pressure and constant volume = (Cp/ Cv)
23.

Consider two cases :


(i) A point charge q at the origin
(ii) A uniformly charged solid sphere of radius R (wth its centre at the origin) and total charge q.
Given below are graphs of a property X versus distance r from the origin for the two cases. The graphs
coincide for r R.

(A) X is electric potential due to point charge/charged sphere.


(B) X is magnitude of electric field due to point charge/charged sphere
(C) X is electrostatic potential energy of point charge/charged sphere
(D) X is charge density in space.

CLASS-XII_STREAM-SB+2_PAGE # 19

24.

One end of a cylindrical solid rod of length L and radius r is clamped in a fixed positon. The other end is
turned by an external torque resulting in a twist . The sheer modulus is given by . The twist angle is
proportional to :
(A) r1/L2
(B) r4/L
(C) L/r4
(D) L /r4

25.

A particle of charge q and mass m moves in a cirular orbit with angular momentum given by l . The ratio

of its magnetic moment to orbital angular moment l is given by


(A)

26.

q
m

(B) q

(C)

q
2m

(D) m q

Thermal motion of atoms in a gas causes the spectral line emitted by the atoms to be shifted at random
towards both the red and blue. This leads to Doppler broadening of the spectral lines. If f is the frequency
of the spectral line and f is a measure of broadening of the line, the ratio

f
is proportional to
f

(Proportionality constant is given to be dimensionless)

m
(A)

kT

(B)

kT
m

(C)

mkT

(D)

1 kT
c m

27.

Consider a sinusoidal travelling wave along a string, with amplitude A and wave velocity v. The power
carried by the wave is proportonal to
(A) Av2
(B) AV
(C) A2v2
(D) A2 v
(The proportionality constant is not dimensionless)

28.

Monochromatic light falls on a pair of slits mounted 24 cm in front of a photographic film. After exposure,
the film shows a series of bright bands spaced 0.20 cm apart. The separation between the slits is 6.0
10-3 cm. The wavelength of light is :
(A) 600 nm
(B) 400 nm
(C) 500 nm
(D) 560 nm

29.

Two clean mercury droplets when pushed into contact spontaneously coalesce to form a single droplet.
The single droplet so formed will :
(A) Be slightly warmer than the separate pair of droplets
(B) Be slightly cooler than the separate pair droplets
(C) Have the same temperature as the separate pair of droplets
(D) Be warmer or cooler depending on the size of each initial droplet.

30.

The speed of a comet at perihelion (closest to the sun) is 5.6 104 ms1, while its distance from the sun
is 9.0 1010m. At aphelion (farthest from the sun) its distance is 5.6 1012m. The comets aphelion speed
is :
(A) 1.0 km s1
(B) 900 ms1
(C) 504 ms1
(D) 5.6 104 ms 1

31.

Consider two wave forms


y1 = A cos (k x t) and y2 = A cos (k x + t)
whose superposition forms a standing wave. Here x is in metres and t is in seconds. A node is found at
x = 10 m. The longest wavelength possible for this situation is
(A) 1 m
(B) 40 m
(C) 20 m
(D) 10 cm

CLASS-XII_STREAM-SB+2_PAGE # 20

32.

The displacement x of a damped oscillator in one dimension is given by


x(t) = A e t sin (t + )
where x is in metres. The SI units of the constants A, , , are respectively
(A) m, s1, s1, dimensionless
(B) m, s, s1, m
(C) m, s1, s, dimensionless
(D) dimensionless, s1, s1, dimensionless

33.

In the following reaction, a proton bombards a lithium nucleus at rest producing two -particles :
Li7 + 1H1 2 2He4
3
The total rest mass of the products is less than the total rest mass of the reactants by 0.01864 atomic
mass unit (amu). By mass-energy conversion formula, 1 amu = 931 MeV approximately. This means that
(A) The kinetic energy of the proton 17.4 MeV
(B) The total kinetic energy of two - particles is more than the kinetic energy of the proton by 17.4 Mev
(C) Each -particle has a kinetic energy of 8.7 MeV.
(D) The protons kinetic energy is 8.7 MeV more than that of each -article

34.

The radius of the first (n = 1) orbit in Bohrs model of hydrogen atom is 0.53 1010 m. (Plancks constant
h = 6.63 1034 Js, mass of electron = 9.11 1031 kg). The speed of the electron in this orbit is
approximately
(A) 3.0 1010 m s1
(B) 1.4 107 m s 1
(C) 3.5 107 m s 1
(D) 2.2 107 m s 1

35.

In an electric motor, two parallel wires 60 cm long are separated by a distance of 1.5 cm. The wires have
non-magnetic insulation between them. A short circuit in the motor results suddenly in a large current of
4000 A. The currents flow in opposite directions in the two wires. Then
(A) There will be a repulsive force of 128 N on each wire
(B) There will be an attractive force of 128 N on each wire
(C) There will be no force experienced by any wire, since they are insulated.
(D) There will be a force along the length of each wire, of magnitude128 N.

36.

Let be the typical de Broglie wavelength associated with an He atom in helium gas at room temperature
T (20C) and pressure P(1 atmosphere).Let d be the mean separation between helium atoms under these
conditions.Then
(A) is greater than d under the given T and P.
(B) is less than d under the given T and P.
(C) is equal to d under the given T and P
(D) The ratio of to d has no relation to T or P.

37.

In a plane electromagnetic wave of frequency f traveling in free space with speed c, the electric field
magnitude E and magnetic field amplitude B are related ( In S.I. units) by
(A) B = fE

38.

(C) B =

E
c

(D) E = fB

A resistor R and a capacitor C are connected in series to a 220 V, 50 Hz a.c. source. Let VR and Vc be the
r.m.s. voltages across R and C respectively. Then
(A) VR = Vc = 220 V

39.

(B) B = cE

(B) VR Vc = 220 V

(C) Vc VR = 220 V

(D)

VR2 VC2 = 220 V

Two identical point sources P and Q vibrating in phase with the same amplitude generate sinusoidal
waves on a water surface.The sources are 6.5 cm apart. Two nearest points (from P) of destructive
interference along PQ are found to be at 0.7 cm and 2.4 cm from P. The total number of points of
destructive interference on the line segment PQ is
(A) 4
(B) 3
(C) 2
(D) 5

CLASS-XII_STREAM-SB+2_PAGE # 21

40.

An ideal gas is subjected to an isothermal -isochoric cycle 1 2 3 4 1 as shown.


V

On the pressure - density (P-) graph, this cycle is represented by

4
3

1
4

(A)

(B)

P
2

2
3

3
1

1
4
4

(C)

(A) Graph (A)

(D)

(B) Graph (C)

(C) Graph (B)

(D) Graph (D)

CHEMISTRY
41.

Li metal is a better reducing agent than Na metal because (A) The ionization enthalpy of Li is lower than that of Na
(B) The hydration enthalpy of Li is lower than that of Na
(C) The ionization enthalpy of Li is higher than that of Na
(D) The hydration enthalpy of Li is higher than that of Na

42.

One mole each of the two gases X and Y are stored separately in two cylinders at 25C at pressures 1
atm. and 2 atm, respectively. The difference in the compressibilities of the two gases. (kx ky) is
(A) 0.1 atm1
(B) 0.5 atm1
(C) 1.0 atm1
(D) 2.0 atm1

43.

(S)-lactic acid is
OH

OH
(A)

(B)

CO2H

OH

OH
(C)

CO2H

(D)

CO2H

CO2H

CLASS-XII_STREAM-SB+2_PAGE # 22

44.

45.

The reaction between p-methylbenzaldehyde and NaOH is an example of (A) Aldol condensation reaction

(B) Cannizzarro reaction

(C) Disproportionation reaction

(D) Hydrolysis reaction

A saturated solution of BaSO4 is heated from 25C to 35C and the conductance of the solution and the
solubility of BaSO4 are measured. It is found that :
(A) both conductance and solubility increase
(B) both conductance and solubility decrease
(C) conductance increases but solubility decreases
(D) conductance decreases but solubility increases.

46.

An ideal gas is subjected to a cyclic change as shown in the P-V diagram below :

A
P

V
The step in which the gas will cool down is along
(A) AB
47.

(B) BC

(A) (3Z)-hept-3-en-1-ol

(C) (3Z)-hept-4-en-7-ol

(D) (3E)-hept-4-en-7-ol

is

(B) (3E)-hept-3-en-1-ol

The Lewis acid strength of BF3, BCl3 and BBr3 follows the order.
(A) BBr3 > BCl3 > BF3

49.

(D) both BC and CA

The IUPAC name of

OH

48.

(C) both AB and CA

(B) BF3 > BCl3 > BBr3

(C) BCl3 >BBr3 > BF3

(D) BCl3 > BF3 > BBr3

The total number of possible geometrical and optical isomers for [CoCl2(en)2]+ (en = 1, 2-diaminoethane)
is (A) 1

50.

(B) 2

(C) 3

(D) 4

In balancing the reaction.


xH2S + 2NaNO3 + 2HCl = y S + zNO + kNaCl + 4H2O
one would get x,y, z and k, respectively, as
(A) 3,3,2 and 2

51.

(B) 2,2,3 and 3

(C) 3,3,4 and 4

(D) 4,4,3 and 3

The overall order of a reaction involving two reactants, X and Y, which follows the rate expression,Rate
= k [X]1/3 [Y]2/3 . Where k is the specific rate and [ ] represents concentration, is (A) 2/3

(B) 0

(C) 1/3

(D) 1

CLASS-XII_STREAM-SB+2_PAGE # 23

52.

In a Daniel cell in operation :


(A) Electrons flow externally from copper to zinc while anions flow from zinc to copper in solution.
(B) Electrons flow externally from zinc to copper while anions flow from zinc to copper in solution.
(C) Electrons flow externally from zinc to copper while anions flow from copper to zinc in solution.
(D) Electrons flow externally from coppper to zinc while anions flow from copper to zinc in solution.

53.

In the pressure vs. molefraction of benzene curves/lines shown below, the total vapour pressure of an
ideal mixture of benzene and toluene will follow the curve/line.

0.5
2
P(bar)

3
4

0.0
0.0

(A) 1
54.

(D) [Fe(H2O)6]2+

(B) SO2

(C) SO3

(D) O2

(B) O22 > O2 > O2+

(C) O2 > O22 > O2+

(D) O2+ > O22 > O2

(B) Polyvinylchloride

(C) Teflon

(D) Bakelite

(B) 200 s

(C) 0.05 s

(D) 100 s

(C) 6

(D) 8

The number of facial atoms in a fcc unit shell is (A) 2

60.

(C) [FeCl4]2

The half-life of ammonia adsorbed on a Ni surface if the rate of desorption is 6.93 103 s1 , is (A) 0.01 s

59.

(B) [Fe(CN)6]3

A naturally occuring polymer is


(A) Amylose

58

(D) 4

The interatomic distance in O2+, O2 , and O22 follow the order


(A) O2+ > O2 > O22

57.

(C) 3

The gas formed when conc. H2SO4 is added to a mixture of NaCl and MnO2, is (A) Cl2

56.

(B) 2

sp3d2 hybridization explains the bonding in


(A) [FeCl4]

55.

1.0

molefraction (benzene)

(B) 3

The maximum amount of work produced by a heat engine operating between 200 K and 800 K, if 100 J of
heat is absorbed from the hot reservoir, is (A) 100 J

(B) 75 J

(C) 50 J

(D) 25 J

CLASS-XII_STREAM-SB+2_PAGE # 24

BIOLOGY
61.

62.

Embryonic stem cells are derived from,


(A) Inner cell mass of the blastocyst
(C) Cells from morula

(B) Outer cell mass of the blastocyst


(D) Cells from the placenta

The phase in which meiotic recombination occurs


(A) Diplotene
(B) Zygotene
(C) Pachytene

(D) Diakinesis

63.

SCID (Severe Combined Immuno Defficiency Syndrome) patients do not have


(A) T-lymphocytes
(B) Platelets
(C) Monocytes
(D) Erythrocytes

64.

What is the maximum number of hydrogen bonds possible involving a water molecule ?
(A) 0
(B) 1
(C) 2
(D) 3

65.

A strand of a nucleic acid having 60% of base A and 30% of base G is


(A) B-DNA
(B) A-DNA
(C) Should be an RNA

(D) Single stranded

66.

Tetracycline, cyclohexamide, and streptomycin inhibit :


(A) Transcription
(B) Translation
(C) Splicing
(D) mRNA editing

67.

In the genetic code, a nonsense codon codes for


(A) An antisense amino acid
(B) A sensible amino acid
(C) Does not code for any amino acid
(D) Methionine

68.

The dinosaurs became extinct at the end of the following period :


(A) Cambrian
(B) Cretaceous
(C) Ordovician

(D) Silurian

The anticoagulant most commonly used in blood banks is :


(A) EDTA
(B) Heparin
(C) Sodium Citrate

(D) Hirudin

69.

70.

Totipotent cell is
(A) A cell which can be differentiated into most of the cell types.
(B) A cell which can be differentiated to all cell types to form a complete organism
(C) A cell which can be differentiated into only a specific cell type
(D) A cell which does not differentiated at all

71.

You have an infection of pneumococcus (a bacteria). Which part of the bacteria may be toxic to your body
and causes immunological reaction ?
(A) The outer cell wall lipoplysaccharide
(B) The plasma membrane of the bacteria
(C) bacterial nucleus
(D) Polysomes

72.

Three nucleotides form a codon, which can code for a single amino acid. However, the same amino acid
can be coded by three different codons. These three codons are collectively called
(A) Puncture codons
(B) Degenerat codons
(C) Nonsense codons
(D) Termination codons

73.

The reason for doctors advice for vaccination of newborns is :


(A) To increase the innate immunity of the baby
(B) To increase the acquired immunity of the baby
(C) To increase both, the innate and acquired immunity of the baby
(D) To protect the baby only against bacterial diseases

CLASS-XII_STREAM-SB+2_PAGE # 25

74.

If you start a bacterial culture with 100 E. coli cells and allow the culture to grow for 2 hours, approximately what would be the total number of E. coli in the culture considering E.coli has a doubling time of
20 minutes.
(A) 102
(B) 103
(C) 105
(D) 107

75.

Bacterial Flagellar movement requires


(A) Energy through ATP hydrolysis
(B) Nutrient gradient
(C) Proton gradient coupled to transport
(D) Energy through GTP hydeolysis

76.

Which of the following bio-molecules is responsible for the prion infectious diseases
(A) DNA
(B) Protein
(C) RNA
(D) Lipid

77.

Charles Darwins Theory of natural selection was heavily influenced by :


(A) Thomas Malthus An Essay on the Principle of Population
(B) Jean-Bapiste Lamark Philosophie Zoologique
(C) Issac Newton Principia
(D) Gregor Mendel Experiments on Plant Hybridization

78.

Which one of the following chemical groups is not present in the nascent polypeptide chain of a protein ?
(A) Methine
(B) Methylene
(C) Amide
(D) Phosphate

79.

Identify the evolutionarily related proteins :


(A) Pepsin & Papain
(C) Myoglobin & Hemoglobin

80.

(B) Collagen & Collagenase


(D) Lysozyme & Ribozyme

How many peptide linkages are present in a protein with 176 residues ?
(A) 174
(B) 175
(C) 176

(D) 177

PART-II (2 Mark)
MATHEMATICS
81.

Suppose a, b, c are in arithmetic progression and a2, b2, c2 are in geometric progression. If a < b < c and
a + b + c = 3/2, the value of a is :

1
(A)

82.

(B)

1
1

2
2

(C)

(D)

1
1

3
3

Let y = g(x) be a function whose derivative g'(x) has the following graph. Which of the following values of
g is the largest ?

2
1
1
2
3
4

(A) g(2)

(B) g(3)

1 2 3 4 5

(C) g(4)

(D) g(5)

CLASS-XII_STREAM-SB+2_PAGE # 26

83.

Let ABCDEFGHI be a regular nanogon (9-sided polygon). If AB = x, AC = y, AD = z, then x, y, z are


related by
(A) z2 = x2 + xy + y2
(B) z = x + y
(C) y2 = xz
(D) 2y = x + z

84.

If A is a 10 10 matrix with entries from the set {0, 1, 2, 3} and if AAT is of the form :

0 * * *

* 0 * *
* * 0 *

* * * 0
the number of such matrices A is :
(A) (43)10
(B) (42)10
85.

(A)

1 5
2

(C)

5 2
2

(B)

88.

[ x ]e x dx equals :

e
e 1

(B)

What is the value of

/2

2006

(A)

(C) 1

e 1


cos1003 xdx

(B)

x
x

2007

/2

1
e

(D)

1
e 1

(D)

2009

cos1004 xdx ?

(C)

2008

e f ( t ) f ( x ) dt is

(A) 0

90.

e2

Let f(x) and g(x) be real polynomials of degree 4 and 3 respectively with leading coefficients 4 and 3
respectively. Then

lim g( x )

89.

2 3
2

(D) not uniquely determinable

The integral

(A)

87.

(D) 1

In an ellipse, O is the centre, AB is the major axis and CD is the minor axis. Suppose the focus between
A and O is the ortho-centre of the triangle ACD. The eccentricity of the ellipse is

86.

(C) 410

(B)

(C)

3
16

(D)

The equation of the curve through the origin satisfying the differential equation
(A) log 1 tan

(x y)
=y
2

(B) log |1 + tan(x + y)| = x

(C) log 1 tan

(x y)
=x
2

(D) log |1 + tan(x + y)| = y

4
13

dy
= sin(x + y) + cos(x + y)
dx

Let A = {1, 2, 3, 4, 5, 6} and f : A A be a bijection. What is the probability that f o f = id, i.e., f is its own
inverse ?
(A)

19
180

(B)

13
48

(C)

1
720

(D)

5
16

CLASS-XII_STREAM-SB+2_PAGE # 27

PHYSICS
91.

Two stars of masses M1 and M2 form a binary system. The distance between the centres of the stars is
d. The orbital period is given by
(A)

(B)

(C)

(D)

2 d 3
G(M1 M2 )
2d3 / 2
G(M1 M2 )
2d3 / 2
G

M1 M2
, where is the reduced mass = M M
1
2

2 d 3
G

92.

A particle is stuck on the rim of a wheel of radius 50 cm. The wheel is rotating with an angular acceleration
of 20 rad s2. If at an instant the angular speed of the wheel is 10 rad s1, the total linear acceleration of the
particle is :
(A) 10 ms2
(B) 50 ms2
(C) 51 ms2
(D) 60 ms2

93.

A beam of 30 keV electrons strikes different targets in different experiments. The lowest wave length cut
-off of the continuous spectrum of X-rays generated by beam for any target is

94.

(A) 1.0 10 10 m

(B) 3.0 10 10 m

(C) 4.14 10 11 m

(D) dependent on the nature of the target

A bat flying towards a wall with a speed 9.0 m s1 emits ultrasound of frequency 90 kHz. (Speed of
ultrasonic waves is 340 ms1) The frequency of ultrasound received by the bat after reflection from the wall
is :
(A) 90 kHz

95.

(B) 94.9 kHz

(C) 85.4 kHz

(D) 99 kHz

A cylindrical glass vessel of height 18 cm and diameter 8 cm is 4 mm thick. It is covered with a1 mm thick
copper lid (Thermal conductivity of copper is 400 W K1m1) In a cold environment the water in the vessel
has got frozen into 0C ice. It is then immersed into a tank of 15C water. (Density of ice is 0.92 103 kgm3 and
latent heat of fusion of water is 333 x 103 J kg1) The time taken for the ice to melt completely is
(A) 9.2 s

96.

(B) 46 s

(C) 18.4 s

(D) 136 s

An upright cylinder of large base area is filled with water up to height H. Water is flowing out through holes
(1, 2 and 3) of equal diameter on the side of the cylinder at heights H/4, H/2 and 3H/4 respectively. Let x1,
x2 and x3 be the respective horizontal distance covered by the water flowing out of the holes before hitting
the ground. Then
(A) x3 > x2 > x1

97.

(B) x3 < x2 < x1

(C) x2 > x1 = x3

(D) x2 > x1 > x3

Ocean tides on the Earth are caused by the gravitational effects of the Moon (for lunar tides) as well as
the Sun (for solar tides). If the diameter of the earth were to increase by 20%, then
(A) Lunar tides would be strengthened but solar tides would be weakened
(B) Lunar tides would be weakened but solar tides would be strengthened
(C) Both lunar and solar tides would be strengthened with lunar tides strengthening more than solar tides
(D) Both lunar and solar tides would be weakened with lunar tides weakening more than solar tides.

CLASS-XII_STREAM-SB+2_PAGE # 28

98.

The wavelength of radiation emitted by a hydrogen atom when it de-excites from its first excited state to
ground state (n = 2 to n = 1) is 121.7 nm. For the analogous transition in a positronium atom (bound state
of electron and its antiparticle called positron) the wavelength of radiation will be approximately
(A) 243.4
(B) 121.7
(C) 60.85
(D) 0.53

99.

The objective lens of a telescope has a diameter of 12.2 cm. The angular resolution of the telescope at the
wavelength of 500 nm is
(A) 2 10 9 rad
(B) 1.22 10 7 rad
(C) 4 10 5 rad
(D) 5 10 6 rad

100.

A conducting rod of length 80 cm rotates with its one end fixed at the centre of a circular metallic ring and
the other end in contact with the ring. The angular frequency of the rod is 300 s1. There is a uniform and
constant magnetic field of 1.0 T parallel to the axis of rotation. The emf developed between the centre and
the ring is :
(A) 48 V
(B) 192 V
(C) 36 V
(D) 96 V

CHEMISTRY
101.

The numbers of lone pairs of electrons in XeF2 and XeF4 respectively, are (A) 3 and 3
(B) 2 and 3
(C) 2 and 2
(D) 3 and 2

102.

When 4 moles of N2 gas reacts with 16 moles of H2 gas in 10 lit vessel, 4 moles of ammonia gas is
produced in the equilibrium mixture.
The equilibrium constant Kc for this reaction in mol2 lit2 is (A) 0.4
(B) 0.2
(C) 0.8
(D) 1.6

103.

The freezing point of pure benzene is 5.5 C. When 2.9 g of butane is dissolved in 200g of benzene, the
freezing point of benzene decreases to 4C. To lower the freezing point of benzene by another 1.5C, the
amount of butane that has to be added to mixture is (A) 5.8 g
(B) 2.9 g
(C) 1.5 g
(D) 8.7 g

104.

X and Y in the following reactions, respectively are


SO3H

MgBr
(i)
+

cat

(ii) H3O

OH

(A) X =

Y=
Q

OH

(B) X =

Y=

OH

(C) X =

Y=

OH
Q

OH

(D) X =

Y=

Q = Phenyl group

CLASS-XII_STREAM-SB+2_PAGE # 29

105.

The configuration at C-2 and C-5 in the following compound, respectively, are
OH
2

5
OH

(A) 2R and 5R
106.

(B) 2S and 5S

(C) 2R and 5S

The cell potential of an electrochemical cell with the cell reaction


Zn + 2Ag+ (0.0001M) Zn2+ (0.1 M) + 2Ag, is
(A) 1.25 V
(B) 1.35 V
(C) 1.45 V
Given that the standard cell potential is 1.56 V

(D) 2S and 5R

(D) 1.55 V

107.

Methyl chloride reacts with X at high temperature in the presence of a catalyst Y to give Me2SiCl2 as one
of the products. The compound can also be formed by reaction of silicon tetrachloride with an organometallic reagent, Z.
X, Y, and Z respectively,are
(A) Si, Cu, MeMgBr
(B) SiO2, Cu, Me2Zn
(C) Si, Ni, MeMgBr
(D) SiO2, Fe, Me2Zn

108.

A chemical reaction takes place at 625 K with an activation energy barrier, E/R = 500 K. A catalyst when
used in the reaction reduces the activation energy barrier to 400 K. The temperature at which the rate
constant with and without the catalyst will be same is (A) 300 K
(B) 400 K
(C) 500 K
(D) 600 K

109.

A divalent transition metal ion with valence electron configuration 3d8 forms a complex with cyanide ion.
The correct identity of the metal ion, the complex and its geometry, respectively, are
(A) Fe2+, [Fe(CN)6]4 , and octahedral
(B) Ni2+, [Ni (CN)4]2 and tetrahedral
(C) Fe2+, [Fe(CN)6]3 and octahedral
(D) Ni2+, [Ni(CN)4]2 and square planar

110.

The number of and particles to be emitted by 238U92 to give 206Pb82 , respectively, are (A) 8 and 6
(B) 4 and 3
(C) 6 and 8
(D) 3 and 4

BIOLOGY
111.

In a double-stranded DNA coding for a protein, in principle, how many codon reading frames are possible?
(A) 1
(B) 2
(C) 3
(D) 6

112.

Which of the following is advantage of meiotic recombination in diploids ?


(A) Helps in maintaining chromosome length
(B) Ensures chromosome segregation
(C) Helps chromosomes to attach to the spindle microtubules
(D) Ensures new combinations of genetic traits

113.

Plants obtain their nitrogen supply through bacteria of the soil because :
(A) Nitrogen is absent in the air and present in the soil
(B) Plants do not have a mechanism to absorb gaseous Nitrogen
(C) Bacteria are Nitrogen rich
(D) Getting nitrogen is a side-effect of a bacterial infection

CLASS-XII_STREAM-SB+2_PAGE # 30

114.

The number of genes in man (Homo sapiens) is X-fold more than in a fly (Drosophila melanogaster). The
value of X is
(A) 2
(B) 10
(C) 250
(D) 10000

115.

You are supposed to mix a 3000 bp DNA fragment and a 600 bp DNA fragment in 1 : 5 molar ratio. If you
take 100 ng of the 3000 bp fragment how much of the 600 bp fragment do you require to get desired ratio
(A) 10 ng
(B) 100 ng
(C) 500 ng
(D) 2500 ng

116.

An enzyme that cleaves DNA recognizes an 8 base-pair unique DNA sequence. The probable number of
times this enzyme will cleave a 70 kilobase pair random DNA sequence is
(A) 1
(B) 2
(C) 3
(D) 4

117.

Mendels law of independent assortment when interpreted in a modern context indicates :


(A) Alleles are present on the same chromosome, but they assort independently due to recombination
(B) Alleles are present on independent chromosomes and these separate and assort independently
(C) Alleles are present on independent chromosomes and they can be sorted during meiosis.
(D) Alleles are present on the same chromosome and their combination is dependen

118.

Fat absorption in the microvilli is by :


(A) Endocytosis
(B) Simple diffusion through the plasma membrane
(C) Facilitated diffusion
(D) Active transport

119.

During the process of photosynthesis


(A) Glucose is synthesized during the dark reaction and ATP during the light reaction
(B) Glucose and ATP are produced during light and dark reaction
(C) Glucose and ATP are produced during the dark reaction
(D) Glucose is synthesized during the light reaction and ATP during the dark reaction

120.

Identify the protein with more than one polypeptide chain.


(A) Myoglobin
(B) Trypsin
(C) Immunoglobulin

(D) Lysozyme

CLASS-XII_STREAM-SB+2_PAGE # 31

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2007
Time : 3Hr.

1.

Max. Marks : 160

In Year 2007, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90),Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2008
Time : 3Hr.

1.

Max. Marks : 160

In Year 2008, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90), Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2009
Time : 3Hr.

1.

Max. Marks : 160

In Year 2009, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90), Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2010
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2011
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2012
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

YEAR-2009 (KVPY-STREAM-SB+2)
PART-I (1 Mark)
MATHEMATICS
1.

Suppose the sequence a1, a2, a3 ...... is an arithmetic progression of distinct numbers such that the
sequence a1, a2, a4, a8...... is a geometric progression. The common ratio of the geometric progression is :
(A) 2
(B) 4
(C) a1
(D) not determinable

2.

The positve integer k for which (101)k/2/k! is a maximum is :


(A) 9
(B) 10
(C) 11

3.

(D) 101

Let p(x) = a0 + a1x + .......+ anxn be a zero polynomial with integer coefficients. If p( 2 3 6 ) = 0, the
smallest possible value of n is :
(A) 8
(B) 6

(C) 4

(D) 2

4.

Three players play a total of 9 games. In each game, one person wins and the other two lose ; the winner
gets 2 points and the losers get 1 each. The number of ways in which they can play all the 9 games and
finish each with a zero score is :
(A) 84
(B) 1680
(C) 7056
(D) 0

5.

In a triangle, two vertices are (2, 3) and (4, 0), and its circumcentre is (2, z) for some real number z. The
circumradius is :

6
(A)

6.

2 13

(B)

(C) 2

(D)

13
6

Consider an ellipse with foci at (5, 15) and (21, 15). If the x-axis is a tangent to the ellipse, then the length
of its major axis equals :
(A) 17

(B) 34

(C) 13

(D)

416

7.

Let the line 2x + 3y = 18 intersect the y-axis at B. Suppose C ( B), with coordinates (a, b), is a point on
the line such that PB = PC, where P = (10, 10). Then 8a + 2b equals :
(A) 60
(B) 62
(C) 66
(D) 79

8.

If cosec2( + ) sin2( ) + sin2(2 ) = cos2( ), where , (0, /2) then sin( ) is equal to :
(A)

9.

If sinx + siny =

(A)

10.

1
2

7
25

(B)

1
2

3
2

(D)

3
2

(D)

24
25

7
1
and cos x + cosy = , the sin(x + y) equals :
5
5

(B)

24
25

The number of solutions to sin x =


(A) 1

(C)

(B) 6

(C)

7
25

6
with 0 x 12 is :
x
(C) 10

(D) 12

CLASS-XII_STREAM-SB+2_PAGE # 32

11.

Define a function f : R R given by :

sin x 2

,
for x 0
f(x) = 2 x
x ax b, for x 0

Suppose f(x) differentiable on R. Then,


(A) a =0, b = 0
(B) a = 1, b = 0
12.

(C) a = 0, b = 1

(D) a = 1, b = 1

The shortest distance from (0, 3) to the parabola y2 = 4x is :


(A) 2

(B)

(C) 5

(D)

13.

Ten trucks, numbered 1 to 10, are carrying packets of sugar. Each packet weighs either 999 gms or 1000
gms and each truck carries only the packets equal weights. The combined weight of 1 packet selected
from the first truck, 2 packets from the second, 4 packet from the third, and so on and 29 packets from the
tenth truck is1022870 gms. The trucks that have the lighter bags are :
(A) 1, 3, 5
(B) 2, 4, 5
(C) 1, 9
(D) 2, 8

14.

What is the value of

(A) 1

cos( x ) cos([2x]) dx ? (Here | t | denotes the integral part of the real number t)
0

(B) 1
1

15.

The value of the limit lim

n 0

(A) 0
16.

(B)

(D)

(D) 1

x10 sin(nx )dx equals :


1
10!

(C)

The area bounded by the parabolas y = x2 and y = 1 x2 equals :


(A)

17.

(C)

2
3

(B)

2 2
3

(C)

1
3

(D)

2
3

A vector which bisects the angle between a 3 i 4k and b = 5 j 12k is :

(A) 39 i 25 j 8k

5
(B) 3 i 5 j k
8

(C) 39 i 25 j 8k

5
(D) 3 i 5 j k
8

18.

An envelope has space for at most 3 stamps. If you are given three stamps of denomination 1, and three
stamps of denomination a (a > 1), the least positive integer for which there is no stamp value is :
(A) 7
(B) 8
(C) 9
(D) 10

19.

If m, n are positive integers such that m < n and

d = d (here d | k moeans d is a positive of k), then :


d/n

d/m

(A)

d < d

d/m

d/n

(C)
20.

d = d

d/m

d/n

d > d

d/m

(B)

(D) no relationship can be determined

d/n

The number of relation R from an m-element set A to an n-element set B satisfying the condition :
(a, b1) R, (a, b2) R b1 = b2 for a A, b1, b2 is :
(A) nm
(B) 2m + n 2m 2n
(C) mn
(D) (n + 1)m

CLASS-XII_STREAM-SB+2_PAGE # 33

PHYSICS
21.

The relation Cp Cv = R(Cp, Cv : Molar specific heats at constant pressure, volume) is exactly true for :
(A) an ideal mono-atomic gas
(B) any ideal gas, whether mono-dia polyatomic
(C) any real gas above its critical temperature
(D) all real gases

22.

The molecules of air in the room that you are sitting are all experiencing the force of gravity tending to
bring them down. The molecules are also frequently and randomly undergoing collisions, which tend to
oppose the effect of fall under gravity. The density of air is nearly uniform throughout the room because
(A) the mass of the molecules is very small
(B) the gravitational potential energy mgh is such lesser than the average thermal energy kT.
(C) the gravitational potential enrgy mgh is mush greater the the average thermal energy kT.
(D) mgh is nearly of the same magnitude as kT, which results in the cancellation of the two opposing
factors.
A parallel plate capacitor is charged fully by using a battery. Then without disconnecting the battery, the
plates are moved further apart. Then,
(A) the charge on the capacitor increases
(B) the voltage difference between the plates decreases
(C) the capacitance increases
(D) the electrostatic energy stored in the capacitor decreases

23.

24.

The five sides of a regular pentagon are represented by vectors A 1 , A 2 , A 3 , A 4 and A 5 , in cyclic order

as shown. Corresponding vertices are represented by B1 , B 2 , B 3 , B 4 and B 5 drawn from the centre of
the pentagon.
A2

A1
B1
B5

B2
A5

B4

B3

A3

A4

Then B 2 + B 3 + B 4 + B 5 =

(A) A 1
(B) A 1
25.

(C) B1

(D) B1

Four metallic plates each of surface area (of one side) A, are placed at a distance d apart from each other.
The two outer plates are connected to a point P and the two inner plates to another point Q as shown in
figure.
Q

Then the capacitance of the system is


(A) 0

A
2d

(B) 0

A
d

(C) 2 0

A
d

(D) 3 0

A
d

26.

A progressive wave travelling in positive x-direction given by y = a cos (kx t) meets a denser surface at
x = 0, t = 0. The reflected wave is then given by
(A) y = a sin(kx ax) (B) y = a cos(kx + ax) (C) y = a sin (t kx) (D) y = a cos (kx t)

27.

A charge Q is spread non uniformly on the surface of a hollow sphere of radius R, such that the charge
density is given by = 0 (1 sin), where is the usual polar angle. The potential at the centre of the
sphere is

Q
(A) 2 R
0

Q
(B) R
0

Q
(C) 8 R
0

Q
(D) 4 R
0

CLASS-XII_STREAM-SB+2_PAGE # 34

28.

An ideal diatomic gas is heated at constant pressure. The ratio of the work done to the heat supplied is
(A)

29.

2
5

(C)

2
7

(D)

4
7

5
27

(B)

5
48

(C)

27
5

(D)

1
3

Two identical conducting spheres carry identical charges. If the spheres are set at a certain distance
apart, they repel each other with a force F. A third conducting sphere, identical to the other two, but
initially uncharged, is then touched to one sphere, and then to the other before being removed. The forcebetween the original two spheres is now
(A)

31.

(B)

In the hydrogen spectrum, the ratio of the wavelengths for Lyman radiation to Balmer radiation is
(A)

30.

3
5

F
2

(B)

F
4

(C)

3F
4

(D)

3F
8

A small rectangular loop of wire in the plane of the paper is moved with uniform speed across a limited
region of uniform magnetic field perpendicular to the plane of the paper, as shown.
Uniform magnetic field
Initial
position

x
x
x
x
x
x
x
x

x
x
x
x
x
x
x
x

x
x
x
x
x
x
x
x

x
x
x
x
x
x
x
x

x
x
x
x
x
x
x
x

x
x
x
x
x
x
x
x

x
x
x
x
x
x
x
x

x
x
x
x
x
x
x
x

x
x
x
x
x
x
x
x

x
x
x
x
x
x
x
x

Final
position

Which graph would best represent the variation of the electric current, I, in the wire with time t ?

(A)

(B)

I
t

(C)

32.

(D)

I=0

The moment of inertia of a solid disc made of thin metal of radius R and mass M about one of its diameter
is given by

MR 2
. What will be the moment of inertia about this axis if the disc is folded in half about this
4

diameter ?
(A)

33.

MR 2
8

(B)

MR 2
2

(C)

MR 2
4

(D) MR2

A plane electromagnetic weve propagating in the direction of the unit vector n with a speed c is described

by electric and magnetic field vectors E and B , respectively. Which of the following relations ( in SI units)
s)

between E and B can be ruled out on dimensional grounds alone ?

n E
n B

(A) E =
(B) E cn B
(C) B
(D) n E B 0
c
c

CLASS-XII_STREAM-SB+2_PAGE # 35

34.

A point electric dipole placed at the origin has a potential given by V(r, ) =

p cos
4 0r 2

where is the angle

made by the position vector with the direction of the dipole. Then
(A) since the potential vanishes at =

, the electric field is zero everywhere on the =


plane
2
2

(B) the electric field everywhere on the =

plane is normal to the plane.


2

(C) the electric field everywhere on the =

plane is along the plane


2

(D) the electric field vanishes on the = 0


35.

A uniform non-deformable cylinder of mass m and radius R is rolling without slipping on a horizontal rough
surface. The force of friction is
(A) mg, where is the coefficient of sliding friction
(B) zero
(C) increases with time
(D) decreases with time

36.

Consider a one-dimensional potential V(x) as shown in the figure below. A classical particle of mass m
moves under its influence and has total energy E as shown.

V(x)
E

The motion is
(A) non-periodic
(C) periodic but not simple harmonic

(B) stationary
(D) simple harmonic

37.

A source of frequency f is emitting sound waves. If temperature of the medium increases, then
(A) wavelength of the sound wave increases
(B) speed of the sound wave decreases
(C) wavelength of the sound wave decreases
(D) amplitude of the sound wave increases

38.

A block of mass m is stationary on a rough plane of mass M inclined at an angle to the horizontal
while the whole set up is accelerating upwards at an acceleration a. If the coefficient of friction between
the block and the plane is , then the force that the plane exerts on the block is
(A) m (g + a) upwards
(B) mg cos normal to the plane
(C) resultant of mag cos normal to the plane and mg cos along the plane
(D) resultant of m (g + a) cos normal to the plane and mg cos along the plane.

CLASS-XII_STREAM-SB+2_PAGE # 36

39.

A stream of charged particles enter into a region with crossed electric and magnetic fields as shown in
the figure. On the other side is a screen with a hole that is right on the original path of the particles
then,
E

Charged
Particles

(A) no particle can get through the hole


(B) all particles can get through the hole
(C) only positively charged particles with speed
(D) all particles with speed
40.

E
can get through the hole
B

E
can get through the hole.
B

A small body is released from a height H of an inclined plane. At the bottom of the plane is a loop of
radius R as shown.

O
R
x

Ignoring friction, the minimum H required for the body to just complete the loop ( that is, reach the
point O) is
(A) 2R

(B)

5R
2

(C) 3R

(D)

7R
2

CHEMISTRY
41.

The gas that has the slowest rate of diffusion among O2, H2, CO2 and CH4 is
(A) O2
(B) H2
(C) CO2
(D) CH4

42.

Assuming ideal behaviour the ratio of kinetic energies of 3 g of H2 and 4g of O2 at any temperature is
(A) 3 : 4
(B) 1 : 16
(C) 4 : 3
(D) 12 : 1

43.

The IUPAC name for the compound


O

Cl

is

Me
Me

44.

(A) 1-chloro - 3-methyl- 4-pentanone


(C) 5-chloro - 3 - methyl- 2-pentanone

(B) 1-chloro - 2-methyl- 4-pentanone


(D) 5-chloro - 2-methyl- 3-pentanone

The shape of the molecule CIF3 is


(A) triangular
(B) pyramidal

(C) T-shape

(D) linear

CLASS-XII_STREAM-SB+2_PAGE # 37

45.

Among CO32, OH, NH3 and HCO3, the species that acts as a Bronsted acid as well as a Bronsted
base is
(A) Na2CO3
(B) NH3
(C) OH
(D) HCO3

46.

The ratio of the heat capacities Cp/Cv for one mole of a gas is 1.67. The gas is :
(A) He
(B) H2
(C) CO2
(D) CH4

47.

The ion that is isoelectronic with CO is


(A) O2+
(B) O2

48.

49.

(D) N2+

(C) CN

Among CH4, CO2, H2O and SO2, the bond angle is the highest in
(A) CH4
(B) CO2
(C) H2O

(D) SO2

The solvent of choice for carrying out a Grignard reaction is


(A) diethyl ether (B) chloroform
(C) ethyl acetate

(D) ethanol

50.

The reaction of butanal with n-propylmagnesium bromide gives a


(A) chiral secondary alcohol
(B) achiral secondary alcohol
(C) chiral tertiary alcohol
(D) achiral tertiary alcohol

51.

The hybridization of Ni centre in Ni[(PPh3)2Cl2] and [NiCl4]2 respectively are


(A) dsp2 and sp3
(B) dsp2 and sp2d
(C) sp3 and sp3
(D) sp3 and dsp2

52.

Oxalic acid when treated with potassium permanganate in the presence of an acid, produces
(A) O2
(B) C
(C) CO
(D) CO2

53.

The equilibrium constant for the reaction N2 + 3H2


2NH3 at 400 K is 41. The equilibrium constant
for the reaction 1/2N2 + 3/2H2
NH3 at the same temperature will be closest to
(A) 41
(B) 20.5
(C) 6.4
(D) 1681

54.

In a one component second order reaction, if the concentration of the reactant is reduced to half, the
rate
(A) increases two times
(B) increases four times
(C) decreases to one half
(D) decreases to one fourth

55.

The conjugate bases for HCO3 and NH3, respectively, are


(A) H2CO3 and NH4+
(B) CO32 and NH2
(C) H2CO3 and NH2

56.

(D) CO32 and NH4+

Among the following

S
CH2
I
II
the aromatic compounds are
(A) I & II
(B) I & III
57.

IV

III
(C) II & III

(D) II & IV

Among the compounds


O

N
H
I
the order of basicity is
(A) I > III > II > IV

N
H

N
H

II

III

IV

(B) II > IV > I > III

(C) III > I > IV > II

(D) II > I > III > IV

CLASS-XII_STREAM-SB+2_PAGE # 38

58.

The Newman projection of Me


H

Me

H
H

is known as the
(A) eclipsed conformer

(B) staggered conformer (C) skewed conformer

(D) gauche conformer

59.

The half-life of a first order reaction is 30 min. The time required for 75% completion of the same reactionwill be
(A) 45 min
(B) 60 min
(C) 75 min
(D) 90 min

60.

The hydrogen ion concentration in a mixture of 10 ml of 0.1 M H2SO4 and 10 ml of 0.1 M KOH solution
in water, is
(A) 0.1 M
(B) 0.05 M
(C) 0.2 M
(D) 0.02 M

BIOLOGY
61.

62.

During photosynthesis the chemical conversion of water is termed :


(A) photolysis
(B) hydrolysis
(C) hydration

(D) condensation

In the organisms muscle, oxygen is carried by :


(A) albumin
(B) myosin
(C) myoglobin

(D) hemoglobin

63.

Enzymes do the following :


(A) make products and reactants of equal energy
(B) help the chemical processes by lowering the energy of products
(C) reduce the activation barrier and speed up chemical processes
(D) hydrolyze all the biopolymers indiscriminately

64.

Glycolysis is :
(A) biosynthesis of glucose
(C) degradation of glucose

65.

(B) biosynthesis of glycine


(D) reaction of glucose with proteins

Plants are attracted to light through the hormonal action of :


(A) Gibberelic acid
(B) Auxin
(C) Chlorophyll

(D) Thiamine

66.

During development, unspecified cells become cells having unique functions. This process is called :
(A) evolution
(B) differentiation
(C) translation
(D) replication

67.

The chromosomal attachment site of the spindle microtubule is :


(A) centrosome
(B) liposome
(C) centromere

(D) telomere

Which fo the following diseases is NOT sexually transmitted ?


(A) Syphilis
(B) Gonorrhoea
(C) AIDS

(D) Tuberculosis

68.

69.

This cell organelle consists of two granule-like centrioles and is found in animal cells only. It helps in
cell division. What is it called ?
(A) centrosome
(B) chromosome
(C) centromere
(D) chromatids

CLASS-XII_STREAM-SB+2_PAGE # 39

70.

Nucleotides are monomers of DNA. What does each nucleotide consist of ?


(A) A nitrogenous base and a pentose sugar
(B) A nitrogenous base and a phosphate group
(C) A pentose sugar and a phosphate group
(D) A nitrogenous base, a pentose sugar and a phosphate group

71.

Fetilization in humans usually takes place in :


(A) Uterus
(B) Graafian follicle

(C) Ovary

(D) Fallopian tube

72.

ELISA, the standard screening test for HIV, detects which of the following ?
(A) HIV DNA
(B) HIV RNA
(C) HIV proteins
(D) Antibodies to HIV proteins

73.

Sickle cell anemia is caused by :


(A) complete absence of the haemoglobin gene
(C) increased affinity of haemoglobin for oxygen

(B) point mutation of the haemoglobin gene


(D) truncation of the haemoglobin protein

The natural source of Ti plasmid is :


(A) bacteria
(B) virus

(C) plants

74.

(D) animals

75.

Earthworms are bisexual but still cross-fertilization is common. This is because :


(A) spermatozoa of different earthworms are different
(B) spermatozoa and ova mature at different times in the same earthworm
(C) ova from other earthworms may be larger
(D) sperm and ova from the same earth worm cannot fertilize

76.

One difference between blood and lymph is that :


(A) blood contains WBC and lymph contains RBC
(B) blood contains RBC and WBC and lymph contains only WBC
(C) blood contains RBC and lymph contains WBC
(D) blood is liquid while lymph is solid

77.

The abnormal development of which of the following lymphoid organs would result in the most severe
immunodeficiency ?
(A) Spleen
(B) Thymus
(C) Tonsil
(D) Lymph node

78.

Mitochondria are associated with all of the following functions, EXCEPT :


(A) ATP synthesis
(B) DNA syntheis
(C) Protein synthesis

(D) Protein glycosylation

79.

The probability of having a girl child with blood group O when the parents have blood group A and B is :
(A) 0%
(B) at least 50%
(C) at most 25%
(D) exactly 75 %

80.

Wooden doors and windows swell up in the rainy season by :


(A) a special type of diffusion called imbibition
(B) evaporation of stored water wood
(C) conduction of water from walls
(D) transpiration

CLASS-XII_STREAM-SB+2_PAGE # 40

PART-II (2 Mark)
MATHEMATICS
81.

Let p(x) = a0 + a1x + ........+ anxn. If p( 2) = 15, p( 1) = 1, p(0) = 7, p(1) = 9, p(2) = 13 and p(3) = 25,
then the smallest possible value of n is :
(A) 5
(B) 4
(C) 3
(D) 2

82.

Let a, b, c be the sides of triangle. If t denotes the expression (a2 + b2 + c2)/(ab + bc + ca), the set of all
possible values of t is :
(A) {x R| x > 1}
(B) {x R | 1 x < 2}
(C) {x R | 1 x < 2}
(D) {x R | 1 x 2}

83.

The area of the region bounded by y = | x 3 | 4 5 and the x-axis is


(A) 24.5

84.

(C) 49

1
( 6 2)
2

(B)

1
( 5 1)
2

Define a sequence {an}n 0 by an =

87.

(C)

(D)

1 a n1
for n 1. a0 = cos1.
2

Then lim n 4n(1 an) equals


(A) 2
(B) 2/2
86.

(D) 35 2

The lengths of the sides and the diagonal of an isosceles trapezium from a two-element set {a, b}. If
a > b, then a/b equals
(A)

85.

(B) 37

(C) /2

The range of the function f(x) = (sin x)sinx defined on (0, ) is


(A) (0.1)
(B) (e 1/e , 1)
(C) [e 1/e, 1)

(D)

(D) [e1/e , 1]

Let A denote the area bounded by the curve y = 1/x and the lines y = 0, x = 1, x = 10, Let B = 1 +
1
1
1
1
, and let C =
+
+ ......+
. Then
9
3
10
2
(A) C < B < A
(C) C < A < B and A C < B A

1
+
2

....+

88.

(B) A < C < B


(D) C < A < B and B A < A C

Two points are randomly choses on the circumference of a circle of radius r. The probability that the
distance between the two points is at least r is equal to
(A)

(B) sin r

(C)

(D)

2
3

89.

Consider al natural numbers whose decimal expansion has only then even digits 0, 2, 4, 6, 8. Suppose
these are arranged in increasing order. If an denotes the n-th number in this sequence, then
lim n log an /log n equals :
(A) 0
(B) log510
(C) log210
(D) 2

90.

The sum of all absolute values of the differences of the numbers 1, 2, 3......., n, taken two at a time,
i.e.

i j

equals :

jin

(A)

n 1
3

(B)

n
3

(C)

n 1
3

(D)

n2
3

CLASS-XII_STREAM-SB+2_PAGE # 41

PHYSICS
91.

A spherical cavity of radius r is carved out of a uniform solid sphere of radius R as shown in the figure.

R
r

The distance of the center of mass of the resulting body from that of the solid sphere is given by
(A)

92.

(B)

Rr
2

(C) 0

(D)

r3
R 2 Rr r 2

A plano-convex lens made of material of refractive index with radius of curvature R is silvered on the
curved side. How far away from the lens-mirror must you place a point object so that the image coincides
with the object ?
(A)

93.

Rr
2

(B) R

(C)

R
1

(D) R

n2a

n moles of a van der Waal gas obeying the equation of state


(V nb) = nRT, where a and b are
V 2

gas dependent constants, is made to undergo a cyclic process that is depicted by a rectangle in the PV
diagram as shown in the figure. What is the heat absorbed by the gas in one cycle?
P
P1

P2
V1

94.

V2

(A) n(P1 P2) (V2 V1)

(B) (P1 P2) (V2 V1)

n 2a
n 2 a

(C) P1 2 P2 2 (V1 V2)


V1
V2

n 2a
n 2 a

(D) P1 2 P2 2 (V2 V1)


V1
V2

For what value of the resistor X will the equivalent resistance of the two circuits shown be the same ?

R
6x

(A) R

6x

6x

(B) 6R

R
x

R
6x

(C) 2R

6x

6x

(D)

6x

R
x

5 1
R
2

CLASS-XII_STREAM-SB+2_PAGE # 42

95.

2
MR2 rolls down a plane
5
inclined at an angle to the horizontal starting from rest. The coefficient of static friction between the
sphere and plane is . Then,
(A) the sphere will always roll without slipping
(B) the sphere will always slide

A solid uniform sphere having a mass M, radius R, and moment of inertia of

(C) the sphere will roll without slipping only if sin

7
2

(D) the sphere will roll without slipping only if tan1

96.

A cubical box of side a sitting on a rough table-top is pushed horizontally with a gradually increasing force
until the box moves. If the force is applied at a height from the table top which is greater than a critical
height H, the box topples first. If it is appliced at a height less than H, the box starts sliding first. Then the
coefficient of friction between the box and the table top is :
(A)

97.

a
2H

(B)

2H
a

(C)

a
H

(D)

H
a

A vehicle is moving with speed v on a curved road of radius r. The coefficient of friction between the vehicle
and the road is . The angle of banking needed is given by
(A) tan =

98.

7
2

v2 r g
v2 r g

v2 r g

(B) tan =

v2 r g

(C) tan =

v2 r g
r g v2

(D) tan =

r g v2
r g v2

Two small identical speakers are connected in phase to the same source. The speakers are 3m apart and
at ear level. An observer stands at P, 4m in front of one speaker as shown. The sound she hears is least
intense when the wavelength is 1 and most intense when the wavelength is 2.

4m

3m

Then possible values of 1 and 2 are :


(A) 1 = 1m and 2 = 2m
(C) 1 = 2m and 2 = 1m
99.

(B) 1 = 4m and 2 = 3m
(D) 1 = 0.5m and 2 = 0.25m

Two small blocks slide without losing contact with the surface along two frictionless tracks 1 and 2,
starting at the same time with same initial speed v. Track 1 is perfectly horizontal, while track 2 has a
dip in the middle, as shown.
V

2
Start

Finish

Which block reaches the finish line first ?


[Hint : Use velocity-time graph to solve]
(A) Block on track 1 reaches the finish line first
(B) Block on track 2 reaches the finish line first
(C) Both blocks reach the finish line at the same time
(D) It depends on the length of the dip in the second track, relative to the total length of the tracks.

CLASS-XII_STREAM-SB+2_PAGE # 43

100.

Consider 1 kg of liquid water undergoing change in phase to water vapour at 100C. At 100C, the
vapour pressure 1.01 105 Nm2 and the latent heat of vaporization is 22.6 105 J kg1. The density of
liquid water is 103 kg m3 and that of vapour is
change is nearly.
(A) 1.8 105 J kg1

(B) 20.8 105 J kg1

1
kg m3. The change in internal energy in this phase
1 .8

(C) 22.6 105 J kg1

(D) 11.3 105 J kg1

CHEMISTRY
101.

If the pH of a mixture of 10 ml of 0.1 M NH4OH and 10 ml of 1 M NH4Cl solution is 8, the pKb value of
NH4OH is then closest to
(A) 3
(B) 5
(C) 7
(D) 9

102.

A cylinder of cooking gas in a household contains 11.6 kg of butane.The thermochemical reaction for
the combustion of butane is
2C4H10(g) + 13O2(g) 8CO2(g) + 10H2O(); H = 2658 KJ/mol. If the household needs15000 KJ of
energy per day, the cooking gas cylinder will last for about
(A) 64 days
(B) 45 days
(C) 20 days
(D) 35 days

103.

The addition of 0.643 g of a compound to 50 ml of benzene (density = 0.879 g ml1) lowers the freezing
point from 5.51C to 5.03C. If the freezing point constant, Kf for benzene is 5.12 K Kg mol 1, the molar
mass of the compound is approximately
(A) 156 g mol1
(B) 88 g mol1
(C) 60 g mol1
(D) 312 g mol1

104.

Consider the following electrochemical cell :


Zn(s) + 2Ag+(0.04 M) Zn2+(0.28M)+ 2Ag(s). If Ecell = 2.57 V, then e.m.f. of the cell at 298 K, is
(A) 2.5 V
(B) 1.5 V
(C) 0.5 V
(D) 0.5 V

105.

When Co(II) chloride is dissolved in concentrated HCl a blue solution is obtained. Upon dilution with
water, the color changes to pink because
(A) CoCl64 is converted to CoCl63
(B) CoCl42 is converted to Co(OH2)62 +
2+
3+
(C) Co(OH2)6 is converted to Co(OH2)6
(D) CoCl42 is converted to Co(OH2)63 +

106.

The rate constant for the reaction COCl2(g) CO(g) + Cl2(g) is given by ln [k/(min1)] = 11067/T K +
31.33. The temperature at which the rate of this reaction will be doubled from that at 25C is
(A) 75C
(B) 100C
(C) 31C
(D) 50C

107.

Some reactions and their equilibrium constants given below


CuCl42 + Br
CuCl3Br2 + Cl
K1
CuCl3Br2 + Br
CuCl2Br22 + Cl
K2
2

CuCl2Br2 + Br
CuClBr3 + Cl
K3
CuClBr32 + Br
CuBr42 + Cl
K4
The equilibrium constant, K for the reaction
CuCl42 + 3Br
CuClBr32 + 3 Cl, is
(B) K1K2K3K4
(C) K1 + K2 + K3
(A) K1K2K3

(D) 1/(K1K2K3)

CLASS-XII_STREAM-SB+2_PAGE # 44

OH
Br2 in CS2

108.

NaOH

Me-I

In the above sequence of reactions, the major products X and Y are

OH

OMe
Br

(A) X =

OH
Br

(C) X =

(B) X =

OMe

Y=

OH

Y=
Br

(D) X =
Br

109.

234

110.

In the following transformation

OH

Br

Y=

OH

OH

OH

Y=
Br

OH

Th90 gets converted to 206Pb82 through a series of radioactive decay processes. The number of alpha and
beta particles lost in this transformation respectively, are
(A) 6 and 6
(B) 6 and 7
(C) 4 and 2
(D) 7 and 6

O
O

OH

Me

CO2H

Reagent 1
Reagent 2
OMe

OMe

reagents 1 and 2 are :


(A) H2SO4 ; alkaline KMnO4
(C) H3PO4 ; CHCl3/KOH

(B) AlCl3 ; l2 / NaOH


(D) KOH;CHCl3 / KOH

BIOLOGY
111.

112.

The mode of action of penicillin is as follows :


(A) It inhibits viral replication
(C) It inhibits bacterial cell wall synthesis

(B) It enhances immunity


(D) It inhibits transcription

Which of the following statements is true for meiosis ?


(A) One round of chromosome duplication and one round of cell division
(B) One round of chromosome duplication and two rounds of cell division
(C) Two rounds of chromosome duplication and one round of cell division
(D) Two rounds of chromosome duplication and two rounds of cell division

CLASS-XII_STREAM-SB+2_PAGE # 45

113.

Instead of 3, if 2 bases code for an amino acid, the degeneracy of codons coding for the same amino acid
would have :
(A) increased
(B) decreased
(C) remained the same
(D) been uncertain

114.

Gregor Mendel showed that unit factors exist in pairs and exhibit as dominant-recessive relationship.
These unit factors, in modern terminology, are called :
(A) genes
(B) alleles
(C) Ioci
(D) determinants

115.

E.coli has optimal growh temperature of 37C. Which of the following in an INCORRECT explanation for
this ?
(A) The membrane is most permeable at this temperature
(B) DNA synthesis makes the least mistakes at this temperature
(C) Most enzymes in the cell have the highest activity at this temperature
(D) Protein synthesis is most efficient at this temperature

116.

Male offsprings of which of the following couples have the highest chance of haemophilia ?
(A) Haemophiliac father and normal, non-carrier mother
(B) Haemophiliac father and normal, carrier mother
(C) Normal father and normal, carrier mother
(D) Normal father and haemophiliac mother

117.

The effect of consumption of excess protein by normal individuals would result in :


(A) excretion of excess protein in urine
(B) increase in the amount of adipose tissue
(C) increase in the synthesis of muscle protein
(D) increase in the circulatory plasma proteins

118.

The condition varicose veins in swelling of veins, that occurs due to :


(A) loss of elasticity of the muscular layer
(B) condition of high blood pressure
(C) condition of low blood pressure
(D) condition of anoxia

119.

Greatest proportion of photosyntheis in the world is carried out by :


(A) trees in the rain forests of the world
(B) trees in the temperate forests of the world
(C) algae in oceans
(D) irrigated crop fields

120.

Energetically unfavourable reactions occur in human cells through :


(A) heat energy supplied by the body
(B) heat energy released through exercise
(C) coupling of energetically favourable reactions with unfavourable ones
(D) photosynthesis

CLASS-XII_STREAM-SB+2_PAGE # 46

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2007
Time : 3Hr.

1.

Max. Marks : 160

In Year 2007, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90),Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2008
Time : 3Hr.

1.

Max. Marks : 160

In Year 2008, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90), Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2009
Time : 3Hr.

1.

Max. Marks : 160

In Year 2009, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90), Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2010
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2011
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2012
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

YEAR-2010 (KVPY-STREAM-SB+2)
PART-I (1 Mark)
MATHEMATICS

1.

0 i
1 0
, where i2 = 1, and let I denote the identity matrix
. Then
Let denote the matrix
i 0
0 1

I + A + A2 + .............+ A2010 is
0 0

(A)
0 0

2.

0 i

(B)
i 0

1 i

(C)
i 1

1 0

(D)
0 1

Suppose the sides of a triangle from a geometric progression with common ratio r. Then r lies in the
interval

1 5

(A) 0,
2

1 5 2 5

(B) 2 , 2

1 5 1 5

(C)
2
2

2 5

(D) 2 ,

3.

The number of rectangles that can be obtained by joining four of the twelve vertices of a 12-sided regular
polygon is
(A) 66
(B) 30
(C) 24
(D) 15

4.

Let 1, and 2 be the cube roots of unity. The least possible degree of a polynomial, with real coefficients,
having 22, 3 + 4, 3 + 42 and 5 2 as roots is
(A) 4
(B) 5
(C) 6
(D) 8

5.

A circle touches the parabola y2 = 4x at (1, 2) and also touches its directrix. the y-coordinate of the point
of contact of the circle and the directrix is
(A) 2

6.

(B) 2

(C) 2 2

(D) 4

Let ABC be an equilateral triangle; let KLMN be a rectangle with K, L on BC, M on AC and N on AB.
Suppose AN / NB = 2 and the area of triangle BKN is 6. The area of the triangle ABC is

7.

(A) 54

(B) 108

(C) 48

(D) not determinable with the above data

Let P be an arbitrary point on the ellipse

x2
a2

y2
b2

1 , a > b > = 0. Suppose F and F are the foci of the


1
2

ellipse. The locus of the centroid of the triangle PF1F2 as P moves on the ellipse is
(A) a circle
8.

(B) an ellipse

(C) a parabola

(D) a hyperbola

The number of roots of the equation cos7 sin6 = 1 that lie in the interval [0, 2] is
(A) 2

(B) 3

(C) 4

(D) 8

CLASS-XII_STREAM-SB+2_PAGE # 47

9.

The product
(1 + tan 1) (1 + tan 2) (1 + tan 3) ... (1 + tan 45)
equals
(A) 221

10.

(B) 222

(C) 223

(D) 224

Let f : R R be a differentiable function such that f (a) = 0 = f (b) and f(a) f(b) > 0 for some a < b. Then
the minimum number of roots of f(x) = 0 in the interval (a, b) is
(A) 3

11.

(B) 2

(C) 1

(D) 0

The roots of (x 41)49 + (x 49)41 + (x 2009)2009 = 0 are


(A) all necessarily real
(B) non-real except one positive real root
(C) non-real except three positive real roots
(D) non-real except for three real roots of which exactly one is positive

12.

The figure shown below is the graph of the derivative of some function y = (x)

Then
(A) f has local minima at x = a, b and a local maximum at x = c
(B) f has local minima at x = b, c and a local maximum at x = a
(C) f has local minima at x = c, a and a local maximum at x = b
(D) the given figure is insufficient to conclude any thing about the local minima and local maxima of f

CLASS-XII_STREAM-SB+2_PAGE # 48

13.

The following figure shows the graph of continuous function y = (x) on the interval [1, 3]. The points A,
B, C have coordinates (1, 1), (3, 2), (2, 3) respectively, and the lines 1 and 2 are parallel, with 1 being
tangent to the curve at C. If the area under the graph of y = (x) from x = 1 to x = 3 is 4 square units, then
the area of the shaded region is :

(A) 2

(B) 3

(C) 4

(D) 5

14.

n
Let n (log x ) dx, where n is a non-negative integer..

Then I2011 + 2011 I2010 is equal to

15.

(A) 1000 + 999 998

(B) 889 + 890 891

(C) 100 + 100 99

(D) 53 + 54 52

Consider the regions A = {(x, y) | x2 + y2 100} and B = {(x, y) | sin (x + y) > 0} in the plane. Then the area
of the region A B is
(A) 10

16.

(B) 100

(C) 100

(D) 50

Three vertices are chosen randomly from the seven vertices of a regular 7sided polygon. The probability
that they form the vertices of an isosceles triangle is
(A)

17.

(B)

1
3

(C)

3
7

(D)

3
5

Let u = 2i j + k , v = 3 j + 2 k be vectors in R3 and w be a unit vector in the xy-plane. Then the

maximum possible value of |( u v ) . w | is


(A)

18.

1
7

(B)

12

(C) 13

(D) 17

How many six-digit numbers are there in which no digit is repeated, even digits appear at even places,
odd digits appear at odd places and the number is divisible by 4?
(A) 3600

(B) 2700

(C) 2160

(D) 1440

CLASS-XII_STREAM-SB+2_PAGE # 49

19.

The number of natural number n in the interval [1005, 2010] for which the polynomial
1 + x + x2 + x3 +.......+ xn1 divides the polynomial 1 + x2 + x4 + x6 + .........+ x2010 is
(A) 0

20.

(B) 100

(C) 503

(D) 1006

Let a0 = 0 and an = 3 an1 + 1 for n 1. Then the remainder obtained on dividing a2010 by 11 is
(A) 0

(B) 7

(C) 3

(D) 4

PHYSICS
21.

A pen of mass m is lying on a piece of paper of mass M placed on a rough table. If the coefficients of
friction between the pen and paper, and, the paper and the table are 1 and 2 respectively, then the
minimum horizontal force with which the paper has to be pulled for the pen to start slipping is given by :

22.

(A) (m + M) (1 + 2)g

(B) (m 1 + M 2)g

(C) (m 1 + (m + M)2)g

(D) m(1 + 2)g

Two masses m1 and m2 connected by a spring of spring constant k at rest on a frictionless surface. If the
masses are pulled apart and let go, the time period of oscillation is :

1 m1m 2
(A) T = 2 k m m
2
1

23.

m1 m 2
(B) T = 2 k m m
1 2

(C) T = 2 m1 (D) T = 2 m 2
k
k

A bead of mass m is attached to the midpoint of a taut, weightless string of length and placed on a
frictionless horizontal table.

Under a small transverse displacement x, as shown, if the tension in the string is T, then the frequency of
oscillation is :

(A)

24.

1 2T
2 m

(B)

1 4T
2 m

(C)

1 4T
2 m

(D)

1 2T
2 m

A comet (assumed to be in an elliptical orbit around the sun) is at a distance of 0.4 AU from the sun at the
perihelion. If the time period of the comet is 125 years, what is the aphelion distance ? AU : Astronomical
Unit.
(A) 50 AU

(B) 25 AU

(C) 49.6 AU

(D) 24.6 AU

CLASS-XII_STREAM-SB+2_PAGE # 50

25.

The circuit shown consists of a switch (S), a battery (B) of emf E, a resistance R, and an inductor L.

The current in the circuit at the instant the switch is closed is :


(A) E/R
26.

(B) E/(R(1 e))

(C)

(D) 0

Consider a uniform spherical volume charge distribution of radius R. Which of the following graphs correctly
represents the magnitude of the electric field E at a distance r from the center of the sphere ?

(A)

27.

(B)

(C)

(D)

A charge +q is placed somewhere inside the cavity of a thick conducting spherical shell of inner radius R1
and outer radius R2. A charge +Q is placed at a distance r > R2 from the center of the shell. Then the
electric field in the hollow cavity.

28.

(A) depends on both +q and +Q

(B) is zero

(C) is only that due to +Q

(D) is only that due to +q

The following travelling electromagnetic wave


Ex = 0, Ey = E0sin(kx + t), Ez = 2E0sin(kx + t) is :

29.

(A) elliptically polarized

(B) linearly polarized

(C) circularly polarized

(D) unpolarized

A point source of light is placed at the bottom of a vessel which is filled with water of refractive index to
a height h. If a floating opaque disc has to be placed exactly above it so that the source is invisible from
above, the radius of the disc should be :
h

h
(A)
30.

(B)

h
(C)

(D)

2 1

Three transparent media of refractive indices 1,2, 3, respectively, are stacked as shown. A ray of light
follows the path shown. No light enters the third medium.

Then :
(A) 1 < 2 < 3

(B) 2 < 1 < 3

(C) 1 < 3 < 2

(D) 3 < 1 < 2

CLASS-XII_STREAM-SB+2_PAGE # 51

31.

A nucleus has a halflife of 30 minutes. At 3PM its decay rate was measured as 120,000 counts/sec.
What will be the decay rate at 5 PM ?

32.

(A) 120,000 counts/sec.

(B) 60,000 counts/sec.

(C) 30,000 counts/sec.

(D) 7,500 counts/sec.

A block is resting on a shelf that is undergoing vertical simple harmonic oscillations with an amplitude of
2.5 cm. What is the minimum frequency of oscillation of the shelf for which the book will lose contact with
the shelf ? (Assume that g = 10 m/s2)
(A) 20 Hz

33.

(C) 125.6 Hz

(D) 10 Hz

n2a

A vander Waal's gas obeys the equation of state


(V nb) = nRT. Its internal energy is given by
V 2

U = CT

34.

(B) 3.18 Hz

n2a
. The equation of a quasistatic adiabat for this gas is given by :
V

(A) TC/nRV = constant

(B) T(C+nR)/nRV = constant

(C) TC/nR (V nb) = constant

(D) P(C+nR)/nR (V nb) = constant

An ideal gas is made to undergo a cycle depicted by the PV diagram alongside. The curved line from A to
B is an adiabat.

Then :
(A) The efficiency of this cycle is given by unity as no heat is released during the cycle
(B) Heat is absorbed in the upper part of the straight line path and released in the lower part
(C) If T1 and T2 are the maximum and minimum temperatures reached during the cycle, then the efficiency

T2
is given by 1 T
1
(D) The cycle can only be carried out in the reverse of the direction shown in the figure

35.

A bus driving along at 39.6 kmph is approaching a person who is standing at the bus stop, while honking
repeatedly at an interval of 30 seconds. If the speed of sound is 330 ms1, at what interval will the person
hear the horn.
(A) 31 sec.

(B) 29 sec.

(C) 30 sec.

(D) The interval will depend on the distance of the bus from the passenger

CLASS-XII_STREAM-SB+2_PAGE # 52

36.

Velocity of sound measured at a given temperature in oxygen and hydrogen is in the ratio :
(A) 1 : 4

37.

(B) 4 : 1

(C) 1 : 1

(D) 32 : 1

In Young's double slit experiment, the distance between the two slits is 0.1 mm, the distance between
the slits and the screen is 1m and the wavelength of the light used is 600 nm. The intensity at a point on
the screen is 75% of the maximum intensity. What is the smallest distance of this point from the central
fringe?
(A) 1.0 mm

38.

(B) 2.0 mm

(C) 0.5 mm

(D) 1.5 mm

Two masses m1 and m2 are connected by a massless spring of spring constant k and unstretched length
. The masses are placed on a frictionless straight channel which we consider our x-axis. They are
initially at rest at x = 0 and x = , respectively. At t = 0, a velocity of v0 is suddenly imparted to the first
particle. At a later time t, the center of mass of the two masses is at :

39.

m2
(A) x = m m
1
2

m2 v 0 t
m1
(B) x = m m m m
1
2
1
2

m2 v 0 t
m2
(C) x = m m m m
1
2
1
2

m1v 0 t
m2
(D) x = m m m m
1
2
1
2

A charged particle of charge q and mass m, gets deflected through an angle upon passing through a
square region of side a which contains a uniform magnetic field B normal to its plane. Assuming that the
particle entered the square at right angles to one side, what is the speed of the particle ?
(A)

40.

qB
a cot
m

(B)

qB
a tan
m

(C)

qB
a cot 2
m

(D)

qB
a tan 2
m

A piece of hot copper at 100C is plunged into a pond at 30C. The copper cools down to 30C, while the
pond, being huge, stays at its initial temperature. Then :
(A) copper loses some entropy, the pond stays at the same entropy
(B) copper loses some entropy, and the pond gains exactly the same amount of entropy
(C) copper loses entropy, and the pond gains more than this amount of entropy
(D) both copper and the pond gain in entropy

CHEMISTRY
41.

The number of isomers of Co(diethylene triamine) Cl3 is.


(A) 2

42.

(C) 4

(D) 5

(B) NH3

(C) CN

(D) I

(B) 3

(C) 1.5

(D) 1

Among the following, the -acid ligand is :


(A) F

43.

(B) 3

The bond order in O22 is


(A) 2

CLASS-XII_STREAM-SB+2_PAGE # 53

44.

The energy of a photon of wavelength = 1 meter is (Planck's constant = 6.626 1034 J.s, speed of light
= 3 108 ms1)
(A) 1.988 1025 J

45.

(B) 1.988 1030 J

(C) 1.988 1028 J

(D) 1.988 1031 J

The concentration of a substance undergoing a chemical reaction becomes one half of its original value
after time t, regardless of the initial concentration. The reaction is an example of a :

46.

(A) zero order reaction

(B) second order reaction

(C) first order reaction

(D) third order reaction

The shape of the molecule CIF3 is :


(A) trigonal planar

47.

48.

49.

(C) pyramidal

(D) Y-shaped

FriedalCrafts acylation is :
(A) -acylation of a carbonyl compound

(B) acylation of phenols to generate esters

(C) acylation of aliphatic olefins

(D) acylation of aromatic nucleus

The order of acidity of compounds IIV, is

II

III

IV

(A) I < III < II < IV

(B) III < I < II < IV

(C) IV < I < II < III

(D) II < IV < III < I

(C)

(D)

(C) 11H

(D) 12 H

The most stable conformation for n-butane is

(A)

50.

(B) T-shaped

(B)

In the nuclear reaction


234
90 Th

234
91
Pa + X

X is :
(A)

51.

0
1e

(B) 10 e

A concentrated solution of copper sulphate, which is dark blue in colour, is mixed at room temperature
with a dilute solution of copper sulphate, which is light blue. For this process
(A) Entropy change is positive, but enthalpy change is negative.
(B) Entropy and enthalpy changes are both positive.
(C) Entropy change is positive and enthalpy does not change.
(D) Entropy change is negative and enthalpy change is positive.

CLASS-XII_STREAM-SB+2_PAGE # 54

52.

53.

Increasing the temperature increacses the rate of reaction but does not increase the :
(A) number of collisions

(B) activation energy

(C) average energy of collisions

(D) average velocity of the reactant molecules

In metallic solids, the number of atoms for the face centred and the body-centered cubic unit cells, are,
respectively.
(A) 2,4

54.

(B) 2,2

(C) 4,2

From equation 1 and 2


CO2

CO +

H2 O

H2 +

1
O
2 2
1
O
2 2

[ K c = 9.1 1012 at 1000C]

(eq 1)

[ Kc

(eq 2)

find out Kc for the following equation CO2 + H2


(A) 0.78
55.

(B) 2.0

CO + H2O
(C) 16.2

(D) 1.28

(B) [R0] (ekt)

(C) [R0e]kt

(D) [R0] (ekt)

(C)

(D)

The correct structure of PCl3F2 is

(A)

57.

= 7.1 1012 at 1000C]

For a first order reaction R P, the rate constant is k. If the initial concentration of R is [R0], the
concentration of R at any time 't' is given by the expression.
(A) [R0] ekt

56.

(D) 4,4

(B)

The enantiomeric pair among the following four structures is

II

III

IV

(A) I & II

(B) I & IV

(C) II & III

(D) II & IV

CLASS-XII_STREAM-SB+2_PAGE # 55

58.

59.

Consider the reaction : 2NO2 (g) 2NO (g) + O2(g). In the figure below, identify the curves X,Y and Z
associated with the three species in the reaction

(A) X = NO, Y = O2, Z = NO2

(B) X = O2, Y = NO, Z = NO2

(C) X = NO2, Y = NO , Z = O2

(D) X = O2, Y= NO2, Z = NO

The aromatic carbocation among the following is

(A)

60.

(B)

(C)

(D)

Cyclohexene is reacted with bromine in CCl4 in the dark. The product of the reaction is

(A)

(B)

(C)

(D)

CLASS-XII_STREAM-SB+2_PAGE # 56

BIOLOGY
61.

Ribouncleic Acid (RNA) that catalyze enzymatic reactions are called ribozymes. Which one of the following acts as a ribozyme?
(A) Ribosome

62.

(B) Amylase

(C) tRNA

(D) Riboflavin

In 1670, Robert Boyle conducted an experiment wherein he placed a viper (a poisonous snake) in a
chamber and rapidly reduced the pressure in that chamber. Which of the following would be true?
(A) Gas bubble developed in the tissues of the snake
(B) The basal metabolic rate of the snake increased tremendously
(C) The venom of the snake was found to decrease in potency
(D) The venom of the snake was found to increase in potency

63.

Bacteria can survive by absorbing soluble nutrients via their outer body surface, but animals cannot,
because
(A) Bacteria cannot ingest particles but animals can
(B) Bacteria have cell walls and animals do not
(C) Animals have too small a surface area per unit volume as compared to bacteria
(D) Animals cannot metabolize soluble nutrients

64.

A horse has 64 chromosomes and a donkey has 62. Mules result from crossing a horse and donkey.
State which of the following is INCORRECT?
(A) Mules can have either 64, 63 or 62 chromosomes
(B) Mules are infertile
(C) Mules have well defined gender (male/female)
(D) Mules have 63 chromosomes

65.

If the total number of photons falling per unit area of a leaf per minute is kept constant, then which of the
following will result in maximum photosynthesis?

66.

67.

(A) Shining green light

(B) Shining sunlight

(C) Shining blue light

(D) Shining ultraviolet light

Path-finding by ants is by means of


(A) Visually observing landmarks

(B) Visually observing other ants

(C) Chemical signals between ants

(D) Using the earth's magnetic field

Sometimes urea is fed to ruminates to improve their health. It works by


(A) Helping growth of gut microbes that break down cellulose
(B) Killing harmful microorganisms in their gut
(C) Increasing salt content in the gut
(D) Directly stimulating blood cell proliferation

CLASS-XII_STREAM-SB+2_PAGE # 57

68.

If you compare adults of two herbivore species of different sizes, but from the same geographical area, the
amount of faeces produced per kg body weight would be
(A) More in the smaller one than the larger one
(B) More in the larger one than the smaller one
(C) Roughly the same amount in both
(D) Not possible to predict which would be more

69.

Fruit wrapped in paper ripens faster than when kept in open air because
(A) Heat of respiration is retained better
(B) A chemical in the paper helps fruit ripening
(C) A volatile substance produced by the fruit is retained better and helps in ripening
(D) The fruit is cut off from the ambient oxygen which is an inhibitor to fruit ripening.

70.

When a person is suffering form high fever, it is sometimes observed that the skin has a reddish tinge.
Why does this happen?
(A) Red colour of the skin radiates more heat
(B) fever causes the release of a red pigment in the skin
(C) There is more blood circulation to the skin to keep the body warm
(D) There is more blood circulation to the skin to release heat from the body

71.

Bacteriochlorophylls are photosynthetic pigments found in phototrophic bacteria. Their function is distinct from the plant chlorophylls in that they
(A) do not produce oxygen
(B) do not conduct photosynthesis
(C) absorb only blue light
(D) function without a light source

72.

Athletes often experience muscle cramps. Which of the following statements is true about muscle cramps?
(A) Muscle cramp is caused due to conversion of pyruvic acid into lactic acid in the cytoplasm
(B) Muscle cramp is caused due to conversion of pyruvic acid into lactic acid in the mitochondria
(C) Muscle cramp is caused due to nonconversion of glucose to pyruvate in the cytoplasm
(D) Muscle cramp is caused due to conversion of pyruvic acid into ethanol in the cytoplasm

73.

A couple went to a doctor and reported that both of them are "carriers" for a particular disorder, their first
child is suffering from that disorder and that they are expecting their second child. What is the probability
that the new child would be affected by the same disorder?
(A) 100%
(B) 50%
(C) 25%
(D) 75%

74.

Of the following combinations of cell biological processes which one is associated with embryogenesis?
(A) Mitosis and Meiosis
(B) Mitosis and Differentiation
(C) Meiosis and Differentiation
(D) Differentiation and Reprogramming

75.

Conversion of the Bt toxin produced by Bacillus thuringienesis to its active form in the gut of the insects
is mediated by
(A) acidic pH of the gut
(B) alkaline pH of the gut
(C) lipid modification of the protein
(D) cleavage by chymotrypsin

CLASS-XII_STREAM-SB+2_PAGE # 58

76.

If you dip a sack full of paddy seeds in water overnight and then keep it out for a couple of days, it feels
warm. What generates this heat?
(A) Imbibation
(B) Exothermic reaction between water and seed coats
(C) Friction among seeds due to swelling
(D) Respiration

77.

Restriction endonucleases are enzymes that cleave DNA molecules into smaller fragments. Which type
of bond do they act on?
(A) N-glycosidic Bond
(B) Phosphodiester bond
(C) Hydrogen bond
(D) Disulfide bond

78.

The fluid part of blood flows in and out of capillaries in tissues to exchange nutrients and waste materials.
Under which of the following conditions will fluid flow out from the capillaries into the surrounding tissue?
(A) When arterial blood pressure exceeds blood osmotic pressure
(B) When arterial blood pressure is less than blood osmotic pressure
(C) When arterial blood pressure is equal to blood osmotic pressure
(D) Arterial blood pressure and blood osmotic pressure have nothing to do with the outflow of fluid from
capillaries

79.

The distance between two consecutive DNA base pairs is 0.34 nm. If the length of a chromosome is 1 mm
the number of base pairs in the chromosome is approximately
(A) 3 million
(B) 1.5 million
(C) 30 million
(D) 6 million

80.

Estimate the order of the speed of propagation of an action potential or nerve impulse
(A) nm/s
(B) micron/s
(C) cm/s
(D) m/s

PART-II (2 Mark)
MATHEMATICS
n

81.

1
1/ 2
Arrange the expansion of x 1/ 4 in decreasing powers of x. Suppose the coefficients of the first
2x

three terms form an arithmetic progression. Then the number of terms in the expansion having integer
powers of x is
(A) 1

82.

(B) 2

(C) 3

(D) more than 3

Let r be a real number and n N be such that the polynomial 2x2 + 2x +1 divides the polynomial (x + 1)n
r. Then (n, r) can be
(A) (4000, 41000)

(B) 4000, 1000


4

1000 1
, 1000
(C) 4
4

(D) 4000,
4000

CLASS-XII_STREAM-SB+2_PAGE # 59

83.

Suppose a, b are real numbers such that ab 0. Which of the following four figures represents the curve
(y ax b) (bx2 + ay2 ab) = 0 ?

(A) Fig.1
84.

(B) Fig.2

(C) Fig.3

(D) Fig.4

Among all cyclic quadrilaterals inscribed in a circle of radius R with one of its angles equal to 120,
consider the one with maximum possible area. Its area is
(A)

85.

2 R2

(B) 2 R2

(C)

3 R2

(D) 2 3 R 2

The following figure shows the graph of a differentiable function y = (x) on the interval [a, b] (not
containing 0).

Let g(x) = (x) / x. Which of the following is a possible graph of y = g (x)?

(A) Fig.1

(B) Fig.2

(C) Fig.3

(D) Fig.4

CLASS-XII_STREAM-SB+2_PAGE # 60

86.

Let V1 be the volume of a given right circular cone with O as the centre of the base and A as its apex. Let
V2 be the maximum volume of the right circular cone inscribed in the given cone whose apex is O and
whose base is parallel to the base of the given cone. Then the ratio V2 / V1 is
(A)

3
25

(B)

4
9

(C)

4
27

(D)

8
27

87.

Let : R R be a continuous function satisfying ( x ) x ( t ) dt , for all x R. Then the number of

elements in the set S = {x R (x) = 0 } is


(A) 1

(B) 2

(C) 3

(D) 4

88.

The value of

min| x |, cos

(cos x ) dx is

(A)

89.

2
4

(B)

2
2

(C)

2
8

(D) 2

Let ABC be a triangle and P be a point inside ABC such that PA 2PB 3PC 0 . The ratio of the area
of triangle ABC to that of APC is
(A) 2

90.

(B)

3
2

(C)

5
3

(D) 3

Suppose m, n are positive integers such that 6m + 2m+n 3m + 2n = 332. The value of the expression m2 + mn
+ n2 is
(A) 7

(B) 13

(C) 19

(D) 21

PHYSICS
91.

A ball is dropped vertically from a height of h onto a hard surface. If the ball rebounds from the surface with
a fraction r of the speed with which it strikes the latter on each impact, what is the net distance travelled
by the ball up to the 10th impact ?
(A) 2h

92.

1 r 10
1 r

(B) h

1 r 20
1 r 2

(C) 2h

1 r 22
1 r 2

(D) 2h

1 r 20
1 r 2

A certain planet completes one rotation about its axis in time T. The weight of an object placed at the
equator on the planet's surface is a fraction f (f is close to unity) of its weight recorded at a latitude of 60.
The density of the planet (assumed to be a uniform perfect sphere) is given by :
(A)

4 f 3
1 f 4GT 2

(B)

4 f 3
1 f 4GT 2

(C)

4 3f 3
1 f 4GT 2

(D)

4 2f 3
1 f 4GT 2

CLASS-XII_STREAM-SB+2_PAGE # 61

93.

Three equal charges +q are placed at the three vertices of an equilateral triangle centred at the origin.
They are held in equilibrium by a restoring force of magnitude F(r) = kr directed towards the origin, where
k is a constant. What is the distance of the three charges from the origin ?
1 q2

(A)
6 0 k

94.

1/ 3

3 q2

(B)
12 0 k

1/ 3

1 q2

(C)
6 0 k

2/3

3 q2

(D)
4 0 k

2/3

Consider the infinite ladder circuit shown below :

For which angular frequency will the circuit behave like a pure inductance ?

LC
(A)
95.

R(2 )
2( 1)

LC

(B)

R(2 )
2( 1)

(C)

R(2 )
2( 1)

(D)

R(2 )
2( 1)

x
1 2
kx V0cos ,
a
2
where V0,k, a are constants. If the amplitude of oscillation is much smaller than a, the time period is given
by

ma 2
ka 2 V0

(B) 2

m
k

(C) 2

ma 2
V0

(D) 2

ma 2
ka 2 V0

An ideal gas with heat capacity at constant volume CV undergoes a quasistatic process described by
PV in a PV diagram, where is a constant. The heat capacity of the gas during this process is given
by :
(A) CV

98.

LC

2L
(D)

A particle of mass m undergoes oscillations about x = 0 in a potential given by V(x) =

(A) 2
97.

1
(C)

A narrow parallel beam of light falls on a glass sphere of radius R and refractive index at normal
incidence. The distance of the image from the outer edge is given by :
(A)

96.

2
(B)

(B) CV +

nR
1

(C) CV + nR

(D) CV +

nR
1 2

3
nR is made to carry out
2
a cycle that is depicted by a triangle in the figure given below :
The following statement is true about the cycle :
An ideal gas with constant heat capacity CV =

P1V1
(A) The efficiency is given by 1 P V
2

1 P1V1
(B) The efficiency is given by 1 2 P V
2

(C) Net heat absorbed in the cycle is (P2 P1) (V2 V1)
(D) Heat absorbed in part AC is given by 2(P2V2 P1V1) +

1
(P V P2V1)
2 1 2

CLASS-XII_STREAM-SB+2_PAGE # 62

99.

Two identical particles of mass m and charge q are shot at each other from a very great distance with an
initial speed v. The distance of closest approach of these charges is :

q2
(A)

100.

q2
(B)

8 0mv 2

q2

4 0mv 2

(C)

2 0mv 2

(D) 0

At time t = 0, a container has N0 radioactive atoms with a decay constant . In addition, c numbers of
atoms of the same type are being added to the container per unit time. How many atoms of this type are
there at t = T ?
(A)

c
exp(T) N0exp(T)

(B)

c
exp(T) + N0exp(T)

(C)

c
(1 exp(T)) + N0exp(T)

(D)

c
(1 + exp(T) + N0exp(T)

CHEMISTRY
101.

2.52 g of oxalic acid dihydrate was dissolved in 100 mL of water. 10 mL of this solution was diluted is 500
mL. The normality of the final solution and the amount of oxalic acid (mg/mL) in the solution are respectively.
(A) 0.16 N, 5.04

102.

(B) 0.08 N, 3.60

(C) 0.04 N, 3.60

(D) 0.02 N, 10.08

Two isomeric compounds I and II are heated with HBr.

II

The products obtained are

(A)

(B)

(C)

(D)

CLASS-XII_STREAM-SB+2_PAGE # 63

103.

The number of possible enantiomeric pair(s) produced from the bromination of I and II, respectively, are

(A) 0, 1

104.

105.

(B) 1 , 0

(C) 0, 2

(D) 1, 1

For the reaction A B, H = 7.5 kJ mol1 and S = 25 J mol1, the value of G and the temperature,
at which the reaction reaches equilibrium are, respectively,
(A) 0 kJ mol1 and 400 K

(B) 2.5 kJ mol1 and 400 K

(C) 2.5 kJ mol1 and 200 K

(D) 0 kJ mol1 and 300 K

The solubility product of Mg(OH)2 is 1.0 1012. Concentrated aqueous NaOH solution is added to a
0.01 M aqueous solution of MgCl2. The pH at which precipitation occurs is
(A) 7.2

106.

(B) 7.8

(C) 8.0

(D) 9.0

A metal with an atomic radius of 141.4 pm crystallizes in the face centred cubic structure. The volume
of the unit cell in pm3 is
(A) 2.74 107

107.

(C) 2.19 107

(D) 9.20 107

Identify the cyclic silicate ion given in the figure below

(A) [Si6O24]24
108.

(B) 6.40 107

(B) [Si6O18]18

(C) [Si6O18]12

Diborane is formed the elements as shown in equation (1)


2B (s) + 3H2(g) B2H6(g)
Given that
H2O () H2O (g)
2B + 3/2 O2 (g) B2O3(s)
B2H6(g) + 3 O2 (g) B2O3 (s) + 3 H2O (g)
H2(g) + 1/2 O2 (g) H2O ()
the H0 for the reaction (1) is :
(A) 36 kJ
(B) 520 kJ
(C) 509 kJ

(D) [Si6O24]12

... (1)
H10 = 44 kJ
H20 = 1273 kJ
H30 = 2035 kJ
H40 = 286 kJ
(D) 3550 kJ

CLASS-XII_STREAM-SB+2_PAGE # 64

109.

The Crystal Field stabilization Energy (CFSE) and the spin only magnetic moment in Bohr Magneton
(BM) for the complex K3[Fe(CN)6] are, respectively.
(A) 0.0 and

35 BM

(C) 0.4 and

110.

(B) 2.0 and

24 BM

3 BM

(D) 2.4 and 0 BM

A solution containing 8.0 g of nicotine in 92 g of water freezes 0.925 degrees below the normal freezing
point of water. If the molal freezing point depression constant, Kf = 1.85C mol1 then the molar mass of
nicotine is :
(A) 16

(B) 80

(C) 320

(D) 160

BIOLOGY
111.

A host cell has intracellular bacterial symbionts. If the growth rate of the bacterial symbiont is always
10% higher than that of the host cell, after 10 generations of the host cell the density of bacteria in host
cells will increase
(A) by 10%

112.

(B) two-fold

(C) ten-fold

(D) hundred-fold

In a diploid organism, there are three different alleles for a particular gene. Of these three alleles one is
recessive and the other two alleles exhibit co-dominance. How many phenotypes are possible with this
set of alleles?
(A) 3

113.

(B) 6

(C) 4

(D) 2

Two students are given two different double stranded DNA molecules of equal length. They are asked to
denature the DNA molecules by heating. The DNA given to student A has a following composition of base
(A:G:T:C::35:15:35:15). While that given to student B is (A : G : T : C : : 12 : 38 : 12 : 38) Which of the
following statements is true?
(A) Both the DNA molecules would denature at the same rate
(B) The information given is insufficient to draw any conclusion
(C) DNA molecule given to student B would denature faster than that of student A
(D) DNA molecule given to student A would denature faster than that given to student B

CLASS-XII_STREAM-SB+2_PAGE # 65

114.

The amino acid sequences of a bacterial protein and a human protein carrying out similar function are
found to be 60% identical. However, the DNA sequences of the genes coding for these proteins are only
45% identical. This is possible because
(A) Protein sequence does not depend on DNA sequence
(B) DNA codons having different nucleotides in the third position can code for the same amino acids
(C) DNA codons having different nucleotides in the second position can code for the same amino acids
(D) Same DNA codons can code for multiple amino acids.

115.

The following DNA sequence (5 3) specifies part of a protein coding sequence, starting from position
1. Which of the following mutations will give rise to a protein that is shorter than the full-length protein?

10

11

12

13

14

15

(A) Deletion of nucleotide 13


(B) Deletion of nucleotide 8
(C) Insertion of a single nucleotide between 3 and 4
(D) Insertion of a single nucleotide between 10 and 11

116.

Which of the following correctly represents the results of an enzymatic reaction? Enzyme is E, Substrate
is S and Products are P1 and P2

117.

(A) P1 + S P2 + E

(B) E + S P1 + P2

(C) P1 + P2 + E S

(D) E + S P1 + P2 + E

Four species of birds have different egg colors: [1] while with no markings, [2] pale brown with no markings, [3] grey-brown with dark streaks and spots, [4] pale blue with dark blue-green spots. Based on egg
color, which species is most likely to nest in a deep tree hole?
(A) 1

118.

(B) 2

(C) 3

(D) 4

Consider a locus with two alleles, A and a, If the frequency of AA is 0.25, what is the frequency of A under
Hardy-Weinberg equilibrium?
(A) 1

(B) 0.25

(C) 0.5

(D) 0

CLASS-XII_STREAM-SB+2_PAGE # 66

119.

Which of the following graphs accurately represents the insulin levels (Y-axis) in the body as a function of
time (X-axis) after eating sugar and bread/roti?

120.

(A)

(B)

(C)

(D)

You marked two ink-spots along the height at the base of a coconut tree and also at the top of the tree.
When you examine the spots next year when the tree has grown taller, you will see
(A) the two spots at the top have grown more apart than the two spots at the bottom
(B) the top two spots have grown less apart than the bottom two spots
(C) both sets of spots have grown apart to the same extent
(D) both sets of spots remain un-altered.

*****

CLASS-XII_STREAM-SB+2_PAGE # 67

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2007
Time : 3Hr.

1.

Max. Marks : 160

In Year 2007, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90),Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2008
Time : 3Hr.

1.

Max. Marks : 160

In Year 2008, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90), Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2009
Time : 3Hr.

1.

Max. Marks : 160

In Year 2009, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90), Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2010
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2011
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2012
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

YEAR-2011 (KVPY-STREAM-SB+2)
PART-I (1 Mark)
MATHEMATICS
1.

Suppose logab + logb a= c. The smallest possible integer value of c for all a,b > 1 is
(A) 4
(B) 3
(C) 2
(D) 1

2.

Suppose n is a natural number such that | i + 2i2 + 3i3 + ....+ nin | = 18


11 . Then n is.
(A) 9
(B) 18
(C) 36

3.

2 . Where i is the square root of

Let P be an m m matrix such that P2 = P . Then (I+P)n equals


(A) I + P
(B) I + nP
(C) I + 2nP

(D) 72

(D) I + (2n1)P

4.

Consider the cubic equation x3 + ax2 + bx + c = 0 , where a,b,c are real numbers . Which of the following
statements is correct ?
(A) If a2 2b < 0 , then the equation has one real and two imaginary roots
(B) If a2 2b 0, then the equation has all real roots
(C) If a2 2b > 0, then the equation has all real and distinct roots
(D) If 4a3 27b2 > 0 , then the equation has real and distinct roots

5.

All the points (x,y) in the plane satisfying the equation x2 + 2x sin(xy) + 1 = 0 lie on
(A) a pair of straight lines
(B) a family of hyperbolas
(C) a parabola
(D) an ellipse

6.

Let A = (4,0) , B = (0,12) be two points in the plane . The locus of a point C such that the area of triangle
ABC is 18 sq.units is
(A) (y + 3x + 12)3 = 81
(B) (y + 3x + 81)2 = 12
2
(C) (y + 3x 12) = 81
(D) (y + 3x 81)2 = 12

7.

In a rectangle ABCD , the coordinates of A and B are (1,2) and (3,6) respectively and some diameter of the
circumscribing circle of ABCD has equation 2x y + 4 = 0. Then the area of the rectangle is
(A) 16

(B) 2 10

(C) 2 5

(D) 20

8.

In the xyplane , three distinct lines 1,2,3 concur at a point (,0). Further the lines 1,2,3 are normals
to the parabola y2 = 6x at the points A = (x1 , y1) , B (x2 , y2) , C = (x3 , y3) respectively . Then we have
(A) < 5
(B) > 3
(C) 5 < < 3
(D) 0 < < 3

9.

Let f(x) = cos5x + A cos 4x + Bcos3x + Ccos2x + Dcosx + E. and

2
3
8
9
f
+ ..............+ f
f
Then T
T = f(0) f + f
5
5
5
5
5
(A) depends on A,B,C,D,E
(B) depends on A,C,E, but independent of B and D
(C) depends on B,D , but independent of A,C,E
(D) is independent of A,B,C,D,E

10.

In triangle ABC , we are given that 3sinA + 4 cosB = 6 and 4sinB + 3cosA = 1. Then the measured of the
angle C is
(A) 30
(B) 150
(C) 60
(D) 75

11.

Which of the following intervals is possible domain of the function f(x) = log{x} [x] + log[x] {x} , where [x] is
the greatest integer not exceeding x and {x} = x [x] ?
(A) (0,1)
(B) (1,2)
(C) (2,3)
(D) (3,5)
CLASS-XII_STREAM-SB+2_PAGE # 68

12.

If f(x) = (2011 + x)n , where x is a real variable and n is a positive integer , then the value of f(0) + f(0) +

f " (0 )
f (n 1)(0)
+
......+
is
2!
(n 1)!
(A) (2011)n
13.

(B) (2012)n

(C) (2012)n 1

(D) n(2011)n

The minimum distance between a point on the curve y = ex and a point on the curve y = loge x is

1
(A)

(B)

(C)

(D) 2 2

14.

Let f : (2,) N be defined by f(x) = the largest prime factor of [x] , Then

f ( x) dx is equal to
2

(A) 17
15.

(B) 22

(C) 23

(D) 25

Let [x] denote the largest integer not exceeding x and {x} = x [x]. Then

2012

e cos( { x })

e cos( { x }) e cos( { x })

is equal to
(A) 0

16.

The value of lim


2
n
4
n

(A)

17.

1
4

(B)

(C) 2012

1
4n 2 4

.......... ..

12

(C)

(D) 2012

is
2
2
4n n
1

(D)

Two players play the following game : A writes 3,5,6 on three different cards ; B writes 8 ,9,10 on three
different cards . Both draw randomly two cards from their collections . Then A computes the product of
two numbers he/she has drawn , and B computes the sum of two numbers he/she has drawn . The player
getting the larger number wins. What is the probability that A wins ?
(A)

18.

(B) 1006

dx

1
3

(B)

5
9

(C)

4
9

(D)

1
9



Let a, b, c be three vectors in the xyz space such that a b = b c = c a 0 . If A,B,C are points with

position vectors a, b, c respectively , then the number of possible positions of the centriod of triangle ABC

is
(A) 1

(B) 2

(C) 3

(D) 6

19.

The sum of (12 1 + 1) (1!) + (22 2 + 1)(2!) + .... + (n2 n + 1)(n!) is


(A) (n + 2) !
(B) ( n 1) ((n + 1) !) + 1
(C) (n + 2)! 1
(D) n((n + 1)!) 1

20.

Let X be a nonempty set and let P(X) denote the collection of all subsets of X. Define f : X P(X) R by
1, x A
f(x,A) =
.Then f(x , A B) equals
0, x A

(A) f(x, A) + f(x ,B)


(B) f(x ,A) + f (x ,B) 1
(C) f (x , A) + f(x , B) f (x ,A) f( x ,B)
(D) f( x ,A) + | f( x ,A) f( x ,B) |

CLASS-XII_STREAM-SB+2_PAGE # 69

PHYSICS
21.

A narrow but tall cabin is falling freely near the earths surface. Inside the cabin, two small stones A and
B are released from rest (relative to the cabin). Initially A is much above the centre of mass and B much
below the centre of mass of the cabin. A close observation of the motion of A and B will reveal that :
(A) both A and B continue to be exactly at rest relative to the cabin
(B) A moves slowly upward and B moves slowly downward relative to the cabin
(C) both A and B fall to the bottom of the cabin with constant acceleration due to gravity
(D) A and B move slightly towards each other vertically.

22.

Two plates each of mass m are connected by a massless spring as shown :

A weight W is put on the upper plate which compresses the spring further. When W is removed, the entire
assembly jumps up. The minimum weight W needed for the assembly to jump up when the weight is
removed is just more than :
(A) mg
(B) 2mg
(C) 3mg
(D) 4mg
23.

If the speed (v) of the bob in a simple pendulum is plotted against the tangential acceleration (a), the
correct graph will be represented by :

(A)

(B)

(C)

(D)

(A) I

(B) II

(C) III

(D) IV

24.

A container with rigid walls is covered with perfectly insulating material. The container is divided into two
parts by a partition. One part contains a gas while the other is fully evacuated (vacuum). The partition is
suddenly removed. The gas rushes to fill the entire volume and comes to equilibrium after a little time. If
the gas is not ideal ,
(A) the initial internal energy of the gas equals its final internal energy
(B) the initial temperature of the gas equals its final temperature
(C) the initial pressure of the gas equals to its final pressure
(D) the initial entropy of the gas equals to its final entropy

25.

Two bulbs of identical volumes connected by a small capillary are initially filled with an ideal gas at
temperature T. Bulb 2 is heated to maintain a temperature 2T while bulb 1 remains at temperature T.
Assume throughout that the heat conduction by the capillary is negligible. Then the ratio of the final mass
of the gas in bulb 2 to the initial mass of the gas in the same bulb is close to :
(A) 1/3
(B) 2/3
(C) 1/3
(D) 1
CLASS-XII_STREAM-SB+2_PAGE # 70

26.

Two rods, one made of copper and the other steel of the same length and cross sectional area are joined
together. (The thermal conductivity of copper is 385 J.s1. m1. K1 and steel is 50 J.s1.m1.K1.) If the
copper end is held at 100C and the steel end is held at 0C, what is the junction temperature (assuming
no other heat losses) ?
(A) 12C
(B) 50C
(C) 73C
(D) 88C

27.

Jet aircrafts fly at altitudes above 30,000 ft where the air is very cold at 40C and the pressure is 0.28
atm. The cabin is maintained at 1 atm pressure by means of a compressor which exchanges air from
outside adiabatically. In order to have a comfortable cabin temperature of 25C, we will require in addition :
(A) a heater to warm the air injected into the cabin
(B) an air conditionaer to cool the air injected into the cabin
(C) neither a heater nor an air -conditioner : the compressor is sufficient
(D) alternatively heating and cooling in the two halves of the compressor cycle.

28.

A speaker emits a sound wave of frequency f0. When it moves towards a stationary observer with speed
u, the observer measures a frequency f1. If the speaker is stationary and the observer moves towards it
with speed u, the measured frequency is f2. Then :
(A) f1 = f2 < f0
(B) f1 > f2
(C) f1 < f2
(D) f1 = f2 > f0

29.

A plane polarized light passed through successive polarizers which are rotated by 30 with respect to
each other in the clockwise direction. Neglecting absorption by the polarizers and given that the first
polarizers axis is parallel to the plane of polarization of the incident light, the intensity of light at the exit
of the fifth polarizer is closest to :
(A) same as that of the incident light
(B) 17.5% of the incident light
(C) 30% of the incident light
(D) zero

30.

At 23C, a pipe open at both ends resonates at a frequency of 450 hertz. At what frequency does the same
pipe resonate on a hot day when the speed of sound is 4 percent higher than it would be at 23 C ?
(A) 446 Hz
(B) 454 Hz
(C) 468 Hz
(D) 459 Hz

31.

In a Youngs double slit set-up, light from a laser source falls on a pair of very narrow slits separated by
1.0 micrometer and bright fringes separated by 1.0 millimeter are observed on a distant screen. If the
frequency of the laser light is doubled, what will be the separation of the bright fringes ?
(A) 0.25 mm
(B) 0.5 mm
(C) 1.0 mm
(D) 2.0 mm

32.

For a domestic AC supply of 220 V at 50 cycles per second, the potential difference between the terminals of a two -pin electric outlet in a room is given by :

33.

(A) V(t) = 220 2 Cos(100t)

(B) V(t) = 220Cos(50t)

(C) V(t) = 220Cos(100t)

(D) V(t) = 220 2 Cos(50t)

In the circuit shown below the resistances are given in ohms and the battery is assumed ideal with emf
equal to 3.0 volts. The resistor that dissipates the most power is

(A) R1
34.

(B) R2

(C) R3

(D) R4

An electron collides with a free molecules initially in its ground state. The collision leaves the molecule in
a excited state that is metastable and does not decay to the ground state by radiation. Let K be the sum

of the initial kinetic energies of the electron and the molecule, and P the sum of their initial momenta. Let

K and P' represent the same physical quantities after the collision. Then



(A) K = K, P P'
(B) K < K, P P'
(C) K = K, P P'

(D) K < K, P P'

CLASS-XII_STREAM-SB+2_PAGE # 71

35.

In the circuit shown, the switch is closed at time t = 0

Which of the graphs shown below best reprsents the voltage across the inductor, as seen on an oscilloscope?

(I)

(II)

(III)

(IV)

(A) I
36.

(B) II

(C) III

(D) IV

Given below are three schematic graphs of potential energy V(r) versus distance r for three atomic
particles electron (e), proton (p+) and neutron (n), in the presence of a nucleus at the origin O. The radius
of the nucleus is r0. The scale on the Vaxis may not be the same for all figures. The correct pairing of
each with the corresponding atomic particle is :

(A) (1, n), (2, p+), (3, e)


(C) (1, e), (2, p+), (3, n)

(B) (1, p+), (2, e), (3, n)


(D) (1, p+), (2, n), (3, e)

37.

Due to transitions among its first three energy levels, hydrogenic atom emits radiation at three discrete
wavelength 1,2 and 3(1 < 2 < 3). Then :
(A) 1 = 2 + 3
(B) 1 + 2 = 3
(C) 1/1 + 1/2 = 1/3
(D) 1/1 = 1/2 + 1/3

38.

The total radiative power emitted by spherical blackbody with radius R and temperature T is P. If the
radius is doubled and the temperature is halved then the radiative power will be :
(A) P/4
(B) P/2
(C) 2P
(D) 4P

CLASS-XII_STREAM-SB+2_PAGE # 72

39.

The Quantum Hall Resistance RH is a fundamental constant with dimensions of resistance. If h is Plancks
constant and e the electron charge, then the dimension of RH is the same as :
(A) e2/h
(B) h/e2
(C) h2/e
(D) e/h2

40.

Four students measure the height of a tower. Each student uses a different method and each measures
the height many different times. The data for each are plotted below. The measurement with highest precision is :

(A) I

(B) II

(C) III

(D) IV

CHEMISTRY
41.

Ther hybridizations of Ni (CO)4 and [Cr(H2O)6]2+, respectively (A) sp3 and d3sp2
(B) dsp2 and d2sp3
(C) sp3 and d2sp3
(D) dsp2 and sp3 d2

42.

Extraction of silver is achieved by initial complexation of the ore (Argentite) with X followed by
reaction with Y, X and Y, respectively, are (A) CN and Zn
(B) CN and Cu

(C) Cl and Zn
(D) Br and Zn

43.

Assuming ideal behaviour, the enthalpy and volume of mixing of two liquids, respectively, are (A) zero and zero
(B) +ve and zero
(C) ve and zero
(D) ve and ve

44.

At 298 K, the ratio of osmotic pressures of two solutions of a substance with concentrations of 0.01
M and 0.001 M, respectively, is (A) 1
(B) 100
(C) 10
(D) 1000

45.

The rate of gas phase chemical reactions generally increases rapidly with rise in temperature. This is
mainly because :
(A) the collision frequency increases with temperature.
(B) the fraction of molecules having energy in excess of the activation energy increases with temperature.
(C) the activation energy decreases with temperature.
(D) the average kinetic energy of molecules increases with temperature.

CLASS-XII_STREAM-SB+2_PAGE # 73

46.

Among i-iv :

the compound that does not undergo polymerization under radical initiation, is :
(A) i
(B) ii
(C) iii
(D) iv
47.

Two possible stereoisomers for

are :
(A) enantiomers

(B) diastereomers

(C) conformers

(D) rotamers

48.

For a process to occur spontaneously.


(A) only the entropy of the system must increase.
(B) only the entropy of the surrounding must increase.
(C) either the entropy of the system or that of the surroundings must increase.
(D) the total entropy of the system and the surroundings must increase.

49.

When the size of a spherical nanoparticle decreases from 30 nm to 10 nm, the ratio surface area/volume
becomes
(A) 1/3 of the original
(B) 3 times the original (C) 1/9 of the original
(D) 9 times the original

50.

The major product of the following reaction is :

(A)

51.

(B)

(C)

(D)

(C) H3O+

(D) H2/Pt

For the transformation

the reagent used is :


(A) LiAlH4

(B) H3PO2

52.

The values of the limiting molar conductivity () for NaCl, HCl and NaOAc are 126.4. 425.9 and 91.0 S
cm2 mol1 respectively. For HOAC. in S cm2 mol1 is :
(A) 390.5
(B) 299.5
(C) 208.5
(D) 217.5

53.

To obtain a diffraction peak, for a crystalline solid with interplane distance equal to wavelength of incident
X-ray radiation, the angle of incidence should be :
(A) 90
(B) 0
(C) 30
(D) 60

54.

The standard Gibbs free energy change (G in kJ mol1), in a Daniel cell (Ecell = 1.1 V), when 2 moles
of Zn(s) is oxidized at 298 K, is closed to :
(A) 212.3
(B) 106.2
(C) 424.6
(D) 53.1

CLASS-XII_STREAM-SB+2_PAGE # 74

55.

All the products formed in the oxidation of NaBH4 by I2, are :


(A) B2H6 and NaI
(B) B2H6, H2 and NaI
(C) BI3 and NaH

(D) NaBI4 and HI

56.

The spin-only magnetic moments of [Mn(CN)6]4 and [MnBr4]2 in Bohr Magneton, respectively, are :
(A) 5.92 and 5.92
(B) 4.89 and 1.73
(C) 1.73 and 5.92
(D) 1.73 and 1.73

57.

In a zero-order reaction, if the initial concentration of the reactant is doubled, the time required for half the
reactant to be consumed :
(A) increases two-fold (B) increases four-fold (C) decreases by half
(D) does not change

58.

The adsorption isothermal for a gas is given by the relation x = ap/(1 + bp) where x is moles of gas
adsorbed per gram of the adsorbent, p is the pressure of the gas, and a and b are constants. Then x :
(A) increases with p
(B) remains unchanged with p
(C) decreases with p
(D) increases with p at low pressure and the same at high pressure.

59.

The reaction

NaOH / Heat

+ CHCl3

is known as :
(A) Perkin reaction
(C) Reimer-Tiemann reaction
60.

(B) Sandmeyer reaction


(D) Cannizzaro reaction

Among i-iii

the boiling point follows the order


(A) ii < i < iii
(B) iii < ii < i

(C) i < ii < iii

(D) ii < iii < i

CLASS-XII_STREAM-SB+2_PAGE # 75

BIOLOGY
61.

The major constituents of neurofilaments are


(A) microtubules
(C) actin filaments

(B) intermediate filaments


(D) protofilaments

62.

In which phase of the cell cycle are sister chromatids available as template for repair ?
(A) G1 phase
(B) G2 phase
(C) S phase
(D) M phase

63.

A person has difficulty in breathing at higher altitudes because


(A) oxygen is likely to diffuse from lungs to blood.
(B) oxygen is likely to diffuse from blood to lungs
(C) partial pressure of O2 is lower than partial pressure of CO2
(D) overall intake of O2 by the blood becomes low.

64.

In humans , the composition of a zygote that will develop into a female is


(A) 44A +XX
(B) 44A + XY
(C) 22 + X
(D) 23 A

65.

If you fractionate all the organelles from the cytoplasm of a plant cell. In which one of the following
sets of fractions will you find nucleic acids ?
(A) nucleus, mitochondria, chloroplast, cytoplasm
(B) nucleus, mitochondria, chloroplast, glyoxysome
(C) nucleus, chloroplast , cytoplasm and peroxisome
(D) nucleus, mitochondria, chloroplast, Golgi bodies

66.

A protein with 100 amino acid residues has been translated based on triplet genetic code. Had the
genetic code been quadruplet. the gene that codes for the protein would have been.
(A) same in size
(B) longer in size by 25%
(C) longer in size by 100%
(D) shorter in size

67.

If the sequence of base in DNA is 5'- ATGTATCTCAAT- 3', than the sequence of bases in its transcript
will be :
(A) 5' - TACATAGAGTTA - 3'
(B) 5' - UACAUAGAGUUA - 3'
(C) 5' - AUGUAUCUCAAU - 3'
(D) 5' - AUUGAGAUACAU - 3'

68.

The Na+/K+ pump is present in the plasma membrane of mammalian cells where it
(A) expels potassium from the cell
(B) expels sodium and potassium from the cell.
(C) pumps sodium into the cell.
(D) expels sodium from the cell.

69.

The CO2 in the blood is mostly carried


(A) by haemoglobin in RBCs
(B) in the cytoplasm of WBCs
(C) in the plasma as bicrbonate ions
(D) by plasma proteins

CLASS-XII_STREAM-SB+2_PAGE # 76

70.

Patients who have undergone organ transplants are given anti-rejection medications to
(A) minimize infection
(B) stimulate B- macrophage cell interaction
(C) prevent T- lymphocyte proliferation
(D) adopt the HLA of donor

71.

Saline drip is given to a Cholera patient because


(A) NACl kills Vibrio cholera
(B) NACl generates ATP
(C) Na+ ions stops nerve impulse and hence sensation of pain
(D) Na+ ions help in retention of water in body tissue

72.

A water molecule can form a maximum of hydrogen bonds.


(A) 1
(B) 2
(C) 3

(D) 4

73.

Circadian Rhythm is an endogenously driven cycle for biochemical, physiological and behavioral
processes. In humans, the approximate duration of this 'biological clock' is :
(A) 1 Hours
(B) 6 Hours
(B) 12 Hours
(D) 24 Hours

74.

Modern evolutionary theory consists of the concepts of Darwin modified by knowledge concerning :
(A) population statistics
(B) Mendel's laws
(C) the idea of the survival of the fittest
(D) competition

75.

Soon after the three germ layers are formed in a developing embryo, the process of organogenesis
starts. The human brain is formed from the
(A) ectoderm
(B) endoderm
(C) mesoderm
(D) partly endoderm and partly mesoderm

76.

Puffs in the polytene chromosomes of Drosophila melanogaster salivary glands represent


(A) transcriptionally active genes
(B) transcriptionally inactive genes
(C) heterochromatin
(D) housekeeping genes

77.

The process of cell death involving DNA cleavage in cells is known as


(A) necrosis
(B) apoptosis
(C) cytokinesis
(D) endocytosis

78.

According to the original model of DNA. as proposed by Watson & Crick 1953, DNA is a
(A) left handed helix
(B) helix that makes a full turn every 70 nm.
(C) helix where one turn of DNA contains 20 basepairs
(D) two stranded helix where each strand has opposite polarity.

79.

At which stage of meiosis I does crossing over occur ?


(A) lepoptene
(B) zygotene
(C) pachytene
(D) diplotene

80.

An electrode is placed in the axioplasm of a mammalian axon and another electrode is placed just
outside the axon. The potential difference measured will be
(A) 0
(B) 70mV
(B) 70V
(D) +70 V

CLASS-XII_STREAM-SB+2_PAGE # 77

PART-II (2 Mark)
MATHEMATICS
81.

Let A and B be any two n n matrices such that the following conditions hold : AB = BA and there exist
positive integers k and l such that Ak = I (the identity matrix) and B = 0 (the zero matrix), Then
(A) A + B = l
(B) det (AB) = 0
(C) det (A + B) 0
(D) (A + B)m = 0 for some integer m

82.

The minimum value of n for which


(A) is 101

83.

2 2 4 2 6 2 ....... ( 2n)2
1 2 3 2 5 2 ....... ( 2n 1)2

(B) is 121

(C) is 151

< 1.01
(D) does not exist

The locus of the point P = (a , b) where a , b are real numbers such that the roots of x3 + ax2 + bx + a = 0
are in arithmetic progression is

84.

(A) an ellipse

(B) a circle

(C) a parabola whose vertex is on the y axis

(D) a parabola whose vertex is on the x axis

The smallest possible positive slope of a line whose yintercept is 5 and which has a common point with
he ellipse 9x2 + 16y2 = 144 is
(A)

85.

3
4

(B) 1

(C)

4
3

(D)

9
16

Let A = { R | cos2(sin) + sin2(cos) = 1} and B = { R | cos(sin) sin(cos) = 0 }. Then A B


(A) is the empty set
(B) has exactly one element
(C) has more than one but finitely many elements
(D) has infinitely many elements

86.

Let f(x) = x3 + ax2 + bx + c , where a,b,c are real numbers. If f(x) has local minimum at x = 1 and a local

maximum at x =

1
1
and f(2) = 0 , then f ( x ) dx equals
3

(A)

87.

14
3

(B)

14
3

(C)

7
3

(D)

7
3

Let f(x) = x12 x9 + x4 x + 1. Which of the following is true ?


(A) f is one one
(B) f has a real root
(C) f never vanishes
(D) f takes only positive values

CLASS-XII_STREAM-SB+2_PAGE # 78

88.

x n (1 x )n

For each positive integers n, define fn(x) = minimum n! , n! , for 0 x 1. Let In = fn ( x ) dx, n 1 .

Then I n is equal to
n1

(A) 2 e 3

(B) 2 e 2

(C) 2 e 1

(D) 2 e

89.

The maximum possible value of x2 + y2 4x 6y , x,y real subject to the condition | x + y | + | x y | = 4


(A) is 12
(B) is 28
(C) is 72
(D) does not exist

90.

The arithemetic mean and the geometric mean of two distinct 2 digit numbers x and y are two integers
one of which can be obtained by reserving the digits of the other (in base 10 representation). Then x + y
equals
(A) 82
(B) 116
(C) 130
(D) 148

PHYSICS
91.

An isolated sphere of radius R contains uniform volume distribution of positive charge. Which of the
curves shown below correctly illustrates the dependence of the magnitude of the electric field of the
sphere as a function of the distance r from its centre ?

(A) I
92.

(B) II

(C) III

(D) IV

The surface of a planet is found to be uniformly charged. When a particle of mass m and no charge is
thrown at an angle from the surface of the planet, it has a parabolic trajectory as in projectile motion with
horizontal range L. A particle of mass m and charge q, with the same initial conditions has a range L/2.
The range of particle of mass m and charge 2q with the same initial conditions is :
(A) L
(B) L/2
(C) L/3
(D) L/4

CLASS-XII_STREAM-SB+2_PAGE # 79

93.

Figure below shows a small mass connected to a string, which is attached to a vertical post.If the ball is
released when the string is horizontal as shown , the magnitude of the total acceleration (including radial
and tangential) of the mass as a function of the angle is

(A) g Sin

(B) g

3 Cos 2 1

(C) g Cos

(D) g

3Sin 2 1

94.

One mole of an ideal gas at intial temprature T, undergoes a quasistatic process during which the
volume V is doubled .During the process the internal energy U obeys the equation U = aV3, where a is a
constant .The work done during this process is
(A) 3RT / 2
(B) 5RT / 2
(C) 5RT / 3
(D) 7RT / 2

95.

A constant amount of an ideal gas undergoes the cyclic process ABCA in the PV diagram shown below.

The path BC is an isothermal .The work done by the gas during one complete cycle , beginning and
ending at A is nearly
(A) 600 KJ
(B) 300 KJ
(C) 300 KJ
(D) 600 KJ
96.

A material is embedded between two glass plates . Refractive index n of the material varies with thickness as shown below .The maximum incident angle (in degrees) on the material for which beam will pass
through the material is

(A) 60.0

(B) 53.1

(C) 43.5

(D) 32.3

CLASS-XII_STREAM-SB+2_PAGE # 80

97.

At a distance form a uniformly charged long wire , a charged particle is thrown radially outward with a
velocity u in the direction perpendicular to the wire . When the particle reaches a distance 2 from the wire
its speed is found to be

2u . The magnitude of the velocity , when it is a distance 4l away from the wire,

is (ignore gravity)
(A) 3u
98.

(B) 2 u

(C) 2 2 u

(D) 4 u

A rectangular loop of wire shown below is coplanar with a long wire carrying current I .

The loop is pulled to the right as indicated .What are the directions of the induced current in the loop and
the magnetic forces on the left and the right sides of the loop ?
Inducded Current
Force on left side
Force on right side
(A)
Counterclockwise
To the left
To the right
(B)
Clockwise
To the left
To the right
(C)
Counter clockwise
To the right
To the left
(D)
Clockwise
To the right
To the left
99.

Two batteries V1 and V2 are connected to three resistors as shown below

If V1 = 2V and V2 = 0V , the current I = 3mA. If V1 = 0V and V2 = 4V , the current I = 4 mA. Now if V1 = 10


V and V2 = 10V , the current I will be
(A) 7 mA
(B) 15 mA
(C) 20 mA
(D) 25 mA
100.

y2
+
= 1. At point (0, b), the x-component
a2
b2
of velocity is u. the y-component of acceleration at this point is :
(A) bu2 / a2
(B) u2 / a2
(C) au2 / b2
(D) u2 / a
A particle moves in a plane along an eliptic path given by

x2

CHEMISTRY
101.

XeF6 hydrolyses to give an oxide. The structure of XeF6 and the oxide, respectively are
(A) octahedral and tetrahedral
(B) distorted octahedral pyramidal
(C) octahedral and pyramidal
(D) distorted octahedral and tetrahedral

102.

MnO4 oxidizes (i) oxalate ion in acidic medium at 333 K and (ii) HCl. For balanced chemical equations,
the rations [MnO4 : C2O42] in (i) and [MnO4 : HCl] in (ii), respectively, are :
(A) 1 : 5 and 2 : 5
(B) 2 : 5 and 1 : 8
(C) 2 : 5 and 1 : 5
(D) 5 : 2 and 1 : 8

103.

If E Fe 2 / Fe = 0.440 V and E Fe3 / Fe 2 = 0.770 V, then E Fe3 / Fe is :


(A) 0.330 V
(B) 0.037 V
(C) 0.330 V
(D) 1.210 V

104.

The electron in hydrogen atom is in the first Bohr orbit (n = 1). The ratio of transition energies, E(n = 1
n = 3) to E (n = 1 n = 2), is
(A) 32/27
(B) 16/27
(C) 32/9
(D) 8/9

CLASS-XII_STREAM-SB+2_PAGE # 81

105.

In the following conversion,


(i) MeMgBr

NaOH / I

(ii) H3O

H3O

2

X
Y

the major products X and Y, respectively, are :

106.

(A) i
(B) ii
The reaction sequence,

HNO2

X

(C) iii

(D) iv

(C) iii

(D) iv

the major products X and Y, respectively, are :

(A) i
107.

(B) ii

Optically active (S)--methoxyacetaldehyde on reaction with MeMgX gave a mixture of alcohols. The
major diastereomer P on treatment with Me1/K2CO3 gave an optically inactive compound. P is :

(A) i

(B) ii

(C) iii

(D) iv

CLASS-XII_STREAM-SB+2_PAGE # 82

108.

At 300 K the vapour pressure of two pure liquids, A and B are 100 and 500 mm Hg, respectively. If in a
mixture of A and B, the vapour pressure is 300 mm Hg, the mole fractions of A in the liquid and in the
vapour phase, respectively, are :
(A) 1/2 and 1/10
(B) 1/4 and 1/6
(C) 1/4 and 1/10
(D) 1/2 and 1/6

109.

The crystal field stabilization energies (CFSE) of high spin and low spin d6 metal complexes in terms of
0, respectively, are :
(A) 0.4 and 2.4
(B) 2.4 and 0.4
(C) 0.4 and 0.0
(D) 2.4 and 0.0

110.

Emulsification of 10 ml of oil in water produces 2.4 1018 droplets. If the surfaces tension at the oil-water
interface is 0.03 Jm2 and the area of each droplet is 12.5 1016 m2, the energy spent in the formation of
oil droplets is :
(A) 90 J
(B) 30 J
(C) 900 J
(D) 10 J

BIOLOGY
111.

Which sequence of events gives rise to flaccid guard cells and stomatal closure at night ?
(A) low [Glucose ] low osmotic pressure low pH high pCO2
(B) low pH high pCO2 low [Glucose ] low osmotic pressure
(C) low osmotic pressure high pCO2 low pH low [Glucose]
(D) high pCO2 low pH low [Glucose] low osmotic pressure

112.

Rice has a diploid genome with 2n = 24. If crossing over is stopped in a rice plant and then selfed
seeds are collected, will all the offsprings be genetically identical to the parent plant ?
(A) yes, because crossing-over is the only source of genetic variation
(B) no, because stopping of crossing over automatically increases rate of point mutation
(C) yes, only if the parent plant was a completely inbred line
(D) yes, only if the parent plant was a hybrid between two prue-bred lines

113.

Rodents can distinguish between many different types of odours. The basis for odour discrimination
is that
(A) they have a small number of odorant receptors that bind to many different odorant molecules
(B) the mechanoreceptors in the nasal cavity are activated by different odorant molecules found in
the air passing through the nostrils
(C) the part of the brain that processes the sense of smell has many different receptors for odorant
molecules
(D) a large number of different chemoreceptors are present in the nasal cavity that binds a variety of
odorant molecules

114.

Although blood flows through large arteries at high pressure, when the blood reaches small capillaries
the pressure decreases because
(A) the valves in the arteries regulate at he rate of blood flow into the capillaries
(B) the volume of blood in the capillaries is much lesser than that in the arteries
(C) the total cross-sectional area of capillaries arising form an artery is much greater than that of
the artery
(D) elastin fibers in the capillaries help to reduce the arterial pressure

115.

E.coli about to replicate was pulsed with tritiated thymidine for 5 min and then transferred to normal
medium . After one cell division which one of the following observations would be correct ?
(A) both the strands of DNA will be radioactive
(B) one strand of DNA will be radioactive
(C) none of the strands will be radioactive
(D) half of one strand of DNA will be radioactive

CLASS-XII_STREAM-SB+2_PAGE # 83

116.

Selection of lysine auxotroph (bacteria which requires lysine for growth) from a mixed population of
bacteria can be done growing bacterial population in the presence of
(A) lysine
(B) penicillin
(B) lysine and penicillin
(D) glucose

117.

Increasing the number of measurements of an experimental variable will


(A) increase the standard error of the sample
(B) increase the mean of the sample
(C) decrease the standard error of the sample
(D) result in all of the above

118.

119.

For a human male what is the probability that all the maternal chromosomes will end up in the
same gamete ?
(A) 1/23
(B) 223
46
(C) 2
(D) ()23
Nocturnal animal have retinas that contain
(A) a high percentage of rods to increase sensitivity to low light conditions
(B) a high percentage of cones so that nocturnal color vision can be improved in low light conditions
(C) an equal number of rods and cones so that vision can be optimized
(D) retinas with the photoreceptor layer present in the front of the eye to increase light sensitivity

120.

The length of one complete turn of a DNA double helix is

(A) 34 A

(B) 34 nm

(C) 3.4 A

(D) 3.4 m

*****

CLASS-XII_STREAM-SB+2_PAGE # 84

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2007
Time : 3Hr.

1.

Max. Marks : 160

In Year 2007, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90),Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2008
Time : 3Hr.

1.

Max. Marks : 160

In Year 2008, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90), Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2009
Time : 3Hr.

1.

Max. Marks : 160

In Year 2009, Question Number 1-80 each carries 1 (one) mark, Maths(1-20), Physics
(21-40), Chemistry(41-60), Biology(61-80) & Question Number 81 to 125 each carries
2 marks, Maths(81-90), Physics(91-100), Chemistry(101-110), Biology(111-120)

2.

Blank papers, clip boards, log tables, slide rule, calculators, mobile or any other
electronic gadgets in any form is not allowed.

3.

Write your Name and Roll No. in the space provided in the bottom of this booklet.

4.

Before answering the paper, fill up the required details in the blank space provided in
the answer sheet.

5.

Do not forget to mention your roll number neatly and clearly in the blank space provided
in the answer sheet.

6.

In case of any dispute, the answer filled in the OMR sheet available with the institute
shall be final.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2010
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2011
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

GENERAL INSTRUCTIONS FOR KVPY TEST PAPER, STREAM- SB+2


YEAR : 2012
Time : 3Hr.

Max. Marks : 160

1.

The Question paper consists of two parts (both contain only multiple choice question) for 100
marks. There will be four sections in Part-I (each containing 20 questions) four sections in
Part-II (each containing 10 questions). Answer any THREE of the four sections in Part-I and
any TWO of the four sections in Part-II.

2.

The composition of the question paper is given in the table below :


S No.
1
2
3
4

Subject

Part-I

Part-II

Mathematics

20 questions - 1 mark each

10 questions - 2 mark each

Physics

20 questions - 1 mark each

10 questions - 2 mark each

Chemistry

20 questions - 1 mark each

10 questions - 2 mark each

Biology

20 questions - 1 mark each

10 questions - 2 mark each

3.

The answer paper is machine readable. Do not forget to mention your paper code and Roll
Number neatly and clearly in the blank space provided in the Objective Response Sheet
(ORS)/Answer Sheet.

4.

For each question, indicate your answer by filling the corresponding oval with a HB pencil only.

5.

For each question there will be four choices given and only one of them is the correct answer. Fill
only one oval per question. If you mark more than one oval, it will be considered as an incorrect
answer.

6.

There is negative marking for wrong answers. Unanswered questions will not be evaluated and
will not be penalized as a wrong answer.

7.

In Part-I each correct answer gets 1 mark and for each incorrect answer 0.25 mark will be
deducted. In Part-II each correct answer gets 2 marks and for each incorrect answer 0.5 mark
will be deducted.

8.

You are permitted to use a non programable calculator.

9.

Candidates are permitted to carry their question paper after the examination.

YEAR-2012 (KVPY-STREAM-SB+2)
PART-I (1 Mark)
MATHEMATICS
1.

Three children, each accompanied by a guardian, seek admission in a school. The principal wants to
interview all the 6 persons one after the other subject to the condition that no child is interviewed before
its guardian. In how many ways can this be done?
(A) 60
(B) 90
(C) 120
(D) 180

2.

In the real number system, the equation


(A) no solution
(C) exactly four distinct solutions

x 3 4 x 1 + x 8 6 x 1 = 1 has
(B) exactly two distinct solutions
(D) infinitely many solutions

3.

The maximum value M of 3x + 5x 9x + 15x 25x, as x varies over reals, satisfies


(A) 3 < M < 5
(B) 0 < M < 2
(C) 9 < M < 25
(D) 5 < M < 9

4.

Suppose two perpendicular tangents can be drawn from the origin to the circle x2 + y2 6x 2py + 17 =
0, for some real p. Then |p| is equal to
(A) 0
(B) 3
(C) 5
(D) 17

5.

Let a, b, c be numbers in the set {1, 2, 3, 4, 5, 6} such that the curves y = 2x3 + ax + b and y = 2x3 + cx
+ d have no point in common. The maximum possible value of (a c)2 + b d is
(A) 0
(B) 5
(C) 30
(D) 36

6.

Consider the conic ex2 + y2 2e2x 22y + e3 + 3 = e. Suppose P is any point on the conic and S1, S2
are the foci of the conic, then the maximum value of (PS1 + PS2) is
(A) e

(B)

(C) 2

sin( x a) sin( x a)
, then
cos( x a) cos( x a)
(A) f(x + 2) = f(x) but f(x + ) f(x) for any 0 < < 2
(B) f is a strictly increasing function
(C) f is strictly decreasing function
(D) f is a constant function

7.

Let f(x) =

8.

The value of tan 81 tan 63 tan27 + tan9 is


(A) 0
(B) 2
(C) 3

9.

(D) 2 e

The midpoint of the domain of the function f(x) =


(A)

1
4

(B)

3
2

(D) 4

4 2x 5 for real x is
(C)

2
3

(D)

2
5

10.

Let n be a natural number and let a be a real number. The number of zeros of x2n+1 (2n + 1) x + a = 0
in the interval [1, 1] is
(A) 2 if a > 0
(B) 2 if a < 0
(C) at most one for every vale of a
(D) at least three for every value of a

11.

Let f : R R be the function f(x) = (x a1) (x a2) + (x a2) (x a3)+ (x x3) (x x1) with a1, a2, a3 R.
Then f(x) 0 if and only if
(A) at least two of a1, a2, a3 are equal
(B) a1 = a2 = a3
(C) a1, a2, a3 are all distinct
(D) a1, a2, a3 are all positive and distinct
CLASS-XII_STREAM-SB+2_PAGE # 85

/2

12.

The value

(sin x )

2 1

(sin x )

2 1

dx

0
/2

is

dx

2 1

(A)

2 1

(B)

2 1

2 1

2 1

(C)

(D) 2 2

2012

13.

(sin( x

The value

) x 5 1) dx is

2012

(A) 2012

14.

(B) 2013

(C) 0

(D) 4024

Let [x] and {x} be the integer part and fractional part of a real number x respectively. The value of the
5

integral

[ x] { x} dx is
0

(A) 5/2

15.

Let Sn =

(B) 5
n

k 1

(C) 34.5

(D) 35.5

k denote the sum of the first n positive integers. The numbers S1, S2, S3, ....S99 are

written on 99 cards. The probability of drawing a cards with an even number written on it is
(A)

16.

(B)

49
100

(C)

49
99

(D)

48
99

A purse contains 4 copper coins and 3 silver coins. A second purse contains 6 coins and 4 silver coins.
A purse is chosen randomly and a coin is taken out of it. What is the probability that it is a copper coin?
(A)

17.

1
2

41
70

(B)

31
70

(C)

27
70

(D)

1
3

Let H be the orthocentre of an acuteangled triangle ABC and O be its circumcenter. Then HA HB HC
(A) is equal to HO

(B) is equal to 3HO

(C) is equal to 2HO

(D) is not a scalar multiple of HO in general

18.

The number of ordered pairs (m,n) where m, n {1, 2, 3, ......, 50}, such that 6m + 9n is a multiple of 5 is
(A) 1250
(B) 2500
(C) 625
(D) 500

19.

Suppose a1, a2, a3, ....., a2012 are integers arranged on a circle. Each number is equal to the average of
its two adjacent numbers. If the sum of all even indeced numbers is 3018, what is the sum of all
numbers?
(A) 0
(B) 1509
(C) 3018
(D) 6036

20.

Let S = 1, 2, 3, ...., n} and A = {(a, b) | 1 a, b n} = S S . A subset B of A is said to be a good subset


if (x, x) B for every x S. Then the number of good subsets of A is
(A) 1

(B) 2n

(C) 2n(n1)

(D) 2 n2
CLASS-XII_STREAM-SB+2_PAGE # 86

PHYSICS
21.

An ideal monatomic gas expands to twice its volume. If the process is isothermal, the magnitude of work
done by the gas is W i . If the process is adiabatic the magnitude of work done by the gas is W a . Which
of the following is true
(A) W i = W a > 0
(B) W i > W a > 0
(C) W i > W a = 0
(D) W a > W i = 0

22.

The capacitor of capacitance C in the circuit shown is fully charged initially, Resistance is R.

After the switch S is closed, the time taken to reduce the stored energy in the capacitor to half its initial
value is :
(A)

23.

RC
2

(B) RC ln 2

(C) 2RC ln 2

(D)

RC ln 2
2

A liquid drop placed on a horizontal plane has a near spherical shape (slightly flattened due to gravity). Let
R be the radius of its largest horizontal section. A small disturbance causes the drop to vibrate with
frequency v about its equilibrium shape. By dimensional analysis the ratio

can be (Here is

R 3
surface tension, is density, g is acceleration due to gravity, and k is an arbitrary dimensionless constant)
(A)

24.

kgR 2

(B)

k R 3
g

(C)

k R 2
g

k
(D) g

Seven identical coins are rigidly arranged on a flat table in the pattern shown below so that each coin
touches its neighbours. Each coin is a thin disc of mass m and radius r. Note that the moment of inertia
of an individual coin about an axis passing through center and perpendicular to the plane of the coin is
mr 2
.
2

The moment of inertia of the system of seven coins about an axis that passes through the point P (the
centre of the coin positioned directly to the right of the central coin) and perpendicular to the plane of the
coins is
(A)

55
mr2
2

(B)

127
mr2
2

(C)

111
mr2
2

(D) 55 mr2

CLASS-XII_STREAM-SB+2_PAGE # 87

25.

A planet orbits in an elliptical path of eccentricity e around a massive star considered fixed at one of the
foci. The point in space where it is closest to the star is denoted by P and the point where it is farthest is
denoted by A. Let vP and vA be the respective speeds at P and A. Then

vP 1 e
(A) v 1 e
A
26.

vP
(B) v = 1
A

(C)

vP 1 e2

vA
1 e

(D)

vP 1 e2

v A 1 e2

In a Young's double slit experiment the intensity of light at each slit is 0. Interference pattern is observed
along a direction parallel to the line S1 S2 on screen S.

The minimum, maximum, and the intensity averaged over the entire screen are respectively.
(A) 0, 40 , 20
(B) 0 , 20 , 30/2
(C) 0, 40 , 0
(D) 0, 20 , 0
27.

A loop carrying current has the shape of a regular polygon of n sides. If R is the distance from the centre

to any vertex, then the magnitude of the magnetic induction vector B at the centre of the loop is
(A) n

28.

tan
2 R
n

(B) n

0
2
tan
2 R
n

(C)

0
2R

(D)

tan
R
n

A conducting rod of mass m and length is free to move without friction on two parallel long conducting
rails, as shown below. There is a resistance R acorss the the rails. In the entire space around, there is a
uniform magnetic filed B normal to the plane of the rod and rails. The rod is given an impulsive velocity v0.

1
mv02
2
(A) will be converted fully into heat energy in the resistor
(B) will enable rod to continue to move eith velocity v0 since the rails are frictionless
(C) will be converted fully into magnetic energy due to induced current
(D) will be converted into the work done against the magnetic field
Finally, the initial energy

CLASS-XII_STREAM-SB+2_PAGE # 88

29.

A steady current flows through a wire of radius r, length L and resistivity . The current produces heat in
the wire. The rate of heat loss in a wire is proportional its surface area. The steady temperature of the wire
is independent of
(A) L
(B) r
(C)
(D)

30.

The ratio of the speed of sound to the average speed of an air molecule at 300K and 1 atmospheric
pressure is close to
(A) 1

31.

(B)

300

1
300

(C)

(D) 300

In one model of the election, tho electron of mass me is thought to be a uniformly charged shell of radius
R and total charge e, whose electrostatic energy E is equivalent to its mass me via Einstein's mass
energy relation E = mec2 . In this model, R is approximately (me = 9.1 1031 kg, c = 3 108 m.s1,

1
= 9 109 Farads m1, magnitude of the electron charge = 1.6 1019 C)
4 0
(A) 1.4 1015 m
(B) 2 1013 m
(C) 5.3 1011 m
(D) 2.8 1035 m
32.

A body is executing simple harmonic motion of amplitude a and period T about the equilibrium position
x = 0. Large numbers of snapshots are taken at random of this body in motion. The probability of the body
being found in a very small interval x to x + |dx| is highest at
(A) x = a

(B) x = 0

(C) x = a/2

(D) x =

a
2

33.

Two identical bodies are made of a material for which the heat capacity increases with temperature One
of these is held at a temperature of 100C while the other one is kept at 0C. If the two are brought into
contact, then, assuming no heat loss to the environment, the final temperature that they will reach is
(A) 50C
(B) more than 50C
(C) less than 50C
(D) 0C

34.

A particle is acted upon by a force given by F = x3 x4 where and are positive constants. At the
point x = 0, the particle is
(A) in stable equilibrium
(B) in unstable equiibrium
(C) in neutral equilibrium
(D) not in equilibrium

35.

The potential energy of a point particle is given by the expression V(x) = x + sin (x / ). A dimensionless
combination of the constants , and is
(A)

36.

(B)

(C)

(D)

A ball of mass m suspended from a rigid support by an inextensible massless string is released from a
height h above its lowest point. At its lowest point it colIides elastically with a block of mass 2m at rest on
a frictionless surface. Neglect the dimensions of the ball and the block. After the collision the ball rises to
a maximum height of

(A)

h
3

(B)

h
2

(C)

h
8

(D)

h
9

CLASS-XII_STREAM-SB+2_PAGE # 89

37.

A particle released from rest is falling through a thick fluid under gravity. The fluid exerts a resistive force
on the particle proportional to the square of its speed. Which one of the following graphs best depicts the
variation of is speed v with time t?

(A)

(B)

(C)

(D)

38.

A cylindrical steel rod of length 0.10m and thermal conductivity 50 W.m1.K1 is welded end to end to
copper rod of thermal conductivity 400 W.m1.K1 and of the same area of cross section but 0.20 m long.
The free end of the steel rod is maintained at 100C and that of the copper rod at 0C. Assuming that the
rods are perfectly insulated from the surrounding the temperature at the junction of the two rods is
(A) 20C
(B) 30C
(C) 40C
(D) 50C

39.

A parent nucleus X is decaying into daughter nucleus Y which in turn decays to Z. The half lives of X and
Y are 4000 years and 20 years respectively. In a certain sample, it is found that the number of Y nuclei
hardly changes with time. If the number of X nuclei in the sample is 4 1020 , the number of Y nuclei
present in it is
(A) 2 1017
(B) 2 1020
(C) 4 1023
(D) 4 1020

40.

An unpolarized beam of light of intensity 0 passes through two linear polarizers making an angle of 30
with respect to each other. The emergent beam will have an intensity.
(A)

3 0
4

(B)

3 0
4

(C)

3 0
8

(D)

0
8

CHEMISTRY
41.

42.

43.

44.

Among the following, the species with the highest bond order is :
(A) O2
(B) F2
(C) O2+

(D) F2

The molecule with non-zero dipole moment is :


(A) BCl3
(B) BeCl2

(D) NCl3

(C) CCl4

For a one-electron atom, the set of allowed quantum numbers is :


(A) n = 1, = 0, m = 0, ms = +

(B) n = 1, = 1, m = 0, ms = +

(C) n = 1, = 0, m = 1, ms =

(D) n = 1, = 1, m = 1, ms =

In the reaction of benzene with an electrophile E+, the structure of the intermediate -complex can be
represented as :

(A)

(B)

(C)

(D)

CLASS-XII_STREAM-SB+2_PAGE # 90

45.

The most stable conformation of 2, 3-dibromobutane is :

(A)

(B)

(C)

(D)

46.

Typical electronic energy gaps in molecules are about 1.0 eV. In terms of temperature, the gap is closest
to:
(A) 102 K
(B) 104 K
(C) 103 K
(D) 105 K

47.

The major final product in the following reaction is :


1) CH MgBr

3
CH3CH2CN

2) H3O

(A)

(B)

(C)

(D)

48.

A zero-order reaction, A Product, with an initial concentration [A]0 has a half-life of 0.2 s. If one starts
with the concentration 2[A]0, then the half-life is :
(A) 0.1 s
(B) 0.4 s
(C) 0.2 s
(D) 0.8 s

49.

The isoelectronic pair of ions is :


(A) Sc2+ and V3+
(B) Mn3+ and Fe2+

50.

(C) Mn2+ and Fe3+

(D) Ni3+ and Fe2+

(C)

(D)

(C)

(D)

The major product in the following reaction is :


NaNH

(A)

51.

(B)

The major product of the following reaction is :


Conc.HBr

(A)

(B)

CLASS-XII_STREAM-SB+2_PAGE # 91

52.

The oxidation state of cobalt in the following molecule is :

(A) 3

(B) 1

(C) 2

(D) 0

53.

The pKa of a weak acid is 5.85. The concentrations of the acid and its conjugate base are equal at a pH
of:
(A) 6.85
(B) 5.85
(C) 4.85
(D) 7.85

54.

For a tetrahedral complex [MCl4]2, the spin-only magnetic moment is 3.83 BM. The element M is :
(A) Co
(B) Cu
(C) Mn
(D) Fe

55.

Among the following graphs showing variation of rate (k) with temperature (T) for a reaction, the one that
exhibits Arrhenius behavior over the entire temperature range is :

(A)

56.

57.

58.

(B)

(C)

(D)

The reaction that gives the following molecule as the major product is

(A)

(B)

(C)

(D)

The CO bond length in CO, CO2 and CO32 follows the order :
(A) CO < CO2 < CO32 (B) CO2 < CO32 < CO (C) CO > CO2 > CO32

(D) CO32 < CO2 < CO

The equilibrium constant for the following reactions are K1 and K2, respectively.
2P(g) + 3Cl2(g)
2PCl3(g)
PCl3(g) + Cl2(g)
PCl5(g)
The the equilibrium constant for the reaction
2P(g) + 5Cl2(g)
2PCl5(g)
is :
(A) K1K2
(B) K1K22

(C) K12K22

(D) K12K2
CLASS-XII_STREAM-SB+2_PAGE # 92

59.

The major product of the following reaction is :


AlCl

+ (CH3C)2CHCH2Cl

60.

(A)

(B)

(C)

(D)

Doping silicon with boron produces a :


(A) n-type semiconductor
(C) p-type semiconductor

(B) metallic conductor


(D) insulator

BIOLOGY
61.

The disorders that arise when the immune system destroys 'self' cells are called autoimmmune disorders. Which of the following would be classified under this
(A) rheumatoid arthritis (B) asthma
(C) rhintis
(D) eczema

62.

Which of the following class of immunoglobulins can trigger the complement cascade ?
(A) IgA
(B) IgM
(C) IgD
(D) IgE

63.

Diabetes insipidus is due to


(A) hypersecretion of vasoperssin
(C) hypersecretion of insulin

(B) Hyposecretion of insulin


(D) hyposecretion of vasopressin

64.

Fossils are most often found in which kind of rocks ?


(A) meteorites
(B) sedimentary rocks
(C) igneous rocks
(D) metamorphic rocks

65.

Peptic ulcers are caused by


(A) a fungus, Candida albicans
(B) a virus, cytomegalo virus
(C) a parasite, Trypanosoma brucei
(D) a bacterium, Helicobacter pylori

66.

Transfer RNA (tRNA)


(A) is present in the ribosomes and provides structural integrity
(B) usually has clover leaf-like structure
(C) carries genetic information from DNA to ribosomes
(D) codes for proteins

67.

Some animals excrete uric acid in urine (uricotelic) as it requires very little water. This is an adaptation to
conserve water loss. Which animals among the following are most likely to be uricotelic?
(A) fishes
(B) amphibians
(C) birds
(D) mammals

68.

A ripe mango, kept with unripe mangoes causes their ripening. This is due to the release of a gaseous
plant hormone
(A) auxin
(B) gibberlin
(C) cytokinine
(D) ethylene

CLASS-XII_STREAM-SB+2_PAGE # 93

69.

Human chromosomes undergo structural changes during the cell cycle. Chromosomal structure can be
best visualized if a chromosome is isolated from a cell at
(A) G1 phase
(B) S phase
(C) G2 phase
(D) M phase

70.

By which of the following mechanisms is glucose reabsorbed from the glomerular filtrate by the kidney
tubule
(A) osmosis
(B) diffusion
(C) active transport
(D) passiver transport

71.

In mammals, the hormones secreted by the pituitary, the master gland, is itself regulated by
(A) Hypothalamus
(B) median cortex
(C) pineal gland
(D) cerebrum

72.

Which of the following is true for TCA cycle in eukaryotes


(A) takes place in mitochondrion
(B) produces no ATP
(C) takes place in Golgi complex
(D) independent of electron transport chain

73.

A hormone molecule binds to a specific protein on the plasma membrane inducing a signal. The protein
it binds to it called
(A) ligand
(B) antibody
(C) receptor
(D) histone

74.

DNA mutations that do not cause my functional change in the protein product are known as
(A) nonsense mutations (B) missense mutations (C) deletion mutations (D) silent mutations

75.

Plant roots are usually devoid of chlorophyll and cannot perform photosynthesis. However, three are
exceptions. Which of the following plant root can perform photosynthesis
(A) Arabidopsis
(B) Tinospora
(C) Rice
(D) Hibiscus

76.

Vitamin A deficiency leads to night-blindness. Which of the following is the reason for the disease ?
(A) rod cells are not converted to cone cells
(B) rhodopsin pigment of rod cells is defective
(C) melanin pigment is not synthesized in cone cells
(D) cornea of eye gets dried

77.

In Dengue virus infection, patients often develop haemorrhagic fever due to internal bleeding. This happens due to the reduction of
(A) platelets
(B) RBCs
(C) WBCs
(D) lymphocytes

78.

If the sequence of bases in sense strand of DNA is 5'-GTTCATCG-3, then the sequence ofd bases in its
RNA transcript would be
(A) 5'-GTTCATCG-3'
(B) 5'GUUCAUCG-3
(C) 5'CAAGTAGC-3'
(D) 5'CAAGUAGC -3

79.

A refilex aciton is a quick involuntary response to stimulus. Which of the following is an example of
BOTH, unconditioned and conditioned reflex
(A) knee jerk reflex
(B) secretion of saliva in response to the aroma of food
(C) sneezing reflex
(D) contration of the pupil in response to bright light

80.

In a food chain such as grass deer lion, the energy cost of respiration as a proportion of total
assimilated energy at each level would be
(A) 60%- 30%-20%
(B) 20%- 30%-60%
(C) 20%- 60%-30%
(D) 30%- 30%-30%
CLASS-XII_STREAM-SB+2_PAGE # 94

PART-II (2 Marks)

MATHEMATICS
81.

Suppose a, b, c are real numbers, and each of the equations x2 + 2ax + b2 = 0 and x2 + 2bx + c2 = 0 has
two distinct real roots. Then the equation x2 + 2cx + a2 = 0 has
(A) two distinct positive real roots
(B) two equal roots
(C) one positive and one negative root
(D) no real roots

82.

The coefficient of x2012 in

(1 x 2 )(1 x )

(A) 2010

(B) 2011

83.

325
36

(B)

(B)

36
325

(C)

13
25

5
6

(D)

25
13

cosx = sin2(x + ) is
2
4

(C)

(D) 2

(B) P(1) 0

(C) P(1) 0

(D)

Define a sequence (an) by a1 = 5, an = a1a2 ... an1 + 4 for n > 1. Then lim

(A) equals

1
2

(B) equal 1

87.

(D) 2013

A polynomila P(x) with real coefficients has the property that P(x) 0 for all x. Suppose P(0) = 1 and
P(0) = 1. What can you say about P(1)?
(A) P(1) 0

86.

(C) 2012

The sum of all x [0, ] which satisfy the equation sinx +


(A)

85.

is

Let (x, y) be a variable point on the curve 4x2 + 9y2 8x 36y + 15 = 0. Then
min (x2 2x + y2 4y + 5) + max(x2 2x + y2 4y + 5) is
(A)

84.

1 x

The value of the integral

cos 2 x

1 a

(C) equals

2
5

1
1
< P(1) <
2
2

an
an 1
(D) does not exists

dx , where a > 0, is

(A)
88.

(B) a

(C)

(D) 2

Consider
L=

2012 +

2013 + ... +

3011

R=

2013 +

2014 + ... +

3012

3012

and I =

3 x dx .

2012

(A) L + R < 2I

(B) L + R = 2I

(C) L + R > 2I

(D)

LR = I

CLASS-XII_STREAM-SB+2_PAGE # 95

89.

A man tosses a coin 10 times, scoring 1 point for each head and 2 points for each tail. Let P(K) be the

1
is
2
(D) 17

probability of scroing at least K points. The largest value of K such that P(K) >
(A) 14

90.

(B) 15

(C) 16

x 1
for all x 1. Let f1(x) = f(x), f2(x) = f (f(x)) and generally fn(x) = f(fn1(x)) for n > 1. Let P =
x 1
f1(2) f2(3) f3(4) f4(5) which of the following is a multiple of P
(A) 125
(B) 375
(C) 250
(D) 147
Let f(x) =

PHYSICS
91.

The total energy of a black body radiation source is collected for five minutes and used to heat water. The
temperature of the water increases from 10.0C to 11.0C. The absolute temperature of the black body is
doubled and its surface area halved and the experiment repeated for the same time. Which of the following
statements would be most nearly correct?
(A) The temperature of the water would increase from 10.0C to a final temperature of 12C
(B) The temperature of the water would increase from 10.0C to a final temperature of 18C
(C) The temperature of the water would increase from 10.0C to a final temperature of 14C
(D) The temperature of the water would increase from 10.0C to a final temperature of 11C

92.

A small asteroid is orbiting around the sun in a circular orbit of radius r0 with speed V0. A rocket is
launched from the asteroid with speed V = V0 where V is the speed relative to the sun. The highest
value of for which the rocket will remain bound to the solar system is (ignoring gravity due to the asteroid
and effect of other planets)
(A)

93.

(B) 2

(C)

(D) 1

A radioactive nucleus A has a single decay mode with half life A. Another radioactive nucleus B has two
decay modes 1 and 2. If decay mode 2 were absent, the half life of B would have been A/2. If decay mode

B
1 were absent, the half life of B would have been 3 A. If the actual half life of B is B , then the ratio
A
is
(A)

3
7

(B)

7
2

(C)

7
3

(D) 1

94.

A stream of photons having energy 3 eV each impinges on a potassium surface. The work function of
potassium is 2.3 eV. The emerging photo-electrons are slowed down by a copper plate placed 5 mm
away. If the potential difference between the two metal plates is 1V, the maximum distance the electrons
can move away from the potassium surface before being turned back is
(A) 3.5 mm
(B) 1.5 mm
(C) 2.5 mm
(D) 5.0 mm

95.

Consider three concentric metallic spheres A, B and C of radii a, b, c respectively where a<b<c. A and B
are connected whereas C is grounded. The potential of the middle sphere B is raised to V then the charge
on the sphere C is
(A) 40V

96.

bc
c b

(B) + 40V

bc
c b

(C) 40V

ac
ca

(D) zero

On a bright sunny day a diver of height h stands at the bottom of a lake of depth H. Looking upward, he
can see objects outside the lake in a circular region of radius R. Beyond this circle he sees the images
of objects lying on the floor of the lake. If refractive index of waler is 4/3, then the value of R is
(A)

3(H h)
7

(B) 3h 7

(C)

(H h)
7
3

(D)

(H h)
5
3

CLASS-XII_STREAM-SB+2_PAGE # 96

97.

As shown in the figure below, a cube is formed with ten indentical resistance R (thick lines) and two
shorting wires (dotted lines) along the arms AC and BD.

Resistance between point A and B is


5R
R
(A)
(B)
6
2
98.

(C)

3R
4

(D) R

A standing wave in a pipe with a length L = 1.2 m is described y

2
2

y (x, t) = y0 sin L x sin L x 4



Based on above information, which one of the following statement is incorrect.


(Speed of sound in air is 300 ms1)
(A) A pipe is closed at both ends
(B) The wavelength of the wave could be 1.2 m
(C) There could be a nods at x = 0 and antinode at x = L/2
(D) The frequency of the fundamental mode of vibrations is 137.5 Hz
99.

Two block (1 and 2) of equal mass m are connected by an ideal string (see figure below) over a frictionless
pulley. The blocks are attached to the ground by springs having spring constants k1 and k2 such that
k1 > k2 .

Initially, both springs are unstretched. The block 1 is slowly pulled down a distance x and released. Just
after the release the possible value of the magnitudes of the acceleration of the blocks a1 and a2 can be
(k 1 k 2 ) x
k x
k x

or a1 1 g and a 2 2 g
(A) either a1 a 2
2
m
m
m

(k 1 k 2 ) x

only
(B) a1 a 2
2m

(k 1 k 2 ) x

only
(C) a1 a 2
2m

(k 1k 2 ) x
(k 1 k 2 ) x

g
or a1 a 2
(D) either a1 a 2
(k 1 k 2 )m
2m

CLASS-XII_STREAM-SB+2_PAGE # 97

100.

A simple pendulum is released from rest at the horizontally stretched position. When the string makes an
angle with the vertical, the angle which the acceleration vector of the bob makes with the string is
given by

(A) = 0

tan

(B) = tan1
2

(C) = tan1 (2 tan )

(D) =

CHEMISTRY
101.

The final major product obtained in the following sequence of reactions is :

(A)

(B)

(C)

(D)

102.

In the DNA of E. Coli the mole ratio of adenine to cytosine is 0.7. If the number of moles of adenine in the
DNA is 350000, the number of moles of guanine is equal to :
(A) 350000
(B) 500000
(C) 225000
(D) 700000

103.

(R)-2-bromobutane upon treatment with aq. NaOH gives

104.

(A)

(B)

(C)

(D)

Phenol on treatment with dil. HNO3 gives two products P and Q. P is steam volatile but Q is not. P and Q
are respectively

(A)

(B)

(C)

(D)

CLASS-XII_STREAM-SB+2_PAGE # 98

105.

A metal is irradiated with light of wavelength 660 nm. Given that the work function of the metal is 1.0 eV,
the de-Broglie wavelength of the ejected electron is close to :
(A) 6.6 107 m
(B) 8.9 1011 m
(C) 1.3 109 m
(D) 6.6 1013 m

106.

The inter-planar spacing between the (2 2 1) planes of a cubic lattice of length 450 pm is :
(A) 50 pm
(B) 150 pm
(C) 300 pm
(D) 450 pm

107.

The H for vaporization of a liquid is 20 kJ/mol. Assuming ideal behaviour, the change in internal energy
for the vaporization of 1 mole of the liquid at 60C and 1 bar is close to :
(A) 13.2 kJ/mol
(B) 17.2 kJ/mol
(C) 19.5 kJ/mol
(D) 20.0 kJ/mol

108.

Among the following, the species that is both tetrahedral and diamagnetic is :
(A) [NiCl4]2
(B) [Ni(CN)4]2
(C) Ni(CO)4
(D) [Ni(H2O)6]2+

109.

Three moles of an ideal gas expands reversibly under isothermal condition from 2 L to 20 L at 300 K. The
amount of heat-change (in kJ/mol) in the process is :
(A) 0
(B) 7.2
(C) 10.2
(D) 17.2

110.

The following data are obtained for a reaction, X + Y Products.


Expt.
[X0]/mol
[Y0]/mol
rate/mol L1 s1
1
0.25
0.25
1.0 106
2
0.50
0.25
4.0 106
3
0.25
0.50
8.0 106
The overall order of the reaction is :
(A) 2
(B) 4
(C) 3

(D) 5

BIOLOGY
111.

When hydrogen peroxide is applied on the wound as a disinfectant, there is frothing at the site of injury,
which is due to the presence of an enzyme in th skin that uses hydrogen peroxide as a substrate to
produce
(A) hydrogen
(B) carbon dioxide
(C) water
(D) oxygen

112.

Persons suffering from hypertension (high blood pressure) are advised a low-salt diet because
(A) more salt is absorbed in the body of a patient with hypertension
(B) high salt leads to water retention in the blood that further increases the blood pressure
(C) high salt increases nerve conduction and increases blood pressure
(D) high salt causes adrenaline release that increases blood pressure

113.

Insectivorous plants that mostly grow on swampy soil use insects as a source of
(A) carbon
(B) nitrogen
(C) phosphorous
(D) magnesium

114.

In cattle, the coat colour red and white are two dominant traits, which express equally in F1 to produce
roan (red and white clour in equal proportion). If F1 progeny are self-bred, the resulting progeny in F2 will
have phenotypic ratio (red:roan:white) is (A) 1 : 1 : 1
(B) 3 : 9 : 3
(C) 1 : 2 : 1
(D) 3 : 9 : 4

115.

The restriction endonuclease EcoR-I recognises and cleaves DNA sequence as shown below 5 G A A T T C 3
3 C T T A A G 5
What is the probable number of cleavage sites that can occur in a 10 kb long random DNA sequence?
(A) 10
(B) 2
(C) 100
(D) 50

116.

Which one of the following is true about enzyme catalysis ?


(A) the enzyme changes at the end of the reaction
(B) the activation barrier of the process is lower in the presence of an enzyme
(C) the rate of the reaction is retarded in the presence of an enzyme
(D) the rate of the reaction is independent of substrate concentration

CLASS-XII_STREAM-SB+2_PAGE # 99

117.

Vibrio cholerae causes cholera in humans. Ganga water was once used successfully to combat the
infection. The possible reason could be (A) high salt content of Ganga water
(B) low salt content of Ganga water
(C) presence of bacteriophages in Ganga water
(D) presence of antibiotics in Ganga water

118.

When a person begins to fast, after some time glycogen stored in the liver is mobilized as a source of
glucose. Which of the following graphs best represents the change of glucose level (y-axis) in his blood,
starting from the time (x-axis) when he begins to fast ?

(A)

(B)

(C)

(D)

119.

The following sequence contains the open reading frame of a polypeptide. How many amino acids will the
polypeptide consist of ?
5 AGCATATGATCGTTTCTCTGCTTTGAACT3
(A) 4
(B) 2
(C) 10
(D) 7

120.

Insects constitute the largest animal group on earth. About 25-30% of the insect species are known to be
herbivores. In spite of such huge herbiore perssure, globally, green plants have persisted. One possible
reason for this persistence is :
(A) food preference of insects has tended to change with time
(B) herbivore insects have become inefficient feeders of green plants
(C) herbivore population has been kept in control by predators
(D) decline in reproduction of herbivores with time

CLASS-XII_STREAM-SB+2_PAGE # 100

KISHORE VAIGYANIK PROTSAHAN YOJANA - 2013


Date : 27-10-2013

Duration : 3 Hours

Max. Marks : 160

STREAM - SB/SX
GENERAL INSTRUCTIONS

The Test Booklet consists of 120 questions.

There are Two parts in the question paper. The distribution of marks subjectwise in each
part is as under for each correct response.

MARKING SCHEME :
PART-I :
MATHEMATICS
Question No. 1 to 20 consist of ONE (1) mark for each correct response.
PHYSICS
Question No. 21 to 40 consist of ONE (1) mark for each correct response.
CHEMISTRY
Question No. 41 to 60 consist of ONE (1) mark for each correct response.
BIOLOGY
Question No. 61 to 80 consist of ONE (1) mark for each correct response.

PART-II :
MATHEMATICS
Question No. 81 to 90 consist of TWO (2) marks for each correct response.
PHYSICS
Question No. 91 to 100 consist of TWO (2) marks for each correct response.
CHEMISTRY
Question No. 101 to 110 consist of TWO (2) marks for each correct response.
BIOLOGY
Question No. 111 to 120 consist of TWO (2) marks for each correct response.

YEAR-2013 (KVPY-STREAM-SB+2)

PART-I
One Mark Questions
MATHEMATICS
1.

The sum of non-real roots of the polynomial equation x3 + 3x2 + 3x + 3 = 0.


(A) equals 0
(B) lies between 0 and 1
(C) lies between 1 and 0
(D) has absolute value bigger than 1

2.

Let n be a positive integer such that


log2log2log2log2log2(n) < 0 < log2log2log2log2(n).
Let be the number of digits in the binary expansion of n. Then the minimum and the maximum
possible values of are
(A) 5 and 16
(B) 5 and 17
(C) 4 and 16
(D) 4 and 17

3.

Let be a cube root of unity not equal to 1. Then the maximum possible value of | a + bw + cw2 | where
a, b, c {+1, 1} is
(A) 0

(B) 2

(C)

(D) 1+ 3

4.

If a, b are positive real numbers such that the lines ax + 9y = 5 and 4x + by = 3 are parallel, then the
least possible value of a + b is
(A) 13
(B) 12
(C) 8
(D) 6

5.

Two line segments AB and CD are constrained to move along the x and y axes, respectively, in such a
way that the points A, B, C, D are concyclic. If AB = a and CD = b, then the locus of the centre of the
circle passing through A, B, C, D in polar coordinates is
(A) r 2

a2 b 2
4

(B) r 2 cos 2

a2 b2
4

(C) r2 = 4(a2 + b2)

(D) r2 cos2 = 4(a2 b2)

6.

Consider a triangle ABC in the xy -plane with vertices A = (0,0), B = (1,1) and C = (9, 1). If the line
x = a divides the triangle into two parts of equal area, then a equals
(A) 3
(B) 3.5
(C) 4
(D) 4.5

7.

Let ABC be an acute-angled triangle and let D be the midpoint of BC. If AB = AD, then tan(B)/tan(C)
equals
(A)

(B)

(C) 2

(D) 3

8.

The angles , , of a triangle satisfy the equations 2sin + 3cos = 3 2 and 3sin + 2cos = 1. Then
angle equals
(A) 150
(B) 120
(C) 60
(D) 30

9.

Let f : R R be a function such that lim f(x) = M > 0. Then which of the following is false?

10.

(A) xlim
xsin(1/x) f(x) = M

(B) xlim
sin(f(x)) = sin M

(C) xlim
xsin(ex) f(x) = M

(D) lim

sin x
.f ( x ) 0
x

For x, t R let pt(x) = (sint)x2 (2cost)x + sint


1

be a family of quadratic polynomials in x with variable coefficients. Let A(t) =

p ( x)dx . Which of the


t

following statements are true?


(I) A(t) < 0 for all t.
(III) A(t) = 0 for infinitely many t.
(A) (I) and (II) only
(B) (II) and (III) only

(II) A(t) has infinitely many critical points.


(IV) A(t) < 0 for all t.
(C) (III) and (IV) only
(D) (IV) and (I) only
CLASS-XII_STREAM-SB+2_PAGE # 101

11.

Let f(x) =

2 x x 2 and g(x) = cos x. Which of the following statements are true?


(I) Domain of f((g(x))2) = Domain of f(g(x))
(II) Domain of f(g(x)) + g(f(x)) = Domain of g(f(x))
(III) Domain of f(g(x)) = Domain of f(g(x))
(IV) Domain of g((f(x))3) = Domain of f(g(x))
(A) Only (I)
(B) Only (I) and (II)
(C) Only (III) and (IV)
(D) Only (I) and (IV)
x

12.

For real x with 10 x 10 define f(x) =

[t]

dt , where for a real number r we denote by [r] the largest

10

integer less than or equal to r. The number of points of discontinutiy of f in the interval (10,10) is
(A) 0
(B) 10
(C) 18
(D) 19
13.

For a real number x let [x] denote the largest integer less than or equal to x and {x} = x [x]. The
n

smallest possible integer value of n for which

xxdx exceeds 2013 is


1

(A) 63
14.

(B) 64

4 2

(B) 8 2

4 2

(C) 4 2

4 2

(D) 4 2

A box contains coupons labeled 1, 2, 3....n. A coupon is picked at random and the number x is noted.
The coupon is put back into the box and a new coupon is picked at random. The new number is y. Then
the probability that one of the numbers x, y divides the other is (in the options below [r] denotes the
largest integer less than or equal to r)
(A)

16.

(D) 91

The area bounded by the curve y = cos x, the line joining (/4, cos(/4)) and (0, 2) and the line joining
(/4, cos(/4)) and (0, 2) is

4 2

(A) 8 2

15.

(C) 90

1
2

(B)

n

2
n k 1 k

(C)

1 1

n n2

n
k
k 1

(D)

1 2

n n2

k
k 1

Let n 3. A list of numbers 0 < x1 < x2 < ... < xn has mean and standard deviatiion . A new list of
numbers is made as follows : y1 = 0, y2 = x2, ....,yn1 = xn1, yn = x1 + xn. The mean and the standard
deviation of the new list are and . Which of the following is necessarily true?

17.

(A) = ,

(B) = ,

(C) =

(D) may or may not be equal to

Let 1, 2 , 3 , 4 be unit vectors in the xy -plane, one each in the interior of the four quadrants. Which
of the following statements is necessarily true?

(A) 0
1
2
3
4

(B) There exist i, j with 1 i < j 4 such i j is in the first quadrant

(C) There exist i, j with 1 i < j 4 such that i . j < 0


(D) There exist i, j with 1 i < j 4 such that i . j > 0
18.

The number of integers n with 100 n 999 and containing at most two distinct digits is
(A) 252
(B) 280
(C) 324
(D) 360
CLASS-XII_STREAM-SB+2_PAGE # 102

19.

For an integer n let Sn = {n + 1, n + 2, ....., n + 18}. Which of the following is true for all n 10?
(A) Sn has a multiple of 19
(B) Sn has a prime
(C) Sn has at least four multiples of 5
(D) Sn has at most six primes

20.

Let P be a closed polygon with 10 sides and 10 vertices (assume that the sides do not intersect except
at the vertices). Let k be the number of interior angles of P that are greater than 180. The maximum
possible value of k is
(A) 3
(B) 5
(C) 7
(D) 9

PHYSICS
21.

Consider an initially neutral hollow conducting spherical shell with inner radius r and outer radius 2r. A
point charge +Q is now placed inside the shell at a distance r/2 from the centre. The shell is then
grounded by connecting the outer surface to the earth. P is an external point at a distance 2r from the
point charge +Q on the line passing through the centre and the point charge +Q as shown in the figure.

The magnitude of the force on a test charge +q placed at P will be

1 qQ
(A) 4
2
0 4r
22.

1 9qQ
(B) 4
2
0 100r

1 4qQ
(C) 4
2
0 25r

(D) 0

Consider the circuit shown in the figure below :

All the resistors are identical. The charge stored in the capacitor, once it is fully charged, is
(A) 0
23.

(B)

5
CV
13

(C)

2
CV
3

(D)

5
CV
8

A nuclear decay is possible if the mass of the parent nucleus exceeds the total mass of the decay
particles. If M(A, Z) denotes the mass of a single neutral atom of an element with mass number A and
atomic number Z, then the minimal condition that the decay

X AZ YZA1 v e
will occur is (me denotes the mass of the particle and the neutrino mass mv can be neglected) :
(A) M(A, Z) > M(A, Z + 1 ) + me
(B) M(A, Z) > M(A, Z + 1)
(C) M(A, Z) > M(A, Z + 1) + Zme
(D) M(A,Z) > M(A, Z + 1) me

CLASS-XII_STREAM-SB+2_PAGE # 103

24.

The equation of state of n moles of a non-ideal gas can be approximated by the equation
2

P n a V nb nRT

V 2

where a and b are constants characteristic of the gas. Which of the following can represent the equation
of a quasistatic adiabat for this gas (Assume that CV, the molar heat capacity at constant volume, is
independent of temperature)?

25.

(A) T( V nb)R / C V = constant

(B) T( V nb)C V / R = constant

ab

R / CV
constant
(C) T 2 V nb
V R

n 2ab

V nbCV / R constant
T

(D)
2
V
R

A blackbox (BB) which may contain a combination of electrical circuit elements (resistor, capacitor or
inductor) is connected with other external circuit elements as shown below in the figure (a). After the
switch (S) is closed at time t = 0, the current (I) as a function of time (t) is shown in the figure (b).

From this we can infer that the blackbox contains


(A) A resistor and a capacitor in series
(C) A resistor and an inductor in series
26.

(B) A resistor and a capacitor in parallel


(D) A resistor and an inductor in parallel

In a photocell circuit the stopping potential, V0, is a measure of the maximum kinetic energy of the
photoelectrons. The following graph shows experimentally measured values of stopping potential versus
frequency v of incident light.

The values of Planks constant and the work function as determined from the graph are (taking the
magnitude of electronic charge to be e = 1.6 1019 C)
(A) 6.4 1034 Js, 2.0 eV
(B) 6.0 1034 Js, 2.0 eV
34
(C) 6.4 10 Js, 3.2 eV
(D) 6.0 1034 Js, 3.2 eV
27.

An engine moving away from a vertical cliff blows a born at a frequency f. Its speed is 0.5% of the speed
of sound in air. The frequency of the reflected sound received at the engine is
(A) 0.990 f
(B) 0.995 f
(C) 1.005 f
(D) 1.010 f

CLASS-XII_STREAM-SB+2_PAGE # 104

28.

An arangement with a pair of quarter circular coils of radii r and R with a common centre C and carrying
a current I is shown.

The permeability of free space is 0. The magnetic field at C is


(A) 0 I(1/r 1/R)/8 into the page
(B) 0 I (1/r 1/R)/8 out of the page
(C) 0 I(1/r + 1/R)/8 out of the page
(D) 0 I(1/r + 1/R)/8 into the page
29.

The circuit shown has been connected for a long time. The voltage across the capacitor is

(A) 1.2 V
30.

(B) 2.0 V

(C) 2.4 V

(D) 4.0 V

A wheel of radius R with an axle of radius R/2 is shown in the figure and is free to rotate about a
frictionless axis through its centre and perpendicular to the page. Three forces (F, F, 2F) are exerted
tangentially to the repective rims as shown in the figure.

The magnitude of the net torque acting on the system is nearly


(A) 3.5FR
(B) 3.2 FR
(C) 2.5 FR

(D) 1.5 FR

31.

Two species of radioactive atoms are mixed in equal number. The disintegration of the first species is
and of the second is /3. After a long time the mixture will behave as a species with mean life of approximately
(A) 0.70/
(B) 2.10/
(C) 1.00/
(D) 0.52/

32.

The bulk modulus of a gas is defined as B = VdP/dV. For an adiabatic process the variation of B is
proportional to Pn. For an idea gas, n is
(A) 0

(B) 1

(C)

5
2

(D) 2
CLASS-XII_STREAM-SB+2_PAGE # 105

33.

Photons of energy 7 eV are incident on two metals A and B with work functions 6 eV and 3 eV respectively.
The minimum de Broglie wavelengths of the emitted photoelectrons with maximum energies are A and
B, respectively where A/B is nearly
(A) 0.5
(B) 1.4
(C) 4.0
(D) 2.0

34.

An electron enters a chamber in which a uniform magnetic field is


present as shown. Ignore gravity.
During its motion inside the chamber.
(A) the force on the electron remains constant
(B) the kinetic energy of the electron remains constant
(C) the momentum of the electron remains constant
(D) the speed of the electron increases at a uniform rate

35.

A ray of light incident on a glass sphere (refractive index

36.

Young-Laplace law states that the excess pressure inside a soap bubble of radius R is given by
P = 4/R where is the coefficient of surface tension of the soap. The
number E0 is a
dimensionless number that is used to describe the shape of bubbles rising through a surrounding fluid. It
is a combination of g, the acceleration due to gravity, , the density of the surrounding fluid, and a
characterstic length scale L which could be the radius of the bubble. A possible expression for E0 is

3 ) suffers total internal reflection before


emerging out exactly parallel to the incident ray. The angle of incidence was
(A) 75
(B) 30
(C) 45
(D) 60

(A)
37.

g
L3

L2
(B)
g

gL2
(C)

gL2
(D)

A plank is resting on a horizontal ground in the northern hemisphere of the Earth at a 45 latitude. Let the
angular speed of the Earth be and its radius re. The magnitude of the frictional force on the plank will be
(A) mre2

(B)

mre 2
2

(C)

mre 2
2

(D) Zero

38.

The average distance between molecules of an ideal gas at STP is approximately of the order of
(A) 1 nm
(B) 100 nm
(C) 100 cm
(D) 1 m

39.

A point particle of mass 0.5 kg is moving along the x-axis under a force described by the potential energy
V shown below. It is projected towards the right from the origin with a speed v.
What is the minimum value of v for which the particle will escape infinitely fasr away from the origin ?

(A) 2 2 ms1
(C) 4 ms1

(B) 2 ms1
(D) The particle will never escape

CLASS-XII_STREAM-SB+2_PAGE # 106

40.

The figure below shows pressure variation in two different sound waves in air with time at a given position.
Both the figures are drawn to the same scale.

Which of the following statements is true?


(A) Wave 1 has lower frequency and smaller amplitude compared to wave 2
(B) Wave 1 has higher frequency and greater amplitude compared to wave 2
(C) Wave 1 has shroter wavelength and greater amplitude compared to wave 2
(D) Wave 1 has shorter wavelength and smaller amplitude compared to wave 2

CHEMISTRY
41.

Among the following, the set of isoelectronic ions is :


(A) Na+, Mg2+, F, Cl
(B) Na+, Ca2+, F, O2
(C) Na+, Mg2+, F, O2

(D) Na+, K+, S2, Cl

42.

For a zero-order reaction with rate constant k, the slope of the plot of reactant concentration against time
is:
(A) k/2.303
(B) k
(C) k/2.303
(D) k

43.

The compound which reacts with excess bromine to produce 2, 4, 6-tribromophenol, is :


(A) 1, 3-cyclohexadiene
(B) 1, 3-cyclohexanedione
(C) salicylic acid
(D) cyclohexanone

44.

Ethyl acetate reacts with NH2NHCONH2 to form :


(A) CH3CONHCONHNH2
(C) CH3CONHNHCONH2

45.

(B) CH3CON(NH2)CONH2
(D) CH3CH2NHNHCONH2

The variation of solubility of four different gases (G1, G2, etc.) in a given solvent with pressure at a
constant temperature is shown in the plot.

The gas with the highest value of Henrys law constant is


(A) G4
(B) G2
(C) G3

(D) G1
CLASS-XII_STREAM-SB+2_PAGE # 107

46.

For the reaction,


the concentration of A decreases from 0.06 to 0.03 mol L1 and that of B
1
rises from 0 to 0.06 mol L at equilibrium. The values of n and the equilibrium constant for the reaction,
respectively, are :
(A) 2 and 0.12
(B) 2 and 1.2
(C) 3 and 0.12
(D) 3 and 1.2

47.

The reaction of ethyl methyl ketone with Cl2/excess OH gives the following major product :
(A) ClCH2CH2COCH3
(B) CH3CH2COCCl3
(C) ClCH2CH2COCH2Cl (D) CH3CCl2COCH2Cl

48.

The compound that readily tautomerizes is :


(A) CH3COCH2CO2C2H5
(B) CH3COCH2CH2CH3

(C) CH3COCH2CH2CH3

(D) (CH3)3CCOC(CH3)3

49.

Hydrolysis of BCl3 gives X which on treatment with sodium carbonate produces Y, X and Y, respectively,
are
(A) H3BO3 and NaBO2
(B) H3BO3 and Na2B4O7
(C) B2O3 and NaBO2
(D) B2O3 and Na2B4O7

50.

The numbers of lone pair(s) on Xe in XeF2 and XeF4 are, respectively :


(A) 2 and 3
(B) 4 and 1
(C) 3 and 2

(D) 4 and 2

51.

The entropy change in the isothermal reversible expansion of 2 moles of an ideal gas from 10 to 100 L at
300 K is :
(A) 42.3 JK1
(B) 35.8 J K1
(C) 38.3 J K1
(D) 32.3 J K1

52.

D-Glucose upon treatment with bromine-water gives :

(A)

(B)

(C)

(D)

53.

In the structure of borax, the numbers of boron atoms and B-O-B units, respectively, are :
(A) 4 and 5
(B) 4 and 3
(C) 5 and 4
(D) 5 and 3

54.

The number of peptide bonds in the compound is :

(A) 1
55.

(B) 2

(C) 3

(D) 4

For the isothermal reversible expansion of an ideal gas :


(A) H > 0 and U = 0
(B) H > 0 and U < 0
(C) H = 0 and U = 0

(D) H = 0 and U > 0

56.

If the angle of incidence of X-ray of wavelength 3 which produces a second order diffracted beam from
the (100) planes in a simple cubic lattice with interlayer spacing a = 6 is 30, the angle of incidence that
produ ces a first-order diffracted beam from the (200) planes is :
(A) 15
(B) 45
(C) 30
(D) 60

57.

The number of ions produced in water by dissolution of the complex having the empirical formular,
COCl34NH3, is :
(A) 1
(B) 2
(C) 4
(D) 3

58.

The spin-only magnetic moments of [Fe(NH3)6]3+ and [FeF6]3 in BM are, respectively,


(A) 1.73 and 1.73
(B) 5.92 and 1.73
(C) 1.73 and 5.92
(D) 5.92 and 5.92

CLASS-XII_STREAM-SB+2_PAGE # 108

59.

The order of SN1 reactivity in aqueous acetic acid solution for the compounds is :

(A) 1 > 2 > 3


60.

(B) 1 > 3 > 2

(C) 3 > 2 > 1

(D) 3 > 1 > 2

An ionic compound is formed between a metal M and a non-metal Y. If M occupies half the octahedral
voids in the cubic close-packed arrangement formed by Y, the chemical formula of the ionic compound is:
(A) MY
(B) MY2
(C) M2Y
(D) MY3

BIOLOGY
61.

Human fetal haemoglobin differs from the adult haemoglobin in that it has
(A) higher affinity for oxygen
(B) lower affinity for oxygen
(C) two subunits only
(D) is glycosylated

62.

Nucleolus is an organelle responsible for the production of


(A) carbohydrates
(B) messenger RNA
(C) lipids

(D) ribosomal RNA

63.

The sequences of four DNA molecules are given below:


i. TATATATATATATA
ii. TTTCCCGGGAAA
ATATATATATATAT
AAAGGGCCCTTT
iii. TTGCGTTGCCC
iv. GCCGGATCCGGC
AACGCAACGGG
CGGCCTAGGCCG
Which one of these DNA moelcules will have the highest melting temperature (Tm)?
(A) i
(B) ii
(C) iii
(D) iv

64.

If DNA codons are ATG GAA, insertion of thymine after the first codon results in,
(A) non-sense mutation
(B) mis-sense mutation (C) frameshift mutation (D) silent mutation

65.

Genetic content of a cell reduces to half during


(A) meiotic prophase I
(B) mitotic prophase

66.

67.

(C) meiotic prophase II

(D) meiotic telophase

Which one of the following techniques is used for the detection of proteins ?
(A) Northern blotting
(B) Western blotting
(C) Southern blotting

(D) In-situ hybridization

Fission yeasts are


(A) Archaebacteria

(D) Eukaryotes

(B) Eubacteria

(C) Prokaryotes

68.

In green leaves, the light and dark reactions occur in


(A) stroma and grana respectively
(B) grana and stroma respectively
(C) cristae and matrix respectively
(D) both occur in cytoplasm

69.

According to Mendel, ..................................... segregate and ........................... assort independently.


(A) alleles of a gene; alleles of different genes
(B) alleles of different genes; alleles of a gene
(C) dominanat traits; recessive traits
(D) recessive traits; recessive traits

70.

The two enzymatic activities associated with RUBISCO are


(A) oxidase and oxygenase
(B) oxygenase and carboxylase
(C) oxidase and carboxylase
(D) oxygenase and carbamylation

71.

Chlorofluorocarbons (CFCs) are belived to be associated with cancers because,


(A) CFCs react with DNA and cause mutations
(B) CFCs react with proteins involved in DNA repair
(C) CFCs destroy the ozone layer and permit harmful UV rays to reach the earth
(D) CFCs react with DNA polymerase and reduce fidelity of DNA replication

72.

Morphogenetic movements take place predominantly during the following embryonic stage
(A) blastula
(B) Morula
(C) Gastrula
(D) Fertilized eggs
CLASS-XII_STREAM-SB+2_PAGE # 109

73.
74.

75.

The only organ which is capable of producing Fructose in humans is


(A) liver
(B) pancreas
(C) seminal vesicles

(D) muscle

Stroke could be prevented/treated with


(A) balanced diet
(B) clotting factors

(C) insulin

(D) blood thinners

In orange and lemon, the edible part of the fruit is


(A) placenta
(C) hairs of the ovary wall

(B) thalamus
(D) succulent Mesocap

76.

Which one of the following statements about nitrogenase is correct?


(A) It is sensitive to CO2 and therefore present in isolated nodules.
(B) It requires O2 and therefore functional during the day
(C) It is sensitive to O2 and therefore is functional in anaerobic environments
(D) It is sensitive to light and therefore functions only in dark.

77.

Part of epidermis that keeps out unwanted particles is called


(A) columnar epithelium
(B) squamous epithelium
(C) ciliated epithelium
(D) cuboidal epithelium

78.

Species that are most effective at colonising new habitats show


(A) low reproductive ability
(B) high dispersal ability
(C) slow growth and maturation
(D) high competitive ability

79.

In a large isolated population, alleles p and q at a locus are at Hardy Weinberg equilibrium. The frequencies
are p = 0.6 and q = 0.4. The proportion of the heterozygous genotype in the population is
(A) 0.24
(B) 1
(C) 0.48
(D) 0.12

80.

In vertebrates glycogen is stored chiefly in


(A) heart and blood
(B) spleen and stomach

(C) bones and lymph

(D) liver and muscles

PART-II
Two Mark Questions
MATHEMATICS
81.

82.

1
Let f(x) be a non-constant polynomial with real coefficients such that f = 100 and f(x) 100 for all
2
real x. Which of the following statements is NOT necessarily true ?
(A) The coefficient of the highest degree term in f(x) is negative
(B) f(x) has at least two real roots
(C) If x 1/2 then f(x) < 100
(D) At least one of the coefficients of f(x) is bigger than 50.

Let a, b, c, d be real numbers such that


n

(ak

bk 2 ck d) n 4

k 1

for every natural number n. Then | a | + | b | + | C | + | d | is equal to


(A) 15
(B) 16
(C) 31
83.

(D) 32

The vertices of the base of an isosceles triangle lie on a parabola y2 = 4x and the base is a part of the line
y = 2x 4. If the third vertex of the triangle lies on the x-axis, its coordinates are
5
(A) ,0
2

7
(B) ,0
2

9
(C) ,0
2

11
(D) ,0
2

CLASS-XII_STREAM-SB+2_PAGE # 110

84.

In a triangle ABC, let G denote its centroid and let M, N be points in the interiors of the segments AB,
AC, respectively, such that M, G, N are collinear. If r denotes the ratio of the area of triangle AMN to the
area of ABC then
(A) r = 1/2
(B) r > 1/2
(C) 4/9 r < 1/2
(D) 4/9 < r

85.

Let XY be the diameter of a semicircle with centre O. Let A be a variable point on the semicircle and B
another point on the semicircle such that AB is parallel to XY. The value of BOY for which the inradius
of triangle AOB is maximum, is

1 5 1
(A) cos 2

86.

Let f(x) = 1+
(A) 0

87.

1 5 1
(B) sin 2

(D)

x x2 x3 x 4

. The number of real roots of f(x) = 0 is


1! 2!
3!
4!
(B) 1
(C) 2

(D) 4

Suppose that the earth is a sphere of radius 6400 kilometers. The height from the earths surface from
where exactly a fourth of the earths surface is visible, is
(A) 3200 km

88.

(C)

(B) 3200 2 km

(C) 3200 3 km

(D) 6400 km

Let n be a positive integer. For a real number x, let [x] denote the largest integer not exceeding x and
n 1

{x} = x [x]. Then

(A) loge(n)

x[ x ] dx
is equal to
x
(B)

1
n 1

(C)

n
n 1

(D) 1

1
1
....
2
n

89.

A box contains coupons labelled 1,2,...,100. Five coupons are picked at random one after another
without replacement. Let the numbers on the coupons be x1, x2,....,x5. What is the probability that
x1 > x2 > x3 and x3 < x4 < x5?
(A) 1/120
(B) 1/60
(C) 1/20
(D) 1/10

90.

In a tournament with five teams, each team plays against every other team exctly once. Each game is
won by one of the playing teams and the winning team scores one point, while the losing team scores
zero. Which of the following is NOT necessarily true?
(A) There are at least two teams which have at most two points each.
(B) There are at least two teams which have at least two points each.
(C) There are at most three teams which have at least threee points each
(D) There are at most four teams which have at most two points each

PHYSICS
91.

A bullet of mass m is fired horizontally into a large sphere of mass M and radius R resting on a smooth
horizontal table.

The bullet hits the sphere at a height h from the table and sticks to its surface. If the sphere starts rolling
without slippng immediately on impact, then
(A)

h 4m 3M

R 2m M

(B)

h m 3M

R m 2M

(C)

h 10m 7M

R
5m M

(D)

h 4m 3M

R
mM

CLASS-XII_STREAM-SB+2_PAGE # 111

92.

A small boy is throwing a ball towards a wall 6 in front of him. He releases the ball at a height of 1.4 m
from the ground. The ball bounces from the wall at a height of 3 m, rebounds from the ground and reaches
the boys hand exactly at the point of release. Assuming the two bounces (one from the wall and the other
from the ground) to be perfectly elastic, how far ahead of the boy did the ball bounce from the ground?
(A) 1.5m
(B) 2.5 m
(C) 3.5 m
(D) 4.5 m

93.

In the P-V diagram below the dashed curved line is an adiabat.

For a process that is described by a straight line joining two points X and Y on the adiabat (solid line in the
diagram) heat is : (hint : Consider the variations in temperature from X to Y along the straitght line)
(A) absorbed throughtout from X to Y
(B) released throughout from X to Y
(C) absorbed from X up to an intermediate point Z (not shown in the figure) and then released from Z to Y
(D) released from X up to an intermediate point Z (not shown in the figure) and then absorbed from Z to Y
94.

A singly ionized helium atom in an excited state (n = 4) emits a photon of energy 2.6 eV. Given that the
ground state energy of hydrogen atom is 13.6 eV, the energy (Et) and quantum number (n) of the
resulting state are respectively,
(A) Et = 13.6eV, n = 1 (B) Et = 6.0 eV, n = 3 (C) Et = 6.0 eV, n = 2 (D) Et = 13.6 eV, n = 2

95.

The figure below shows a circuit and its input voltage vi as function of time t.

Assuming the diodes to be ideal, which of the following graphs depicts the output voltage v0 as function of
time t ?

(A)

96.

(B)

(C)

(D)

A ball is rolling without slipping in a spherical shallow bowl (radius R) as shown in the figure and is
executing simple harmonic motion. If the radius of the ball is doubled, the period of oscillation

(A) increases slightly


(C) is increased by a factor of 2

(B) is reduced by a factor of 1/2


(D) decreases slightly

CLASS-XII_STREAM-SB+2_PAGE # 112

97.

A solid sphere rolls without slipping, first horizontal and then up to a point X at height h on an inclined
plane before rolling down, as shown.

The initial horizontal speed of the sphere is


(A)
98.

10gh / 7

7gh / 5

(B) 10 J

5gh / 7

(D)

2gh

(C) 20 J

(D) 30 J

A block of mass m slides from rest at a height H on a frictionless inclined plane as shown in the figure. It
travels a distance d across a rough horizontal surface with coefficient of kinetic friction , and compresses
a spring of spring k by a distance x before coming to rest momentarily. Then the spring extends and the
block travels back attaining a final height of h. Then

(A) h = H 2(d + x)
(C) h = H 2d + kx2/mg
100.

(C)

The three processes in a thermodynamic cycle shown in the figure are : Process 1 2 is isothermal;
Process 2 3 is isochoric (volume remains constant); Process 3 1 is adiabatic. The total work done
by the ideal gas in this cycle is 10 J. The internal energy decreases by 20 J in the isochoric process. The
work done by the gas in the adiabatic process is 20 J. The heat added to the system in the isothermal
process is

(A) 0 J
99.

(B)

(B) h = H + 2(d + x)
(D) = H 2(d + x) + kx2/ 2mg

A metallic prong consists of 4 rods made of the same material, cross-section and same lengths as
shown. The three forked ends are kept at 100 C and the handle end is at 0C. The temperature of the
junction is

(A) 25C

(B) 50C

(C) 60

(D) 75C

CLASS-XII_STREAM-SB+2_PAGE # 113

CHEMISTRY
101.

The major product obtained in the reaction of aniline with acetic anhydride is
NHCOCH3

NH2

NHCOCH3

(B) H3C

(A)

(D) H3C

(C)

102.

The maximum number of isomers that can result from monobromination of 2-methyl-2-pentene with Nbromosuccinimide in boiling CCl4 is
(A) 1
(B) 2
(C) 3
(D) 4

103.

The compound X (C7H9N) reacts with benzensulfonyl chloride to give Y (C13H13NO2S) which is insoluble in
alkali. The compound X is

NH2
(A)

NH2

NH2

NH CH3

(B)

CH3

(C)

(D)

CH3

H3C

104.

In 108 g of water, 18 g of a non-volatile compound is dissolved. At 100C the vapor pressure of the solution
is 750 mm Hg. Assuming that the compound does not undergo association or dissociation, the molar
mass of the compound in g mol1 is
(A) 128
(B) 182
(C) 152
(D) 228

105.

The standard electrode potential of Zn2+/Zn is 0.76 V and that of Ca2+/Cu is 0.34 V. The emf (V) and the
free energy change (kJ mol1), respectively, for a Daniel cell will be
(A) 0.42 and 81
(B) 1.1 and 213
(C) 1.1 and 213
(D) 0.42 and 81

106.

Consider the equilibria (1) and (2) with equilibrium constants K1 and K2, respectively
SO2(g) +

1
O (g)
2 2

2SO3(g)

SO3(g)

.... (1)

2SO2(g) + O2(g)

.... (2)

K1 and K2 are related as


(A) 2K1 = K22

(B) K12 =

1
K2

(C) K22 =

1
K1

2
(D) K2 =

K 12

107.

Aqueous solution of metallic nitrate X reacts with NH4OH to form Y which dissolves in excess NH4OH.
The resulting complex is reduced by acetaldehyde to deposit the metal. X and Y, respectively, are
(A) Cs(NO3) and CsOH
(B) Zn(NO3)2 and ZnO
(C) AgNO3 and Ag2O
(D) Mg(NO3)2 and Mg(OH)2

108.

The density of eq. wt of a metal are 10.5 g cm3 and 100, respectively. The time required for a current of
3 amp to deposit a 0.005 mm thick layer of the same metal on an area of 80 cm2 is closest to
(A) 120 s
(B) 135 s
(C) 67.5 s
(D) 270 s

109.

The amount of Na2S2O3.5H2O required to completely reduce 100 mL of 0.25 N iodine solution, is
(A) 6.20 g
(B) 9.30 g
(C) 3.10 g
(D) 7.75 g

110.

In aqueous solution, [Co(H2O)6]2+ (X) reacts with molecular oxygen in the presence of excess liquor NH3
to give a new complex Y. The number of unpaired electrons in X and Y are, respectively
(A) 3, 1
(B) 3, 0
(C) 3, 3
(D) 7, 0

CLASS-XII_STREAM-SB+2_PAGE # 114

BIOLOGY
111.

109 bacteria were spread on an agar plate containing penicillin. After incubation overnight at 37C,
10 bacterial colonies were observed on the plate. That the colonies are likely to be resistant to penicillin
can be tested by
(A) measuring their growth rate
(B) observing the colour of the colonies
(C) checking their ability to grow on another plate containing penicillin.
(D) checking their ability to cause disease

112.

Watson and Crick model of DNA is


(A) B-form DNA with a spiral length of 34 and a diameter of 20
(B) A-form DNA with a spiral length of 15 and a diameter of 20
(C) Z-form DNA with a spiral length of 34 and a diameter of 20
(D) B-form DNA with a spiral length of 28 and a diameter of 14

113.

Eco RI and Rsa I restriction endonucleases require 6 bp and 4 bp sequences respectively for cleavage. In
a 10 kb DNA fragment how many probable cleavage sites are present for these enzymes
(A) 0 Eco RI and 10 Rsa I
(B) 1 Eco RI and 29 Rsa I
(C) 4 Eco RI and 69 Rsa I
(D) 2 Eco RI and 39 Rsa I

114.

From an early amphibian embryo the cells that would give rise to skin in adults were transplanted into the
developing brain region of another embryo. The transplanted cells developed into brain tissue in the
recipient embryo. What do you infer from this experiment?
(A) Cell fate is permanently determined during early embryonic development.
(B) Developmental fate of donor cells is influenced by the surrounding cells.
(C) Developmental fate of donor cells is not influenced by recipient cells.
(D) Any cell which is transplanted into another embryo always develops into a brain.

115.

Presence of plastids in Plasmodium suggests


(A) it is a plant species
(B) it is a parasite with a cynobacterium as an endosymbiont
(C) it is a parasite with a archebacterium as an endosymbiont
(D) it is a plant species with a archebacterium as an endosymbiont

116.

The figure below demonstrates the growth curves of two organisms A and B growing in the same area.
What kind of relation exists between A and B?

Increase in biomass

organism A only
organism B only
organism B in presence of A
organism A in presence of B

Time

(A) Competition

(B) Symbiosis

(C) Commensalisms

(D) Mutualism

CLASS-XII_STREAM-SB+2_PAGE # 115

117.

A scientist has cloned an 8 Kb fragment of a mouse gene into the Eco RI site of a vector of 6 Kb size. The
cloned DNA has no other Eco RI site within. Digestions of the cloned DNA is shown below.

Which one of the following sets of DNA fragments generated by digestion with both Eco RI and Bam HI as
shown in (iii) is from the gene?
(A) 1 Kb and 4 Kb
(B) 1 Kb and 2.5 Kb
(C) 1 Kb and 3 Kb
(D) 1 Kb and 3.5 Kb
118.

Brown fat is a specialised adipose tissue with abundant mitochondria and rich blood supply. Brown fat
(A) insulates animals that are acclimatised to cold.
(B) is the major source of heat production of birds.
(C) provides energy to muscles.
(D) produces heat without producing ATP.

119.

In some species, individuals forego reproduction and help bring up another individuals offspring. Such
altruistic behaviour CANNOT be explained by which of the following?
(A) An individual helps relatives only and gets indirect genetic benefits.
(B) The individual benefits because it can later inherit the breeding position.
(C) The individual benefits because it gets access to resources, such as food and security from predators,
in return.
(D) The species benefits from a reduction in competition among offspring.

120.

Lions in India are currently restricted to Gir, Gujarat. Efforts are being made to move them to other parts
of the country. This is because they are MOST susceptible to extinction due to infectious diseases under
the following conditions when present as
(A) several small, isolated populations
(B) one large population
(C) several large, connected populations
(D) several large, isolated populations

CLASS-XII_STREAM-SB+2_PAGE # 116

KISHORE VAIGYANIK PROTSAHAN YOJANA - 2014


Date : 02-11-2014

Duration : 3 Hours

Max. Marks : 160

STREAM - SB/SX
GENERAL INSTRUCTIONS

The Test Booklet consists of 120 questions.

There are Two parts in the question paper. The distribution of marks subjectwise in each
part is as under for each correct response.

MARKING SCHEME :
PART-I :
MATHEMATICS
Question No. 1 to 20 consist of ONE (1) mark for each correct response.
PHYSICS
Question No. 21 to 40 consist of ONE (1) mark for each correct response.
CHEMISTRY
Question No. 41 to 60 consist of ONE (1) mark for each correct response.
BIOLOGY
Question No. 61 to 80 consist of ONE (1) mark for each correct response.

PART-II :
MATHEMATICS
Question No. 81 to 90 consist of TWO (2) marks for each correct response.
PHYSICS
Question No. 91 to 100 consist of TWO (2) marks for each correct response.
CHEMISTRY
Question No. 101 to 110 consist of TWO (2) marks for each correct response.
BIOLOGY
Question No. 111 to 120 consist of TWO (2) marks for each correct response.

YEAR-2014 (KVPY-STREAM-SB/SX)

PART-I
One Mark Questions
MATHEMATICS
1.

Let C0 be a circle of radius 1.for n 1 , let Cn be a circle whose area equals the area of a square inscribed
in Cn-1.Then

i0

Area Ci equals :

(A) 2
2.

(B)

(C)

1
2

(D)

2
2

For a real number r we denote by [r] the largest integer less than or equal to r. If x,y are real numbers with
x,y 1 then which of the following statements is always true ?
(A) [x+y] [x]+[y]

3.

2
2

(C) [2x] 2[x]

(B) [xy] [x][y]

x x
(D) y y

For each positive integer n, let A n max r | 0 r n . Then the number of elements n is

1,2,3,........20
An
for which 1.9 A 2 is :
n 1
(A) 9
4.

(B) 10

(D) 12

Let b, d>0. The locus of all points P(r,) for which the line OP (where O is the origin) cuts the line rsin=b
in Q such that PQ=d is :
(A) (r d)sin b

5.

(C) 11

(B) (r d)sin b

(C) (r d)cos b

(D) (r d)cos b

Let C be the circle x2 + y2 = 1 in the xy-plane. For each t 0 , let Lt be the line passing through (0,1) and
(t,0). Note that Lt intersects C in two points, one of which is (0,1). Let Qt be the other point. As t varies
between 1 and 1 2 , the collection of points Qt sweeps out an arc on C. The angle subtended by this
are at (0,0) is :
(A)

6.

(B)

(C)

(D)

3
8

In a ellipse, its foci and the ends of its major axis are equally spaced, if the length its semi-minor axis is

2 2 , then the length of its semi-major axis is :


(A) 4
7.

(C) 10

(D) 3

Let ABC be a triangle such that AB=BC. Let F be the midpoint of AB and X be a point on BC such that
FX is perpendicular to AB. If BX=3XC then the ratio BC/AC equals :
(A)

8.

(B) 2 3

(B)

(C)

3
2

4
The number of solutions to the equation cos x

(A) 6

(B) 4

(C) 2

(D) 1
1
1
sin4 x
in the interval 0,2 is :
2
cos x
sin2 x
(D) 0
CLASS-XII_STREAM-SB+2_PAGE # 117

9.

Consider the function

x 5

f x x 2
1

if x 2

if x 2

Then f(f(x)) is discontinuous


(A) at all real numbers
(C) at exactly one value of x
10.

(B) at exactly two values of x


(D) at exactly three values of x

For a real number x let [x] denote the largest number less than or equal to x. for x R let f(x) [x]sin x .
Then :
(A) f is differentiable on R
(B) f is symmetric about the line x=0

(C)

f x dx 0
3

(D) For each real , the equation f(x)-=0 has infinitely many roots.
11.

Let f : 0, R be defined as
sin x, if x is irrational and x 0,

f x 2
tan x, if x is rational and x 0,

The number of points in[0, ] at which the function f is continuous is :


(A) 6
(B) 4
(C) 2

(D) 0

12.

Let f : [0,1] [0, ) be a continuous function such that

f x dx 10 . Which of the following state0

ments is NOT necessarily true ?


1

1
x
(A) e f x dx 10

(B)

f x

1 x

dx 10

1
2

(C) 10 sin 100x f x dx 10

(D) f x dx 100

13.

A continuous function f : R R satisfies the equation f x x f t dt .


0

Which of the following options is true ?


(A) f(x+y) = f(x) + f (y)
(C) f(x+y) = f(x) + f(y) + f(x)f(y)
14.

(B) f (x+y) = f(x)f(y)


(D) f(x+y) = f(xy)

For a real number x let [x] denote the largest integer less than or equal to x and {x} = x - [x]. Let n be a
n

positive integer. Then cos 2[x] x dx is equal to :


0

(A) 0

(B) 1

(C) n

(D) 2n-1

15.

Two persons A and B throw a (fair) die (six-faced cube with faces numbered from 1 to 6) alternately,
starting with A. The first person to get an outcome different from the previous one by the opponent wins.
The probability that B wins is :
(A) 5/6
(B) 6/7
(C) 7/8
(D) 8/9

16.

Let n 3 .A list of numbers x1,x 2 ,.........xn has mean and standard deviation . A new list of numbers

y1,y 2 ,..........yn is made as follows : y1

x1 x 2
x1 x 2
, y2
and y j x for j 3,4,.......n . The mean
2
2

and the standard deviation of the list are and . Then which of the following is necessarily true ?
(A) and

(B) and

(C)

(D)
CLASS-XII_STREAM-SB+2_PAGE # 118

17.

What is the angle subtended by an edge of a regular tetrahedron at its center ?


1 1
(B) cos

1 1
(A) cos
2

1 1
(C) cos
3

1 1

(D) cos
3

18.

Let S = {(a,b):a,b Z,0 a,b 18}. The number of elements (x,y) in S such that 3x + 4y + 5 is divisible by
19 is :
(A) 38
(B) 19
(C) 18
(D) 1

19.

For a real number r let [r] denote the largest integer less than or equal to r. Let a > 1 be a real number
which is not an integer, and let k be the smallest positive integer such that [ak]>[a]k. then which of the
following statements is always true ?
(A) k 2 a 1

20.

(B) k a 1

(C) k 2[a ] 1

(D) k

1
1
a [a]

Let X be a set of 5 elements. The number d of ordered pairs (A,B) of subsets of X such that

A ,B ,A B satisfies :
(A) 50 d 100

(B) 101 d 150

(C) 151 d 200

(D) 201 d

PHYSICS
21.

A uniform thin rod of length 2L and mass m lies on a horizontal table. A horizontal inpulse J is given to the
rod at one end. There is no friction. The total K.E. of the rod just after the impulse will be :
(A) J2/2m
(B) J2/m
(C) 2J2/m
(D) 6J2/m

22.

A solid cylinder P rolls without slipping from rest down an inclined plane attaining a speed vp at the
bottom. Another smooth solid cyclinder Q of same mass and dimensions slides without friction from rest

vp
down the inclined plane attaining a speed vq at the bottom. The ratio of the speeds v is :
q
3
(A) 4

3
(B) 2

2
(C) 3

4
(D) 3

23.

A body moves in a circular orbit of radius R under the action of a central force. Potential due to the central
force is given by V(r) = kr (k is a positive constant). period of revolution of the body is proportional to :
(A) R1/2
(B) R-1/2
(C) R-3/2
(D) R-5/2

24.

A simple pendulum is attached to a block which slides without friction down an inclined plane (ABC)
having an angle of inclination as shown

while the block is sliding down the pendulum oscillates in such a way that at its mean position the
direction of the string is :
(A) at angle to the perpendicular to the inclined plane AC.
(B) parallel to the inclined plane AC.
(C) vertically downwards.
(D) perpendicular to the inclined plane AC.
CLASS-XII_STREAM-SB+2_PAGE # 119

25.

Water containing air bubbles flows without turbulence through a horizontal pipe which has a region of
narrow cross- section. In this region the bubbles :
(A) move with greater speed and are smaller than in the rest of the pipe
(B) move with greater speed and are larger in size than in the rest of the pipe
(C) move with lesser speed and are smaller than in the rest of the pipe.
(D) move with lesser speed and are of the same size as in the rest of the pipe

26.

A solid expands upon heating because :


(A) the potential energy of interaction between atoms in the solid is asymmetric about the equilbrium
positions of atoms
(B) the frequency of vibration of the atoms increases
(C) the heating generates a thermal gradient between opposite sides
(D) a fluid called the caloric flows into the interatomic spacing of the solid during heating thereby expanding
it.

27.

Consider two thermometers T1 and T2 of equal length which can be used to measure temperature over the
range 1 to 2. T1 contains mercury as thermometric liquid while T2 contains bromine. The volumes of the
two liquids are the same at the temperature 1.The volumetric coefficients of expansion of mercury and
bromine are 18 10-5 K-1 and 108 10-5 K-1, respectively. The increase in length of each liquid is the same
for the same increase in temperature. If the diameters of the capillary tubes of the two thermometers are
d1 and d2 respectively, then the ratio d1:d2 would be closest to :
(A) 6.0
(B) 2.5
(C) 0.5
(D) 0.4

28.

An ideal gas follows aprocess described by PV2=C from (P1,V1,T1) to (P2,V2,T2)(C is a constant). Then
(A) if P1 > P2 then T2 > T1
(B) if V2 > V1 then T2 < T1
(C) if V2 > V1 then T2 > T1
(D) if P1 > P2 then V2 > V2

29.

A whistle emitting a loud sound of frequency 540 Hz is whirled in a horizontal circle of radius 2m and at a
constant angular speed of 15rad/s. The speed of sound is 330 m/s. The ratio of the highest to the lowest
frequency heard by a listener standing at rest at a large distance from the center of the circle is :
(A) 1.0
(B) 1.1
(C) 1.2
(D) 1.4

30.

Monochromatic light passes through a prism. Compares to that in air, inside the prism the lights
(A) speed and wavelength are different but frequency remains same.
(B) speed and frequency are different but wavelength remains same.
(C) frequency and wavelength are different but speed remains same.
(D) speed,wavelength and frequency are all different.

31.

The flat face of a plano-convex lens of focel length 10 cm is silvered. A point source placed 30 cm in front
of the curved surface will produce a :
(A) real image 15 cm away from the lens
(B) real image 6 cm away from the lens
(C) virtual image 15 cm away from the lens
(D) Virtual image 6 cm away from the lens

32.

Two identical metallic square loops L1 and L2 are placed next to each other with their sides parallel on a
smooth horizontal table. Loop L1 is fixed and a current which increases as a function of time is passed
through it.Then loop L2 :
(A) rotates about its center of mass
(B) moves towards L1
(C) remains stationary
(D) moves away from L1

33.

An electron enters a parallel plate capacitor with horizontal speed and is found to deflect by angle on
leaving the capacitor as shown. It is found that tan = 0.4 and gravity is negligible

If the initial horizontal speed is doubled,then tan will be :


(A) 0.1
(B) 0.2
(C) 0.8

(D) 1.6
CLASS-XII_STREAM-SB+2_PAGE # 120

34.

Consider a spherical shell of radius R with a total charge +q uniformly spread on its surface (center of the
chell lies at the origin x = 0). Two point charges, +q and -q are brought, one after the other, from far away
and placed at x = -a/2 and x = +a/2 (a<R), respectively. Magnitude of the work done in this process is :
2

(A) Q q / 4 0 a
35.

(C) q2 / 40 a

(B) zero

(D) Qq / 40 a

two identical parallel plate capacitors of capacitance C each are


connected in series with abattery of emf, E as shown, If one of the
capacitors is now filled with a dielectric of dielectric constant k, the
amount of charge which will flow through the battery is (neglect internal
resistance of the battery)
k 1
(A) 2 k 1 CE

(C)

k 1
(B) 2 k 1 CE

k2
CE
k2

(D)

k2
CE
k2

36.

A certain p-n junction, having a depletion region of width 20 m,was found to have a breakdown voltage of
100 V.If the width of the depletion region is reduced to 1 m duringits production, then it can be used as
azener diode for voltage regulation of :
(A) 5 V
(B) 10 V
(C) 7.5 V
(D) 2000 V

37.

The Half life of a particle of mass 1.610-26 kg is 6.9 s and a stream of such particles is travelling with the
K.E. of a particle being 0.05eV. The fraction of particles which will decay when they travel a distance of
1 m is :
(A) 0.1
(B) 0.01
(C) 0.001
(D) 0.0001

38.

A 160 watt light source is radiating light of wavelength 6200 A uniformly in all directions. The photon flux
at a distance of 1.8 m is of the order of (Planks constant 6.6310-34 J-s) :
(A) 102 m-2s-1
(B) 1012 m-2s-1
(C) 1019 m-2s-1
(D) 1025 m-2s-1

39.

The wavelength of the first Balmer line caused by a transition from the n = 3 level to the n = 2 level in

hydrogen is 1 . the wavelength of the line caused by an electronic transition from n=5 to n=3 is :
(A)

40.

375
1
128

(B)

125
1
64

(C)

64
1
125

(D)

128
1
375

The binding energy per nucleon of 5 B10 is 8.0 MeV and that of 5 B11 is 7.5 MeV. The Energy required to
remove a neutron from 5 B11 is (mass of electron and proton are 9.1110-31 kg and 1.6710-27 kg) :
(A) 2.5 MeV

(B) 8.0 MeV

(C) 0.5 MeV

(D) 7.5 MeV

CHEMISTRY
41.

When 1.88 g of AgBr(s) is added to a 10-3 M aqueous solution of KBr, the concentration of Ag+ is
510-10 M. If the same amount of AgBr(s) is added to a 10-2 M aqueous solution of AgNO3, the concentration
of Br- is:
(A) 9.4 10-9 M
(B) 5 10-10 M
(C) 1 10-11 M
(D) 5 10-11 M

42.

Aniline reacts with excess Br2/H2O to give the major product :


NH2

NH2
NH 2

Br
Br

(A)

Br
Br

Br

NH2

Br

Br

(B)

(C)
Br

(D)

Br

Br

Br

Br

CLASS-XII_STREAM-SB+2_PAGE # 121

43.

The Metal with the highest oxidation state present in K2CrO4, NbCl5 and MnO2 is :
(A) Nb
(B) Mn
(C) K
(D) Cr

44.

The number of geometrical isomers of [CrCl2(en)(NH3)2], where en = ethylenediamine, is :


(A) 2
(B) 3
(C) 4
(D) 1

45.

The element that combines with oxygen to give an amphoteric oxide is :


(A) N
(B) P
(C) Al

46.

47.

48.

The Arrhenius plots of two reactions, I and II are shown graphically :


The graph suggests that
(A) EI > EII and AI > AII

(B) EII > EI and AII > AI

(C) EI > EII and AII > AI

(D) EII > EI and AI > AII

(D) Na
I
ln k
II
1/T

Ni(CO)4 is :
(A) tetrahedral and paramagnetic
(C) tetrahedral and diamagnetic

(B) square planar and diamagnetic


(D) square planar and paramagnetic

In the following reactions :

1. ozonolysis

2. OH

the major product X is :


O

O
O

(A)

(B)

(C)

(D)
O

49.

Given the structure od D-(+)-glucose as :


CHO
H

OH
H

HO
H

OH

OH
CH2OH

The structure of L-(-)- glucose is :


CHO

CHO

(A)

HO

HO

HO

OH

OH
CH2OH

(B)

H
OH

HO

HO

H
CH2 OH

CHO

CHO

(C)

OH

HO

HO

OH
H

HO
CH2OH

(D)

H
OH
H

HO
H

OH
CH2OH

CLASS-XII_STREAM-SB+2_PAGE # 122

50.

In a cubic close packed structure, fractional contributions of an atom at the corner and at the face in the
unit cell are, respectively :
(A) 1/8 and 1/2
(B) 1/2 and 1/4
(C) 1/4 and 1/2
(D) 1/4 and 1/8

51.

The equilibrium constant Kc of the reaction 2A B C is 0.5 at 25C and i atm. The reaction will
proceed in the backward direction when concentrations [A], [B] and [C] are respectively :
(A) 10-3, 10-2 and 10-2 M
(B) 10-1, 10-2 and 10-2 M
(C) 10-2, 10-2 and 10-3 M
(D) 10-2, 10-3 and 10-3 M

52.

Major products formed in the reaction of t-butyl methyl ether with HI are :

(A)

(B)

(C)

(D)

53.

If the molar conductivities (in S cm2 mol-1) of NaCl, KCl and NaOH at infinite dilution are 126, 150 and 250
respectively, the molar conductivity of KOH (in S cm2 mol-1) :
(A) 526
(B) 226
(C) 26
(D) 274

54.

4-Formylbenzoic acid on treatment with one equivalent of hydraine followed by heating with alcoholic
KOH gives the major product :

(A)

(B)

(C)

(D)

55.

Two elements, X and Y, have atomic numbers 33 and 17 respectively. The milecular formula of a stable
compound formed between then is
(A) XY
(B) XY2
(C) XY3
(D) XY4

56.

The number of moles of KMnO4 required to oxidize one equivalent of Kl in the presence of sulfuric acid
is
(A) 5
(B) 2
(C) 1/2
(D) 1/5

57.

Three successive measurements in an experiment gave value 10.9, 11.4042 and 11.42 the correct way
of reporting the average value is
(A) 11.2080
(B) 11.21
(C) 11.2
(D) 11

58.

The latent heat of melting of ice at 0 C is 6 kJ mol-1. The entropy change during the melting in J K-1 is
closest to
(A) 22
(B) 11
(C) -11
(D) -22

CLASS-XII_STREAM-SB+2_PAGE # 123

59.

The major product of the following reaction

is

60.

(A)

(B)

(C)

(D)

The energies of dxy and d2z orbitals in octahedral and tetrahedral transition metal complexes are such that
(A) E (dxy) > E (dz2) in both tetrahedral and octahedral complexes
(B) E (dxy) < E (dz2) in both tetrahedral and octahedral complexes
(C) E (dxy) > E (dz2) in tetrahedral abut E (dxy) < E (dz2) in octahedral complexes
(D) E (dxy) < E (dz2) in tetrahedral abut E (dxy) < E (dz2) in octahedral complexes

BIOLOGY
61.

In which of the following types of glands is the decretion collected inside the cell and discharged by
disintegration of intire gland ?
(A) Apocrine
(B) Merocrine
(C) Holocrine
(D) Epicrine

62.

Which one of the following interactions does NOT promote coevolution ?


(A) Commensalism
(B) Mutualism
(C) Parasitism

(D) Interspecific competition

Stratification is more common in which of the following ?


(A) Deciduous forest
(B) Tropical rain forest (C) Temperate forest

(D) Tropical savannah

Where is the 3rd ventricle of the brain located?


(A) Cerebrum
(B) Cerebellum

(D) Diencephalon

63.

64.

(C) Pons varoli

65.

Which of the following is the final product of a gene ?


(A) a polypeptide
(B) an RNA only
(C) either polypeptide or RNA
(D) a nucleotide only

66.

Forelimbs of whales,bats,humans and cheetah are examples of which of the following processes?
(A) Divergent evolution (B) Convergent evolution (C) Adaptation
(D) Saltation

67.

Which of the following results from conjugation in paramecium ?


(A) Cell death
(B) Cell division
(C) Budding

68.

(D) Recombination

In an experiment investigating photoperiodic response, the leaves of a plant are removed.what is the most
likely outcome ?
(A) Photoperiodism is not affected
(B) Photoperiodic response does not occur
(C) The plant starts flowering
(D) The plant starts to grow taller

CLASS-XII_STREAM-SB+2_PAGE # 124

69.

70.

71.

72.

73.

74.

Testosterone is secreted by which endocrine part of testis?


(A) Leydig cells
(B) Seminiferous tubules (C) Tunica albugenia

(D) Sertoli cells

The mutation of a purine to a pyrimidine is known as:


(A) transition
(B) frame shift
(C) nonsense

(D) transversion

Which of the following is secreted at the ends of an axon ?


(A) Ascorbic acid
(B) Acetic acid
(C) Acetyl choline

(D) Acetyl CoA

A bacterial colony is produced from :


(A) a single bacterium by its repetitive division
(C) clumping of two to three bacteria

(B) multiple bacterium without replication


(D) a single bacterium without cell division

Rhinoviruses are the causative agents of :


(A) Diarrhoea
(B) AIDS

(C) Dengue

What is the genetic material of Ebola virus ?


(A) Single-Standard DNA
(C) Single-Standard RNA

(D) Common Cold

(B) Double-Standard RNA


(D) Double-Standard DNA

75.

Name the terminal acceptor of electrons in the mitochondrial electron transport chain :
(A) Nitrate
(B) Fumarate
(C) Succinate
(D) Oxygen

76.

Two tubes labeled Pand Q contain food stuff. Tube Pgave positive test with Benedicts solution while
tube Q gave positive test with Nitric acid. Which of the foloowing is correct ?
(A) Tube P contains sugar;tube Q contains protein
(B) Tube P contains protein;tube Q contains sugar
(C) Both tube P and tube Q contain sugar
(D) Both tube P and tube Q contain protein

77.

How many linear DNA fragments will be produced when a circular plasmid is digested with a restriction
enzyme having 3 sites ?
(A) 4
(B) 5
(C) 3
(D) 2

78.

If the humidity of the atmosphere suddenly increases substantially, the water flow in the xylem will :
(A) increase
(B) decrease
(C) remain unaltered
(D) increase sharply and then reduce slowiny to the pre-existing level

79.

Which one of the following is the complementary sequence for the DNA with 5-CGTACTA-3
(A) 5-TAGTACG-3
(B) 5-ATCATGC-3
(C) 5-UTCUTGC-3
(D) 5-GCUAGCA-3

80.

A diploid plant has 14 chromosomes,but its egg cell has 6 chromosomes. Which one of the following is
the most likely explanation of this ?
(A) Non-disjunction in meiosis I and II
(B) Non-disjunction in meiosis I
(C) Non-disjunction in meiosis
(D) Normal meiosis

CLASS-XII_STREAM-SB+2_PAGE # 125

PART-II
Two Mark Questions
MATHEMATICS
81.

Let n 3 be an integer. For a permutation =(a1,a2,....an) of (1,2,...,n) we let f (x) = anxn-1+an1+...+a x+a .Let S
be the sum of the roots of f (x) = 0 and let S denote the sum over all permutation
2
1
of (1,2,....,n) of the number S . Then
(A) S < -n!
(B) -n! < S < 0
(C) 0 < S < n!
(D) n! < S

82.

If n is a positive integer and 1 is a cube root of unity, the number of possible values of

(A) 2

(B) 3

(C) 4

n k
is
k

ek 0

(D) 6

83.

Suppose a parabola y = ax2 + bx + c has two x intercepts one positive and one negative, and its vertex
is (2,2). Then which of the following is true
(A) ab > 0
(B) bc > 0
(C) ca > 0
(D) a + b + c > 0

84.

Let n 3 and let C1, C2,....Cn, be circles with radii r1,r2,...,rn, respectively. Assume that Ci and Ci+1 touch
externally for 1 i n-1. It is also given that the x-axis and the line y = 2 2 x+10 are tangential to each
of the circles. Then r1,r2,.....,rn are in
(A) An arithmetic progression with common difference 3+ 2
(B) A geometric progression with common ratio 3+ 2
(C) An arithetic progression with common diffrence 2+ 3
(D) A geometric progression with common ratio 2+ 3

85.

86.

The under of integers n for which 3x3 - 25x+n = 0 has three real roots is
(A) 1
(B) 25
(C) 55

An ellipse inscribed in a semi-circle touches the circular are at two distinct points and also touches the
bounding diameter. its major axis is parallel to the bounding diameter. When the ellipse has the maximum possible area, its eccentricity is

(A)

(B)

2
/ 2

87.

Let In =

/2
(A) e 1

88.

(D) Infinite

1
2

(C)

(D)

2
3

I
cos x dx, where n is a non negative int eger . Then n 2 n n 2 equal
n! (n 2)!

(B) e / 2 1

/2
(C) e

(D) e /2

For a real number x let [x] denote the largest integer less than or equal to x. The smallest positive
n

integer n for which the integral

[x][

x ]dx exceeds 60 is

(A) 8
89.

(C) 10

(D) [602/3]

Choose a number n uniformly at random from the set {1,2,...100}. Choose one of the first seven days of
the year 2014 at random and consider n consencutive days among the chosen n days, the number of
Sunday is different from the number of Mondays?
(A)

90.

(B) 9

1
2

(B)

2
7

(C)

12
49

(D)

43
175

Lets S = {(a,b)}Ia,b Z, 0 a,b, 18}. The number of lines in R2 passing through (0,0) and exactly one
other point in S is
(A) 16
(B) 22
(C) 28
(D) 32
CLASS-XII_STREAM-SB+2_PAGE # 126

PHYSICS
91.

A solid sphere spinning about a horizontal axis with an angular velocity is placed on a horizontal
surface. Subsequently it rolls without slipping with an angular velocity of
(A) 2 /5
(B) 7 /5
(C) 2 /7
(D)

92.

Consider the system shown below


F

A horizontal force F is applied to a block X of mass 8 kg such that the block Y of mass 2kg adjacent to
it does not slip downwards under gravity. There is no friction between the horizontal plane and the base
of the block X. The coefficient of friction between the surfaces of blocks X and Y is 0.5. Take acceleration
due to gravity to be 10ms-2. The minimum value of F is
(A) 200N
(B) 160N
(C) 40N
(D) 240N
93.

The maximum value attained by the tension in the string of a swinging pendulum is four times the
minimum value it attains. There is no slack in the string. The angular amplitude of the pendulum is
(A) 90
(B) 60
(C) 45
(D) 30

94.

One mole of a monoatomic ideal gas is expanded by a process described by PV3 = C where C is a
constant. The heat capacity of the gas during the process is given by (R is the gas constant)

5
3
R
(C) R
(D) R
2
2
A concave mirror of radius of curvature R has a circular outline of radius r. A circular disk is to be placed
normal to the axis at the focus so that it collects all the light that is reflected from the mirror from a beam
parallel to the axis. for r<<R, the area of this disc has to be at least
(A) 2R

95.

(A)
96.

(B)

r 4
4R 2

(C)

r 5
4R 3

(D)

r 4
R2

The angles of incidence and refraction of a monochromatic ray of light of wavelength at an air glass
inteface are i and r, respectively. A parallel beam of light with a small spread in wavelenth about a
mean wavelenth is refracted at the same air-glass interface. The refractive index of glass depends
on the wavelength as ( ) = a+b/ 2where a and b are constant. Then the angular spread in the angle
of refraction of the beam is
(A)

97.

r 6
4R 4

(B)

sin i

cosr
3

(B)

2b

(C)

2b tanr

a 3 b

(D)

2b(a b / 2 )sin i

What are the charges stored in the 1 F and 2 F capacitors in the circuit below, once the currents
s
become steady?

(A) 8 C and 4 C respectively


(C) 3 C and 6 C respectively

(B) 4 C and 8 C respectively


(D) 6 C and 3 C respectively

CLASS-XII_STREAM-SB+2_PAGE # 127

98.

A 1.5 KW (kilo-watt) laser beam of wavelength 6400 A is used to levitate a thin aluminium disk of same
area as the cross section of the beam. The laser light is reflected by the aluminium disk without any
absorption. The mass of the foil is close to
(A) 10-9 kg
(B) 10-3 kg
(C) 10-4 kg
(D) 10-6 kg

99.

When ultraviolet radiation of a certain frequency falls on a potassium target, the photoelectrons released
can be stopped competely by a retarding potential of 0.6 V. If the frequency of the radiation is increased
by 10%, this stopping potential rises to 0.9V. The work functin of potassium is
(A) 2.0eV
(B) 2.4eV
(C) 3.0eV
(D) 2.8 eV

100.

The dimensions of stefan-Boltzmann constant can be written in terms of Plancks constanth Boltzmann
constant KB and the speed of light c as = h KBC. Here
(A) = 3, = 4 and = -3
(B) = 3, = -4 and = 2
(C) = -3, = 4 and = -2
(D) = 2, = -3 and = -1

101.

101.

CHEMISTRY
In the raction sequence

X and Y are,respectively

(A)

(B)

(C)

(D)

102.

The density of acetic acid vapor at 300 K and 1 atm is 5 mg cm-3. The number of acetic acid molecules
in the cluster that is formed in the gas phase is closest to
(A) 5
(B) 2
(C) 3
(D) 4

103.

The milar enthalpy change for H2O()


H2O(g) at 373 K and 1 atm is 41 kJ/mol. Assuming ideal
behavior, the internal energy change for vaporization of 1 mol of water at 373 K and 1 atm in kJ mol-1 is
(A) 30.2
(B) 41.0
(C) 48.1
(D) 37.9

CLASS-XII_STREAM-SB+2_PAGE # 128

104.

The equlibrium constants (Ke) of two reactions H2 + I2


2HI and N2 + 3H2
2NH3 are 50 and 1000,
respectively. The equilibrium constant of the reaction N2 + 6HI
2NH3+3I2 is closest to
(A) 50000
(B) 20
(C) 0.008
(D) 0.005

105.

Given that the bond energies of : N N is946 kJ mol-1 H-H is 435 kJ mol-1,N-N is 159kJ mol-1, and N-H is
389 kJ mol-1, the heat of formation of hydrazine in the gas phase in kJ mol-1 is
(A) 833
(B) 101
(C) 334
(D) 1264

106.

The radius of K+ is 133 pm and that of Cl- is 181 pm. The volume of the unit cell of KCl expressed in
10-22 cm3 is
(A) 0.31
(B) 1.21
(C) 2.48
(D) 6.28

107.

The reaction, K2Cr2O7 + m FeSO4 + n H2SO4 Cr2(SO4)3 + p Fe2(SO4)3+K2SO4 + q H2O when balanced,
m, n, p,and q are, respectively
(A) 6,14,3,14
(B) 6,7,3,7
(C) 3,7,2,7
(D) 4,14,2,14

108.

The standard free energy change (in J) for the reaction 3Fe2+(aq) + 2Cr (s) 2Cr3+(aq) + 3Fe(s), given
0
0
EFe
2
/ Fe = 0.44 V and ECr 3 / Cr = 0.74 V is (F = 96500C)

(A) 57,900
109.

110.

(B) 57,900

(C) 173,700

(D) 173,700

Calcium butanoate on heating followed by tratment with 1,2-ethanediol in the presence of catalytic amount
of acid, produces a major product which is

(A)

(B)

(C)

(D)

XeF6 on complete hydrolysis yields X. The molecular formula of X and its geometry, respectively, are
(A) XeO2 and linear
(B) XeO3 and trigonal planar
(C) XeO3 and pyramidal
(D) XeO4 and tetrahedral

BIOLOGY
111.

Following the cell cycle scheme given below, what is the probability that a cell would be in M-Phase at
any given time ?

(A) 1/24

(B) 1/12

(C) 1/6

(D) 1/2
CLASS-XII_STREAM-SB+2_PAGE # 129

112.

A flower with Tt genotype is cross-pollinated by TT pollens. What will the genotypes of the resulting
endosperm and embro,respectively, be?
(A) TTT,(TT+Tt)
(B) (TTT+TTt),TT
(C) TTt,Tt
(D) TTt,(TT+Tt)

113.

A new life from discovered on a distant has a genetic code consisting of five unique nucleotides and only
one stop codon.If each codon has four bases,what is the maximum number of unique amino acids this life
from can use ?
(A) 624
(B) 20
(C) 124
(D) 3124

114.

A spontaneous mulation results in a couple having only female progeny.when the daughter marries and
has children,none of them are males.However,in the third generation there are few male offspring. What is
the most likely explanation of this observation ?
(A) The mutation reverses spontaneously in the third generation
(B) The mutation occurs on the X chromosome and is both recessive and ethal
(C) The mutation occurs on the X chromosome and is both recessive and dominant
(D) The mutation occurs on an autosome and is dominant

115.

A circular plasmid of 10,000 base pairs (bp) is digested with two restriction enzymes,A and B, to produce
a 3000 bp and a 2000 bp bands when visualised on an agarose gel. when digested with one enzyme at a
time,only one band is visible at 5000 bp. If the first site for enzyme A(A1) is present at the 100th base, the
order in which the remaining sites(A2,B1 and B2) are present is :
(A) 3100,5100,8100
(B) 8100,3100,5100
(C) 5100,3100,8100
(D) 8100,5100,3100

116.

After meiosis-II,daughter cells differ from the parent cells and each other in their genotypes. This can
occur because of which one of the following mechanism(s)?
(A) Only synaptic
(B) Only crossing over and independent assortment of chromosomes
(C) only crossing over and chromosomal segregation
(D) crossing over, independent assortment and segregation and chromosomes

117.

A desert lizard (an ectotherm) and a mouse (an endotherm) are placed inside a chamber at 15C and their
body temperatures [T(L) for the lizard and T(M) for the mouse] and metabolic rates [M(L) for the lizard and
M(M) for the mouse] are monitored. Which one of the following is correct ?
(A) T(L) and M(L) will fall while T(M) M(M) will increase
(B) T(L) and M(L) will increase while T(M) and M(M) will fall
(C) T(L) and M(L) will fall, T(M) will remain same and M(M) will increase
(D) T(L) and M(L) will remain same and T(M) and M(M) will decrease

118.

In Griffiths experiments mice died when injected with :


(A) heat killed S-strain
(B) heat killed S-strain combined wuth R-strain
(C) heat killed R-strain
(D) live R-strain

119.

Human height is a multigenic charecter. If the Heights of all the individuals living in a metropoils are
measured and he percentages of the population belonging to a specific height are plotted as shown
below,which of the plots would represent the most realistic distribution ?

(A)

120.

(B)

(C)

(D)

If mitochondria isolated from a cell are first placed without carbon source in a buffer at pH 8.0 and then
transferred to a buffer at pH 4, it will lead to
(A) an increase in intra-mitochondrial acidity
(B) a decrease in intra-mitochondrial acidity
(C) blockage of ATP synthesis
(D) synthesis os ATP

CLASS-XII_STREAM-SB+2_PAGE # 130

HINTS & SOLUTIONS (YEAR-2007)


ANSWER KEY
Que s.

10

11

Ans.

D
16

B
17

C
18

C
19

D
20

D
21

A
22

B
23

B
24

A
25

Que s.

26

27

28

29

30

Ans.

Que s.

31

32

33

34

35

36

37

38

39

40

A
41

D
42

B
43

A
44

A
45

Ans.

B
46

B
47

B
48

D
49

D
50

C
51

D
52

B
53

B
54

A
55

D
56

C
57

A
58

59

D
60

B
61

C
62

B
63

C
64

B
65

A
66

B
67

B
68

A
69

B
70

C
71

A
72

A
73

C
74

B
75

C
76

B
77

A
78

B
79

C
80

D
81

D
82

D
83

C
84

C
85

C
86

A
87

B
88

B
89

C
90

Ans.
B
Que s. 91
A
Ans.
Que s. 106
C
Ans.

A
92
D

B
93
D

C
94
A

A
95
C

B
96
D

B
97
A

C
98
A

A
99
C

A
100
D

B
101
B

A
102
D

C
103
A

B
104
B

B
105
D

107
C

108
D

109
B

110
B

111
C

112
A

113
A

114
D

115
D

116
B

117
A

118
A

119
A

120
B

Que s.
Ans.
Que s.
Ans.
Que s.

12

13

14

15

PART-I (1 Mark)
MATHEMATICS

1.

2
1
x2 x3

1
2
r 7
General term = ( 1) Cr x

Tr + 1

r 7

= ( 1) Cr
r 7

= ( 1) Cr
r 7

= ( 1) Cr
r 7

= ( 1) Cr

7 r

2
3
x

7 r 2r
x 2 x3
7 r 2r

x 2 3
213r 4r
x 6
21r
x 6

21 r
=4
6
21 + r = 24
r = 24 21
r=3
= ( 1)3 7C3

For the coefficient of x4,

T3 + 1

=1

765
32

= 35.

CLASS-XII_STREAM-SB+2_PAGE # 131

z
2.

z
z = 1 and | z | = 1

Let

z = x + iy

Then,

z = x iy
x2 y2 = 1

|z|=

x2 + y2 = 1

or

x iy x iy

x iy x iy = 1

x 2 y 2 2ixy x 2 y 2 2ixy
x2 y2
2( x 2 y 2 )
x2 y2

=1

=1

2x2 2y2 = x2 + y2
x2 = 3y2
x=
Now,

3y
x +y =1
3y2 + y2 = 1
4y2 = 1
2

y2 =

1
4

y=
Then, x =

1
2
3
2

Different complex number are : z =


3.

1
1
1
1
3
3
3
3
+i ,z=
i ,z=
+ i and z =
i .
2
2
2
2
2
2
2
2

Let A 1 = B
Therefore AB =
35 37
1 0
A
=

41 43
0 1
R1

R1
35

37

1 35
35 0
A
= 0 1
41 43

R 2 R 2 41R1
37

1 35
35 0

12 = 41
A

0
1

35

35
R2

35
R2
12

CLASS-XII_STREAM-SB+2_PAGE # 132

0
37

35
1

35 = 41
35
A

0 1
12
12

R1 R1

37
R2
35

43
12
1
0

A
= 41

0 1
12

43
12
A = 41

12

37
12
35

12

37
12
35

12

43 37
12 A =

41 35

det (12A) = | 43 35 4137|


= 1505 1517
= 12.

4.

Given :

2
6

n 1

1 3 5 ... ( 2n 1)

n 1

23 3 3 ..... n3

n2

n (n 1)
2

n 1

(n 1)

n 1

1 2

n 1

n
n 1


......... 1
3

2

4 6 1 .

CLASS-XII_STREAM-SB+2_PAGE # 133

5.

4ax2 + xy + 4y2 = 0
m1 + m2 =

2h
b

m1 + m2 =

1
4

m 1m 2 =

a
b

4a
=a
4
Given : m2 = m12
m 1m 2 =

1
4
4m12 + 4m1 = 1
4m12 + 4m1 + 1 = 0
(2m1 + 1)2
=0
m 1 + m 12 =

1
2
m1 m2 = a
m1 m12 = a
m 13 = a
m1 =

1
=a
2
a=

6.

1
.
8

y = 2x2 + x 2
A

Let point A is (t1, 2t12 + t1 2 ) and point B is (t2, 2t22 + t2 2)


Given : Mid point of AB is (0, 0)
So,

t1 t 2
= 0 t1 + t2 = 0
2

2t 1 t 1 2 2t 2 t 2 2
=0
2
2(t12 + t22) + (t1 + t2) 4 = 0
2[(t1 + t2)2 2t1t2] + 0 4 = 0
2[0 2t1t2] = 4
4t1t2 = 4
t1 t2 = 1
(t1 t2)2 = (t1 + t2)2 4t1t2
= 0 4( 1)
=4
t1 t2 = 2.
Distance AB :
2

AB =

( t 1 t 2 ) 2 ( 2t 1 t 1 2 2t 2 t 2 2)2

AB =

( t1 t 2 )2 2( t1 t 2 ) ( t1 t 2 )

CLASS-XII_STREAM-SB+2_PAGE # 134

AB =

( 2)2 2( t 1 t 2 )( t1 t 2 ) ( t 1 t 2 )

AB =

4 2(0) ( 2)

AB =

44 =

8=2 2.

7.

0, c
4
3x
+
4y
+
c
=

1 (1, 1)

1
1

c , 0
3
Perperndicular from (1, 1) on line 3x + 4y + c = 0

34c

=1
9 16
|7+c|=5
7+c= 5
c=57
c = 12
| c | = 12.

8.

R
P
p cos2 + r cos2
2
2

s(s r )
s(s p)
+r
pq
qr

s
[s r + s p]
q

s
[2s r p]
q

s
[p + q + r r p]
q

=s
=
9.

pqr
.
2

3cos2x sin2x sin4x cos2x = 0

3(1 sin2x) sin2x sin4x (1 sin2x) = 0

3 sin2x 3sin4x sin4x 1 + sin2x = 0

4sin4x + 4sin2x 1 = 0

4sin4 4sin2x + 1 = 0

(2 sin2x 1)2 = 0

2sin2x = 1

CLASS-XII_STREAM-SB+2_PAGE # 135

sin2x =

sinx =

1
2
1

2
sin x has 4 solution in the interval [0, 2].

10.

1
1
sin1
4
2

sin2 =

1
4

2sincos =

1
4

1
8
Value of : 64sin + 64cos 8sec 8cosec + tan + cot

sincos =

sin cos

= 64(sin + cos) 8 (sec + cosec)+


cos sin
2
2
1 sin cos
1

= 64(sin + cos) 8
+
cos sin sin cos

sin cos
1
+
= 64(sin + cos) 8
sin cos sin cos
(sin cos )
+8
1/ 8
= 64(sin + cos) 64 (sin + cos) + 8
= 8.

= 64(sin + cos) 8

11.

lim
1
1
1
2
n
x 0 x sin x sin 2 .... x sin n
L = nlim

x
x
x

1
1
1
lim x sin lim x 2 sin 2 ......... lim x n sin n

L = nlim
x 0
x 0
x x 0
x
x

L = nlim
0 0 0 .......... . 0

L=0

12.

x 3
for x 1

f(x) = 2
ax bx c for x 1
f(x) = 3x2 = 2ax + b
[f(x)] x = 1 = 6x = 2a

6 = 2a
a = 3.

13.

f(x) = x3 3ax2 + b
f(x) = 3x2 6ax
For the f(x) to be increasing f(x) > 0.
3x2 6ax > 0
3x (x 2a) > 0
(x 2a) > 0
[ x > 0]
x > 2a
So, a 0.

CLASS-XII_STREAM-SB+2_PAGE # 136

14.

xcos 2 x xdx
1

= cos 2 x 1dx +

2 cos 2 x 2dx

15.

sin 2 x 1

2
4
[1 0] [1 0]

6
.

sin 2 x 2

+ 2

Let A =

1
{(2n + 1) (2n + 2) ------- (2n + n)}1/n
n

log A =

( 2n n)
( 2n 1) ( 2n 2) ( 2n 3 )
1
.....
lim log
n
n
n
n
n n

log A =

1
2
2
n
1 lim
log 2 n 2 n 2 n ..... 2 n
n

log A =

log( 2 x )dx
0

log A = x log( 2 x) x 2 log(2 x) 0


log A = [log 3 1 + 2 log 3 2 log2]
log A = [log 3 loge + log 9 log4]
log A = [log (27/4e)]
A = (27/4e).
16.

V1 + V2 + V3 = 0

V1 V2 = ?
V1 V2 = V3

V V . V V = V . V
1

V1

+ V2 + 2V2 . V2 = V3

1 + 1 + 2V2 . V2 = 1
2V2 . V2 = 1
V2 . V2 =

1
2

CLASS-XII_STREAM-SB+2_PAGE # 137

V1 V2

= V1

+ V2 2 V1 . V2

1
2
=1+1+1=3
=1+12

V1 V2

=3

V1 V2 =

17.

Total number of possible cases = 4 + 3 + 2 + 1 = 10


Favourable cases = {(H T T H T),(T H T H T ), (T T H H T ), (T T T H H)}
Total number of favourable cases = 4

18.

3.

p(4th toss is a head) =

4
10

2
.
5

a + b + c = even
Case 1 : All taken are even : 5C3 = 10
Case 2 : One even + 2 odd : 5C1 5C2 = 50
Total = 10 + 50 = 60.

19.

2log(x 2y) = logx + logy


log(x 2y)2 = log(xy)
(x 2y)2 = xy
x2 + 4y2 4xy = xy
x2 + 4y2 5xy = 0
x2 4xy xy + 4y2 = 0
x(x 4y) y (x 4y) = 0
(x y)(x 4y) = 0
x = y (N.P.), x = 4y

x
y = 4.
20.

Let x, y and z are 2n, n2 1 & n2 +1.


Let x = 2n, y = n2 1 and z = n2 +1.
Option (A) : 2 does not divide x .
Clearly 2 divides x. So option (A) is not true.
Ex : 8, 15 and 17 are pythogorean triplet. 2 divides 8.
Option (B) : 2 does not divide z(x + y)
(n2 + 1)(2n + n2 1) which is an odd number so, 2 does not divides z(x + y).
So, option (B) is true.
Option (C) : 4 divides x + y + z
Ex : 5, 12, 13 are the pythogorean triplet.
Clearly 5 + 12 + 13 = 30, and 4 does not divides 30.
So, option (C) is not true.
Option (D) : 8 divides x + y + z
Ex : 8, 15, 17 are the pythogorean triplet.
Clearly 8 + 15 + 17 = 40, and 8 divides 40.
So, option (B) is true.
CLASS-XII_STREAM-SB+2_PAGE # 138

PHYSICS
21.

By work energy theorem, W = K


mgh wf = 0
wf = mgh

22.

E = 13.6

z2
n

= 13.6

4
= 54.4eV Ans (D)
1

2E
23.

E
VFB
deflected in x direction (Ans.B)
P
P1
I

25.

P2

45

90

By Malus's law, I=cos245


initensity after P1

I
2
initensity after P2
I = Icos245 =

I2 =

I1
I
cos245 = Ans : B
2
4

26.

Due to inertia ballon displace in the direction of motion of the bus.

27.

(D) As for hydrogen like atom

1
1
1
R.z 2 2 2

n1 n2
So,

28.

(Here z = 1, same for deuterium and hydrogen)

1
will be same for deuterium as that for hydrogen.

Bulk modulus, B =

P
V

As in isothermal process, PV = K
On differentiating, PdV + VdP = 0

V
P

V
P
P

Hence B = P = P
P

CLASS-XII_STREAM-SB+2_PAGE # 139

29.

2
From brewsters law tan =
1

30.

Cheaking dimensionally all the formula


g
L
[L] 2 [L2 T 2 ]
2
T

and

g [MLT 2 ] [L1T 2 ]

[ML3 ]
[L]

1/ 2

= [L2T2]

(dimension of v2)

2 [M1L1T 2 ][L1]

= [L2T2]

[L][ML3 ]
Only (A) option is correct dimensionally
33.

As v & d depends on frame of referance but change in KE and hence heat does not depend.
V

34.

V>> 2gr

36.

2v

C
2v

2v
vB = v0 1
c

vC = vo 1

v
c

2v cos
VA = V0 1

VA > VC > VB
(Answer : C)

37.

By dalton's law of partion pressure.

38.

Ein = 0 Eout =

(Ans : D)

KQ
r2

KQ
KQ
= const.
Vout =
R
r
X is for electric field versus distance graph
Y is for potential versus distance graph
Ans. is (B)
Vin =

kq
39.

Enet = 2
Enet =

( x y 2 )3 / 2

[ x]

2kq
x2

CLASS-XII_STREAM-SB+2_PAGE # 140

CHEMISTRY
41.

For weak acid [H+] = C


[H+] = 0.1 0.1
[H+] = 102
pH = log[H+]
pH = log[102]
pH = 2

42.

O
O

it has two donor side [O & N]

43.

H3O+
sp3 hybridisation, due to presence of 1 p
structure is trigonal pyramidal.

45.

(D) Ba > Ca > Mg > Be


Solubility increases down the group due to increase of size of cation.

46.

C > Be > B > Li


Zeff I E

47.

Dipole moment = e d
F

Be
=0

48.

[NiCl4]2 is tetrahedral.

50.

mvr =

51.

(A) both valencies of one double bonded C-atom are occupied by the same group (H).

52.

p-nitrophenol
I & M

nh
2

where n = 1, 2, 3 -------

-o-nitrophenol
I & M ( intramolecular H-bond)

CH2 O COR

54.

(A) CH O COR

m-nitrophenol
I

CH2 OH
+ 3NaOH

CH2 O COR

3RCOONa + CH OH
Salt of fatty acid
CH2 OH
glycerol

55.

(B) Branching surface area


vanderwaals forces b.p.

CLASS-XII_STREAM-SB+2_PAGE # 141

56.

(C) Zn/NaOH
2

58.

NO2

Zn/NaOH

N=N

CH3 CH2 CH(OH) COOH

OH
COOH

59.

(C)

[contains phenolic group]

60.

(B) stability of carbanions

& M
& M

PART-II (2 Mark)
MATHEMATICS
81.

ab = 2 (a + b)
ab 1

ab
2
1 1 1

a b 2

...... (i)

bc = 3( b + c)
bc 1

bc
3
1 1 1

b c 3

...... (ii)

ca = 4( c + a)
ca 1

ca
4
1 1 1

c a 4

...... (iii)

Add (i), (ii) and (iii)


1 1 1 1 1 1
2
a b c 2 3 4
1 1 1 643

a b c
24
1 1 1 13

a b c 24

...... (iv)

From (i) and (iv)


c = 24

CLASS-XII_STREAM-SB+2_PAGE # 142

From (ii) and (iv)


a=

24
5

From (iii) and (iv)


b=

24
7

So, value of 5a + 7b + c
= 24 + 24 + 24 = 72.
82.

x2 + ax + b = 0
+ = a, = b
x4 + ax3 + cx2 + dx + e = 0
Roots are + , , + and
Sum of roots = a
+ + + = a
a = 0 + = 0
Sum of roots taken two at a time = + c
( + ) ( ) + ( ) ( + ) + ( + )( ) + ( ) ( + ) + ( + ) ( + ) + ( )
( + ) = c
0 ( + )2 + 0 + 0 + 0 ( + )2 = c
2( )2 = c
2[2 + 2 2] = c
2[( + )2 2 2] = c
2[ 4] = c
c = 8
c = 8b 0
Product of roots taken three at a time = d
( + ) ( ) ( + ) + ( + ) ( + )( ) + ( ) ( + ) + ( + ) ( + ) ( + ) ( +
) = d
0+0+0+0=d
d=0
Product of roots = e
( + )( )( + )( ) = e
e=0
So, c = 0 is the false statement

83.
y = 3x
Q
y = 2x
P
O

PQ = 5
Let point Q is (x, 3x)

CLASS-XII_STREAM-SB+2_PAGE # 143

Given QP = 5 and QP line 2x y = 0

2x 3 x

=5

4 1
x= 5 5

Therefore point Q is ( 5 5 , 15 5 )
2

OQ =

5 5 15 5

125 1125

1250

= 25 2
In OPQ
OQ2 = OP2 + PQ2

25 2

= OP2 + (5)2

1250 25 = OP2
OP2 = 1225
OP = 35 cm.
84.

s(s b)
(s a )(s c )

cot

B
=
2

cot

s(s c )
C
=
(
s

a)(s b)
2

cot

s(s b)
(s a)(s c )

B
C
cot
=
2
2

s(s c )
(s a)(s b)

s 2 (s b)(s c )

cot

B
C
cot
=
2
2

cot

B
C
cot
=
2
2

cot

s
B
C
cot
=
sa
2
2

(s a)2 (s b)(s c )
s2
( s a) 2

Given : b + c = 3a

s=

a 3a
abc
=
= 2a.
2
2

cot

2a
2a
B
C
cot
=
=
= 2.
2
a

a
a
2
2

CLASS-XII_STREAM-SB+2_PAGE # 144

85.

C
F
E

Given : AE = EF = FC =

AC
3

Let,

AB = BC = CD = DA = x

Then,

AC =

2x

Let BE = a
In AEB

2x 2
x 2 a2
9
cos 45 =
2x
2
.x
3

11x 2
a2
9
1
= 2 2x 2
2
3

2x 2
11x 2
=
a2
3
9

a2 =

11x 2
2x 2

9
3

a2 =

11x 2 6 x 2
5x 2
=
9
9

a=

5
x
3

Similarily BF = a =

5x
.
3

In BEF
BE = BF =

and

EF =

5x
3

2x
3

CLASS-XII_STREAM-SB+2_PAGE # 145

cos =

BE 2 BF 2 EF 2
2BE BF

5 x 2 5 x 2 2x 2

9
9
9
cos =
5x
5x
2

3
3

8x 2
9
cos =
10 x 2
9

tan =

86.
D

8
4
= .
10
5

3
.
4
x

2007

v = Volume of box = (2007 2x)2 x


dv
= 2(2007 2x)( 2x) + (2007 2x)2
dx

= (2007 2x)[ 4x + 2007 2x]


= (2007 2x) (2007 6x)
For the maximum volume
dv
=0
dx

(2007 2x)(2007 6x) = 0


x=
d2 v
dx 2

2007
2007
or x =
6
2

= (2007 6x) ( 2) + (2007 2x) ( 6)


= 4014 + 12x 12042 + 12x
= 24x 16056

d2 v

2007
dx 2 2007 = 24
16056

x
6
6

= 8028 16056 < 0

Volume is maximum when x =

2007
669
=
cm.
6
2

CLASS-XII_STREAM-SB+2_PAGE # 146

87.

S = y2 4x
S (0, 2) = 4, S (1/2, 5/2) = 25/4 2 = 17/4, S (5/2, 9/2) = 81/4 20/2 = 41/4 and S (1, 3) = 9 4 = 5
It is clear that (0, 2) is closest to parabola y2 = 4x.

88.

or
2

or
2

I<0
J<0

I<0
J>0

J<0

So, I and J can be both negative but not both positive.


89.

|z1 z2 + z2 z3 + z3z1| = |z1z2z3|

1
1
1

z1 z 2 z 3

= z1 z2 z3

[ |z1| = |z2| = |z3| ]

= |z1 + z2 + z3|.
90.

So, the angles will be 99, 108, ....., 153, 162


Sum of largest two angles = 153 + 162 = 315.

PHYSICS
91.

Rotational inertia does not depend on speed so rotational inertia of the cylinder about its axis will be

1
MR2.
2
92.

Air column is closed at one end, so fundamental frequency


n=

v
330

= 125 Hz
4 4 66 10 2

n1 : n2 : n3 ....... = 1 : 3 : 5 ...........
So, possible frequencies are
125, 375, 675, 875, 1125 (> 1kHz)
So only possible frequenceies are 3.
93.

Time period of pendulum on the surface of the earth


T0 = 2p 2

At a depth d,

........(i)

g = g 1
R

and = 1

So new time period,


T = 2

1
d

(1 )

= 2
= (1+ ) (1 d/R) = 1 1
2
2R
g
g(1 d / R)

CLASS-XII_STREAM-SB+2_PAGE # 147

94.

For first darkness,


d sin =

95.

6 10 7
2 10 6

0.3 = 17

In LC circuit time period, T = 2 Lc


t=

96.

sin =

LC
=
4
2

For insulated material capacity,

0 A
C = (d a a / )
r
But of metal, r =
0 A
(d a)

So, C =
97.

Amax = g
A2 = g
Amax =

98.

(block and piston remains together)

g
4 2 f 2

z = 0, as P and E in same direction

dE
105
dZ
99.

F = P

dE
= 107 105 = 102 N
dZ

Inside the atom,


Electric field due to +v charge , E(r) =

Due to ve charge, E(r) = K

So, E(r) =

kz e
r2

ze r
r3

ze 1
r
2 3
4 0 r
R

r<R

For out side atom


Qnet = 0
E(r) = 0
r>R
100.

Q = cPT
f

= 1 RT = 1 PV
2
2

Q
10.61
1 =

2
PdV

1.01 10 5 3 10 5

f = 4.3
So, gas is a mixture of mono and diatomic molecules.

CLASS-XII_STREAM-SB+2_PAGE # 148

CHEMISTRY
101.

CH2 = CH CH CH2 CH3

Br2

H C Br
H C Br
CH2 CH3

CH2Br
H C Br
Br C H
CH2CH3

/////////////////////////

CH2Br

Br

/////////////////////////

Br

*
*
CH2 CH CH CH2 CH3
Br

Br

CH2Br
Br C H
Br C H
CH2 CH3

CH2Br
Br C H
H C Br
CH2CH3

102.
V

according to above graph P V


This contradict the Boyles law
103.

Molarity of acetic acid = 0.1 M [Suppose volume of acetic acid = x]


no. of millimoles present in x ml of acetic acid = 0.1x
Molarity of sodium acetate = 0.2
no. of millimoles present in 10 ml of sodium acetate = 0.2 10 = 2
[Salt]
pH = pKa + log
[ Acid]

2
4.91 = 4.76 + log 10 x
0.1x
10 x
2
0.15 = log
0.1x

[ total volume = (10 + x) ml]

0.15 = log20 logx


0.15 = 1.3010 logx
logx = 1.151
x = antilog (1.151)
x = 14.16 ml
x 14.2 ml

CLASS-XII_STREAM-SB+2_PAGE # 149

104.

Ba(OH)2 + SO2 BaSO3 + H2O


(White ppt.)
Ba(OH)2 + SO3 BaSO4 + H2O
(White ppt.)
BaSO3 is soluble in dil HCl but BaSO4 is not soluble in dil HCl . After filteration , filtrate contains BaSO3
Br2
+
H2O 2HBr + O
(Bromine water)
BaSO3 + O BaSO4
White ppt

1
105.

106.

Kb = 0.52 Kg K mol1 (given)


Tb = 0.052 K (given)
m = molecular mass of given polymer (solute)

V
according to question
given potential energy = kinetic energy
1
eV = mv2
----- (1)
2
P2
eV =
[ P = mv]
2m
h2
h
eV = 2
[ p = ]

2m
2
h
2 =
2meV
h
=
2meV
e, m, h are constants
1
so
V

Tb =

1000 K b w 0
mW

It means we can calculate

Tb m
w0
= 1000K
W
b

---------------- (i)

Relative lowering of vapour pressure of water

Po Ps
w
M
= 0
------(ii)
Po
W
m

M = molecular mass of water = 18


m = molecular mass of polymer (solute) is given

w0
= by equation (i)
W
so we can calculate relative lowering of V.P. of water by equation (ii)
n
ST
V
But V is unknown, so we cant find out the value of osmotic pressure.
osmotic pressure =

freezing point depression Tf =

1000 K f w o
mW

CLASS-XII_STREAM-SB+2_PAGE # 150

107.

But value of Kf is not given so we cant calculate the magnitude of freezing point depression.
Test of Nitrogen
Organic compound
no ppt.
Nitrogen
Fused with Na + FeSO4
observed
absent
+ FeCl3
Test of sulphur
Organic compound fused
violet
S present
with Na + sodium nitroprusside colour
observed
Thus according to question organic compound contains sulphur only.

NH2
108.

CH3

NHCOCH3

(CH3CO)2O
CH3

NH COCH3

Br2/CH3COOH
(I)

CH3

Br
(II)
H2O/H+
NH2

CH3
Br
(III)

*****

CLASS-XII_STREAM-SB+2_PAGE # 151

HINTS & SOLUTIONS (YEAR-2008)


ANSWER KEY
Que s.

10

11

12

13

14

15

Ans.

D
17

A
18

D
19

C
20

C
21

B
22

C
23

C
24

B
25

Que s.

A
16

26

27

28

29

30

Ans.

Que s.

31

32

33

34

35

36

37

38

39

40

41

A
42

C
43

B
44

B
45

Ans.

C
46

A
47

B
48

D
49

B
50

D
51

C
52

D
53

A
54

D
55

D
56

B
57

B
58

B
59

A
60

B
61

A
62

A
63

C
64

A
65

D
66

C
67

B
68

D
69

A
70

B
71

A
72

D
73

B
74

B
75

A
76

C
77

A
78

A
79

D
80

B
81

C
82

B
83

C
84

B
85

A
86

C
87

B
88

B
89

C
90

B
Que s. 91
B
Ans.
Que s. 106
B
Ans.

A
92
A

B
93
C

C
94
B

B
95
A

B
96
C

A
97
D

A
98
B

D
99
D

D
100
D

D
101
D

C
102
C

C
103
B

C
104
A

A
105
A

107
A

108
C

109
D

110
A

111
D

112
D

113
B

114
A

115
C

116
A

117
B

118
D

119
A

120
C

Que s.
Ans.
Que s.
Ans.
Que s.
Ans.

PART-I (1 Mark)
MATHEMATICS
1.

Sol.

The equation z2 = z , where z is a complex number, has


(A*) 4 solution
(B) 2 solution
(C) no solution
(D) infinitely many solutions
z = a + ib

z = a ib
It is given : z2 = z
(a + ib)2 = a ib
a2 b2 + i 2ab = a ib
a2 b2 = a and 2ab = b
2ab + b = 0
b(2a + 1) = 0
b = 0 or a =
When b = 0,

So,

1
2

a2 b2 = a
a2 0 = a
a (a 1) = 0
a = 0, or a = 1
2

1 1
1
When a =
, b2 =
2
2
2

CLASS-XII_STREAM-SB+2_PAGE # 152

1
1
b2 =
4
2
1
1 3
+ =
4
2 4

b2 =

3
2
z = 0 + 0i or 1 + 0i

z=

b=

1
1
3
3
+i.
or
i
2
2
2
2
There will be four solutions possible.

2.

x 1
x 1

2/3

1/ 3
x 1 x x 1/ 2
x

10

( x1/ 3 1)( x 2 / 3 x1 / 3 1) ( x1/ 2 1)( x1/ 2 1)

( x 2 / 3 x1/ 3 1)
x1/ 2 ( x1/ 2 1)

(x
x

1/ 3

1) (1 x 1 / 2 )

10

10

10

1/ 3

x 1 / 2
General Term

Tr + 1

= ( 1)r 10 Cr (x1/3)10 r (x-1/2)r


= ( 1)r 10 Cr x

For the independent term

10 r r

3
2

10 r r
=0
3
2

10 r r

3
2
20 2r = 3r
5r = 20
r = 4.

10!
So, independent term = ( 1)4 10C4 = 4!6! = 210.

3.

a a2

a3 1

b b2

b3 1

c c2

c3 1

a a2

a3

a a2

b b

b b

c c

c c

=0

1 a a2
abc

1 b b2
1 c c2

=0

a a2 1
1

b b2 1
c c2 1

=0

CLASS-XII_STREAM-SB+2_PAGE # 153

1 a a2
abc

1 b b

a 1 a2

1 c c2

+1

1 a a2
abc

1 b b

c 1 c2

=0

1 a a2

1 c c2

b 1 b2

1 b b2
1 c c2

=0

1 a a2
1 b b2
1 c c2

4.

(abc 1) = 0

abc = 1.

ax2 6xy + y2 = 0
m1 + m2 =

2h
b

m1 + m2 =

6
1

m 1m 2 =

a
b

a
=a
1
Given : m2 = m12
m 12 + m 1 6 = 0
(m1 + 3) (m1 2) = 0
m1 = 3 and m1 = 2
and
m 1m 2 = a
m1 m12 = a
m 13 = a
a is positive, so a = (2)3 = 8.
m 1m 2 =

5.

x2 + 4y2 =1
....(i)
2
2
4x + y = 4
y2 = 4 4x2
Substitute the value of y2 in equation (i)
x2 + 4(4 4x2) = 1
x2 + 16 16x2 = 1
16 1 = 15x2
15 = 15x2
x2 = 1
x=1
y2 = 4 4x2
= 4 4(1)
y2 = 0
y=0
(1, 0) and ( 1, 0) are two common point.

CLASS-XII_STREAM-SB+2_PAGE # 154

6.

Diameter = major axis = 2a


radius = a
Area of circle = a2

(0, b)

Let the equation of the ellipse be

y=

x2
a2

y2
b2

( a, 0)

1.

(0, b)
a

1 2
a = 4
3

Area of ellipse =

b
a 2 x 2 dx
a
a

1
x
b x
a 2 x 2 a 2 sin 1
=4

2
a 0
a 2
2
1 2
b a

a = 4
3
a 4

b 1

a 3

7.

1
1
3

e=

b
1
a

PD =

PA PB
18 2
=
=9
PC
4

8
2 2
=
.
9
3
B

N
O
18
4 P
9
C 2
M
A

1
BN = AB = 10
2
1
13
CD =
2
2
PM = MC PC

MC =

13
5
4=
2
2
5
ON = PM =
2
In ONB
=

OB =

5
10 2
2

100

25
=
4

425
5 17
=
4
2

5 17
2 = 5 17 cm.
2
cos 175 = cos (180 5) = cos 5
cos 185 = cos (180 + 5) = cos 5
cos 355 = cos(360 5) = cos 5

cos 5 + cos 10 + cos 15 + ......+ cos 355


= cos5 + cos 10 + .....+ cos 85 + cos 90 + cos(180 85) + cos (180 80)
+ .......+ cos (180 5) + cos 180 + cos (180 + 5) + cos(180+ 10)
+ .......+ cos (180 + 85) + cos 270 + cos(360 85) + ......+ cos(360 5)
= cos 5 + cos 10 + .......+ cos 85 + 0 cos 85 cos 80 .......... cos 5 1
cos 5 cos 10 cos 85 + 0 + cos 85 + cos 80 + ...........+ cos 5
=1

Diameter = 2 OB =
8.

a x

(a, 0)

(0, 0)

b
a2 x 2
a

b
y= a

CLASS-XII_STREAM-SB+2_PAGE # 155

9.

By AA similarity
QCP ~ PBA

y
D

Q a y

C
ax

ax
ay
3
=
=
a
x
4

P
4

ax
3
=
a
4

x
B

a
4

x=

ay
3
=
x
4
ay
3
=
a/4
4

y=

13a
16

In PAB
42 = x2 + a2
2

a
16 = + a2
4

16 =

17a 2
16

a2 =

16 16
256
=
17
17

Area of square ABCD = a2 =

10.

256
.
17

By Angle bisector theorem

cos B =

11.

s=
s=

7
3 2 4 2 22
9 16 4
21
=
=
= .
8
23 4
24
24

x
2
=
x=4
2
1

x=

D 1

18 x 6
= 9x + 3
2
(9 x 3)( 2)(3 x 1)( 6 x )

= 6 (3 x 1)( 3 x 1)( x )
= 6(3x + 1) x
x is a perfect square, so in 1 to 20, 4 perfect square i.e. possible values are {1, 4, 9, 16}.

CLASS-XII_STREAM-SB+2_PAGE # 156

12.

f(1) = 0 as lim

h0

f (1 h)
exists.
h

f (1 h) f (1)
f (1) exists.
h 0
h
So, f is differentiable at 1.
lim

13.

14.

Statement I is true that the derivative of an odd differentiable function is always even and statement II is
also true that If f(x) is differentiable at a point x0 and g(x) is not differentiable at x0, then f(x) g(x) is not
differentiable at x0.

0,

0 x 1

1, 1 x 0

sin( 1)

sin1, 1 x 0
f(x) = 1

0,
0 x 1

lim f ( x ) sin1

x 0

f (x) 0
and xlim
0
lim f ( x ) does not exists.
x 0

15.

x > 0 for all x > 1.

and

x + 4 x > 0 for all x < 0


So, range of f is [0, ).
x

16.

f(x) =

e (t 1)(t 2) dt
0

f(x) = ex(x 1)(x 2)


For decreasing
f(x) < 0
ex(x 1)(x 2) < 0
(x 1)(x 2) < 0
x (1, 2).
1

17.

x | x |3 / 2 dx

1
0

1
0

[ ex > 0]

x( x )3 / 2 dx +

x 5 / 2 ( 1)3 / 2 dx +
0

= ( 1)

3/2

x( x )3 / 2 dx

0
1

x 5 / 2 dx

x7 / 2
x7 / 2

7 / 2 1 7 / 2 0

= ( 1)3/2

2
2
[0 ( 1)7/2] + [1 0]
7
7

= ( 1)5

2
2
2
2
4
+
=
+
= .
7
7
7
7
7

CLASS-XII_STREAM-SB+2_PAGE # 157

18.

x f ( x)f (x)......f
1

10 ( x )

1 dx

Let f11(x) = t

dx
x f1( x )f2 ( x )......f10 ( x ) = dt

1.dt

=t+C
= f11(x) + C.

19.

Applying AM and GM condition :


x1 2x 2 3 x 3
6 x1x 2 x 3 1 / 3
3
4
6 x1x 2 x 3 1/ 3
3

Cubing both sides

64
6 x1x 2 x 3
27
x1x 2 x 3

32
81

Now also

x1 x 2 x 3
2
2
2
x1 x 2 x 3
3

x1 x 2 x 3
32

3
81
210
x1 + x2 + x3 3
38

1/ 3

2/3

1/ 3

x1 + x2 + x3

38 2

9 9

x 12 + x 22 + x 32

24
0 .6
9

1/ 3

x 12 + x 22 + x 32 1 . 6
So, according options least value is 2.
20.

12 3 4 5 6 7
at each position two posibility i.e. either H or T
So total posible outcomes = 27
As we want three tails is sequence and it happened at 7th turn. So at position 5, 6, 7 we have tails and
position 4 must have head otherwise our requirement is fullfilled at position 6.
So, the position 1, 2, 3 can have anything i.e. H/T = 23
To get tail at 1, 2,3 position we have only one probability.
So, total favourable cases = 23 1 = 7
required probability =

7
27

7
.
128

CLASS-XII_STREAM-SB+2_PAGE # 158

PHYSICS
22.

PV = nRT
PdV + VdP = 0

1 dV 1

V dP P
= P1

23.

(Answer is C)

1
for point charge
r2
Force solid sphere

Inside the sphere E r and out side the sphere E

24.

r2

L
r 4

So, =
25.

L
r 4

Angular momentum, = mvr


Magnetic moment, = IA = nqr2 =

qr 2
2

v
vqr
2
= 2r qr 2
vqr
q

2mvr 2m

or

26.

kT
c m

(Answer is C)

2 2 1/ 2

ML T
=
LT M
1

1/ 2

= [M0L0T0]

which dimensionally satisfies

1 kT
f
=
c m
f
27.

(Answer is D)

Average power, <P> =


Av2

28.

Wave length, =

1 2 2
v Aw
w
2
(Answer is A)

d 0.2 6 103

= 0.5 104 m
D
24

= 5 105 cm
= 500 nm

(Answer is B)

29.

(B)

30.

By angular momentum conservation


m1v1r1 = m2v2r2
( m1 = m2 )

So, v2 =

5.6 10 4 9 1010
5.6 1012

= 900 m/s (Answer is B)

CLASS-XII_STREAM-SB+2_PAGE # 159

31.

y = y1 + y2
= 2A cos (2Kx) cos(2cost)
x = 0, y = 0
(Ans. C)

20m

32.

A m (some as x)

1
sec1
t

1
sec1
t
= angle(dimensionless)
33.

34.

(Answer is A)

KE = 0.01864 931 = 17.4 Mev


KEf KEi = 17.4 Mev
As proton is at rest (B) option is correct

mv 2 kq1q2
2
r
r
kq1q2
mr

v=

v = 1.6 1019

9 10 9
9.11 10 31 0.53 10 10

v = 2.24 106 m/s

(Answer is D)

35.

F=

F=

0 1 2

2d
4 10 7 4000 4000 60 10 2
2 1.5 10 2

F = 128N repulsion

(Answer is B)

37.

(C)

38.

Phase different between VR and VC is 90


so,

VR2 VC2 = 220

(Answer is D)

39.

Distance between to consecutive destructive interference is 1.7cm, so total number of points of


destructive interference on the line PQ is 4. (Answer is A)

40.

(D)

CLASS-XII_STREAM-SB+2_PAGE # 160

CHEMISTRY
41.

The ionization energy or enthalpy of Na is less than that of Li but the hydration enthalpy of Li is higher
than that of Na. Difference between ionization enthalpy of both is less than difference between their
hydration enthalpy so overall oxidation potential of Li is greater than Na. Therefore Li metal is a better
reducing agent than Na metal.

42.

Compressibility K =
Kx Ky =

1
P

1
1

1
2

= 0.5 atm1
OH

43.
CO2H

44.

2CH3

CHO

conc. NaOH

CH3

CH2OH + CH3

COOH

Cannizzarro reaction
45.

On heating solution becomes unsaturated


solubility and conductance both are increase.

46.

According to graph, segment BC represents isobaric process. It means pressure is constant so according to Charles law V T [on constant pressure]
From B to C volume decreases so temperature will also decreases.

H
6

H
3

47.
7

OH

when same groups present in same side of the double bond then geometrical isomer is known as
Z isomer.
Due to back donation electron defficiency of [B] almost neutral.

+
Cl

Cl

Cl
49.

en

Co
Cl
trans

en

en

Co
en
cis/d

/////////////////////////

48.

Cl
Cl
Co

en

en

CLASS-XII_STREAM-SB+2_PAGE # 161

50.

xH2S + 2NaNO3 +2HCl yS + zNO + k NaCl + 4H2O


Put the following values of variables in above equation
x = 3, y = 3, z = 2, k = 2
3H2S + 2NaNO3 + 2HCl 3S + 2NO + 2NaCl + 4H2O

51.

R = k [X]1/3 [Y]2/3
order of reaction =

1
2
+
=1
3
3

52.

Because Zn has higher oxidation potential than Cu,So Zn loses its electrons at an anode and convert in
Zn2+ ions and come into the solution. These electrons flow externally from zinc to Cu by wire.

53.

Because ideal mixture of benzene and toluene follows Raoults law


according to Raoults law
Pmix = PA + PB
Pmix = XAPA + XBPB
Pmix = XAPA + (1 XA) PB
Pmix = XA(PA PB) + PB
This is a linear equation, by comparing with y = mx + c
y = Pmix
x = XA
m = PA PB
c = PB
according to above data graph will be like following -

PB
Pmix
PA
XA = 0
XA = 1
XA
molefraction (benzene )

54.

sp3d2 hybridization explains the bonding of complex which has C.N. (co-ordination number) 6 so answer
may be either [Fe(CN)6]3 or [Fe(H2O)6]2+. But H2O is a weak ligand and CN is a strong ligand.
Because weak ligand form an outer orbital complex with metal ion and this is possible when sp3d2
hybridization takes place.

55.

2NaCl + H2SO4 Na2SO4 + 2HCl


MnO2 + 4HCl MnCl2 + 2H2O + Cl2

56.

Bond order =

1
[N Na]
2 b

CLASS-XII_STREAM-SB+2_PAGE # 162

B.O. of O2+ =

1
[10 5] = 2.5
2

Nb = no. of electrons present in BMO

1
[10 7] = 1.5
Na = no. of electrons present in ABMO
2
1
B.O. of O22 = [10 8] = 1
2
1
Inter atomic distance
B.O
order of inter atomic distance ; O22 > O2 > O2+
B.O. of O2 =

57.

amylose [it is a part of starch]

58

t1/ 2 =
t1/2 =

59.

60.

0.693
K
0.693

6.93 10 3

t1/2 = 100 s
Because unit cell has six faces and every facial atom is a part of two unit cell. It means only half part of
one facial atom belongs to one unit cell.
1
so, total no. of facial atoms in fcc unit cell = 6
=3
2
=

W
T1 T2
=
Q1
T1

W
800 200

800
100

W = 75 J

PART-II (2 Mark)
MATHEMATICS
81.

a=A d
b=A
c=A+d
a + b + c = 3A =
A=

3
2

1
=b
2

a+b+c=
a+c=
b2 =

3
2

3
3
1
b=

=1
2
2
2

....(i)

a 2c 2
2

1
= ac
2
When

ac =
c=

1
4

1
4a

...(ii)

CLASS-XII_STREAM-SB+2_PAGE # 163

From (i) & (ii)


1
=1
4a
4a2 4a + 1 = 0
(2a 1)2 = 0
2a 1 = 0

a+

1
2
By this we get
a=b=c
But a < b < c, so we take
a=

When

ac =

1
4

1
4a

c=

....(iii)

from (i) & (iii)


a

1
=1
4a

4a2 4a 1 = 0
a=

4 16 16
8

44 2
1 2
=
8
2

as b > a

a=

1 2
2

82.

g(x) is changing its slope from positive to negative as it passes through g(2). So, g(2) is largest.

83.

92
180 = 140
B =
9

1 = 2 =

180 140
= 20
2

z
3

3 = 140 2 = 120
In ACD

y 2 x 2 z2
cos 120 =
2xy

y
A

1
x

y 2 x 2 z2
1
=
2xy
2
xy = y2 + x2 z2
z2 = x 2 + y2 + xy

CLASS-XII_STREAM-SB+2_PAGE # 164

84.

0 * * *

* 0 * *
* * 0 *
T
AA =

* * * 0
As the diagonal element of resulting matrix are zero.

multiplication R1 of A and C1 of AT (i.e. = R1 of A) = 0


It is possible only when all element in R1 of A is zero
In the same way we can say that element of all 10 rown of A is zero so for the above condition we can
formm only 1 matrix i.e. A = null matrix.

(0, b) C
E

85.

( a, 0) A

(0, 0)
O

(ae, 0)

D (0, b)

(i)

As line DE and AC are so product of there slope = 1.

b 0
b
=1
0 ae
a
b b

=1
ae
a
2

b
e=
a
(ii) and line CF and AD are also
b0
b 0

=1
0 ae
0a

b
b

=1
ae
a
2

b
e=
a
(iii) and line AO is to CD
00
2b

1
0a
0

b
From (i) & (ii) case e =
a
But in (iii) case e cannot be determined. So, we can not determined uniquely.

86.

[ x ]e x dx =

= 0 + e x

0e
0

2
1

dx +

(1) e x dx +

2e
2

dx + ......

x 3
2

+ 2e + .........

= (e2 e1) 2(e3 e2) 3(e4 e3) .........


= e1 + e 2 + e3 ............

1
e1

1
e2

1
e3

+ ..........

S =

1
e
1
1
e

1
.
e 1

CLASS-XII_STREAM-SB+2_PAGE # 165

87.

/2


cos1003 xdx

lim g( x )

lim

lim
x

=
89.

2008

e f ( t ) dt

g' ( x )

2 1004

0
f(x)

e f ( t ) f ( x ) dt
x

cos1004 xdx

g( x )

(1002 1000 998 .....2) (1003 1001 .....1)

1003 1001 ....... 1


1004 1002 ....... 2
2

88.

/2

lim 0

lim 0

e f ( t ) g( x )e f ( x )

f ' ( x )e f ( x )

g( x )
f ' (x)
3 x 3 .....
16 x 3 ....

3
.
16

dy
= sin(x + y) + cos(x + y)
dx
let x + y = u
Differentiating wrt x

1+

dy
du
=
dx
dx

dy
du
=
1
dx
dx

dy
= sin(x + y) + cos(x + y)
dx

du
1 = sinu + cosu
dx
du
= sinu + cosu + 1
dx
du
dx
sin u cos u 1
Integrating both sides
du

sin u cos u 1 dx

CLASS-XII_STREAM-SB+2_PAGE # 166

du

2 tan u / 2
2

1 tan u / 2

1 tan 2 u / 2
2

1 tan u / 2

dx
1

sec 2 (u / 2)du

2 tan u / 2 1 tan

u / 2 1 tan 2 u / 2

sec 2 (u / 2)du
dx
2 tan u / 2 2

sec 2 (u / 2)du
dx
2(tan u / 2 1)

dx

Put 1+ tanu/2 = t
(1/2)sec2u/2du = dt

dt
dx
t

log |t| = x + c
log |1+ tanu/2| = x + c
log 1 tan

(x y)
=x+c
2

It passes through origin.


log1 = 0 + c
c = 0.
So, log 1 tan
90.

(x y)
= x.
2

Total mappings of bijection is 6 !.


for self inverse
4! 6 C 4
2! 2! 2!

6!
2! 2! 2! 3! +

2 pairing

P=

2 going to their own value

6
C2 1

4 going to their own value

= 76

76
19
=
.
720
180

CLASS-XII_STREAM-SB+2_PAGE # 167

PHYSICS
d
91.

M2

M1
r1

r2

M1r1 = M2r2 and r1 + r2 = d

M2 d
so r1 = M M
1
2
2r1
T = v
1

........(i)

........(ii)

Here

M1v12
=
r1

GM1M2
d2

GM2r1

or v1 =

From (ii)
T=

T=

T=

2r1d
GM2r1

2d r1
GM2
2d

T=

GM2

M2d
M1 M2

2d3 / 2
G(M1 M2 )

92.

a = r = 20 0.5 = 10 m/s2

93.

For min

(Answer is B)

hc
min = K.E.
min =

hc
K.E.

6.6 10 34 3 10 8
min = 30 10 3 1.6 10 19 = 4.14 10111 m

CLASS-XII_STREAM-SB+2_PAGE # 168

94.

95.

V V0
340 9
App. frequency, N = V V N 340 9 90

N = 94.9 kHz

Mass of water, m =

kg
10 3
m = 18102 (3.96)2 104 0.92 103
mLf =

t =
96.

18 (3.96 )2 0.92

mL f
t = KA ( )
1
2

KA (1 2 ) t

18(3.96)2 0.92 333 103 10 3

t = 9.2 s

103 400 (3.96)2 15

(Answer is A)

Range, R = 2 (H h) h
(i) h = H/4
HH

X1 = 2 H
44

3H/4
H/2 2

3
X1 = H
2
(ii) h = H/2
X2 = H
(iii) h = 3H/4
X3 = H

H/4

1
X2

3
2

X1= x3

X2 > X1 = X3 (Answer is C)

CHEMISTRY
101.

Xe contains 8 electrons in its outermost shell or valence shell. In XeF2, Xe uses 2 electrons for bonds so
it contains 3 p. In XeF4., Xe uses 4 electrons for bonds, so it contains 2 p.

N2 + 3H2

102.
initial moles

2NH3

16

at equilibrium

[according to question ammonia gas is produced = 4 mol]


2 = 4
put the value of = 2
42

16 3 2

10

concentration 2
at equilibrium V

10
V

4
V

moles at
equilibrium

22

CLASS-XII_STREAM-SB+2_PAGE # 169

KC

[NH3 ]2
[N2 ][H2 ]3
2

4

V
= 2 10 3

V V
=
=

42
2 10 3
8

V2

(10)2

10 3

(V = 10L]

= 0.8 mol2 lit2


103.

Kw 0
Depression in freezing point TF = m W
0
In given two cases m0, W and K are constants
so TF w0
( TF )1
( w 0 )1
=
( TF )2
( w 0 )2
5.5 4
2.9
=
5.5 2.5
2.9 x
1.5
2.9
=
3
2.9 x
x = 2.9 g
I

105.

OH
II
2

2R and 5R
III

'

III '
5

II

OH
I '

106.

Zn + 2Ag+ (0.0001M) Zn2+ (0.1M) + 2Ag


by nernst equation
Ecell = E

[ Zn2 ][ Ag]2
0.059
log10
[ Ag ]2 [ Zn]
n

[Ag] = [Zn] = 1
Ecell = E

[ Zn2 ]
0.059
log10
[ Ag ]2
2

Ecell = 1.56

(0.1)
0.059
log10
(
0
.
0001)2
2

Ecell = 1.56 0.2065


Ecell 1.35 V
107.

Cu(Y)

(CH3)2SiCl2
2CH3Cl + Si
(X)

SiCl4 + 2CH3MgBr (CH3)2SiCl2 + 2Mg(Br)Cl


(Z)
CLASS-XII_STREAM-SB+2_PAGE # 170

108.

according to Arrhenius theory


K = Ae

E
RT

according to question K is same in both cases, so

E1
E2
RT1 = RT2
E1 and T1 are activation energy and temp. in absence of catalyst

400
500
=
T2
625

E2 and T2 are activation energy and temp. in presence of catalyst

T2 = 500K
109.

28

Ni [Ar]3d84s24p0

Ni2+ [Ar]3d8 4s0 4p0

[Ar]
because CN is a strong ligand ,so pairing of electrons takes place.

[Ar]
dsp2 hybridization

[Ar]
2

dsp hybridized Unhybridized


orbitals
orbitals

In dsp2 hybridization geometry of complex is square planar.

110.

238
206
82
Pb
92 U

x 24He y 01e

by balancing of mass no.


238 = 206 + 4x + 0y
x=8
by balancing of nuclear charge
92 = 82 + 2x 1y
92 = 82 + 2 8 y
y=6

*****

CLASS-XII_STREAM-SB+2_PAGE # 171

HINTS & SOLUTIONS (YEAR-2009)


ANSWER KEY
Que s.
Ans.
Que s.

1
A
16

B
17

C
18

B
19

D
20

B
21

7
D
22

8
A
23

9
A
24

10

11

12

13

14

15

C
25

26

27

28

29

30

Ans.

Que s.

31

32

33

34

35

36

37

38

39

40

41

D
42

C
43

A
44

D
45

Ans.

D
46

C
47

A
48

B
49

B
50

C
51

A
52

A
53

A
54

B
55

C
56

D
57

C
58

C
59

D
60

A
61

C
62

B
63

A
64

B
65

A
66

D
67

C
68

D
69

B
70

D
71

A
72

D
73

B
74

B
75

A
76

C
77

C
78

C
79

B
80

B
81

C
82

D
83

A
84

D
85

D
86

D
87

B
88

A
89

B
90

Ans.
B
Que s. 91
D
Ans.
Que s. 106
C
Ans.

B
92
A

D
93
B

C
94
C

A
95
D

C
96
A

B
97
C

C
98
C

B
99
B

B
100
B

D
101
B

C
102
D

D
103
A

B
104
A

C
105
B

107
A

108
C

109
D

110
B

111
C

112
B

113
A

114
B

115
A

116
D

117
B

118
A

119
C

120
C

Que s.
Ans.
Que s.
Ans.
Que s.

PART-I (1 Mark)
MATHEMATICS
1.

Given : a1, a2, a3 .........AP and a1, a2, a4, a8 ......GP.


Let common difference of A.P. = d
a2 = a1 + d
a4 = a1 + 3d
a8 = a1 + 7d

a8
a2
a4
=
=
a1
a2
a4 = r
a1 d
a1 3d
a1 7d
a1 = a1 d = a1 3d = r
(a1 + d)2 = a1(a1 + 3d)
a12 + d2 + 2 a1d = a12 + 3a1 d
d2 = a1 d

(d 0)

d = a1

....(i)

a2
a1 d
Hence, a = r ; a
=r
1
1
a1 a1
=r
a1

(using (i))

r = 2.

CLASS-XII_STREAM-SB+2_PAGE # 172

2.

Tk
101

till k = 10
Tk 1
k
Tk > Tk1
Let k = 11
T11 < T10 T10 is maximum at k = 10.

3.

x=

2+ 3+ 6
2

x 2 = 3 6

x2 + 2 2 2 = 9 + 6 2
x2 7 = 8 2
(x2 7)2 = 64 2
So, smallest possible value of n is 4.
4.

Let the three players are A, B, C.


Now, each player get 0 score after playing 9 games. It happened only when each player wins 3 games
and loss 6.
So,
A win 3 games out of 9 9C3
B win 3 games out of remaining 6 6C3
C win 3 games out of remaining 3 3C3
So, required way = 9C3 6C3 3C3
=

9 8 7 6!
6 5 4 3!

1
3 2 1 6!
3 2 1 3!

= 1680.
A (2, 3)

5.

O
(2, z)
B
(4, 0)

C
(x, y)

O is circumcenter

OA = OB = OC = circumradius
(2 2)2 + (z 3)2 = (4 2)2 + (0 z)2
z2 + 9 6z = 4 + z2
9 6z = 4
5 = 6z
5
=z
6

Circumcenter =

5
13
.
( z 3 ) 2 ( 2 2) 2 = | z 3 | = 6 3 =
6

CLASS-XII_STREAM-SB+2_PAGE # 173

6.
(5, 15) L(21, 15)
P

P'

5 21 15 15
,

Mid point of PP =
2
2
L = (13, 15)
Point A will be (13, 0)
By property PA + PA = 2a

PA =

(13 5)2 (0 15 )2
=

64 225

289 = 17 cm

PA =
=

(13 21) 2 (0 15) 2


64 225

289 = 17 cm

2a = PA + PA
2a = 17 + 17
2a = 34 cm
So, length of major axis = 2a = 34 cm.
7.

P (10, 10)

B
(0, 6)

2x + 3y = 18

C
(a, b)

PB = PC
(10 0)2 + (10 6)2 = (a 10)2 + (b 10)2
100 + 16 = a2 + 100 20a + b2 + 100 20b
a2 + b2 20a 20b + 84 = 0
....(i)
Also
(a, b) i.e. on 2x + 3y = 18
2a + 3b = 18

3b
2
Using equation (i)
a=9

3b

3b

20b + 84 = 0
9
+ b2 20 9
2
2

81 +

9b2
27b + b2 180 + 30b 20b + 84 = 0
4

13b 2
17b 15 = 0
4
13b2 68b 60 = 0

CLASS-XII_STREAM-SB+2_PAGE # 174

13b2 78b + 10b 60 = 0


13b(b 6) + 10 (b 6) = 0
10
13

b = 6 or b =

When b = 6, then a = 9

When b =

10
3 10
30
132
, then a = 9 +
=9+
=
13
2 13
26
13

132
10
+2
13
13

8a + 2b = 8

1056 20
79 .
13

8.

36
=0
2

cosec2( + ) sin2( ) + sin2(2 ) = cos2( )


cosec2( + ) + sin2(2 ) =

cos 2 ( ) sin 2 ( )
1

cosec2( + ) = 1 sin2(2 )
cosec2( + ) = cos2(2 )
Minimum value of cosec2( + ) is 1 and maximum value of cos2(2 ) is 1.
They will be equal for the value 1.

.....(i)

2 = 0
By adding (i) & (ii)

.....(ii)

+=

3 =

9.

sin( ) = sin (

sinx + siny =

7
5

cos x + cosy =

1
) = sin ( ) =
.
6
3
6
2

....(1)
1
5

....(2)

By (1)2 + (2)2 we get


2 + 2sinx siny + 2 cosx cosy = 2

CLASS-XII_STREAM-SB+2_PAGE # 175

sinx siny + cosx cosy = 0


cos(x y) = 0
x y = 90
By (1) (2) we get
sinx cosx + sinx cosy + siny cosx + siny cosy =

7
25

sin(90 + y)cosx + sin(x + y) + sin(x 90) cos y =

7
25

cosy cosx + sin(x + y) cosx cosy =


sin(x + y) =

7
25

7
.
25

10.

6
x

y=

(1, 1)
1
0
y = sin x
Clearly, curve meet each other twice in

11.

2 3
4 5
6 7
8 9
10 11

Total 10 Times.

f(x) is differentiable on R.
So, it will be contincous on R.
Continuity at x = 0
LHL
2
lim sin x
x 0
x
Put x = 0 h, then h 0
2
lim sin(0 h)
h0
h

lim sin h h = 0
h h
RHL
h0

lim x2 + ax + b

x 0

Put x = 0 + h, then h 0

lim h2 + ah + b = b

h0

Value of f(x) at x = 0
f(0) = b.

CLASS-XII_STREAM-SB+2_PAGE # 176

f(x) is contineous at x = 0
LHL = RHL = f(0)
0=b=b
b=0
Differentiability at x = 0
LHD

lim

f ( 0 h ) f ( 0)
h

lim

sinh 2
b
h
h

h0

h0

2
lim sin h = 1
h0
h2
RHD

lim f (0 h) f (0)
h

h0

2
lim h ah b b
h0
h

lim h(h a ) = a.
h

f(x)is differentiable at x = 0, LHD = RHD


a = 1.
h0

12.

Let point p(x1, y1) is on the curve y2 = 4x.


2

y12 = 4x1 x1 =

y1
4

( x1 0) 2 ( y1 3 ) 2

PA =

AP2 = x12 + y12 6y1 + 9


AP2 = x12 + y12 6y1 + 9
Let AP = z
z2 = x12 + y12 6y1 + 9
2

y12

2
z = 4 + y12 6y1 + 9

z2 =

y1
+ y12 6y1 + 9
16

Diff. w.r.t. y1
3
dz
4 y1
2z dy =
+ 2y1 6
16
1

3
dz
y
2z dy = 1 + 2y1 6
1
4
3

y1 8 y1 24
4

dz
2z dy = (y1 2) (y12 + 2y1 + 12)
1

CLASS-XII_STREAM-SB+2_PAGE # 177

For the critical points

dz
dy 1 = 0
(y1 2)(y12 + 2y1 + 12) = 0
y1 = 2
y12 = 4x1
(2)2 = 4x1
x1 = 1.

dz

2
dy 1

d2 z

+ 2z

dy 1

= (y12 + 2y1 + 12) + (y1 2) ( 2y1 + 2)


= y12 + 2y1 + 12 + 2y12 4y1 + 2y1 4
= 3y12 + 8.

dz
when y1 = 2 and dy = 0
1
d2 z
2

dy 1

>0

z is min at (1, 2)

Minimum distance = (1 0)2 (2 3)2 =


13.

1 1 =

2.

We can find the answer through option as the sum of weight of packet taken from trucks is 1022870 gm
and its unit digit is 0. The truck that have heavier bags have unit digit 0. So, the truck have lighter bags in
which the sum of weight of bags must have unit digit 0.
So, according to option D. i.e. truck no. 2, 8
Track 2 have 21 bags and total weight = 21 999 gm = .......8 gm
Truck have 27 bags and total weight = 27 999 = 128 999 gm = ......2 gm
So, the unit digit of the weight contain by truck 2, 8 together is 0.
1

14.

cos( x ) cos([2x]) dx
0

1/ 2

cos( x ) cos 0 dx +

sin x

0
1/ 2

1/ 2

cos( x ) cos dx

cos( x ) dx
1/ 2

1/ 2

cos( x ) dx
1

sin x

1/ 2

1
1

= 0

2
.

CLASS-XII_STREAM-SB+2_PAGE # 178

cos(nx )x 9 dx
cos(nx)x10
10

+
n
n

0
1

15.

IN =

1
1

10 sin(nx )x 9
9 sin(nx )x 8 dx

0+ n

n
n

0 n 0

10 9
sin(nx )x 8 dx
2

n
0

10 !
sin(nx )dx
= 10

n 0

= 0 as Denom

16.

y = x2 & y = 1 x2
Point of intersections of graphs x2 = 1 x2
2x2 = 1

1
x=

1 1
1 1
, and
, .
Point of intersections =
2 2
2 2
Area under graph :
1/ 2

(1 x )2

1 / 2

1/ 2

1 /

1/ 2

2x 1 = 2x x
1/
3
2
2

2
=2

=2
17.

6 2

26
6 2

1
2
4

3 2

2 2
.
3

a 3 i 4k and b = 5 j 12k

2
2
2
a (3)2 4 5 and b (5) 12 13

Therefore, a vector which bisects the angle is 13 3 i 4k + 5 ( 5 j 12k ) = 39 i 25 j 8k .

CLASS-XII_STREAM-SB+2_PAGE # 179

19.

Let M 2 x1 .3 x 2 .5 x 3 ...... , N 2 y1 .3 y 2 .5 y 3 ...... xi & yi w


x1

5 x3 1
2 y1 1 3 y 2 1

5 1 ....... = 2 1 3 1 .........

3 x2 1

3 1

d = d 22 11

d/m

d/N

x2
1 x1

1 1 1
2
3

....
1 / 2 1 1 / 3 1

1/ d
1 y1
1 y 2

d/M

1/ d = 2 1 3 1

....
d/N
1 / 2 1 1 / 3 1

(2 x1 1)(3 x 2 1).....

2 x1 3 x 2 .....

20.

m C0

(2

y1

m C1 n

1)(3

y2

1)......

N
1.
M

2 y1 3 y 2

m C2 n 2 mC m n m (1 + n)m

only one
element from A

PHYSICS
27.

Sphere is hollow so potential inside sphere will be same as that on surface.

28.

Heat supplied Q = dU + W
PV = RT
PdV = RdT

(at constant pressure)

PdV
R
Q = CVdT + PdV
dT =

PdV
+ PdV
R
Work done at constant pressue,
W = PdV
Q = CV

CV

PdV
PdV
R
PdV

Q CV

1
W
R

(For diatomic gos, CV =

5
R)
2

Q 5R

1
W 2R
Q 7

W 2

W 2

Q 7

CLASS-XII_STREAM-SB+2_PAGE # 180

29.

1
1
1
R 2 2 For lyman series

2
1
1
1
1
R 2 2 For balmer series

3
2

1 1 94

)
4 9
36

3/4
3 9 27
=
5 / 36
1 5
5

27

30.

q
q
and
2
2

charge divides

Than, on touching

q
sphere to q
2

Charge divides

q / 2 q 3q

2
4

force between

3q
q
R

4
2

f=

f=

unchanged

K 3q2
8R 2
3 kq2 3
F

8 R2
8

31.

Intially block enters in the magnetic field rate of change of flux will be constant so constant current will
induce, when it moves inside the magnetic field there is no change in magnetic flux, current I = 0, when
it use the filed the rate of the change in flux will be again constant between in decreasing order so
constant current will induced on opposite.

32.

No change in moment of inertia

34.
E

+q

Electric field at each point of OA obtained to it and opposite to direction of dipole moment.

CLASS-XII_STREAM-SB+2_PAGE # 181

38.

Total force in upward direction m (g + a) because mass m is stationary on inclined plane and whole
system is accelerated with acceletration a in upward direction.
39.

Force of positve charge = Electric force + Magnetic force


F = (qE + qVB)
This force is in upward direction so no any particle will pass through the hole.

40.

Potential energy at H height = Kinetic energy at the lowest point of circular path.
mgH =

1
mv2
2

To complete the circular motion minmum velocity at lowest point will be V =


mgH =

H=

5gR

1
m (5gR)
2

5
R
2

CHEMISTRY
41.

According to Grahams law

1
Rate of diffusion

Molar mass

due to highest molar mass of CO2 rate of diffusion is slowest.

42.

Moles of H2 =

3
4
, Moles of O2 =
2
32

Kinetic energy of n moles of gas =

3
nRT
2

3
n1RT
2
Kinetic energy of hydrogen
so,
= 3
Kinetic energy of oxygen
n 2RT
2
n1
= n
2
=

3/2
4 / 32

= 12 : 1
CLASS-XII_STREAM-SB+2_PAGE # 182

44.

ClF3 sp3d hybridisation,


but due to presence of two lp on central atom Cl, according to VSEPR theory shape is T

45.

HCO3
+ H+ H2CO3
Bronsted base
HCO3 H+ + CO32
Bronsted acid

47.

Isoelectronic means same no. of electrons


CO has 6 + 8 = 14 electrons
CN has 6 + 7 + 1 = 14 electrons

48.

CO2, due to sp hybridisation bond angle = 180

49.

Diethyl ether, because it is inert towards the Grignard reagent

50.

CH3 CH2 CH2 CHO + CH3 CH2 CH2 MgBr

H
+

CH3 CH2 CH2 C CH2 CH2 CH3

H3O

CH3 CH2 CH2 C CH2 CH2 CH3

OMgBr
51.

[Ni (PPh3)2 Cl2]


[NiCl4]2

52.

OH
Achiral Secondary alcohol

dsp2 hybridisation, because PPh3 is strong ligand hence pairing of electrons


takes place
sp3 hybridisation, because Cl is weak ligand hence pairing of electrons is not
takes place

16H++ 2MnO4 + 5COO


COO

53.

Suppose equilibrium constant for the following reaction is K1


N2 + 3H2

2NH3

; K1 =

[NH3 ]2

-------- (i)

[N2 ][H2 ]3

and equilibrium constant for the following reaction is K2


[NH3 ]
1
3
N2 + H2
NH3 ; K2 = [N ]1/ 2 [H ]3 / 2
2
2
2
2
square the both side of equation (ii)

K22 =

[NH3 ]2
[N2 ][H2 ]3

K22 = k1
K2 =

-------- (ii)

[by equation (i)

k1

K2 = 41
K2 = 6.4

[ K1 = 41]

CLASS-XII_STREAM-SB+2_PAGE # 183

54.

Suppose reaction is 2A Product


according to rate law
Rate R = k [A]2

[ A ]12
R1
or R =
[ A ]22
2
R1
[A]12
according to question R =
2
2
[A]1

[ A ]1

[ A]2

R1
R =4
2
R2 =

55.

R1
4

HCO3 H+ + CO32
Conjugate base
NH3 H+ + NH2
Conjugate base

56.

57.

(II) & (IV)


Because both have close system of conjugated double bond and follow Huckels (4n+2) e rule.

N
H
p of N takes part in resonance with conjugated double bonds, so it is not easily available on N for the
protonation.

p is not taken part in resonance so easily available for the protonation.

N
H
due to high E.N. of O availability of p on N decreases.

N
H
No extra effect, so availability of p on N increases.

CLASS-XII_STREAM-SB+2_PAGE # 184

58.

Gauche conformer.
because angle between same groups is 60

59.

Suppose initial quantity = No


after 75% completion of the reaction
remaining quantity N = No

T=

No
2.303

log
N
K

T=

No
2.303
log N / 4
K
o

T=

1.386
-------- (i)
K

T1/2 =

K=

25
N
= o
100
4

0.693
K

0.693
-------- (ii)
30

so by equation (i) and (ii)


T=

1.386
0.693 / 30

T = 60 min.

60.

Concentration of H+ ions in H2SO4 solution = 2 0.1 = 0.2 M


So no. of moles of H+ ions in 10 ml H2SO4
solution =

0.2 10
= 0.002
1000

concentration of OH ions in 0.1 KOH solution


= 1 0.1
= 0.1 M
So no. of moles of OH ions in 10 ml KOH

solution =

0.1 10
1000

= 0.001
after mixing remaining moles of H+ ions

= 0.002 0.001
= 0.001

so concentration of H ions in mixture of


solutions =

0.001
1000 = 0.05 M
10 10

CLASS-XII_STREAM-SB+2_PAGE # 185

PART-II (2 Mark)
MATHEMATICS
81.

p(x) = a0 + a1x + ........+ anxn


p(0) = 7
a0 = 7
p(1) = a0 + a1 + a2 + ............+ an = 9
p( 1) = a0 a1 + a2 ........... = 1
p(2) = a0 + 2a1 + 4a2 + .......... = 13
p( 2) = a0 2a1 + 4a2 ........... = 15
p(1) + p( 1) = 2[a0 + a2 + .........] = 10
a0 + a2 + a4 = 5 .....(1)
7 + a2 + a4 = 5
a2 + a4 = 2
.....(2)
p(2) + p( 2) = 13 15
2(a0 + 4a2 + .........) = 2
a0 + 4a2 + 16a4 = 1
4a2 + 16a4 = 8
.....(2)
p(3) = 25
a0 + 3a1 + 9a2 + ........ = 25
a0 + 3a1 + 9a2 + 27a3 + 81a4 + 243a5 = 25
From (1) and (2)

.....(3)

4a2 + 4a4 = 8
4a2 + 16a4 = 8

+
a4 = 0 and a2 = 2
Smallest possible value of n is 3.
2

82.

(a b )

abc

a 1
ab

|a b| < c
...... (1)
|b c| < a
...... (2)
|c a| < b
...... (3)
Squaring and adding
a2 + b2 + c2 < 2ab + 2bc + 2ca

[Triangle inequalities]

a2
2
ab
So, b [1,2).
83.

y = | x 3 | 4 5
When, x < 1
y=|3x4|5
y=x15
y=x6
When 1 x < 3
y=|3x4|5
= | x 1| 5
=x+15
=x4
When, 3 x < 7
y = |x 7| 5
y=7x5
y=2x

12
6

6
x

2
x

12

CLASS-XII_STREAM-SB+2_PAGE # 186

When, x 7
y = | x 7| 5
=x75
= x 12.
Area bounded region
1

( x 6 )dx

( x 4 )dx

12

( 2 x )dx +

( x 12)dx
7

12

x2

x2

x2

x2
2
x

6
x

4
x

12 x

=
+
+
+
2
2
6
2
1

2
7
3

49
9
1

36
9

144

49

6
36 + 12 4 + 14
144
84
6 +
=
2
2
2

2
2

11
15
9
21 3
119
18

72 +
2
2
2
2
2
2

130
48

90
2
2

= 65 24 90
= 49 sq. unit.

A
84.

cos =

b
a2 b2 a2
=
2
a
2ab

cos(180 ) =

cos =

cos =

....(i)

b2 b2 a2
2b 2

2b 2 a 2
2b 2

a 2 2b 2

....(ii)

2b 2

From (i) & (ii)


a 2 2b 2
2b

b
2a

a
a
2 1=0
b
b

CLASS-XII_STREAM-SB+2_PAGE # 187

a
=x
b

Let

x3 2x 1 = 0
(x + 1)(x2 x 1) = 0
x = 1 or x =

1 1 4( 1)(1)
2

1 5
2
x cannot be negative

x=

85.

1
( 5 1)
2

an =

1 a n1
2

a1 =

1 a0
2

a1 =

1 cos
2

2 cos 2
a1 =

a1 = cos

1 a1
2

a2 =

1 cos

2 cos 2
=

2
= cos

22

an = cos

2n

lim 4n(1 a )
n

lim 4n 1 cos
2n

CLASS-XII_STREAM-SB+2_PAGE # 188

lim 4n 2sin2

2 n 1

2 2n 2 sin2

lim

2n 1

n 1

n 1

2n 1

sin2

n 1

n 1

2
lim

2n 1 2n 1

2
.
2

=
86.

f(x) = (sin x)sinx


f(x) = e sin x log sin x
Minimum value of sinxlog(sinx) is 0.
Maximum value of (sin x)sinx is e0 = 1.
Maximum value of sinxlog(sinx) is
Minimum value of (sin x)sinx is
10

87.

1
.
e

1
e

e .

x dx
1

10

log x

= log10 = 2.303

1
1
+ ....+
9
2
= 1 + 0.5 + 0.33 + 0.25 + 0.20 + 0.16 + 0.14 + 0.12 + 0.11 2.81

B=1+

1
1
1
+ ....+
+
2.81 1 + 0.1 =1.91
9
10
2
So, C < A < B and B A 0.51, A C = 2.303 1.91 0.40. So, B A > A C.

C=

88.

60

60

As we want the distance between two point is at least r. Now when the point A, B are at distance r.Then
the angle made arc BA is 60.
Now as chord AB come closer to centre the length of chord AB is increased that is it is greater than r and
the angle is also increases i.e. from 60 to 180 and now when chord AB move way from centre then the
length of chord AB decreases , when chord AB reach CD the length of AB equal to r and the angle chang
from 180 to 60
CLASS-XII_STREAM-SB+2_PAGE # 189

So, the angle required for desired conditions = 2(180 60) = 240
Total angle for all around the circle = 360
So, required propability =
89.

240
2
=
360
3

Let aN be pth digit no.

4(5P 1)
4(5P 1)
<N
5 1
5 1
P1
P
5 1 < N 5 1

2 10P1 < aN

So

8
(10P1)
9

log aN
10 P 1(ln10 ) (5P 1)
ln(2 10P1 )

=
=
10 P 1 5P ln 5
ln(5P 1)
logN min
=

ln10
= log10
5
ln 5

8 P
10 ln 10 (5P 1 1)
8
ln (10P 1)
9
log aN
9

=
= 8
(10 P 1) 5P 1 ln 5
log N max
ln(5P 1 1)
9
= log10
5
By sandwitch therom limit is log10
5 .

90.

| i j |

S=

1 i j n

(n 1)n
2

= |11| + |1 2| + -------- |1n| =


|2 2| + -------- |2 n| =

n 2)(n 1)
.......
2

S=

(n r )(n r 1)
2
r 1

= n 1C3

PHYSICS
91.

Mass of sphere of radius r

m=

Xcm =

Mr


4 R3

R3

M 0 m(R r )
Mm

Mr 3
Xcm = 3 (R r )
R

4 3

r M

m
4 / 3R3

M R M

R3

CLASS-XII_STREAM-SB+2_PAGE # 190

r 3 (R r )
r 3 (R r )

=
R3 r 3 (R r )(R 2 rR r 2 )

R3
3

92.

Xcm =

r3
2

R rR r 2

For plano convex lens

1
1
( 1)
FL
R

FL =

R
1

Refraction through lens

1 1 1

V
R
u
This v must be centre of mirror

1
1
1

R R u

r 1

u =

93.

In cyclic process u = 0
u =W = Area of loop
= (P1 P2) (V2 V1)

94.

On comparing both the figures

(R x )(6R)
(R x ) 6R
x2 + xR 6R2 = 0
x=

95.

x=

x R 2 ( 4 6R2 )
2

x=

R 5R
2R
2

Torque about point A

2
2
MR 2 MR mg sin R
5

O
A

5g sin
=
7R
Applying Newtons law,
Ma = Mgsin Mgcos
gcos gsin
= tan1

5g sin
7

gcos

2g sin
7

7
2

Velocity of sound =

RT
M

T Velocity of sound

CLASS-XII_STREAM-SB+2_PAGE # 191

96.

F
H

mg

a/2

For height greater than H


Balancing torque about point A

a
2
For height less than H
F = gh
From (1) and (2)
F H = mg

.........(1)
.........(2)

a
2H

97.

mV /r
mg

MV 2
mv 2
cos mg sin mg cos
sin
r
r

V 2
V2
g

sin
r = cos
r

V 2 rg
tan =
V 2 rg
98.

S1

S2
Path difference = 5 4 = 1 m
For constructive interference
n1= 1m
For destructive interference
For n = 1, 1= 1m, 2= 2m

(2n 1) 2
1m
2
99.

(B*) Block on track to reaches the finish line first

CLASS-XII_STREAM-SB+2_PAGE # 192

100.

(1st law of thermodynamics )

Q = u + PV
mv = u + 1.01 105 (

1
1
3)
1/ 1.8 10

u 20.8 105 J kg1

CHEMISTRY
101.

Millimoles of NH4OH in 10 ml of 0.1 M NH4OH solution = 0.1 10 = 1


millimoles of NH4Cl in 10 ml of 1M NH4Cl solution = 1 10 = 10
[Salt]
pOH = pKb + log
[Base]
6 = pKb + log

10 / 10 10
1/ 10 10

[ pOH = 14 pH = 14 8 = 6]

6 = pKb + log10
pKb = 6 1
pKb = 5

102.

2C4H10 + 13O2 8CO2 + 10H2O

H = 2658 kJ/mol

Butane present in cylinder = 11.6 kg


= 11600 g
=

11600
mol
58

Combustion of 1 mol of C4H10 gives = 2658 kJ energy


Combustion of 11600/58 mol of C4H10 gives =

2658 11600
kJ
58

= 531600 kJ energy
energy consumes in 1 day = 15000 kJ
so 531600 kJ energy will be consumed in =

103.

531600
35 days
15000

W = d V = 0.879 50 = 43.95 , Kf = 5.12 Kg kg mol1


= 5120K g mol1
Tf =

Kf wo
mW

5.51 5.03 =

5120 0 .643
m 43 .95

m =

3292.16
21.096

m = 156 g mol1

CLASS-XII_STREAM-SB+2_PAGE # 193

104.

Zn + 2Ag+ Zn2+ + 2Ag


(0.04M)

(0.28M)

[ Zn2 ][ Ag]2
0.059
log
[ Ag ]2 [ Zn]
n

Ecell

= E

Ecell

= 2.57

0.28 1
0.059
log
(0.04)2 1
2

{ [Ag] = [Zn] = 1}

by solving the equation we get


2.50 V
Ecell

105.

2+

Co + Con. HCl

CoCl4

HOH(excess)
[Co(H2O)6]2+
Pink

106.

ln k =

11067
+ 31.33
T

2.303 log k =

11067
+ 31.33
T

suppose k1 and T1 are rate constant and temperature in case-I


and k2 and T2 are rate constant and temperature in case-II
So,

2.303 log k1 =

11067
+ 31.33 --------- (1)
T1

2.303 log k2 =

11067
+ 31.33 --------- (2)
T2

by subracting equation (2) from equation (1)

k1
2.303 log k = 11067
2

1
1

T
T
2
1

k1
2.303 log 2k = 11067
1

2.303 (0.3010) =

1
1

298
T
2

[ k2 = 2k1]

11067 11067

298
T2

by solving the above equation we get


T2 303.7 K
T2 31C

CLASS-XII_STREAM-SB+2_PAGE # 194

107.

K1 =

[CuCl3Br 2 ][Cl ]
[CuCl4

][Br ]

------- (i)

K2 =

[CuCl2Br2 ][Cl ]
[CuCl3Br 2 ][Br ]

------- (ii)

K3 =

K4 =

[CuClBr3 ][Cl ]
2

[CuCl2Br2 ][Br ]
[CuBr4

------- (iii)

][Cl ]

[CuClBr3 ][Br ]

------- (iv)

equilibrium constant for given equation


2

K=

[CuClBr3 ][Cl ]3
[CuCl4

][Br ]3

------- (v)

by multiplying the right hand side of equation (i), (ii) and (iii) we get right hand side of equation (v)
it means K = K1K2K3

OH
108.

OH

ONa
NaOH

Br2 in CS2
HBr

H2O

Br
(X)

Br
NaI MeI
OMe

Br
(Y)

109.

234
206
90 Th
82 Pb

x 24He y 01e
By comparing mass no.
234 = 206 + 4x + oy
x=7
By comparing nuclear charge
90 = 82 + 2x 1y
y = 82 + 2 7 90
y=6
O
II
O

110.

Me

OH

AlCl3

fries
rearrangement

OH

O
II
Me

I2/NaOH

O
II
OH

Haloform
reaction

CLASS-XII_STREAM-SB+2_PAGE # 195

HINTS & SOLUTIONS (YEAR-2010)


ANSWER KEY
Ques. 1
Ans.
C
Ques. 16
D
Ans.
Ques. 31
Ans.
D
Ques. 46
Ans.
B
Ques. 61
Ans.
A
Ques. 76
Ans.
D
Ques. 91
D
Ans.
Ques. 106
C
Ans.

10
B
25
D
40

11
B
26
A
41

12
C
27

13
A
28

14
C
29

15
D
30

B
17
D
32

D
18
D
33

B
19
C
34

C
20
A
35

B
21
A
36

B
22
A
37

A
23
B
38

C
24
C
39

D
42

A
43

B
44

D
45

B
47

C
48

B
49

B
50

A
51

A
52

D
53

A
54

C
55

B
56

C
57

D
58

A
59

B
60

D
62

A
63

A
64

A
65

C
66

B
67

C
68

D
69

B
70

A
71

B
72

A
73

C
74

A
75

A
77

C
78

A
79

C
80

C
81

A
82

A
83

C
84

D
85

A
86

A
87

C
88

B
89

B
90

C
92
A
107
B

A
93
B
108
A

A
94
B
109
B

D
95
A
110
D

C
96
A
111
B

B
97
B
112
C

B
98
D
113
D

C
99
B
114
B

B
100
C
115
B

C
101

A
102
A
117
A

B
103
A
118
C

D
104
D
119
A

C
105
D
120
A

116
D

PART-I (1 Mark)
MATHEMATICS

1.

1 0
I=

0 1
0 i
A=

i 0
1 0
A2 =

0 1
0 i
A3 =

i 0

A4 =

A4n =

+ A + A2 + A3 = 0
= + A + A2 + A3 + ............+ A2010
= ( + A + A2 + A3) + A4 (+ A + A2 + A3) ..... + A2008 (+ A + A2)
0 i
0 i
=0+
=
.
i 0
i 0

CLASS-XII_STREAM-SB+2_PAGE # 196

2.

Let a, ar, ar2 are sides.


Case 1 :

r>1
a + ar > ar2

r2 r 1 < 0

1 5

r 2 ,

Case 2 :
Case 3 :

r = 1 equilateral triangle
r<1
2
ar + ar > a

r2 + r 1 > 0

1 5 1 5

,
r

2
2

1 5 2 5

r lies in the interval 2 , 2 .

3.

Number of diagonals passing through centre = 6

Number of rectangles = 6C2 = 15

4.

22, 3 + 4, 3 + 42, 5 2
1

3 i , 1 + 2 3 i , 1 2 3 i, 6

where =

1 3 i 2 1 3 i
, =
2
2

1 + 2 3 i , 1 2 3 i are conjugate of each other..

5.

Least possible degree = 5

Tangent at (2, 1)
y.2 = 2 (x + 1)

y=x+1

xy+1 =0
equation to circle
(x 1)2 + (y 2)2 + (x y + 1) = 0
putting x = 1
4 + (y 1)2 + ( y) = 0

y2 4y y + 8 = 0
D=0
(+ 4)2 = 32
y=

( 4) D
4

y=

4 2 0
=2 2
2

CLASS-XII_STREAM-SB+2_PAGE # 197

6.

BKN = 6
BN 1
BKN 1 AN 2

AB 3
APB 9 BN 1

9
6
1

APB =

ABC = 108.

7.

x2
a2

h=

a2

y2

=1, a>b>0

b2

x
y
, k=
3
3

(3h)2

8.

54
1

(3k )2
b2

= 1 which is ellipse

7
6
cos
1sin

LH.S is less than or equal 1


while R.H.S is greater or equal to 1
possible when

9.

cos = 1

= 0, 2

and sin = 0

(1 + tan 1) (1+ tan 2) .........(1+ tan 45)


(1 + tan A) (1 + tan B) = 2

if A + B = 45

Ans = 223

10.

f is differentiable function .
f (a) f(b) > 0

f is increasing at x = a and b

or

f is decreasing at x = a and b

minimum number of roots of f (a) = 0 in (a, b) is 2,

CLASS-XII_STREAM-SB+2_PAGE # 198

11.

When x is less than 49 then f(x) has negative value.


Which is not possible.
when x > 49
then f(x) = 49 (x 41)48 + 41 (x 49)40
+ 2009 (x 2009)2008
so sing of f(x) does not change
f(x) > 0
non real except one positive root.

12.

f (x) is given smooth curve hence differentiable i- given domain


By first derivative test
x = a, c is point of local maxima
x = b is point of local minima
3

13.

f ( x )dx 4
i

shaded area = Trapezium Area Area under curve

5 7
(3 1)
2 2
=
4=2
2

14.

n =

(log x ) .dx
1

n = x (log x )

e
1

n(log x )n 1
.x dx
x

n = (e 0) n n1

CLASS-XII_STREAM-SB+2_PAGE # 199

n + n n1 = e
2011 + 2011 2010 = e

15.

100 + 100 99 = e

x2 + y2 100

Area bounded = 100

sin (x + y) > 0
Hence common area of region bounded = 50 as in half the region sin (x + y) > 0 and in other half
sin (x + y) < 0

16.

n(S) = 7C3 = 35

n () = 7 + 7 + 7 = 21

i
17.

P () =

21 3

35 5

2 1 1

= i (2 3) j( 4 ) k (6) =
u v =
0 3 2


(u v ).w ,

53

greatest when x2 + y2 = 1
fmax. = 17

Ans. (D)

18.

Number of ways = 4P2 4P2 10 = 1440

19.

1 + x2 + x4 + .........+ x2010
=

1 ( x 2 )1006
1 x2

1 ( x1006 ) 2
(1 x )(1 x )

(1 x1006 ) (1 x1006 )
(1 x )
(1 x )

= (1 + x1006)

(1 x 503 ) (1 x 503 )
(1 x )
(1 x )

= (1 + x1006) (1 + x + x2 + ...............+ x502) (1 x + x2 x3 + ............ + x502)

n 1 = 502

n = 503

CLASS-XII_STREAM-SB+2_PAGE # 200

20.

an = 3an1 + 1
= 3(3an2 + 1) + 1
= 32 an2 + 3 + 1
= 32 (3an3 + 1) + 3 + 1
= 33 an3 + 32 + 3 + 1
aN = 3n a0 + 3N1 + 3N2 + .... 1
Method - I
a2010 = (1 + 3 + 32 + 33 + 34) + ....... + 32009
= (1 + 3 + 32 + 33 + 34)+ 35 (1 + 3 + 32 + 33 + 34)+ 310 (1 + 3 + 32 + 34 + 35) +.....+32005 (1+ 3 + 32 + 33 + 34)
each (1 + 3 + 32 + 33 + 34) is divisble by
Method-II
a2010 =

32010 1 35402 1 (243)402 1 (242 1)402 1

2
2
2
2

= 11 k (k I)
Hence remainder is 0

PHYSICS

21.

F 1mg 2(m + M)g = M.

1mg
m

F = 1mg + 2(M + m)g + 1Mg


= 1g(M + m) + 2g(m + M)
= (1g + 2g) (M + m)

22.

m1m2 1
T = 2 m m k
2
1
we can use concept of reduced mass.

23.

2T cos = ma ;

If

x<<<<

4T
m

2T
m

x
2

=a

x2
4

2T x
=a
m

2

a=

T = 2

m
.
4T

4Tx
m

f=

1 4T
2 m
CLASS-XII_STREAM-SB+2_PAGE # 201

24.

AU = mean distance between Sun and Earth


and

Time period = 125 year


T 2 r3
(1 yr)2 (1AU)3
ra 0.4
(125)2

ra 0.4
25 =

ra = 50 0.4
= 49.6.
25.

26.

Zero

KQr

E r inside

R3
KQ
r

1
r2

outside.

27.

There is no net effect of outside charge.

29.

tanC =

r
h

from snell's law


sinC =

r=
30.

2 > 3
1sin i1 = 2 sin r
1 < 2

from diagram

1 3

2 2

For condition of TIR


2 > 3 and 1 > 3
So, 2 > 1 > 3 .
31.

A =

A0
2

t/T

A=

120000
2

120 100 10
= 7500
2 2 2 2

(D).

CLASS-XII_STREAM-SB+2_PAGE # 202

32.

2 A = g

g
A

f=

=
33.

1
2

1
2

g
A
10
2.5 10 2

= 3.18

dQ = 0
dU = dw

nRT
n 2a
n 2a
CdT 2 dV =
2 dV

V
V nb V

nRT
.dV
V nb

CdT =

C
nR

dT

dV

C
nT = n(V nb) + C
nR

T V nb

n (V nb)

C
nT = K
nR

[n(V nb) + n TC/nR] = K


ln(V nb) TC/nR = K
(V nb) TC/nR = constant

Answer is (C) option.

35.

v0 = 39.6 kmph = 39.6

5
= 2.2 5 = 11 m/s
18

t1 =

d
330

t2 =

d 11 30
d
11 30
=

330
330
330

t = t1 t2 = 1
time interval = 30 1 = 29 second

CLASS-XII_STREAM-SB+2_PAGE # 203

36.

RT
M

v=

v0

vH

37.

MH

M0

2
1

32 4

d = 0.1 mm
D = 1m
= 600 nm
given IR = 75% of maximum = 75% of 4 = 30
R = 3 = + + 2 cos
=

y=

1 600 10 9
D
=
6d
6 0.1 10 3

x =

dy
=

=
2
3
6
D

y = 1 mm

38.

m1v 0 0
vcom = m m
1
2

xi =

m1(0) m 2 ()
m1 m 2

xcm = xi + vcom t

m1v 0 t
m2 ()
xcm = m m m m
1
2
1
2

39.

According to given information


tan =

a
r

mv

r = a cot

qBr
qBa cot
mv 2
= qvB v =
v =
m
m
r

CLASS-XII_STREAM-SB+2_PAGE # 204

CHEMISTRY
41.

[Co(dien)Cl3]
dien = NH2 CH2 CH2 NH CH2 CH2 NH2
[Co(dien)Cl3] have two geometrical isomers cis and trans.
cis form is optically active but trans form is optically inactive.

42.

The ligands which allow back bonding to sufficient extent are called acid acceptors.
Example CO, CN, NO etc.

43.

O22 : Total electron = 18 ; Bond order = 1.


Peroxide (O22) : (1s)2 (*1s)2 (2s)2 (*2s)2 (2pz)2 (2p2x = 2p2y ) (*2px2 = *2p2y)
NB N A
10 8
Bond order =
= 1.
=
2

hc
6.62 10 34 3 108
=
= 1.988 1025 J.

44.

E=

45.

t1/2 (half-life) is independent of initial concentration so reaction is first order.

..

F F
87.5

Cl

ClF3

..

46.

87.5

F nearly 'T' shaped.

F F

47.

R C Cl
||
O

AlCl3

Friedal craft acylation

CLASS-XII_STREAM-SB+2_PAGE # 205

48.

>

>

>

>

>

Order of stability of conjugate bases

>

49.

anti conformation is most stable

50.

234
234
0
Th 91 Pa 1 e
90

51.

Entropy change is positive, but enthalpy does not change.

52.

On increasing temperature, change in activation energy is not significant.

53.

For FCC unit cell number of atoms per unit cell


Z = 8[corner]

1
1
+ 6 [face center] = 4.
8
2

For body center unit cell number of atoms per unit cell
Z = 8[corner]

54.

1
+ 1 [body center] 1 = 2.
8

CO2

CO +

H2 O

H2 +

1
O
2 2
1
O
2 2

K C1 = 9.1 1012

.....(i)

K C2 = 7.1 1012

.....(ii)

Target eq.
CO2 + H2

CO + H2O

KC = ?

Target eq. can be deduce by

[Eq. (i) Eq(ii)]

K C1
9.1 10 12
KC = K
=
= 1.28.
C2
7.1 10 12

CLASS-XII_STREAM-SB+2_PAGE # 206

55.

R P
t=0

R0

t=t

(R0 x)

Rate =

d[R ]
= K[R]1
dt
x

1
dx
=
= K[R0 x] = (R x ) .dx = K.dt
dt
0
0
0
R0
= ln R x = Kt
0

[R] = (R0 x) = R0eKt

56.

PCl3F2 :

57.

(I) & (IV) are enantiomeric pair

I
58.

IV

2NO2 (g) 2NO (g) + O2 (g)


NO2 is reactant so its concentration is decrease with time while NO and O2 are product so their concentration
increases with time.
Formation of moles of NO is double than O2.
So

59.

X = NO, Y = O2 and Z = NO2.

Cyclic
Planar
Complete conjugation
(4n + 2) e
Tropylium carbocation

60.

Anti addition takes place.

CLASS-XII_STREAM-SB+2_PAGE # 207

PART-II (2 Mark)
MATHEMATICS
n

81.

1
1
1/ 2
n/ 2
x 1/ 4 = x 1 3 / 4
2x
2x

=x

n/2

1 n 1
1
n
n
n
c 0 c 1 3 / 4 c 2 3 / 4 .... c r 3 / 4 .........
2x

2x

2x

n
n

c0 ,

c1 n c 2
,
are in AP
2 22
n n(n 1)
,
are in AP
2
8

1,

n=1+

8(n 1) n (n 1) = 0

(n 1) (8 n) = 0

but

n = 1 i.e. not posible

n=8

Now

1
1/ 2
x 1/ 4
2x

n(n 1)
8

r 0

n=8

1
c r ( x1/ 2 )8 r 1/ 4
2x
r

or

n=1

r 0

1 4
cr x
2

3r
4

required number of terms = 3 (r = 0, 4, 8)

82.

Roots of 2x2 + 2x = 1 = 0 are ,

1 i
2

It will satisfies the (x + 1)n r = 0


n

1 i
1 = r

1 i
1 = r,

n
i
1 4

e
2

rR

=r

CLASS-XII_STREAM-SB+2_PAGE # 208

i
e 4

will be real only if n is multiple of 4.

For n = 4000

r =

83.

y = ax + b

4000

x2 y2

1
a
b

and

fig. 1 and 3 incorrect


Now for a > 0 and
84.

1
1000

(a < 0 b the equation of line y = ax + b)


b < 0 fig. 2 is correct

Area of cyclic quadratic and is maximum only if area of ABC and area of ADC is maximum

Area of ABC is maximum if ABC is equilateral .

AC = 2R sin 60 =

3 R.
3
3 3 2
( 3R)2 =
R
4
4

maximum Area of ABC =

maximum area of ADC =

area of ABCD =

1
(AC) (DM)
2

1 ( 3R) 3R cot 60
2

3R 2
4

3 3 2
3 2
R
R 3R 2
4
4

85.

f(x) is monotonic increasing in [a, )

f(x) > 0 x [a,)

CLASS-XII_STREAM-SB+2_PAGE # 209

f(x) is monotonic decreasing in (, b]

Now

g(x) =

g(x) =

f(x) < 0 x (, b]

f (x)
x
xf( x ) f ( x )
x2

h(x) = xf(x) f(x)

h(x) = f(x) + xf(x) f(x)

h(x) = xf < 0

h(x) is M.D.

{ x > 0 and f(x) < 0 concavity}

So, at x = a it may be M.I. followed by M.D. till x = b

or

M.D. through out a


But cant be M.I. followed by M.D.
So (B) is correct answer.

86.

Let radius of base of given cone is r and length


as h

V1 =

1 2
r h
3

........(1)

Let radius of base 1 and R1 and height H. For the cane with apex O
V2 =

Now

V=

1
R2H
3

r
h

R hH

..........(2)

H R

h
r

R
H = h 1
r

R
1

R 2 h 1
r
3

CLASS-XII_STREAM-SB+2_PAGE # 210


dv 1
2R 2
h 2R

dR 3
r = 0

R=

2r
3

For maximum volume


R

87.

2r
3

V2 =

R
1

R 2h 1
r
3

1
4r 2
2
4 2
h
1 =
h
3
9
3
81

f(x) = 1 + f(x)

.......(2)\

dy
=1+y
dx

n (1 + y) = x + c

y = ex + c 1

y = ex 1

f(x) = ex 1

V2
4

V1 27

..... (1)

Now

f(x) = x +

f (t) dt
0

ex 1 = x + et (t)0x
ex 1 = x + ex x

= 1

f(x) = ex 1

for

f(x) = 0

x=0

ex 1 = 0

88.

A=

89.

.
2
2

2
.
2
2
2

Let P is origin and p.v. of A, B, C are a, b, c respectively


Given

PA 2 PB 3 PC 0

a 2b 3c 0

...... (i)

CLASS-XII_STREAM-SB+2_PAGE # 211

Area of ABC =

|a b + b c + c a |
2


3c a
3c a
1

= | a
+
c + c a |
2
2
2

Area of APC =

90.

1 3
1

| (c a) 0 0 + (c a) + c a|
2 2
2

|c a |
2

...... (ii)

|c a |
2
ABC
3
=
APC
1

6m + 2m+n. 3m + 2n = 332 = 4 83

2m2. 3m + 2m+n2 3m + 2n2 = 83

.......(1)

83 is prime number so that this is possible only if


m=2
32 + 2n 32 + 2n2 = 83

by (1)

2n. 9 + 2n2 = 74

2n2 (36 + 1) = 74

2n2 = 21

n=3

Hence. m2 + mn + n2
= 4 + 6 + 9 = 19

PHYSICS

91.

V02 r 2 V02 r 4 V02

........upto 10 th h

g
g

g
=

V02
[1 + r2 + r4 + .............upto 10th] h
g

1 (r 2 )10
2h
h
2
1 r

1 r 20
2h
h .
2
1 r

CLASS-XII_STREAM-SB+2_PAGE # 212

92.

GMm
r

T=

mv 2

2r
V

T = 2

2r
T=

GM
r

v=

r = 2

GM

r3
GM

r3
GM

geff = g 2 Re cos2
f(g 2 Re cos260) = (g 2Re cos20)
f

fg g = 2R 1
4

g[f 1] =

2R
[f 4]
4

4GM( f 1)
2

(f 4)

= R3

T 2GM( f 1)
= R3
2 ( f 4 )

93.

3
a = 2r
2

Gm

2R
(f 4)
4

(f 1) =

T 2 GM ( f 1)

2 (f 4)

M
= 4
R 3
3

= R3

3( f 4)

Kq2

2Kq2

q2

q2

4T 2G( f 1)

cos30

= 3r
kr = 2

kq2
q2

cos30

2
3
k.r.3r2 = 4 .q2
0
2
q2 3

r =

12

k
0

94.

1/ 3

Consider the infinite ladder circuit shown below :

CLASS-XII_STREAM-SB+2_PAGE # 213

Let the equivalent impedence of circuit be Z


So,
Z = wL + Z
1
Z
C
ZX C
Z = L + Z X = L +
1
Z
C
C
On solving we get,
Z=

LC 2L2C 2 4LC
2C

For Z to be purely inductive 2L2 C 2 4LC 0 = 0

2
=

Ans.

LC

95.

1
1

V1 = R

v1
R

v1

R
1

Vf (2R V1 ) = R
1 1

Vf
R
R
2R

1

1
( 1)

=
1

R 2
R
(2R 2R R )
( 1) ( 2)
1 2

=
R ( 2 )
R 2

96.

V(x) =

G=

vf =

R( 2)
2( 1)

x
1 2
kx V0cos
a
2

dV
dx

x 1
= kx + V0 sin .
a a

Since, x <<<< a

EQ = kx +

T=

So,

sin

x
~
a

x
a

V0

V0 x
. = K 2 x
a a
a

K 20 =
a

Ka 2 V0
a2

K = m2

ma 2
2
= 2
.
ka 2 v 0

CLASS-XII_STREAM-SB+2_PAGE # 214

97.

Q = U + W

nR(T2 T1 )
1
Heat capacity in this process
nCPdt = nCvdt +

CP = Cv +
98.

nR
.
1

W = Area of ABC

1
W = + (P2 P1) (V2 V1)
2
{It is clockwise}
Heat released at CA :
It is at constant volume
So, Q = nCVdT
Q=n

P2
P1

C
A

V2

V1

3
R (TA T
TC)
2

3
(P1 V2 P2V2)
2
Heat released at A B (Constant pressure)
Q1 =

Q2 = nCPdT =

5
nR (TB T
TA)
2

5
(P V P1V2)
2 1 1
Heat absorbed at BC
Q = du + W
QBC + Q1 + Q2 = W
QBC = W + Q1 + Q2
Q2 =

1
5
3
(P2 P1)(V2V1) (P1V1 P1V2) (P1V2 P2V2)
2
2
2

1
[(P2P1)(V2V1) 5P1V1 + 5P1V2 3P1V2+ 3P2V2 ]
2

1
[P V P2V1 P1V2 + P1V1 5P1V1 + 5 P1V2 3P1V2 + 3P2V2]
2 2 2

1
[ 4P1V1 + 4P2V2 + P1V2 P2V1]
2

Q = 2 [(P2V2 P1V1) +

99.

du = 0

1
(P V P2V1]
2 1 2

Kqq
2 mv 2 0 = 0 + 0

1
q2

.
d = 4
2
0 mv

q2
=

4 0mv 2

CLASS-XII_STREAM-SB+2_PAGE # 215

100.

N0 Initial nucleon
N
at t = 0 N0

Add. at a constant rate (N C) =


N

dt =

dN
dt

dN

N C

N0

t=

1
n( N C)N
N0

1 N C
t = n N C
0

N C
et = N C
0

N C = et (N0 C)
N=

C
C (t)
C e t

(N0 C) =
+ N0et
.e

C
[1 e(t)] + N0 edt .

CHEMISTRY
101.

H2C2O4.2H2O (GMM = 126)


Molarity (M) =

2.52 1000
= 0.2M
126 100

M1V1 = M2V2
0.2 10 = M2 500
M2 = 4 103.
valence factor of H2C2O4.2H2O = 2.
Normality = [M] V.F. = 2 [4 103] = 8 103 N
Amount of oxalic acid (mg/mL) =

4 10 3 126 103 mg

= 0.504.
mL
103

Note : Options are not match with solution.

102.

Br

HBr

+ CH3OH

CLASS-XII_STREAM-SB+2_PAGE # 216

103.

104.

A B
H = 7.5 kJ/mole

G = H TS

at equilibrium G = 0

S = 25 J/mole.

0 = 7.5 103 T(25)


T=

105.

7.5 10 3
= 300 K
25

[Mg2+] = 102 M
K SP(Mg( OH )

2)

= [Mg2+] [OH]2 = 1.0 1012

= [OH]2 =

1.0 10 12

10 2
[OH] = 1 105
pOH = 5
;

106.

= 1010
pH = 9

For FCC unit cell


4r =

2a

4 141 .4
= 400 pm
a =
2

Volume of unit cell a3 = (400)3 = 6.4 107 pm3.

107.

Formula of cyclic silicate : [SinO3n]2n

; Cyclic silicates : (SiO32)n or (SiO3)n2n

CLASS-XII_STREAM-SB+2_PAGE # 217

108.

Target eq.,
Given that

Target eq. :

109.

K3[Fe(CN)6]
3+x6=0
Fe = 3d6 4s2
26
26

2B (s) + 3H2(g) B2H6(g)


H2O () H2O (g)
H10 = 44 kJ
2B + 3/2 O2 (g) B2O3(s)
H20 = 1273 kJ
B2H6(g) + 3 O2 (g) B2O3 (s) + 3 H2O (g)
H30 = 2035 kJ
H2(g) + 1/2 O2 (g) H2O ()
H40 = 286 kJ
Eq.(ii) Eq.(iii) + 3[Eq.(iv)] + 3 [Eq.(i)]
= 1273 [ 2035] + 3[286] + 3[44] = 36 KJ/mole.

.....(i)
.....(ii)
.....(iii)
.....(iv)

x=+3

Fe3+ d5 with S.L.

t2g2,2,1, eg0,0

CFSE = 2.0 0 + 2P ~ 2.0 0

Number of unpaired electron = 1.


So,

110.

n(n 2) =

3 B.M

Tf = Kf molality
8 1000
= 0.925 = 1.85

M 92
M = 173.9 ~ 174
Closest answer = 160.

*****

CLASS-XII_STREAM-SB+2_PAGE # 218

HINTS & SOLUTIONS (YEAR-2011)


ANSWER KEY
Que s.

10

11

12

13

14

15

Ans.

Que s.

16

17

18

19

20

21

22

23

24

25

26

27

28

29

30

Ans.

Que s.

31

32

33

34

35

36

37

38

39

40

41

42

43

44

45

Ans.

Que s.

46

47

48

49

50

51

52

53

54

55

56

57

58

59

60

Ans.

Que s.

61

62

63

64

65

66

67

68

69

70

71

72

73

74

75

Ans.

Que s.

76

77

78

79

80

81

82

83

84

85

86

87

88

89

90

Ans.

92
C

93
D

94
D

95
C

96
B

97
A

98
B

99
D

100
A

101
B

102
C

103
B

104
A

105
C

107
B

108
D

109
B

110
A

111
D

112
C

113
D

114
C

115
B

116
A

117
C

118
D

119
A

120
A

Que s. 91
B
Ans.
Que s. 106
C
Ans.

PART-I (1 Mark)
MATHEMATICS

1.

(C) Let loga b = x


C=x+

1
,
x

then,

logba =

For a, b > 1

1
x
logab > 1

By A.M. G.M
C= x

1
2
x

2.

(C)
Hint n is multiple of = 4

3.

(D) Given P2 = P
For n = 2
(I + P)2 = I + P2 + 2PI
= I + P + 2P
= I + 3P
= I + (22 1) P

4.

(A)
f ' (x) = 3x2 + 2ax + b
D = 4a2 4(3b)
= 4(a2 3b)
If a2 2b < 0
then
a2 3b < 0
So, D is negative, so f(x) has one real and two imaginary roots.

CLASS-XII_STREAM-SB+2_PAGE # 219

5.

1 1

1 x2
= x
2
x

2x
sin xy 1 or 1

sin xy = 1 or 1
For x = 1 or 1
sin y = 1 or sin y = 1

(A) sin (xy) =

y = 2n , n I
2

(x, y) on pair of straight line.

6.

x y 1
1
(C) 4 0 1 18
2
0 12 1

7.

|12x y(4) + 48| = 36


(3x + y 12)2 = 92 = 81

(A)

m1 m2 = 1
4t 6 6 6 2


= 1
2t 1 3 3 1
4t

(2) = 1 4t = t + 2
2t 4

t=

2
5

1 38
then C is ,
5 5
2

16
8

5

5

BC =

Area = xy =
8.

(B) h > 2a
h>3

320
25

8 5 8

5
5
8
5

2 5 = 16
here

4a = 6, 2a = 3

CLASS-XII_STREAM-SB+2_PAGE # 220

9.

(C) f(x) = cos5x + A cos 4x + Bcos3x + Ccos2x + Dcosx + E


f( x) = cos5x + Acos4x B cos3x + C cos2x D cos x + E
f (x) f( x) = 2 [A cos4x + C cos2x + E)
for x = 0
f(0) f() = 2(1 + B + D) ...... (i)
at x =

at x =

= 2 | 1 + B cos
, f f
+ D cos | ...... (ii)
5
5
5
5
5

2
6
1 B cos

D cos
5
5

2
3
2
f
=2
, f
5
5
5

f( + x) = cos5x + A cos4x B cos5x + C cos2x D cosx + E


f ( x) = f ( + x)

..... (iii)

...... (iv)

9 2 8 3 7
T = f(0) f() f 5 f 5 + f 5 f 5 f 5 f 5 +



4 6
f
f

5 5

2
8
=f

from equation iind f


5

f = f
3

3
3
7
4
6
= f
and f
= f

f
5
5
5
5

4 2 3
So T = f(0) f() 2 f 5 f 5 f 5 f 5


from equation 1, 2 & 3
T = 2(1 + B + D) 2 [1 + B cos

6
2
+ Dcos | + 2 [ 1 + B cos
+ D cos
]
5
5
5
5

Will depend on B and D only


10.

(B) 3sinA + 4cosB = 6 ...... (i)


3 cosA + 4sinB = 1 .......(ii)
Squaring and adding , we get
9 + 16 + 24 sin(A+B) = 37

1
2
1
sin( C) =
2
sin(A+B) =

sin C =

11.

(C) [x] > 1


[x] 2
x2
But x cannot integers
Possible domain = (2,3)

12.

(C) f(0) + f(0) +

(2011) +

1
2

f " (0 )
f (n 1)(0)
+
......+
2!
(n 1)!

n(2011)n 1 n(n 1)(2011)n 2


n(n 1)...2! (2011)'
,
......

n 1!
1!
2!

= nC02011 + nC12011n1 + .... + nCn1(2011) + nCn (2011)0 1


= (2011 + 1)n 1
= 2012n 1

CLASS-XII_STREAM-SB+2_PAGE # 221

13.

(B)

Point where slope of tangent is 1 of the curve y = ex is


y = ex = 1
x=0
(0,1)
and for y = lnx point is (1,0)
required minimum distance is
8

14.

(B)

f ( x ) dx =

f ( x ) dx

3 f ( x) dx

+ ...... +

7 f ( x ) dx

= 2 + 3 + 2 + 5 + 3 + 7 = 22

e cos x

15.

(B) I = 2012

0e

cos x

e cos x

dx

e cos x
cos x
e cos x
0 e
1

again I = 2012

dx

dx

2I = 2012

I = 1006

16.

(D) lim
2
n
4
n

4n r 2

1
=
2
1

r
2n 1
2n

dx

2
2
4n n
1

lim

n r 1

4n 2 4

.......... ..

= nlim
r 1

x2
4

dx
4 x2
1

1 x
= sin
2 0

CLASS-XII_STREAM-SB+2_PAGE # 222

17.

(C)
E1 : A wins when A takes out 3 & 6 and B takes out 8 & 9
1 1
1

=
3 3
9
E2 : A wins when A takes out 5 & 6 and B takes out any two no.
1
1
P (E2) = 1 =
3
3

P (E1) =

Required probability =
18.


(A) a b b c c a

ab bc 0

ab cb 0

a c b 0

a c b
a c



(bc ) = ca
a c c = c a



a c c a


a c a c 0

(1 + ) ( a c ) = 0


From (ii) a c b

abc 0

........(i)

........(ii)

= 1


abc
0
centroid of ABC =
3

19.

1
1
4
+
=
9
3
9

2
(B) r r 1 r !

r 1

Tr = [(r + 1) (r 1) (r 2)] r!
Tr = (r 1) (r + 1)! (r 2) (r!)
but
r = 1, 2, .............., n
Tr = 1 + (n + 1)! (n 1)
20.

1, x A
(C) If f (x , A B) =
0, x A
Case (i) x A, x B
then,
f(x, A) + f(x, B) f(x, A) f(x, B) = 1 + 0 0 = 1
Case (ii) x A, x B
f(x, A) + f(x, B) f(x, A) f(x, B) = 0 + 1 0 = 1
Case (iii) x A, x B
f(x, A) + f(x, B) f(x, A) f(x, B) = 0 + 0 0 = 0
Case (iv) x A and x B
f(x, A) + f(x, B) f(x, A) f(x, B) = 1 + 1 1 = 1
CLASS-XII_STREAM-SB+2_PAGE # 223

f(x, A B) = f(x, A) + f(x, B) f(x, A) f(x, B)

Aliter

1, x A B
If f (x , A) =
0, x A B
Option A is rejected because x (AB) ,then f(x,A) + f(x,B) = 1+ 1 = 2 which cant be attained by f.

Option B is rejected baecuse if x A B , then f(x,A) + f(x,B) 1 = 0 + 0 1 = 1 which cant be


attained by f .
Also option D is rejected because if x A , then f(x,A) + |f(x,A) f(x,B)| = 1 + |1 0| = 2
Which is also unattainble

PHYSICS
21.

(A)
acceleration of cabin is g relative acceleration of A and B w.r.t. cabin is zero so both A and B continue to
be exactly at rest relative to the cabin.

22.

(B) k k k = mg

23.

(A) v = A 2 r 2
from (i) and (ii)

v2
2 A 2

mg

a2
4 A 2

W = 2mg

...(i)

a = 2r

...(ii)

It is the equation of ellipse


24.

(A) Work done in this process is zero so that


(Ui = Uf)

25.

(B) Using mole conservation


2n = n1 + n2
...(i)
PV = n1RT
...(ii)
PV = n2R(2T)
...(iii)
n1 = 2n2
2n = 2n2 + n2
2n

n2 = 3

26.

(D)

M2 f 2n / 3 2

M2i
n
3

dQ
dT
KA
dt
dx

K1A( T 100 ) K 2 A

(0 T )

K1(T 100) = K2(T)


K1T K1 100 = K2T
T(K1 + K2 ) = K1 100
385 100
= 88C
435

T=
27.

(B) P1- T= constant

CLASS-XII_STREAM-SB+2_PAGE # 224


T1
P

1
T

P
2
2

233K

7/5

(7 / 5)1

0.28

233

T=

(0.28 )2 / 5

466 J

So that we will required in addition an air conditionaer to cool the air injected into the cabin

28.

(C) f1 = v u f0

v u

f2 = v f0

...(i)
...(ii)

f1 v 2

f2 v 2 u2

v2

f1 = f2 2 2
v

f2 > f1
29.

(C) = 0 (cos2)4
3
= 0
4

= 30% of 0

30.

nv

(C) f = 2

f =

n v'
2

f
v v

f ' v ' 1.04 v

f = (1.04)(450) = 468 Hz
31.

(D)
1 1

2 2

f11 = f22
f1 2
f1

2
f2 1 2f1 1
1 2

2 1
1 1

2 2

2 = 2 1 = 2.0 mm
32.

(A) V = V0 cost
CLASS-XII_STREAM-SB+2_PAGE # 225

Vrms =

V0
2

V0 = 220 2 Volt
= 50 2 rad/sec = 100 rad/sec.
v = 220 2 Cos(100t)
33.

(A) Current through R1 is maximum so power dissipates at R1 is maximum.

34.

(B) Momentum is conserved during collision so P P' . But some part of kinetic energy is stored in
excited state
So
K < K

35.

(D) Potential difference across inductor during current growth is


v = v0et/

36.

(A) Neutron is chargeless so graph is (1) Proton is positive charge so graph is (2) and for e graph is (3)

37.

(D) R 9

1

1
1 3R

R 1

2
4 4

1
1 1 5R 5R
R

3
4 9 9 4 36

1
1
1

1 2 3

38.

(A)

P'

AT 4
T
4 A
2

P
4
P'

P =

P
4

V
i

V. i


2
i
e

39.

(B) RH =

40.

(A) From given graph highest precision that means sharpness is maximum in graph (I)

CLASS-XII_STREAM-SB+2_PAGE # 226

CHEMISTRY
41.

(C)
2,2,2
2,2
Ni(CO)4 Ni : [Ar] 3d8 4s2 = t 2g e g

CO is a strong filed ligand

Cr (H2O)6+2 Cr+2 : [Ar] 3d4 45

octahedral complex : d2sp3


42.

(A)
Ag+ + 2CN [Ag(CN)2]
2[Ag(CN)2] + Zn+2 [Zn(CN)4]2 + 2Ag+

43.

(A)
Ideal mixture
H = 0
V = 0

44.

(C) = CRT

45.

(B) Energy distribution at two different temperatures

46.

(D)

1
0.01
2 = 0.001 = 10

The radical formed as intermediate

or

is unstable , where as in all other

cases resonance stabilised radicals are formed.


47.

(A)

The given compound is chiral and the possible stereoisomers are enatiomer to each other.
48.

(D)
According to second law of thermodynamics, for spontaniety

SUNIV > 0

CLASS-XII_STREAM-SB+2_PAGE # 227

49.

(B)
r1 = 30 nm

r2 = 10 nm

2
surface area
3

= 4r =
3
volume

r
4r
3

(3 / r2 )
30
(3 / r1 ) = 10 = 3
50.

(C) The reaction is example of Pinacole Pinacolone reaction with classical ring expanssion rearrangement.

51.

(B)
H3PO2 a mild reducing agent is used to remove the diazonium group with H.

52.

(A)

0NaOAc + 0HCl 0NaCl = 0AOAC


53.

(D)

BRAGGS Law
2dsin = n
d = , n = 1

= 30
2
angle of incidence = 60
sin =

54.

(C)
Zn Zn+2 + 2e
2mol
2mol 4mol
G = nFEcell = 4 96500 1.1 = 424.6 kJ/mol

55.

(B)
2NaBH4 + 2 2Na + B2H6 + H2

56.

(C)
[Mn(CN)6]4 & [(Mn/Br)4]2
Mn+2 in both
Mn+2 : [Ar]3d5 4s
With CN :
With Br :
Magnetic moments :

1(1 2) BM &

5 (5 2) BM

CLASS-XII_STREAM-SB+2_PAGE # 228

57.

(A)
Half life of zero order reactions initial concentration of the reactant.

58.

(D)

59.

(C)

60.

(C)
Due to intramolecular H-bonding boiling point of (ii) is less than (iii) but greater than (i).

PART-II (2 Mark)
MATHEMATICS
81.

82.

(B)
AK = I
B = 0
|AB| = 0

|A|K = 1
|B| = 0

(C) Let 12 + 22 + .......+ (2n1)2 = x and c =

(4r 2 4r 1) = 3 (4n

1)

12 2 2 ...... (2n)2 x
< 1.01
x
2n(2n 1) ( 4n 1)
< 2.01
6x
n (2n 1) ( 4n 1)
n
3 ( 4n 2 1) < 2.01
3

( 4n 1)
< 2.01
(2n 1)

4n + 1 < (2.01) (2n 1)


4n + 1 < 4.02 n 2.01
3.01 < 0.02 n

301
<n
2
150.5 < n
83.

(C)
A - d , A, A + d
3A = a
A =

a
3

a3 a3 ab

+a=0
27
9
3

2a3
ab
a
=0
27
3

a = 0 or
b
2a2
+1=
3
27

2h2
= 1
3

27
parabola whose vertex on y axis.

2x2 = 9 (y - 3)

CLASS-XII_STREAM-SB+2_PAGE # 229

84.

(B) Let line


y = mx + 5
x2 y2

1
16
9

ellipse

c2 = a2m2 + b2
25 = 16m2 + 9
m2 = 1
m = 1

tangent condition

For positive slope m = 1


85.

(A) A ={R|cos2(sin) = cos2 (cos)}


A = {R| sin = n cos}
A = {R| sin cos = n}
A = {R| sin cos = 0}
sin cos[ 2 , 2 ]
B {R| cos (sin) sin(cos) = 0} by A
B {R| cos ( cos) sin(cos) = 0}
B {R|

1
sin(2cos) = 0}
2

2cos = p, p
cos =

p
2

p = 0 only
cos = 0
O = 2k

so AB
86.

(B) f'(x) = 3x2 + 2ax + b


f'(1) = 0 3 + 2a + b = 0
1
3 2a
f ' = 0
b = 0
3
9 3

1 2a + 3b = 0
by (i) + (ii) we get
4 + 4b = 0

b = 1
f(2) = 8 + 4a + 2b + c = 0
8 4 2 + c = 0
c = 2

f(x) = x3 x2 x 2
1

87.

.........(ii)

f ( x ) dx 2 ( x 2) dx
1

.........(i)

x3

= 2 3 2x = 14

0
3

(D) f(x) = x12 x9 + x4 x + 1


for x = 1 , f(1) = 1
x = 0 , f(0) = 1
for x > 1 f(x) = x9(x31) + x(x31) + 1 = positive
for 0 < x < 1 f(x) = x12 x4 (x5 1) + (1 x) = positive
for x < 0 f(x) = x12 + x4 x (1 + x8) + 1 = positve
f(x) is always positive

CLASS-XII_STREAM-SB+2_PAGE # 230

88.

(A) In

1
2

1 (1 x )n
xn
dx
dx +
n!
1
n!

x n1
=
n 1!

1
2

(1 x )n1

n 1 ! 1

0
2

n1

1

2
In = 2 .
n 1!

1 2

2
In = 2.

2!
n1


2 .......... .......

3!

1
= 2 e 2 1

89.

1
= 2 e 3
2

(B) |x + y| + |x y| = 4

x2 + y2 4x 6y
= (x 2)2 + (y 3)2 13
A point on square ABCD which is maximum distance from (2, 3) is C(2, 2)
So, required maximum value is 28.
Now,

90.

(C) Let AM and GM be ab and ba respectively


AM = 10a + b
GM = 10b + a

xy
= 10a + b,
xy = (10b + a)2
2
(x y)2 = (x + y)2 4xy
= 4[10b + a]2 4[10b + a]2
2
(x y) = 22 18 (a + b) (a b)
(x y)2 = 11 9 4 (a + b) (a b)
this should be a perfect square of an integer, only possible case when
a + b = 11
ab=1
a = 6, b = 5
x + y = 2 (10 6 + 5) = 130

CLASS-XII_STREAM-SB+2_PAGE # 231

PHYSICS
91.

92.

(B)
Electric field due to uniformly charged isolated sphere (In volume)
Case (a) r < R

E=

Case (b) r = R

E=

Case (c) r > R

E=

KQ
R3

KQ
R2
KQ
r2

(C) Let gravitational acceleration due to mass of planet is g and due to uniformly charge on surface of
planet electric field is E and which is constant because path of projectile is parabolic. All projetile have
same condition
I.
Range for uncharged particle
Range = L =
II.

u2 sin 2
g

...(1)

Range for a particle of mass m and charge q


L

u2 sin 2

Range = 2
qE
g

...(2)

From eq. (1) and (2)


L
u2 sin 2

qE

g 1
mg

L
L

2 1 qE
mg

qE
=2
mg

qE

mg 1
III.

93.

(D)

Range for a particle of mass m and charge 2q


u2 sin 2
u2 sin 2
L
L

Range =
2qE

2
3
2
qE
g

g1
m
mg

CLASS-XII_STREAM-SB+2_PAGE # 232

Tangential acceleration at angle is


at = g cos
From energy conservation between horizontal and position.
PEi + KEi = PEf + KEf
0 + 0 = mg sin +

1
mv2
2

v2 = 2gsin
Centripetal acceleration at angle is
ac =

v2
= 2gsin

Total acceleration at angle is


a2t ac2 g2 cos 2 ( 2g sin )2

a=
94.

= g 3 sin2 1

(D)
n = 1 mole
initial temperature = T
Initial volume = V
Final volume = 2V
Internal energy V = aV3
3
2

nCVT = aV3

n RT = aV3

PV = nRT

From ideal gas equation

3
PV = aV3
2

P=

2aV 2
3

Work done by gas during this process is


2v

W=

2v

Pdv

2a
= 3

2av 2
dv
3

2v
2

v dv
v

2v

2a v 3
14av 3 7 2av 2
7
= 3 3 9 3 . 3 . v 3 PV

v

W=
95.

7
RT
3

(C)
VA = VC = 2m3, PA = PB = 200K Pa, PC = 500 KPa
BC is isothermal process
PCVC = PBVB
VB =

PC VC 500 2
3

PB
200 = 5m

Total workdone by gas during one complete cycle.


W = W AB + W BC + W CA
= 200 103 (5 2) + 200 103 5n
= 600 103 1000 n

200
+0
500

5
= 300 kJ
2

CLASS-XII_STREAM-SB+2_PAGE # 233

96.

(B)
For total internal reflection
1.5 sinC = 1.2 sin90
1 .2 4

1 .5 5

sinC =

C = 53.1
maximum incident angle is 53.1 Ans.
97.

(A)
Let linear charge density on wire is and mass of the particle is m & charge on particle is q. From energy
conservation between and 2 distance.
Loss in potential energy = gain in kinetic energy
2kq n

1
2 1
2
= m( 2u) mu
2
2
2

2kqn2 =

1
1
m2u2 mu2
2
2

1
mu 2
2

2kqn2 =

...(i)

conservation between and 4 distance.


Loss in potential energy = gain in kinetic energy
2kq n

1
2 1
2
= mv mu
2
2
4e

4kqn2 =

1
1
mv 2 mu2
2
2

From eq (i)
mu2 =
v=
98.

1
1
mv 2 mu2
2
2
3u

(B)

As loop in pulled to right, there free downward magenetic field is decrease. So, induce emf induced as to
oppose the decrement of magnetic field.

99.

Therefore directions of the induced current in the loop is clock wise and force on left side of loop is toward
left and force on right side of loop is towards right
(D)

V1r1 V2r2
I = r r (r r )R
12
2
2
Case I

V1 = 2V

Case II
V2 = 4V
from case (I and Case II)

V2 = 0V

I = 3mA

V1 = 0

I = 4mA

CLASS-XII_STREAM-SB+2_PAGE # 234

Case III

3 r1

2 r2
V2 = 10V

V1 = 10V

................. (i)
I=?

10(r1 r2 )
I = r r (r r )R
12
1
2

................. (ii)

from (i) and (ii)


I = 25 mA
100.

(A)

x2
a2

y2

=1

b2

Different w.r.t.

2x dx 2y dy

=0
................. (i)
a 2 dt b 2 dt
ux = u,
at (o, b),
uy = 0
Different w.r.t.
2x d2 x
2

2 dx

a 2 dt

a dt
accelerat at (o, b) is

2 y d2 y
2

b dt

(from eq (i))

2 dy
=0
b 2 dt

2xo d2 x 2 2 2bay
2

u
(0) = 0
2 2
2
2
a dt a
b
b2

ay =

u2

a2

CHEMISTRY
101.

(B)
XeF6 + 3H2O XeO3 + 6HF
distorted
pyramidal
octahedral

102.

(C)
5e + MnO4

8H+ 4H2O

C2O42 2CO2 + 2e
HCl
103.

1
Cl2 + H+ + e
2

(B)
2e + Fe+2 Fe

0.44 V

Fe+3 + 3e Fe

0.77 V

+3

Fe + 3e Fe
then
104.

x=

xV

2 ( 0.44 ) 0.77
= 0.037 V
3

(A)

E13
E12

1
1
2 2
3
1
8/9
32
= 1
=
1 =
3
/
4
27
2 2
2
1
CLASS-XII_STREAM-SB+2_PAGE # 235

105.

(C)

106.

(C)
Due to intramolecular hydrogen bonding reaction is favored at ortho position.

107.

(B) The statement optically active (S) methoxy acetaldehyde is incorrect.

108.

(D)
Ptotal = PA + (P0B P0A) XB
300 = 100 + (500 100) (1 XA)

1 XA =

YA =

109.

1
2

XA =

1
2

1
1
2 =
6
300

100

(B)
Low spin d6
CFSE = 4

2
3
0 + 0 2
5
5

= 0.4 0
High Spin d6
CFSE = 6
110.

2
= 2.4 0 (ignoring pairing)
5 0

(A)
Total area of droplets = 2.4 1018 12.5 1016 = 3000 m2
Energy liberated = 3000 0.03 = 90 J

CLASS-XII_STREAM-SB+2_PAGE # 236

HINTS & SOLUTIONS (YEAR-2012)


ANSWER KEY
Ques.

10

11

12

13

14

15

Ans.

Ques.

16

17

18

19

20

21

22

23

24

25

26

27

28

29

30

Ans.

Ques.

31

32

33

34

35

36

37

38

39

40

41

42

43

44

45

Ans.

Ques.

46

47

48

49

50

51

52

53

54

55

56

57

58

59

60

Ans.

Ques.

61

62

63

64

65

66

67

68

69

70

71

72

73

74

75

Ans.

Ques.

76

77

78

79

80

81

82

83

84

85

86

87

88

89

90

Ans.

Ques.

91

92

93

94

95

96

97

98

99

100

101

102

103

104

105

Ans.

107

108

109

110

111

112

113

114

115

116

117

118

119

120

Ques. 106
Ans.

PART-I (1 Mark)
MATHEMATICS

1.

2.

Number ways are =

720
6!
=
= 90 ways
8
2!2!2!

x 3 4 x 1 = x + 8 6 x 1 + 1 2 x 8 6 x 1

2 x 1 6 = 2

x 8 6 x 1

x 1 3 =

x 8 6 x 1
(D) Infinite many solutions.

4.

Equation of chord of contact T = 0 w.r.t. origin is


3(x + 0) p (y + 0) + 17 = 0
3x + py 17 = 0
By Homoginization
2

3 x py
3 x py
+ 17
=0
x2 + y2 (6x + 2py)
17
17

CLASS-XII_STREAM-SB+2_PAGE # 237

For perpendicular coeff of x2 + coeff of y2 = 0

6.3
.9
2p2
p2
+
+1
+
=0
17
14
17
17
34 18 + 9 p2 = 0
p2 = 25
|p| = 5
1

5.

6.

2x3 + ax+ b 2x3 + cx + d


(a c)x d b
If a c = 0 & d b 0
Max. (a c)2 + (b d)
= 0 + 5 Ans.
e(x2 2 ex + e2) + (y2 2y + 2) = e

x e2 y 2
e

Ellipse a =

= 1 (a > b)

,b=

Req. PS1 + PS2 = 2


2 sin x. cos a
= cot a
2 sin x sin a
(D) = constant function

7.

f(x) =

8.

tan81 tan63 tan27 + tan9


cot9 cot27 tan27 tan9
(cot9 + tan9) (cot27 + tan 27)
2 cosec18 2 cosec54

2
5 1
2
8
4

9.

5 1

=4

2x 5 0, 2x + 5 0
0 2x + 5 6
5 2x 11
11
5
x
2
2

mid point is

5 11

.6
3
2 2 =
=
2.2
2
2

10.

(D) at least three for every value of a

11.

f(x) = 3x2 2(a1 + a2 + a3) x + a1a2 + a2a3 + a3a1 0


D0
4(a1 + a2 + a3)2 4.3.(a1a2 + a2a3 + a3a1) 0

a12 + a 22 + a 32 a1a2 a2a3 a3a1 0

CLASS-XII_STREAM-SB+2_PAGE # 238

1
[(a a2)2 + (a2 a3)2 + (a3 a1)2] 0
2 1
a1 = a2 = a3

12.

I1 =

/2

(sin

x)

(sinx)1 dx

I1 = (cos x )(sin x )

I1 =

/2

2 (sin x )
0

/2

/2

(cos

x ) (sin x )

2 1

dx

/2
2 1

dx

sin x

2 1

dx

/2

I1 =

2 (I2 I1)

Here I1 =

(sin x )

2 1

dx

2 1
1
2

( 2 1)
2
( 2 1)

= 2 2

Ans.

2012

2012

(sin x

13.

x ) dx +

2012

1. dx

2012

= 0 + 2012 ( 2012)
= 4024 Ans.

14.

[x]{x} dx
0

.1. {x} dx + 2 {x} dx + 3 {x} dx + 4. {x} dx

= 0.{x}dx +

=0+1

x . dx + 2 x . dx 3

xdx 4 .

xdx
0

= (1 + 2 + 3 + 4)

x . dx
0

x2
= 10 . 2
0
1

= 10 . 0
2

=5

CLASS-XII_STREAM-SB+2_PAGE # 239

15.

Sn

K =
k 1

nn 1
is even (n : 1, 2, ............. 49)
2

n = multi fo a
9, 8, .......... 96
Or (+) n is (multi of 4) 1
3, 7 ............... 99
Total favourable cases 24 + 25 = 49
P[E] =

16.

49
Ans.
99

req. prob =

1 4 6

2 7 10

1 40 42 41

Ans.
2
70
70

17.

HA + HB + HC = 2HO

18.

6m + 9n
Unit digit of 6m is = 6
Unit digit of 9n will be = 9 or 1
For multiple of 5 unit digit of 9n must be = 9
It occur when n = odd
Total number of ordered pair = 50 25 = 1250

19.

a2 =

a1 a 3
2

a3 =

a2 a4
2

a1 =

a 2 a 2012
2

a 2011 a1
2
Now a2 + a4 + ......... + a2012 = 3018 .................... (1)
2a2 + 2a4 + .................... + 2a2012 = 6036
a1 + a3 + a3 + a5 + .............. + a2011 + a1 = 6036
2(a1 + a3 + ................. + a2011) = 6036
a1 + a3 + ................ + a2011 = 3018 ..................... (2)
By adding (1) and (2) we get
a1 + a2 + a3 + ............ + a2012 = 6036
a2012 =

20.

Number of element in B = n
So number of subsets of B = 2n

CLASS-XII_STREAM-SB+2_PAGE # 240

PHYSICS

21.

Since area of PV graph under isothermal curve is greater than area under adiabatic curve
So,
wi > wa > 0
22.

Q = Q0et/RC

Q0

= Q0et/RC

2
1

= et/RC

t
RC

t
n 2
RC

t = RC

n2
2

23.

/ R

ML3L3
= T
2
MT
1

R 3

1/ 2

= T1 T

=1

/ R 3

R 3
K2

K2 =

R 3 2
T

R 2
RT 2

K=

R 2
g

CLASS-XII_STREAM-SB+2_PAGE # 241

24.

mr 2

mr 2

mr 2 mr 2
2
2

m
(
2
r
)

m
(
r
2
3
)

m( 4r )2

P = 2
2

111 2
mr .
2

25.

Angular momentum conservation about S


vp (a ae) = vA(a + ae)
vp
vA

vp
vA

26.

a ae
a ae

1 e
1 e

max = ( 0 0 )2
= 40
min = ( 0 0 ) 2 0
avg = 0 + 0 = 20

27.

0
i
B0 = 4 R cos
n
B0 =
28.

sin n sin n

0 i

tan
2 R
n

Due to the negative work on rod K.E. will decrease and finally become zero.

CLASS-XII_STREAM-SB+2_PAGE # 242

29.

R=

R=

L
r 2

2R = K2rL
2 L
r

dT
dt

= K2rL

dT
dt

2 L
dT
=
dt
K 2 2 r 3

30.

RT
m
=
8RT
m

7
= 0.73
58

So, closest ans is 1.


31.

U = mc2

KQ 2
mc 2
2R
9 10 9 (1.6 10 19 )2
= 9.1 1031 (3 108)2
2R

R=

9 10 9 (1.6 10 19 )2
2 9.1 10 31 (3 108 )2

= 1.4 1015
32.

Probability of being found is maximum where speed is minimum.


So,
x = a

33.

Since heat capacity at high temperature is high. So for same amount of heat transfer T is more at lower
temperature then at higher temperature.
So, final temperature is more than 50C .

34.

As F = x3 x4
At x = 0, F = 0
Hence particle is in equilibrium.

35.

It is clear that
dimension x = ML2T2
= ML2T2
and
x=L
So,

= MLT2

will be dimensionless.

CLASS-XII_STREAM-SB+2_PAGE # 243

36.

2gh

From conservation of momentum


m 2gh 0 = mv1 + 2mv2
2gh = v1 + 2v2

...........(i)

From equation of e

v 2 v1

2gh 0

2gh = v2 v1

..........(ii)

From (i) & (ii)


2gh

v1 =

3
Hence after collision maximum height

hmax =

( 2gh / 3 )2
2g

h
hmax = g
37.

Let ball is moving with speed


v at anytime t hence
dv
= mg Kv2
dt
On the basis of equation we can rays that speed first increase and become constant when mg = kv2
Hence, Ans.
(A)

Hence, m

38.

Resistance of steel =

0 .1
1
=
50 A
500 A

Resistance of copper =

0 .2
1
=
400 A
200 A

Both are connected in series hence heat current in both will be same. So

100 T
1

500 A
39.

T0
= 1

2000 A

T = 20C

From
N11 = N22
4 1020 =

n(2)
n( 2)
= N2
40000
20

N2 = 2 107

CLASS-XII_STREAM-SB+2_PAGE # 244

40.

3
0
cos 2 30 0
2 4
2

Final intensity will be =

3 0
8

CHEMISTRY
41.

According to MOT bond order of O2, F2, O2+ and F2 is respectively 2, 1, 2.5 and 0.5.

42.

BCl3, BeCl2 and CCl4 has zero dipole moment due to symmetric structure where as shape of NCl3 is
pyramidal due to presence of lone pair.

43.

The value of n > and m should have values from to + .

44.

Option D Closest, if () is change to

46.

KE = | T.E. |

(KE) = (T.E.)
3
8.3 (T) = 1.6 1019 6 1023
2

(T) =

2
9.6 10 4

3
8 .3

(T) = 7.6 103 K i.e. close to 104 K.

47.

48.

t1/2 (a)1 n
10

( t1/ 2 )I
a1

( t1/ 2 )II = a2
0 .2
A0
( t1/ 2 )II = 2 A 0

(t1/2)II = 0.4 s
49.

25

Mn2+ and 26Fe3+ both has 23 electrons.

CLASS-XII_STREAM-SB+2_PAGE # 245

50.

51.

52.

In metal carbonyls oxidation state of metal is equal to zero.

53.

At pH = pKa the concenteration of acid and its conjugate base are equal.

54.

It is high spin complex as Cl is weak field effect ligand. In [CoCl4]2 oxidation state of Co is +2 in which
3 unpaired electrons are present which gives the spin-only magnetic moment equal to 3.83 BM.

55.

K = Ae Ea / RT
ln K =

Ea
+ ln A
RT

56.

57.

Greater is the bond order shorter will be bond length. In CO32 bond order in between 1 and 2, bond order
of CO2 is 2 where as bond order for CO is in between 2 and 3.

58.

2P(g) + 3Cl2(g)

2PCl3(g)

PCl3(g) + Cl2(g)

........(i)
PCl5(g)

........(ii)

2P(g) + 5Cl2(g)
2PCl5(g)
........(iii)
On multipling equation (ii) by 2 and adding in (i) we obtain equation (iii)
Therefore, K3 = K1K22
59.

The reagent given the question has an addition C within bracket.


(CH3)2CHCH2Cl + AlCl3 (CH3)2CHCH2Cl - - - - AlCl3 (CH3)2CHCH2+ + AlCl4
,2H shiffting (CH ) C+
(CH3)2CHCH2+ 1
3 3

60.

As boron is trivalent impurity it will proudce p-type semiconductor.

CLASS-XII_STREAM-SB+2_PAGE # 246

PART-II (2 Mark)
MATHEMATICS
81.

D1 = 4a2 4b2 > 0 4 (a2 b2) > 0


a2 b2 > 0 .......... (1)
2
2
2
D2 = 4b 4c > 0 b c2 > 0 ............. (2)
now D = 4c2 4a2 = 4(c2 b2 + b2 a2)
= 4 (b2 c2 + a2 b2)
= 4 (D1 + D2)
= Negative
Equation have no real root.

82.

(1+x) (1+x2)1 (1-x)1

(1+x)

r 0

x 2r ( 1)r x r =
r 0

x 2r ( 1)r

r 0

r 0

x r + x 2r ( 1)r
r 0

(x

r 1

r 0

for Coffi. of x2012 = (-1)0 + (-1)1 + (-1)2 + ....... (-1)1006) + ((-1)0 + (-1)1+ ..... +(-1)1005)
=1+0
=1
No answer
83.

4x2 + 9y2 8x 36y + 15 = 0


4(x2 2x + 1) + 9(y2 4y + 4) 25 = 0
4(x 1)2 + 9 (y 2)2 = 25

( x 1) 2
5

2

( y 2) 2
5

3

=1

min ( x 1)2 ( y 2)2 + max. x 12 ( y 2)2

100 225
325
5 5
= + =
=
36
36
3 2

84.

sinx +

cos x = sin2 x
2
4

sinx +

1
1 cos 2 x / 2
cosx =
2
2

1
1 1
cosx = sin2x
2
2 2
2sinx + cosx = 1 + sin2x
2sinx + cosx = 1 + 2 sinx cosx
2sinx (1 cosx) 1 (1 cosx) = 0
(1 cosx) (2sinx 1) = 0
sinx +

cos x = 1 or sinx =

1
2

5
,
6 6

5
sum of roots = 0 +
+
=
6
6

x=0

x=

CLASS-XII_STREAM-SB+2_PAGE # 247

85.

P(x) = ax2 + bx + c
a 0
P(x) = 2ax + b
P(x) = 2a
P(0) = c = 1
P(0) = b = 1
P(x) = ax2 x + 1
P(1) = a 1 + 1 = a 0

87.

I=

cos 2 x

1 a

dx , (a > 0)

...(1)

I=

cos 2 ( x )

1 ax

I=

a x cos 2 x

1 ax

dx

dx

...(2)

(1) + (2)
2I =

cos 2 x(1 a x )

(1 a x )

dx

2
2I = 2 cos x dx

1 cos 2 x

I=
2

1
x cos 2 0 cos 0 0
2

I=

88.

1
1 1
2

.
2

Consider
L=

2012 +

2013 + ... +

3011

R=

2013 +

2014 + ... +

3012

3012

and I =

3 x dx .

2012

89.

P(K) = P (at least K points)


x1 + x2 + x3 + ....... x10 = K
Coeff xK in (x1 + x2)10
= x10(1 + x)10
coeff xk in (1 + x)10
= 10CK10
K 10
Now

P(K) >

1
2

CLASS-XII_STREAM-SB+2_PAGE # 248

10

C 0 10 C1 10 C 2 ...... 10 CK 10
10

1
2

2
C0 + 10C1 + ............. + 10CK10 > 29
1 + 10 + 45 + 120 + 210 + 252 + ...... > 512
10
C0 + 10C1 + 10C2 + 10C3 + 10C4 + 10C5 > 512
K 10 = 5
K = 15
10

90.

P = f(2) . f(f(3)) f(f(f(4)) f(f(f(5)


3
=
1

4 5
f f f
2 3
5
3
5
3

= (3) (3) (f(4)) f(f(5))

3
= (3)
1

5
=9
3

6
f f f f
4


f f

3
2
3
2

6
f
4

1
2

= (15) 3

1
2

= (15) (5) = 75
375 is multiple of 75.

PHYSICS
91.

H1 = AT4 5 = Ms1

A
(2T)4 5 = msq2
2
2 = 81
2 = 8C
The temperature of water would increase from 10C to a final temperature of 18C
H2 =

92.

Mechanical energy of asteroid

GMm
1
mv2 r
2
0
Rocket will remain band to the solar system its B moving energies negative.
=

GMm 1
mv 2 0
r0
2

GMm 1
mv 2
r0
2
GMm 1
m 2 v 02
r0
2
mv02 =
=

1
m2v02
2

2.

CLASS-XII_STREAM-SB+2_PAGE # 249

93.

B = 1 + 2

n2 2n2 n2 7n2

B
A
3 A
3 A
B 3
= 7.
A
94.

3eV
= 2.3 eV
Kmax = 3 2.3 = 0.7 eV
5 mm 1V
1V 5mm
0.7 V 5 0.7 mm
= 3.5 mm.

95.

V=

Kq KQ

b
c

k( q Q )
0
c
q+Q=0
q = Q
K
KQ
( Q )
V
b
c

1 1
KQ V
c b

Q=

bcV
4 0 .
(b c )

96.

4
(sinC) = 1
3

3
tanC =

17

R
Hh

sinC =

R=

3
7

3
4

(H h) .

CLASS-XII_STREAM-SB+2_PAGE # 250

97.

W.S. Bridge
RAB = R/2.
98.

From equation
2
4
=

L
= 0.6 m.
2

99.

T + k1x mg = ma
k2x + mg T = ma
T + k1x mg = k2x + mg T
2T = (k2 k1)x + 2mg
T=

(k 2 k 1 )x
mg
2

(k 1 k 2 )x
2m
If T is 0 then
a=

If T is not zero

a1 =

k 1x mg
k 1x
g
=
m
m

a2 =

k 2 x mg
k2x
g
=
m
m

CLASS-XII_STREAM-SB+2_PAGE # 251

100.

at = g sin
ac = v2/

1
mv2 mg cos
2
aC = v2/ = 2g cos
at = g sin
tan = at/ac
= g sin/2g cos
0+0=

........... (i)
........... (ii)
........... (iii)

tan
2

1 tan

= tan
2

CHEMISTRY
101.

102.

T A
350000
0.7
G C
G
G=

350000
= 5,00,000 Ans.
0.7

103.

104.

Phenol on treatment with dil HNO3 gives onitrophenol and p-nitrophenol.


onitrophenol has intra molecular Hbonding hence steam volatile ie P, where as Q is p-nitrophenol, Q
has inter molecular H-bonding.

105.

Kinetic energy = h work function


KE =

1240
1
660

KE = 0.878 eV

CLASS-XII_STREAM-SB+2_PAGE # 252

150

150
0.878

= 13.07 = 1.3 109 m


450

106.

h K

(2)2 (2)2 (1)2

450
= 150 pm
3

107.

H = 20 kJ/mol
U = H ng RT
U = 20 103 1 8.314 (273 + 60)
U = 20 2.768
U = 17.2 kJ/mol

108.

As in Ni(CO)4 hybridisation of Ni is sp3 and CO is strong field effect ligand therefore, it is diamangetic.

109.

W = nRT ln V
1

V2

W = 3R 300 ln 10
=

900 8.314
2.3 = 17.2 kJ/mol.
1000

q = W = 17.2 kJ/mol. (For isothermal process E = 0).


110.

Rate = K . [X]p [Y]q


From expt. 1 and 2, p = 2 and from expt. 1 and 3, q = 3. Therefore, over all order = 5.

CLASS-XII_STREAM-SB+2_PAGE # 253

(STREAM - SB/SX) : HINTS & SOLUTIONS (YEAR-2013)


ANSWER KEY
Ques

10

11

12

13

14

15

16

17

18

19

20

Ans

Ques

21

22

23

24

25

26

27

28

29

30

31

32

33

34

35

36

37

38

39

40

Ans

Ques

41

42

43

44

45

46

47

48

49

50

51

52

53

54

55

56

57

58

59

60

Ans

Ques

61

62

63

64

65

66

67

68

69

70

71

72

73

74

75

76

77

78

79

80

Ans

Ques

81

82

83

84

85

86

87

88

89

90

91

92

93

94

95

96

97

98

99

100

Ans

Ques

101

102

103

104

105

106

107

108

109

110

111

112

113

114

115

116

117

118

119

120

Ans

AC

PART-I : (1 Mark)
MATHEMATICS
1.

f(x) = x3 + 3x2 + 3x + 3 = 0
f(x) = 3x2 + 6x + 3 = 3(x + 1)2 0
f(x) is Increasing function
Now
f( 3) = 6 < 0
f( 2) = 1 > 0
real root lies between 3 and 2
+ + = 3;
3<<2
+3<++<+2
+3<3<+2
1<+<0

2.

log2log2log2log2log2 n < 0 < log2log2log2log2n


16 < n < 216
no. of digits in the binary expansion of 16 is 5
no. of digits in the binary expansion of 216 is 17
so no. of digits in the binary expansion of n lies in 5 to 16

3.

|a + bw + cw2|
|a c + (b c)w|
, for maximum value taking a = 1 , c = 1, b = 1
|a + bw + cw2| = |2 + 2w| = 2|w2| = 2

4.

a 9
ab = 36
4 b
using AM G.M

ab
ab a + b 12
2

CLASS-XII_STREAM-SB+2_PAGE # 254

5.

2 g2 c = a
2 f2 c = b
Polar coordinates of centre of circle be (rcos, rsin)
g = r cos

and g2 f2 =

f = r sin

a2 b2
4

r2 cos 2 =

B(1, 1)

a2 b2
4

C(19, 1)

6.

P(a, 1)

a
Q a,
9

A(0, 1)
x=a

area of PQC =

1
area of ABC
2

1
a 1 1

(9 a)1 (8 1)
2
9 2 2

(9 - a)2 = 36 a = 3

7.

Using M - N Rule
(1 + 1) cot ( - B) = 1.cot B - cot C
3cotB = cot C
tan B
=3
tan C

8.

2sin + 3cos = 3 2
3sin + 2cos = 1
....(2)
sum of squares of equation (1) and (2)
4 + 9 + 12 sin ( + ) = 19

....(1)

1
+ = 150 or 30
2
If + = 30 = 30 -
put in equation (1) and (2)
sin ( + ) =

we get 7 sin + 3 3 cos = 6 2


7 cos - 3 3 sin = 2

79 6
3
= .8 <
37
2
cos < cos 30
> 30
cos =

+ 30

CLASS-XII_STREAM-SB+2_PAGE # 255

9.

lim

x sin( e x ) f ( x )

lim

sin( e x ) x

ex

ex

f(x)

= 1 (0) M = 0

10.

{(sin t )x

A(t) =

( 2 cos t )x sin t } dx

sin t
4
cos t sin t sin t cos t
3
3

A(t) =

4 cos t
sin t
3
St. I and IV are False

A(t) =

11.

Domain of f(g(x)) is R
2 - cosx - cos2x 0
(cos x + 2)(cosx - 1) 0 - 2 cos x 1
xR
Domain of g(f(x)) is [-2, 1]
2

cos 2 x x
2 - x - x2 0
Domain of f(g(x)2) is R
2 - cos2x - cos4x 0
2
2
(cos x + 2)(cos x - 1) 0
-1 cos x 1
xR
Domain of g(f3(x) is Domain of g(f(x)
i.e., [-2, 1]

12.

Let r be an integer in ( 10, 10)


x

Now, LHL = xlim


r

[t]

dt

10

8
r h
9

2[ t ] dt 2[ t ] dt .... 2[ t ] dt
lim
= h 0

9
r 1
10

2 10 2 9 ..... 2r 1 1 h
= hlim
0

= 210 + 29 + ... + 2r1

... (1)

x
[t ]

lim

xr

dt

10

8
r h
9

2[ t ] dt 2[ t ] dt .... 2[ t ] dt
lim
= h 0

r
9
10 2

= 210 + 29 + ..... + 2r1

... (2)

f(r) =

[t]

dt

10

= 210 + 29 + ... + 2r1


From (1), (2) & (3)
f(x) is continous at all integers.

... (3)

CLASS-XII_STREAM-SB+2_PAGE # 256

13.

n 1 r 1

[r ]{r } dx r( x r ) dx

x2

r
rx
r
2
r 1

r 1 r

n 1

n 1

(r 1)2 r 2

r.1
2

r
r 1

r 1

n 1

r 1

n(n 1)
2013
4

n(n - 1) 4 2013

1
2013 16 1

n
2
4

1 n(n 1)
2

r 2 2

32209 1

2
2

least n = 91

14.

1 1

2 .
required area = 2 2
2
4
15.

/4

4 2

2
cos x dx =
8

Let x = 1
favourable out comes (1, 1), (1, 2) .......(1, n) no. of favourable out comes when x = 1
n
=
1
no. of favourable out comes when x = 1 or y = 1

n
= 2 1
1
no. of favourable out comes when x = 2 or y = 2 but x 1, y 1
n
2 1
2
Similarly
no. of favourable out comes when x = k or y = k but x, y {1, 2, ..... k 1}
n
2 1
k
n

So probability =

k 1 1.......n times
k 1

n2

2
n

k n
k 1

CLASS-XII_STREAM-SB+2_PAGE # 257

16.

0 x 2 x 3 .......x n 1 ( x1 x n )

1 2
y i 2
n

1 2
0 x 22 x 32 ....( x n 1 )2 ( x1 x n )2 2
n

2 2

2x 1x n
0
n

so

17.

In this case B, C, D are not possible.


18.

Total Integers = 999 - 99 = 900


Total Integers in which all distinct digits

9 9 8

= 648

so 900 - 648 = 252


19.

n + 1, n + 2, ...... n + 18
(A) False, if n = 19
(C) False if n = 15
16 to 33
20, 25, 30 only three multiples of 5
(D) no. of odd integers in Sn = 9
every third odd integer is multiple of 3
so maximum prime no. = 6.

20.

Sum of angles of closed polygon with 10 sides is 8. So maximum number of possible obtuse angle
is 7.

CLASS-XII_STREAM-SB+2_PAGE # 258

PHYSICS
21.

Charge on outer most surface is zero


Hence force on q is also 0

22.

5
VAB

Q=

R
3

5R
R
3

5
V
8

5
CV
8

25.

I - t graph is for L-R series circuit.

26.

V=

e
Hence from graph = 2eV

h
6
slope
e
1.6 1015
h=

27.

6 1.6 10 19
1.6 10

15

6.0 10 34

v
f1 = f 0 v v
s

v v s ~ 2v s
v vs
fR = f1 v f 0 v v 1 v f

= 0.990 f

28.

B due to Arc =

0 i
4r

0i 1 1

out of the page


8 r R

29.

In stready state i through capacitor is zero.


Hence V across 2k = V across capacitor
Vacross 2k =

30.

2
6 = 4V
21

Net = F 2 + FR + 2FR = 3.5 FR

CLASS-XII_STREAM-SB+2_PAGE # 259

tdN

31.

avg life =

tdN 2

2N0

where dN1 = N e t dt
dN2 =

t
3
3 N e dt

avg. life =

t(N e t dt

N e 3 dt
3

2N0
Intergrating we got
avg life =
32.

2 2.10

For adiabatic process


PV = C

PV1 +

dp
v =0
dv

dp
dv
Hence n = 1

P = V

34.

work done = 0
Hence kinetic energy = constant

35.

i = 2r
sin i
3
sin r

2cos r =

3
r = 30 & i = 60
Note : But for r = 30 TIR cannot take place at B.
36.

Check dimensionally

37.

Fr = m2r cos 45
where r = Rcos 45
Fr =

m2R
2

CLASS-XII_STREAM-SB+2_PAGE # 260

38.

PV
10 5 1

40
n = RT 25 300
3
N = 40 6.023 1023 ~ 24 1024
1

1 3
Average sep. = ~ 1 nm
N

39.

1
mv2 + 0 = 0 + 1
2
v2 = 4 or v = 2 m/s

CHEMISTRY
41.

Na+, Mg2+, F & O2 are isoelectronic(10 electron speceis)

42.

Ct = C0 kt ; slope = k

43.

44.

45.

P = KH.X(g)
1
X(g) = P K
H
slope

1
KH

46.
c = 0.03
nc = 0.06
n=2
KC =

0.06 2
0.03

0.06 2
0.03

= 0.12

CLASS-XII_STREAM-SB+2_PAGE # 261

47.

48.
Aceto acetic ester has active methylene group.
49.

BCl3 3H2O H3BO 3 3HCl


4H3BO 3 Na 2CO3 Na 2B 4 O 7 CO 2 6H2 O

50.

XeF2 ; no. of lp on Xe = 3
XeF4 ; no. of lp on Xe = 2

51.

S =

v2
v2
nRT v 2
ln
=
nR
ln
=
2.303
nR
log
T
v1
v1
v 1 = 2.303 2 8.314 1 = 38.3 J/k

52.

53.

54.

55.

U = 0, H = 0

CLASS-XII_STREAM-SB+2_PAGE # 262

56.

n = 2 sin , dhk =

h k 2 2

d100 =
d200 =

1 02 02
a
2

2 02 02

=a
=

a
2

sin 1
n1 d2
sin 2 = n 2 d1
sin 30
2a/2
sin 2 = 1 a

or sin 2 = sin 30 or 2 = 30

57.

Coordination number = 6
[Co(NH3)4Cl2]Cl [Co(NH3)4Cl2]+ + Cl

58.

Fe3+ = 3d5

is WFL so = 5.92

While NH3 is SFL & pairing of electrons takes place so = 1.73

59.

Carbocation stability order

So reactivity order is
(CH3)3 CCl > CH3 CH2 CH2 Cl >
60.

then formula of ionic compound is MY2

CLASS-XII_STREAM-SB+2_PAGE # 263

BIOLOGY
61.

HbF have more affinity for oxygen and this property help in extracting O2 from mother.

62.

In nucleolus RNA-PI is present.

63.

In GC Pairing 3 H bonds are present.

64.

Entry of T Cause formation of stop codon.

67.

Schizosaccharomyces pombe is called fission yeast.

68.

Grana bear photosystem and stroma have enzymes of dark reaction.

69.

2 alleles of a gene separate in neiosis and Non linked different genes segregate independently.

71.

UV rays damage DNA causing thymine dimerisation.

72.

In gastrulation cell migration occur forming 3 germ layers.

74.

Thinners prevent cardiovascular accidents which can cause stroke.

79.

Heterozygous population = 2pq = .48

PART-II
Two Mark Questions
MATHEMATICS
81.

Coefficient of highest degree term must be negative becuase if it is positive, then x , y and it is
not possible, since f(x) 100.
Now, graph will be like
y
100

1/2

at least two real roots will be there, & if x

1
, then f(x) < 100, it is not always true, as the graph can be
2

like this also


100

1/2

Now, let the highest coefficients, it can have is 49


49 49
1
f 49
2 ...
2
2
2

But the sum cannot be equal to 100.

then,

CLASS-XII_STREAM-SB+2_PAGE # 264

82.

(ak

bk 2 ck d) n 4

k 1

k3 b

k 1

k2 c

k 1

d n
k 1

k 1

n4(12 - 3a) - n3(4b + 6a) - n2(6c + 6b + 3a) - n(6c + 2b + 12d) = 0


12 - 3a = 0,
4b + 6a = 0,
6c + 6b + 3a = 0,
a = 4, b = - 6, c = 4, d = - 1
|a|+|b|+|c|+|d| = 15

83.

(2x - 4)2 = 4x

6c + 2b + 12d = 0

C
y = 2x - 4

(x - 2) 2 = x
x2 - 5x + 4 = 0
x = 1, 4
C(1, -2)
B(4, 4)

AB = AC
( 4 )2 16 ( 1)2 4

On solving, we get =

84.

9
2

Let AB b , AC c

AM = b

AN = m c
Let G divides MN in the ratio K : 1

k c b b c
So

k 1
3

k
1

k 1 3

k=

k 1 3

1 1
3

AM GM

1 1

... (1)

CLASS-XII_STREAM-SB+2_PAGE # 265

Now,

area of AMN

area of ABC


1
b c
2

1
b c
2

1 1

0,1 maximum value of ratio =


= 3 Ratio =
attain when = 1 using

3 1
3 1
derivative but is not 1 becuase M is an interior point.

using

so
85.

4
1
ratio <
9
2

OD = R sin
AB = 2R cos

ar( OAB)
rOAB =
semi perimeter

B
R

R
x

1
1
OD AB
R sin 2R cos
2
2
=
=
2R AB
2R 2R cos
2
2
rOAB =

R sin cos
(1 cos )

drOAB
(1 cos ) cos 2 sin cos ( sin )

0
d
(1 cos ) 2

at cos =

86.

5 1
2

f(x) = 1 + x +

x2 x3 x 4

2
6 24

f(x) = 1 + x +

x2 x3

2
6

x0

x
>0
2
f(x) is an increasing fn
f(x) = 0 at x = x0

f(x) = 1 + x +

x 20 x 30

=0
2
6
x0 (-2, -1)

f(x0) = 0 1 + x0 +
f(-2) f(-1) < 0
f(x0) = 1 + x0 +

.... (1)

x 02 x 30 x 04 x 04

0
2
6 24 24

no solution
x0

CLASS-XII_STREAM-SB+2_PAGE # 266

87.

AP = Rsin
area of ring = (2 Rsin). Rd

Total area required, R =

2R

sin d

1
= 1 cos
2
cos =

1
2

Now,
cos =

R
RH

1
R

= R = H = 6400
2 R H

n 1

88.

{ x} [ x ]
dx
[ x]
n r 1

r 1 r

89.

r 1

n 1

{x}[ x]
dx
[x]

( x r )r
dx
r
1

r(r 1) n 1
r 1

C 5 [1 2(3 )]

100

{x}[ x]
dx .....
[x]

r 1 r

( x r )r 1

r(r 1) r
r 1

100

n r 1

{ x} [ x]
dx
[x]

{x} [ x ]
dx
[ x]

Suppose 1, 2, 3, 4, 5 are

C 5 5!

selected coupons.

1
20

Place of 1 is fixed
Total arrangements of 5 is 2
and

arrangements of 2, 3, 4, are
2

3 way

CLASS-XII_STREAM-SB+2_PAGE # 267

90.

Let teams be T1, T2, T3, T4 & T5


Now, we can have 5 teams with the scores of 2 points each matches are
(I) T1 T2
(II) T1 T3
(III) T1 T4
(IV) T1 T5
(V) T2 T3
(VII) T2T5
(VIII) T3 T4
(IX) T3 T5
(X) T4 T5

(VI) T2 T4

This score board contradicts, option D


D is not always necssarily true.

PHYSICS
91.

Apply conservation of linear momentum


mv = (m + M) v0
2
2
2
mv sinR = MR mR 0
5

2M 5M R 2
h R
mv
R
0
R
5

(m + M) (h R)0R

2M 5M R 2
5

h 10m 7M

R
5m M

92.

6 x
3 = (6 + x)tan 1
12

3=

1.4 = x tan 1
12

1.4 =

(6 x )(6 x ) tan
12
x 12 x
tan
12
CLASS-XII_STREAM-SB+2_PAGE # 268

30
36 x 2

14 12 x x 2
16x2 360x + 36 14=0
x=

x=

360

360x 30x2 = 36 14 14x2

360 2 4 36 14 16
32

360 312 48

1 .5
32
32

93.

from graph

94.

1
1

2.6 = 13.6 z2 n 2 4 2
1
1
2.6

= 22 n 2 4 2
13.6 4
2.6
1
1
= 2
13.6 4
16
n
n = 3 now Energy

E=

13.6Z 2
n2

eV

13.6 4
eV = 6eV
9

95.

V0 = Vi when no current flow through 1k \


for negative values of Vi i from D1 = 0 (always)
i from D2 = 0 upto 3V
So from 0 to 3V
Vi = V0
from 3 to 4 V
V0 = 3V
For positive values of Vi i from D1 = 0 upto 1V
i from D2 = 0 (always)
Hence 0 to 1V Vi = V0
1 to 4 V V0 = 1 volt
Correct graph is (A)

96.

mg sin Fr = ma

97.

Fr =

2
a
mr 2 2
5
r

5g
7R r

a=

5 g sin
7 R r

T = 2

7R r
5r

mgh =

1
1 2
2
m2 +
mR2 2
2
2 5
R

mgh =

7
m 2
10

10 gh
7

CLASS-XII_STREAM-SB+2_PAGE # 269

98.

Q1 2 = w12
wTotal = w12 + w31
10 = w12 20
Q12 = w12 = 30 J

99.

mgH 2 mg(d + x) mgh = 0


h = H 2 (d + x)

100.

kA
100 T kA T 0

3w 3T = T
T = 75 C
3

CHEMISTRY

101.

102.

103.

Ans. (A)

104.

n PO PS

N
PO
18
18
760 750

m 108
760
18
10

6m 760
6m = 18 76
m = 228

CLASS-XII_STREAM-SB+2_PAGE # 270

105.

E0Cell = E 0 Cu2 |Cu E 0 Zn|Zn2


E0Cell = 0.34 + 0.76 = +1.1V
G = nFE0Cell
G = 2 96500 1.1 = 213 V

106.

K1 =

SO3
1
O 2 2 SO 2

K2 =

SO 2 2 O 2
SO3 2
1

Hence: K2 = K 2
1

1
K12 = K
2

107.

NH OH

4
AgNH3 2
AgNO 3 NH 4 OH AgOH

( excess)

Tollen' s reagent R CHO R COOH

108.

w=

Ei t
96500

w=

100 3 t
96500

m
m = dV
V
w = 10.5 80 5 104 = 42 102
d=

42 102 =

100 3 t
96500

t = 135 sec.
109.

N1V1 = N2V2
mili eq. of hypo = 0.25 100
mili eq. of hypo= 25
eq. of hypo = 0.025
mole of hypo = 0.025 1
Vf = 1
weight of hypo = 0.025 248 = 6.2 g

110.

CLASS-XII_STREAM-SB+2_PAGE # 271

BIOLOGY
6

113.

1
For EcoR I 10000 2.44 sites present
4
4

1
For RsaI 10000 39.06
4
Using probability rules
114.

Early embryonic cells have yet not committed and differentiated.

115.

(Secondary Endosymbiont) Apicoplast i.e: non photosynthetic plastid is present in plasmodium (protista)

116.

Competition is harmful for both species (A is affected more)

117.

Restriction map as per data is shown above. Thus 1 kb, 3 kb, 4 kb are fragments of gene
118.

Brown fat is abundant in bibernating mammals and new born babies (mammals only)

CLASS-XII_STREAM-SB+2_PAGE # 272

(STREAM - SB/SX) : HINTS & SOLUTIONS (YEAR-2014)

ANSWER KEY
Que s.
Ans.
Que s.
Ans.
Que s.
Ans.
Que s.
Ans.
Que s.
Ans.
Que s.
Ans.
Que s.
Ans.
Que s.
Ans.

1
D
16
B
31
B
46
A
61
C
76
A
91
C
106
C

2
A
17
C
32
C
47
C
62
A
77
A
92
A
107
B

3
C
18
A
33
A
48
A
63
B
78
B
93
B
108
C

4
B
19
D
34
C
49
B
64
D
79
A
94
D
109
A

5
B
20
C
35
B
50
A
65
C
80
B
95
A
110
C

6
D
21
C
36
A
51
A
66
B
81
A
96
C
111
B

7
C
22
C
37
D
52
C
67
D
82
C
97
B
112
D

8
D
23
A
38
C
53
D
68
B
83
B
98
D
113
D

9
B
24
D
39
B
54
B
69
A
84
D
99
B
114
A

10
D
25
B
40
A
55
C
70
D
85
C
100
C
115
C

11
B
26
B
41
D
56
D
71
C
86
101
A
116
D

12
D
27
D
42
A
57
C
72
A
87
A
102
B
117
C

13
C
28
B
43
D
58
A
73
D
88
B
103
D
118
B

14
C
29
C
44
C
59
A
74
C
89
B
104
C
119
A

15
B
30
A
45
C
60
C
75
D
90
105
B
120
A

PART-I (1 Mark)
MATHEMATICS
1.

Let a,a1,a2 _ _ _ _ _ _ _ be the length of siden of square inscribed in circle c0,c1,c2 _ _ _ _ _ and
r1, r2, r3, _ _ _ _ _ be radius of circle c1, c2, _ _ _ _ _ then, a 20 2 r12

r1

2a12

Area Ci .i

a12

i0

2.

4
r22

r2

4 8

2
2

2 2

1

3
5
,y
2
3

(A) [ x y ] [ x ] [ y ]

for x

3 5 3 5
2 3 2 3


3 2 false

9 10
6 1 1

(B) [ xy ] [ x ][ y ]

for x

15
6 1 1

2 1 false

(C) [2x ] 2[7 / 2]

for x = 7/2

[27 / 2 ] 2[7 / 2]

1/2
128 23

x [x]
(D) y [ y ] true x R

Ans. (D)

3
5
,y
2
3

11 8 false

Ans. (A)

CLASS-XII_STREAM-SB+2_PAGE # 273

3.

An = (nCr) max
case- n = 2k (even) An = 2kCk n 1 = 2k 1 (odd) An1 = 2k1Ck1 or 2k1Ck

An
1.9 A
2
1.9
n 1
1.9 2 2 which is true for
every n = even
n = 2, 4, 6,.......... 20 10 numbers
case- n = (2k 1) (odd)

2k 1
2k 2

10 k
4.

Ck
2
C k 1

An
An1 = 2k2Ck1 1.9 A
2
n 1

An = 2k1Ck or 2k1Ck1
1.9

2k
2k 1

Ck
2.0
;
C k 1
n 19

2k 1
2;
k
n = 19 only ;
1.9

1.9 k 2k 1 2k
total = 11

Ans-(C)

Ans-(B)

(0,1)
1
2

1
2

5.

( 1 + 2,0 )

Ans - (B)
6.

AS = SS = SB
e = 1/3
a=3
Ans - (D)

7.

AB=BC
Cos

1
2
and Sin
2
3
6

cos

8.

cos sin

y
1

2a
6

cos 4 x

2
6

1
1
sin 4 x
2
cos x
sin2 x

(cos2 x sin2 x ) 1

3
2

Ans- (C)
cos 4 x sin4 x

cos2 x sin2 x
sin2 x cos2 x

1
1

2
sin x cos2 x

cos 2 x 1
2
2
0
x
x
sin

cos

cos2x 0

2x = t, t [0,4 ]

sin2 x cos2 x 1
t (1 t ) 1

sin2 x (1 sin2 x ) 1

t t2 1

t2 t 1 0
D<0
O

CLASS-XII_STREAM-SB+2_PAGE # 274

9.

x 5
, x2

f (x) x 2
1 , x 2

f(x) is discontinuous at x = 2
f(x) = 2

10.

x 5
2
x 2

x 5 2x 4

x9.

Ans(B)

f(x) [x]sin x

Ans - (D)

11.

sinx = tan2x
sin2x = sinx(1 sin2x)
sin x (sin2x + sin 1) = 0

sin x 0

sin x

x 0, sin1

5 1
2

5 1
5 1
, sin1
2
2

Ans(B)

12.

I f(x 2 )dx

dx

Let x2=t ;

I 1 f(t)
0

13.

dt

2 t

f'(x) = 1 +f(x)

1
1

2 2 t

1
2 t
dt

dt
1

dt

f(t) 2 f(t) 2
0

5I

Ans-(D)

f(0) = 0

f (x)
1
1 f (x)

ln (1 + f(x)) = x
then f(x + y) = f(x) + f(y) f(x) f(y)
Ans(C)
14.

cos(2 [ x]{xy })
1

n cos(2 [ x ]1dx ) n | dx n
Ans(C)

CLASS-XII_STREAM-SB+2_PAGE # 275

15.

16.

5
1 1 5
6
P(B) = 1. 1. . . ..........
6
6 6 6
7
Ans -(B)

n 3

2
i

xi

x1 x 2 x1 x 2

x 3 x 4 ......... x n
2
2
=
n

y 1 y 2 y 3 ...... y n
=
n
=

x 1 x 2 ........ x n
=
n

.......(1)

1
(2x 12 2x 22 4 x 1x 2 ) x 32 ........ x n2
4

1 2
( x1 x 22 ) x 1x 2 x 32 ...... x n2 x 2
i
2

n
n

x 12 x 22 ....... x 22 x i

n
n

2
1

.........(2)
(B) is correct

Sol- Let side length = 2a

GA=GB=a

1
3

Ans -(C)
18.

Ans -(A)

19.

Ans- (D)
4 2
3 5
4 5 2 5 2
C4

1
1
3
1
2 1 4 2 3

20 + 106 + 5[8 + 6] + 10 + 20 = 180


5

2
1

cos

20.


by (1) and (2)

17.

x1 x 2 x1 x 2


x 32 ...... x n2
2
2

C2 2 5 C3

3
2

3
2

2a
3
a
2

D
E

Ans - (C)

CLASS-XII_STREAM-SB+2_PAGE # 276

PHYSICS

2L, m

21.

J = mv J.L =

M(2L)2

12

J.L=

ML2

Ans.

(C)

J/M

Cm

ke=
22.

J2 3J2

= 2J2/m
2m 2m

mgh =

1
1
mv2+ I 2
2
2

mgh =

1
1 MR 2 2
mv2 + .
2
2
2

gh =

3J
ML

1
1
3
mv2 + mv2 = v2
2
4
4
4gh
3

V2 =

V=
Vp

VR
23.

V=

4gh
3

2gh

4
2/3
32

Ans.

(C)

V (r) = kr
U (r) = mkr

F=-

2 =

du
mk =
dr

24.

Ans. (D)

25.

A1V1 = A2V2

k
r
k
r

T=

2 r
k

Ans.

(A)

1 2
dv = Const.
2
d = density
P1V1 = P2V2
Ans. (B)
P+

26.

Ans. (B)

27.

Ans. (D)

28.

PV2 = C
PV.V = K
nRT.V = K
VT = K
CLASS-XII_STREAM-SB+2_PAGE # 277

V1T1 = V2T2
V2>V1 T2<T1
P1V12 = P2V22
V2 2 P1

V12 P2

P.

K2
C
T2

P
k
T2
P1
T12

T12 T2 2

P1 T12

P2 T2 2

Ans.

(B)

29.

v o
n = n v v
s

v
n = n v v
s

n' v v s

n" v v s

n' v v s 330 30 360

1.2
n" v v s 330 30 300

30.

(A)

31.

1 1 1

v u f

Ans.

(C)

30 cm

1
1 2

f fm fl
1 1 2
1

f 10
5
f = -5
1
1
1

v 30
5
1 1 1

v 5 30
6 1 5

30
30
v = -6cm

Ans.

(B)

32.
Ans. (D)

CLASS-XII_STREAM-SB+2_PAGE # 278

Vx

33.
vy = ay.t
eE l
.
m u
vx = u

vy =

tan =

34.

eEl
mu2

tan 1
4
tan 2

KQ
W1 = q

35.

Q=

tan 1
0.1
4

Ans. (A)

+q

-q

-a/2

a/2

kq2
a

W=
(C)

tan 2 =

+q

KQ kq
( q)
W2 =
a
R

Ans.

C
E
2

Ceq =

C.KC
C2K
CK

C KC C(1 k) 1 K

Q=

CK
E
1 k

2ck c(k 1)
2ck ck c
ck c
CK C
CK C

=
Ans. (B)
Q = 1 k 2 E ; Q = 1 k 2 E =
2(1

k)
2(1

k)
2(1
k)

36.

V = ed
E=

100
20um

37.

dN
n
dt

38.

N
4R 2

39.

40.

Ans.

N=

100
1 5v
20

V1 =

dN
dt
dt

Ans.

6.93
10 4 = 10-4
6.9

160 6200 10 10
5 1019 10
=
4 3.14 3.24
6.62 10 34 3 108

496
5 1019 10
1019 = 1.25 1019
=
10
4 3.14 3.24

1
1
1 1
2

2
2
3 4 9 125
1
1 1
64
2 = 1 1

2
2
9 25
3
5

(A)

Ans.

125
1
64

Ans.

(D)

16 62 10 7
20 10 34 108

(C)

Ans.

(B)

108 = 80
117.5 = 82.5
Energy required = 82.5-80
= 2.5
(A)
CLASS-XII_STREAM-SB+2_PAGE # 279

CHEMISTRY
41.

-10

-3

KSP AgBr = (Ag ) (Br ) = (510 ) (10 ) = 510-13


Ksp AgBr
-

-2

Concentration of Br in 10 M aq AgNO3 =

[ Ag ]

5 10 13
5 10 11 m
=
(10 2 )

42.

Over bromination take place in activated Aniline.

Ans.

(A)

43.

+6 is maximum oxidation state of Cr.

Ans.

(D)

44.

Ans. (C)

45.

Al2O3 is amphoteric oxide

Ans.

(C)

46.

ln k = ln A

Ans.

(A)

47.

Ni(CO)4 is tetrahedral with d10 configuration

Ans.

(C)

48.

Ozonolysis and intramolecular aldol

Ans.

(A)

49.
50.

Ans. (B)
Ans. (A)

51.

When QC > KC
Reaction move in backward direction

Ans.

(A)

52.

SN-1 Reaction, more stable carbocation is formed

Ans.

(C)

53.

Ans. (D)

54.

Wolf kishner Reduction

Ans.

(B)

55.

Compound is AsCl3

Ans.

(C)

56.

Valency factor of KMnO4 = 5


5e- + MnO4- + 8H+ Mn+2 + 4H2O

Ans.

(D)

Ea 1

R T

57.

Ans. (C)

58.

H 6000 J
S = T 213k 22J/K.mol

Ans.

(A)

59.

Ullmann reaction

Ans.

(A)

60.

Energy of t2g orbitals < eg orbitals in octahedral complexes Ans. (C)

Ans.

(D)

CLASS-XII_STREAM-SB+2_PAGE # 280

PART-II
Two Mark Questions
MATHEMATICS
81.

Ans-(A)
n

82.

k wk

1 w

R0

when n is multiplying of 3, then


S=e, 1/e
when n is not multiple of three,then
s= e1/ 2 e1/ 2
Ans- (C)
83.

y = ax2 + bx + c
a > 0, b < 0, c < 0
Also y(1) = a + b + c < 0
Ans-(B)

84.

Sin

r1
r
2
AP1 AP2

AP2 AP1 r1 r2

r2 3 r1 3 r1 r2
r2 ( 3 1) r1

3 1

r2
2 3
r1
85.

Ans- (D)

Let f(x) = 3x3 - 25x


f(x) = 9x2 - 25
5
3
f(-5/3) = 250/9 27.7
f(5/3) = -250/9 -27.7
n can take 55 values

f(x) = 0

86.

Ans-( )

87.

Sol- In

/2

Ans-(C)

xn cos xdx
n

In +n(n-1)In-2 =
2

.......(1)

I n 2 !I
In
In 2

n 2
n

Also
=

n!
n 2 ! n 2
n 2 n!

n
( 2)
=
n 2 n!

2
= e 1 2

Ans- (A)

CLASS-XII_STREAM-SB+2_PAGE # 281

88.

Sol-

[x][ x ]dx 2dx ............


1

= 50

for n = 8

66

for n = 9

Ans - (B)
89.

Ans- (B), Check for n = 1, 2 , 3,......

90.

Sol- No correct Option


(1,17), (2,17),(3,17),(4,17),(4,17),(6,17),(7,17)_ _ _ _ _ _ _ (16,17),(18,17) = 17 points
Also (17,1), (17,2), _ _ _ _ _ _ _ _ _ _ _ _ _
(17,16), (17,18) = 17 points
So there are more then 34 points.
Ans-()

PHYSICS
Initial

Final

w
V=W'R

91.
A

From cons. of anguler momentum about A

v=

2Rw
7

92.

Ans. (A)

93.

Tmax - mg =

W =

2w
7

mv 2
....(i)
R
from energy cons.
ki + ui = kf + uf

1
O + mg (R-R cos ) = mv2+0
2
V2 = 2gR (1-cos )
Put in eq. (i)
Tmax = 3mg - 2mg cos

Ans.

(C)

Tmin
Tmax
mg cos
V mg

mg

Tmax
Tmin =4
Ans.

=60
(B)

94.

Heat cap. is define as C = Cv +


C=

R
1

3
R
R
R
2
1 3

Ans.

(D)

95.

Ans. (A)

96.

Ans. (C)

CLASS-XII_STREAM-SB+2_PAGE # 282

97.

At steady state capacitor will belave as open circuit


So charge store in 1 F = 14 = 4 C
in 2 F = 2 4 = 8 C
Ans. B

98.

F=

2P
C

mg =

99.

E = + eV

E = + e (.9)

1.1E = + e(.9)

.1E = .3e

E = 3eV put

2.4eV

100.

2 1.5 103
3 108

(MLoT-2 -4) = (ML2T-1) (ML2T-2 -1) (LT


T-1)
Solving we get

m = 10-6kg

Ans.

(C)

Ans.

(B)

Ans.

(D)

Ans.

(B)

Ans.

(C)

Ans.

(D)

Ans.

(B)

CHEMISTRY
101.

Ans. (A)

102.

d=

PM
RT
M = 123

dRT
P
acetic acid exist as dimer

M=

103.

E = H - (PV) = H - ngRT

104.

Ans. (C)

105.

N2 (g) + 2H2(g) N2H4(g)

=
106.

(BDE)

Reacant

(BDE)Pr oducts

Vk+ + VCl- = 133 + 181


KCl form FCC Lattice
2(VK+ + VCl-) = a = edge length of unit cell
V = a3

107.
Ans.

K2Cr2O7+6FeSO4+ 7H2SO4 Cr2(SO4)3 + 3Fe2 (SO4)3+ K2SO4 + 7H2O


(B)

108.

EoCell = SRP cathode - SRP anode


= -0.44 - (-0.74) = 0.3V
o
G = - nF E Cell (n = 6 ele )

109.

Ans. (A)

110.

XeF6 + 3H2O XeO3 + 6HF


XeO3 is SP3 hybrid and pyramidal
(C)

Ans.

Ans.

(C)

CLASS-XII_STREAM-SB+2_PAGE # 283

We Are Here For You...


STUDY CENTRES
KOTA (Head Office):
Pre-Engineering Division
JEE (Advanced)
Pre-Engineering Division
JEE (Main)
Pre-Medical Division
(NEET | AIIMS)
Tel.: 0744-3012222, 3192222
e-mail: contact@resonance.ac.in

NAGPUR

RANCHI

Tel: 0712-6462622, 3017222


e-mail: nagpur@resonance.ac.in

e-mail: ranchi@resonance.ac.in

ALLAHABAD
NANDED

e-mail: allahabad@resonance.ac.in

Mobile: 9373507998

NASHIK
MUMBAI

e-mail: nashik@resonance.ac.in

Tel.: 022-3192 2222, 31922226


e-mail : andheri@resonance.ac.in

RAIPUR
e-mail: raipur@resonance.ac.in

Commerce & Law Program


Division (CLPD)
Tel.: 0744-3192229
e-mail: commerce@resonance.ac.in

PCCP/PSPD/MEx
Tel.: 0744-2434727, 3192223
e-mail: pccp@resonance.ac.in

UDAIPUR
Tel.: 0294-3262733, 5107858
e-mail : udaipur@resonance.ac.in

AURANGABAD

BHUBANESWAR

JABALPUR

Tel.: 0674-3192222, 3274919


e-mail: bbsr@resonance.ac.in

e-mail: jabalpur@resonance.ac.in

AHMEDABAD
Tel.: 079-31922222, 31922224
e-mail: abad@resonance.ac.in

DLPD
Tel.: 0744-3012222
e-mail: dlpd@resonance.ac.in

Tel.: 0612-3192222, 3192223


e-mail: patna@resonance.ac.in

Tel.: 0744-3058242
e-mail: elpd@resonance.ac.in

JODHPUR
JAIPUR
Tel.: 0141-3217766, 3103666,
e-mail: jaipurc@resonance.ac.in

Tel.: 0291-3192222, 2650022


e-mail: jodhpur@resonance.ac.in

Tel.: 0755-3206353, 3192222


e-mail: bhopal@resonance.ac.in

Tel.: 0145-3192222, 2621614


e-mail: ajmer@resonance.ac.in

INDORE
NEW DELHI

Tel: 0731-3192222, 4274200


e-mail: indore@resonance.ac.in

Tel.: 011-31922222, 31922224


e-mail: delhi@resonance.ac.in

Tel: 01572-319222
e-mail: sikar@resonance.ac.in

Tel.: 0522-3192222, 3206974


e-mail: lko@resonance.ac.in

CHANDRAPUR
SURAT
e-mail: surat@resonance.ac.in

RAJKOT
e-mail: rajkot@resonance.ac.in

e-mail: chandrapur@resonance.ac.in

VISAKHAPATNAM (ICCP)
Tel: 0891-2757575
e-mail: vizag@resonance.ac.in

BHAVNAGAR (ICCP)
Mob.: 8000816767 / 8000716868

SIKAR
LUCKNOW

e-mail: gwalior@resonance.ac.in

VADODARA

AJMER
BHOPAL

GWALIOR

e-mail: chandrapur@resonance.ac.in

PATNA
eLPD

e-mail: aurangabad@resonance.ac.in

DEHRADUN (ICCP)
Mob.: 0135-3051000

AGRA
KOLKATA
Tel.: 033-31922222, 32417069
email: kolkata@resonance.ac.in

Tel: 0562-3192224, 3192222


e-mail: agra@resonance.ac.in

CORPORATE OFFICE: CG Tower, A-46 & 52, IPIA, Near City Mall, Jhalawar Road, Kota (Rajasthan) - 324005
Reg. Office: J-2, Jawahar Nagar Main Road, Kota (Raj.) - 324005 | Tel. No.: 0744-3192222, 3012222, 3022222 | Fax : 022-39167222 CIN: U80302RJ2007PTC024029

To know more: sms RESO at 56677 | Toll Free : 1800 258 5555 | Website: www.resonance.ac.in | e-mail: contact@resonance.ac.in
facebook.com/ResonanceEdu

twitter.com/ResonanceEdu

www.youtube.com/resowatch

ResonanceEdu.blogspot.com

linkedin.com/in/ResonanceEdu