True.

It depends on what kind of complexity a given thing exhibits that betrays a

designer. There's random complexity and specified complexity.

An example of random complexity would be if someone dumped out a box of

scrabble letters. The way the letters fell would be enormously improbable. If you
dumped out the letters over and over, you probably would never be able to get the
scrabble letters exactly that way again.

An example of specified complexity would be if you walked into a room and saw
scrabble letters on a table that spelled "Take out the garbage. Love, Mom." Not only
is it extremely improbable that scrabble letters would fall in exactly that way, there
also appears to be a purpose behind the letters being that way. They conform to an
independently given pattern (the English language), and it is the combination of
improbability and specificity that point to an intelligent agent.

I think one human cell alone is rife with such complexity. DNA alone is extremely
specifically complex. Each of the 4 different enzymes that make up DNA act like
binary digits in a computer code. The specific sequencing of DNA determines
whether amino acids form into fully functioning proteins or not, similar to how
blueprints tell construction workers which steps need to be taken in order to build a
house. Each of the enzymes are represented by the letters A, C, T, and G which
stand for adenine, cytosine, thymine, and guanine, respectively. In fact even Bill
Gates has said DNA is like a computer code except much more complex than
anything weve ever devised. He says this because the 4 character chemical
alphabet of DNA instructs amino acids which way they should fold to form a protein
in a similar way that computer code determines how software should function, and
both languages are comprised of a very small number of characters (DNA 4
letters, Binary 2 letters). Except instead of the code being like
101010010101010101010100001111110101010 the code
ACAACACTGACTGCGGTGGTTGGACTCG this is why many people have equated DNA
to a computer code. Moreover, The DNA molecule has been made in such a way
that it is self correcting. There are special proteins called corrective enzymes that go
up and down the DNA molecule looking for errors and making repairs on a minute
by minute, second by second basis. Just as an editor of a newspaper scans the
newspaper looking for mistakes and then corrects the grammatical or spelling
errors, so DNA has special enzymes that go up and down the DNA strand, repairing
the mistakes.

Its not just complex, its specifically complex. In fact, it is a code; a genetic code.
Scientists know today that languages and codes only come from intelligence and
information only comes from an informer. Weve never seen matter by itself give
rise to a code. Heres an illustration; if your walking down the beach and you see

ripples in the sand, whats your conclusion? Well, that nature (the waves) washed
up on shore and created those ripples. The ripples are complex, but theyre not
specifically complex, and so you would attribute the ripples to natural processes.
But if youre walking down the beach and you see John Loves Mary written in the
sand in the middle of a heart with an arrow through it, you wouldnt conclude that
the waves created that. Why? Because thats information with content. Nature
doesnt produce information, it only creates patterns! Whenever we see information,
whether its in a book, whether its in a newspaper, whether its in a computer code,
we know that intelligence is behind it.

And thats just one particular part of a single cell. The entire cell is more complex
and intricate than any man-made machine
. My definition is the first option The Free Dictionary.com gives "1. A space that is or
may be occupied" As in "That easy chair takes up too much room.". Unless the
mother-universe is expanding, there wont be enough of it for all the babies to
expand, but if the mother universe is expanding, its traceable to a cosmic
beginning by backward extrapolation. But then, the Kalam argument can just be
applied to the mother universe. (1) Whatever Begins To Exist has a cause. (2) The
Mother Universe began to exist. (3) Therefore the mother universe has a cause.

And it's not speculation at all. But you would know that if you took the time to look
at the article. The Kalam Cosmological Argument consists of 2 premises, a
conclusion, and a conceptual analysis of the conclusion.

1: Whatever begins to exist has a cause.

2: The universe began to exist.
3: Therefore, the universe has a cause.

This is a logically valid argument since it follows the rule known as modus ponens.
In order for the conclusion to be true, both premises must be true. In my blog post
titled "The Kalam Cosmological Argument" I defend the 2 premises by appealing to
positive reasons rather than a lack of reasons from atheists, that make it far more
probable than not that both premises are true. The conclusion is "The universe has
a cause". The question is "What type of cause must the universe have?" which is
where the conceptual analysis comes into play, which is where a defender of the
KCA would assert that the cause must be a spaceless, timeless, immaterial,
powerful, personal being, and proceed to back up that assertion with good
*positive* reasons. I realize some Christians argue atheists dont know how the
universe started. Point 1 for God! but I dont argue in that way. I give positive
reasons why God (or something very much like God) must be the cause of the

universes origin. These reasons were not only layed out in The Kalam
Cosmological Argument but in the follow up post that I linked to in my previous
comment called Is The Kalam Cosmological Argument A God Of The Gaps
Argument (see http://cerebralfaith.blogspot.com/2015/07/is-kalam-cosmologicalargument-god-of.html).

If you're really interested in knowing why I believe what I believe, you'll look at
those posts and save me the hassle of having to re-type it here. But your apparent
unwillingness to check our my writings suggests to me that you're not interested in
truth, but in bickering against a theist.

Seriously, dont make me type all of that up. Ive been working my fingers to the
bone answering people on this thread today. True. It depends on what kind of
complexity a given thing exhibits that betrays a designer. There's random
complexity and specified complexity.

An example of random complexity would be if someone dumped out a box of

scrabble letters. The way the letters fell would be enormously improbable. If you
dumped out the letters over and over, you probably would never be able to get the
scrabble letters exactly that way again.

An example of specified complexity would be if you walked into a room and saw
scrabble letters on a table that spelled "Take out the garbage. Love, Mom." Not only
is it extremely improbable that scrabble letters would fall in exactly that way, there
also appears to be a purpose behind the letters being that way. They conform to an
independently given pattern (the English language), and it is the combination of
improbability and specificity that point to an intelligent agent.

I think one human cell alone is rife with such complexity. DNA alone is extremely
specifically complex. Each of the 4 different enzymes that make up DNA act like
binary digits in a computer code. The specific sequencing of DNA determines
whether amino acids form into fully functioning proteins or not, similar to how
blueprints tell construction workers which steps need to be taken in order to build a
house. Each of the enzymes are represented by the letters A, C, T, and G which
stand for adenine, cytosine, thymine, and guanine, respectively. In fact even Bill
Gates has said DNA is like a computer code except much more complex than
anything weve ever devised. He says this because the 4 character chemical
alphabet of DNA instructs amino acids which way they should fold to form a protein
in a similar way that computer code determines how software should function, and
both languages are comprised of a very small number of characters (DNA 4
letters, Binary 2 letters). Except instead of the code being like

101010010101010101010100001111110101010 the code

ACAACACTGACTGCGGTGGTTGGACTCG this is why many people have equated DNA
to a computer code. Moreover, The DNA molecule has been made in such a way
that it is self correcting. There are special proteins called corrective enzymes that go
up and down the DNA molecule looking for errors and making repairs on a minute
by minute, second by second basis. Just as an editor of a newspaper scans the
newspaper looking for mistakes and then corrects the grammatical or spelling
errors, so DNA has special enzymes that go up and down the DNA strand, repairing
the mistakes.

Its not just complex, its specifically complex. In fact, it is a code; a genetic code.
Scientists know today that languages and codes only come from intelligence and
information only comes from an informer. Weve never seen matter by itself give
rise to a code. Heres an illustration; if your walking down the beach and you see
ripples in the sand, whats your conclusion? Well, that nature (the waves) washed
up on shore and created those ripples. The ripples are complex, but theyre not
specifically complex, and so you would attribute the ripples to natural processes.
But if youre walking down the beach and you see John Loves Mary written in the
sand in the middle of a heart with an arrow through it, you wouldnt conclude that
the waves created that. Why? Because thats information with content. Nature
doesnt produce information, it only creates patterns! Whenever we see information,
whether its in a book, whether its in a newspaper, whether its in a computer code,
we know that intelligence is behind it.

And thats just one particular part of a single cell. The entire cell is more complex
and intricate than any man-made machine.