Sie sind auf Seite 1von 9

Parasitol Res (2015) 114:21552163 DOI 10.1007/s00436-015-4404-4

ORIGINAL PAPER

ORIGINAL PAPER

Combination of cell culture and qPCR to assess the efficacy of different anticoccidials on Eimeria tenella sporozoites

Ahmed Thabet & Alaa Aldin Alnassan & Arwid Daugschies & Berit Bangoura

Received: 15 January 2015 /Accepted: 27 February 2015 /Published online: 14 March 2015 # Springer-Verlag Berlin Heidelberg 2015

Abstract Three in vitro studies were designed to develop an assay for anticoccidial efficacy by use of laboratory (Houghton) and field (T-376) Eimeria tenella strains. In study (1), minimum inhibitory concentrations (MICs) of monensin (Mon), maduramicin (Mad), salinomycin (Sal), and lasalocid (Las) were determined that are able to inhibit more than 50 % of sporozoites in host cell (Madin-Darby bovine kidney (MDBK)) penetration and more than 95 % of Houghton spo- rozoites development to mature merozoites (treatment time 24 h) using quantitative real-time PCR (qPCR). MICs were 0.5, 2.5, 1, and 0.5 μg/ml for Mon, Mad, Sal, and Las, respec- tively. Applying the previous MIC on T-376 strain revealed a different sensitivity profile. Mad reduced T-376 gene copies by only 89.3 % after 96 h of infection. In study (2), Houghton strain sporozoites were incubated with MIC of the different tested ionophores for 2 and 4 h, respectively; afterwards, their ability to invade MDBK cells was determined using phase- contrast microscopy and qPCR. Treatment of sporozoites with ionophores for 4 h resulted in significant inhibition of invasion compared with non-treated parasites as assessed both by mi- croscopy as well as qPCR. Inhibition rates for Mon, Mad, Sal, and Las were 90.2, 75.0, 88.3, and 82.6 % using phase-contrast microscopy and 83.9, 81.4, 85.8, and 75.4 % using qPCR, respectively. T-376 sporozoite in- vasion into MDBK cells was reduced to 48.9 % by Mad. Study (3) was conducted to determine inhibition exerted by toltrazuril (Tol). Tol at 5 μ g/ml reduced re- production of Houghton strain by 95 %, whereas T-376 was only reduced by 86.5 %. The presented experiments indicate that infectivity inhibition of sporozoites incubated for 4 h with anticoccidials and development inhibition after

A. Thabet : A. A. Alnassan : A. Daugschies : B. Bangoura (*) Institute of Parasitology, Faculty of Veterinary Medicine, Centre for Infectious Diseases, University Leipzig, Leipzig, Germany e-mail: bangoura@vetmed.uni-leipzig.de

96 h of infection by qPCR are suitable means to assess sensi- tivity of E. tenella strains to anticoccidials.

Keywords Eimeria tenella . Ionophores . Toltrazuril . PCR . In vitro assay

Introduction

Eimeria tenella is an intracellular protozoon belonging to the family Apicomplexa. It is one of the most important chicken Eimeria species, causing cecal coccidiosis with recognizable lesions and spectacular losses in poultry industry (McDougald and Fitz-Coy 2013). Even though there are dif- ferent types of anticoccidial vaccines available, application of pharmaceuticals by feed or drinking water remains the most widely distributed method to control coccidiosis worldwide (McDougald 1982). Between the different classes of anticoccidial agents, the modes of action vary as well as the developmental stages of Eimeria that are targeted. Polyether ionophores and triazines are considered the most widely used anticoccidial agents to control chicken coccidiosis. Polyether ionophores arrest spo- rozoites by increasing intrasporozoite Na + /K + concentrations and Na + -K + -ATPase activity (Wang et al. 2006). They also act against merozoites by bursting the cell border, endoplasmic reticulum, and internal organelles (Mehlhorn et al. 1983). On the other hand, toltrazuril, a triazine member, acts upon all intracellular stages in the schizogony and gamogony cycles (Haberkorn and Stoltefuss 1987). Different application strategies are used for anticoccidial agents in poultry flocks in order to reduce the emergence of drug resistant isolates, such as shuttle or rotation programs. Nonetheless, the emergence of resistant isolates has been re- ported against almost all compounds introduced on the market (McDougald et al. 1997; Stephan et al. 1997; Mattiello et al.

against almost all compounds introduced on the market (McDougald et al. 1997 ; Stephan et al.

2156

Parasitol Res (2015) 114:21552163

2000; Peek and Landman 2003; Abbas et al. 2011). The sen- sitivity of Eimeria spp. field isolates against different anticoccidial compounds is currently studied by the use of either in vivo or in vitro sensitivity assays. The in vivo assay is a time-consuming procedure and requires the diagnostic slaughtering of a large number of chickens in order to deter- mine the efficacy of anticoccidial agents (Chapman 1998 ; Stephan et al. 1997). On the other hand, several studies alter- natively used in vitro models to study the anticoccidial activity by counting intracellular sporozoites or schizonts after stain- ing infected cell lines or directly using phase-contrast micros- copy (McDougald and Galloway 1976; Smith et al. 1981; Zhu and McDougald 1992). Recently, a model for estimating intracellular E. tenella sporozoite burden was developed, after treatment with monensin and salinomycin, u sing quantitative and semi- quantitative PCR technology (Jenkins et al. 2014). Real-time quantitative PCR is an advantageous tool to assess anticoccidial sensitivity in vitro; it is considered accurate and allows precise quantification of intracellular Eimeria stages. In this study, a quantitative in vitro assay using real-time PCR was used to assess the efficacy of different anticoccidial agents on E. tenella sporozoites and their development to mature merozoites, in order to establish a sensitive in vitro model, that can be used to determine susceptibility of different E. tenella strains toward these agents. Monensin (Mon), maduramicin (Mad), salinomycin (Sal), lasalocid (Las), and toltrazuril (Tol) were applied on a reference E. tenella strain (Houghton strain) and a field isolate (T-376) for different pe- riods of time. The extent of inhibition in sporozoites penetra- tion and development was calculated as percentage after dif- ferent time intervals in order to define the optimal time inter- vals for determination of E. tenella sensitivity profiles.

Material and methods

Cloning procedure-standard curve preparation

Quantitative PCR (qPCR) standard curve was generated by serial dilution of the cloned amplification target (fragment of internal transcribed spacer (ITS)-1 gene). Primers ET-F (tggaggggattatgagagga) and ET-R (caagcagcatgtaacggaga) were used to generate gene fragment with a product size of 147 bp as previously described (Kawahara et al. 2008). The resulting DNA fragment was amplified with Taq DNA poly- merase using conventional PCR (PeQlab, Erlangen, Germany). A 25 μ l PCR mixture consisted of 2.5 μ l 1× DreamTaq buffer (Fermentas, Thermo Scientific, Germany), 0.8 l dNTPs (2 mM), 0.5 μl of a 25 μM stock of ET-F (final concentration, 0.5 μM), 0.5 μl of a 25 μM stock of ET-R (final concentration, 0.5 μM), and 0.1 μl DreamTaq DNA polymer- ase (5 u, Fermentas, Thermo Scientific). Cycling reaction was

(5 u, Fermentas, Thermo Scientific). Cycling reaction was performed under the following conditions: 5 min at

performed under the following conditions: 5 min at 94 °C, followed by 35 cycles of 45 s at 94 °C, 62 s at 45 °C, and 1 min at 72 °C, and a final extension step for 10 min at 72 °C. PCR product was run on 1.5 % agarose gel to verify the exclusive presence of the expected fragment. StrataClone PCR cloning kit (Stratagene, Catalog # 240205, Life Science, Germany) was used to ligate the PCR product on pSCA-amp/kan following the manufacturer s instructions. The transformant was analyzed using T3/T7 to confirm the presence of gene fragment depending on its size. Then, plas- mid DNA was extracted by QIA prep® Spin Miniprep Kit (Qiagen, Hilden, Germany). Sequencing was performed at IZKF (University Leipzig, Germany) using T3 primer, and sequence confirmation of the 147-bp gene fragment was done using BLAST® program (Basic Local Alignment Search Tool, NLM, USA). Concentration of pSCA-147 plasmid was measured using Nanodrop 2000 (Thermo Scientific, Germany) at 260 nm.

Quantitative PCR assay

Stratagene MX3000P (Stratagene, La Jolla, USA) was used for the real-time PCR. The preparation of reaction solution consisted of 10 μ l of SYBR green master mix (Thermo Scientific, Germany), 0.4 μl of a 25 μM stock of ET-F (final concentration, 0.5 μM), 0.4 μl of a 25 μM stock of ET-R (final concentration, 0.5 μM), and 7.2 μl nuclease-free water. The

template volume was 2 μl, yielding a final 20 μl volume in the reaction tube. Cycling reaction was performed under the fol- lowing conditions: 5 min at 95 °C, followed by 40 cycles of 30 s at 95 °C, 20 s at 62, and 20 s at 72 °C. A melting curve program involving heating from 60 to 95 °C at a rate of

0.1 °C/s was performed to create the dissociation curve. The

gathered data represent the mean values of three replicates with an acceptable standard deviation of less than 0.5 cycles.

E. tenella sporozoites

A laboratory E. tenella strain (Houghton strain) without his- tory of exposure to anticoccidial agents was kindly provided by Dr. D. P. Blake, Royal Veterinary College, University of London, UK. Sporulated oocysts of the Houghton isolate were maintained at 8 °C in 2 % potassium dichromate solution at the Institute of Parasitology, University Leipzig, Germany, by subsequent passage every 6 months as described before (Shirley 1977). A field E. tenella strain (T-376) was isolated from the ceca of a broiler breeder flock of 3 weeks of age near Leipzig, Germany, in 2013 and propagated recently before use. Sporozoites of both E. tenella strains were excysted as described before (Raether et al. 1995). Briefly, after washing oocysts from potassium dichromate in phosphate-buffered sa- line (PBS, pH=7.2), a surface sterilization using 12 % sodium hypochlorite for 10 min was performed. Oocyst walls were

Parasitol Res (2015) 114:21552163

2157

broken using 0.5-mm glass beads (BioSpec Products, Bartlesville, OK, USA). Using 0.25 % trypsin ( w / v ) (Carl Roth, Karlsruhe, Germany) and 4 % sodium taurocholic acid (w/v) (Sigma, Taufkirchen, Germany), sporozoites were re- covered from sporocysts by enzymatic excystation at 41 °C for 90 min. The excysted sporozoites were purified using DE- 52 (Whatman, GE Healthcare, USA) anion exchange method (Schmatz et al. 1984 ). Pelleted sporozoites were collected carefully from the bottom of the microcentrifuge tubes, washed three times with PBS, and counted using a hemocytometer.

Anticoccidial agents

Analytical standard preparations of monensin sodium salt (9095 % TLC) (Mon), salinomycin monosodium hydrate (93.8 %) (Sal), maduramicin ammonium (97.9 %) (Mad), lasalocid A sodium salt solution (100 ng/ μ l) (Las), and toltrazuril (99.7 %) (Tol) were obtained (Sigma-Aldrich, Deisenhofen, Germany), and with the exception of Las which was already purchased as a solution, they were dissolved in deionized water by assistance of dimethyl formamide to pre- pare a stock solution at concentration of 1000 μg/ml.

Cell culture growth conditions

Madin-Darby bovine kidney (MDBK) cells (DSMZ, German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany) were used as host cell cultures for E. tenella . MDBK cells were grown overnight in 24-well plates (TPP, Trasadingen, Switzerland) at an initial density of 2.0×10 5 cells per well and supplied with Dulbeccos mod- ified Eagles medium (DMEM), with high glucose 4.5 g/l and L-glutamine (Gibco, Invitrogen, Karlsruhe, Germany) supple- mented with fetal bovine serum 5 % ( v/ v ) to obtain semi- confluent monolayers. During infection of MDBK cells with sporozoites, 1 % penicillin/streptomycin (penicillin 100 U/ml and streptomycin 100 μ g/ml) and 1 % amphotericin-B (0.25 μg/ml) (GE Healthcare, Germany) were added.

Mitochondrial toxicity test

3-(4,5-Dimethylthiazol-2-yl)- 2,5-diphenyltetrazolium bro- mide (MTT) test (Mosmann 1983) was performed to make sure that anticoccidial agents in different concentrations have no toxic effect on MDBK cells. Overnight-grown MDBK cells were exposed to different concentrations of the anticoccidial test compounds (1, 10, 100 μg/well) and incu- bated for 24 h at 37 °C with 5 % CO 2 . The reagent containing the tetrazolium dye MTT was added (10 μl/well), and plates were further incubated for 4 h. Precipitated formazan crystals were dissolved by adding 100 μ l/well (10 % SDS/10 mM HCl, pH<5) for 24 h. The level of absorption was measured

using a spectrophotometer (Anthos 2001, Salzburg, Austria) at 595 nm. Assays were performed in triplicates.

Study 1: reproduction inhibition assay using ionophores

The abilities of both Houghton and T-376 strains to penetrate MDBK cells and develop to mature merozoites were firstly assessed to compare rate of multiplication of both strain gene copies under standardized conditions without using any anticoccidial agents. A preliminary study was conducted to determine minimum inhibitory concentrations (MICs) of ion- ophores that will inactivate at least 50 % of Houghton sporo- zoites in the first 24 h and reduce total Houghton gene copies by at least 95 % in 48, 72, and 96 h post-infection. Anticoccidial-containing media were prepared at different concentrations (10, 5, 2.5, 1, 0.5, 0.25, and 0.1 μ g/ml) of different ionophores (Mon, Mad, Sal, and Las). MDBK cells were infected with 5.0×10 4 sporozoites and incubated with the abovementioned ionophore concentrations for 24 h at

41 °C and 5 % CO 2 . After 24 h, cultures were washed three

times with PBS and re-incubated with DMEM media contain- ing 5 % newborn calf serum without ionophores for 48, 72, and 96 h. Trypsin-versene (Lonza, Thermo Scientific, Germany) was used in order to detach adherent MDBK

cells at different time points after infection (24, 48, 72,

96 h), in which 200 μl of 1× trypsin was added to each well

and incubated at 41 °C for 15 min. Detached MDBK cells were washed from different wells and transferred to microcentrifuge tubes. Trypsin was eliminated from these

cells by centrifugation (1540×g for 5 min), and the cell pellets were re-suspended in 200 μl PBS and subjected to DNA ex- traction applying the QIAamp® DNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer s instruc- tions (blood and body fluid spin protocol). The DNA was eluted with 50 μl nuclease-free water, and concentrations were measured using Nanodrop 2000 (Thermo Scientific, Germany) at 260 nm. All DNA concentrations, in all samples examined in this study, were diluted to a concentration of

20 ng/μl. DNA was stored at 20 °C until use. The numbers

of gene copies were assessed as correlate of the ability of T-

376 sporozoites to penetrate into MDBK cells and develop to mature merozoites. Percent values were calculated in refer- ence to MIC determined for the Houghton strain (0.5, 2.5, 1, 0.5 μg/ml for Mon, Mad, Sal, and Las, respectively). This model was performed in duplicate including non- treated sporozoite controls for Houghton strain and in quadru- plicate for T-376 strain.

Study 2: sporozoite inhibition assay using ionophores

The determined MICs were used to incubate sporozoites and assess reduction of their ability to invade MDBK cells. Houghton strain sporozoites were incubated for 2 or 4 h with

and assess reduction of their ability to invade MDBK cells. Houghton strain sporozoites were incubated for

2158

Parasitol Res (2015) 114:21552163

Mon (0.5 μ g/ml), Mad (2.5 μ g/ml), Sal (1 μ g/ml), or Las (0.5 μg/ml), at 41 °C in DMEM. T-376 strain sporozoites were incubated for 4 h at the same ionophore concentrations. Following incubation, sporozoites of both strains were centri- fuged three times with PBS to rinse them free of ionophores before they were added to MDBK cell layers at a density of 1.0×10 5 sporozoites/well. After 4 h co-cultivation at 41 °C and 5 % CO 2 , all wells were washed four times with PBS. To determine sporozoite penetration rates, 10 ran- domly selected fields were counted at 400× magnifica- tion using phase-contrast microscopy (Pierce 1980 ). After counting intracellular sporozoites, all wells were detached using trypsin-versene and DNA was extracted following the above mentioned protocol. This model was per- formed in quadruplicate including non-treated sporozoite con- trols for both strains.

Study 3: reproduction inhibition assay using Tol

by Levene test) were compared using Students t test. Kruskal- Wallis and Mann-Whitney U tests were used for non-normally distributed data. Spearman correlation coefficient analysis was used to determine correlation between % of inhibition obtained by qPCR and phase-contrast microscopy in study 2 for both E. tenella strains. All statistical analyses were per- formed using SPSS statistic 22® (IBM, New York, 2014).

Results

Standard curve and qPCR validation

ITS-1 gene fragment was successfully transformed on pSCA- amp/kan plasmid. This transformation was tested by T3/T7 primers (Fig. 1) and confirmed by sequencing and presence of ITS-1 gene fragment in the plasmid. Considering the total length of 4447 bp (insert 147+4300 bp pSCA-amp/kan), a

To determine MIC for Tol that will reduce Houghton strain gene copies by 95 %,
To determine MIC for Tol that will reduce Houghton strain
gene copies by 95 %, a different assay design was chosen.
MDBK cells co-cultured with 5.0×10 4 Houghton sporozoites
were incubated at 41 °C and 5 % CO 2 for 24 h, and then,
extracellular sporozoites were removed by four-times washing
with PBS. After another 24 h, MDBK cells were incubated
with different concentrations (10, 5, 2.5, 1, 0.5, 0.25, and
0.1 μg/ml) of Tol for another 48 h in quadruplicate. Cell cul-
tures were detached using trypsin-versene, and DNA was ex-
tracted following the abovementioned protocol. Based on the
previous results for Houghton strain, a Tol concentration of
5 μg/ml was chosen to study sensitivity of T-376 sporozoites.
Positive (infected and non-treated) and negative (non-in-
fected and non-treated) MDBK controls were performed for
each incubation condition in quadruplicate.
Data analysis
In vitro inhibition percentage for each anticoccidial agent was
calculated as follows:
% of Inhibition
¼ 100* 1−
number of E : tene lla gene copiesintreated sample
number of E : tene lla gene copiesin non ‐ treated control
For RIA, the optimal ionophore test concentration was con-
sidered based on the criteria of more than 50 % of inhibition in
the first 24 h and more than 95 % in further time intervals of
incubation. Statistical difference between treated and non-
treated wells and between % of inhibition in Houghton and
T-376 strains was calculated. Firstly, Kolmogorov-Smirnov
test was used to determine normal distribution of data.
Normally distributed data with an equality of variances (tested
Fig. 1 Gel electrophoresis (1.5 % agarose gel) of plasmid DNA. Band
size of ITS-1 gene fragment in pSCA-amp/kan plasmid using T3/7 and
ET-R/F (ET-147 bp) primers

Parasitol Res (2015) 114:21552163

2159

copy number of (4.82×10 10 )/μl was calculated corresponding to the amount of 235 ng/μl DNA gathered. Different standard dilutions were prepared and preserved at 20 °C. A standard curve using pSCA-amp/kan plasmid was drawn by plotting cycle threshold (C t ) values against the log number of DNA copies obtained from qPCR (Fig. 2) and was considered in each qPCR reaction. Correlation ( r 2 ) values ranged from

0.991

to 1.000. Efficiency of qPCR ranged from 91.0 to

105.0

%. Melting curve analysis of all samples showed a

single melting peak with T m value of 86.1 °C.

Mitochondrial toxicity test

There was no significant difference in cell viability between MDBK cells treated with concentrations from 1 to 10 μg/ml of the tested anticoccidial compounds as compared to cells that were grown without anticoccidial compounds. However, Mon, Mad, Sal, and Tol at 100 μg/ml caused damage. Death of MDBK cells at 100 μg/ml could be attributed to the high concentration of dimethyl formamide, used to dissolve the anticoccidial agents. Las, a stock solution without further need of solvents, did not affect MDBK cellsviability even at a concentration of 100 μg/ml.

Study 1: reproduction inhibition assay with ionophores

Both E. tenella Houghton and T-376 strains show similar abil- ity to invade into and proliferate in MDBK cells though the timing and replication rate is slightly variable (Fig. 3 ). Treating Houghton strain sporozoites with ionophores at con- centrations ranging from 10 to 0.1 μg/ml for 24 h resulted in a linear decrease of E. tenella gene copies. Further development of the previously treated sporozoites (was assessed after 48,

3.6E+04 3.1E+04 2.6E+04 2.1E+04 1.6E+04 Houghton 1.1E+04 T-376 6.0E+03 1.0E+03 24 48 72 96 E.
3.6E+04
3.1E+04
2.6E+04
2.1E+04
1.6E+04
Houghton
1.1E+04
T-376
6.0E+03
1.0E+03
24
48
72
96
E. tenella gene copies

time point after infection (hours)

Fig. 3 Comparison between growth rate of Houghton and T-376 strains in MDBK cells without the presence of anticoccidials (determination by qPCR in study 1)

72, and 96 h) was highly depressed compared with non-treat- ed positive control groups (data not shown). The dose considered as MIC was defined by 50 % reduction in sporozoite invasion within 24 h after treatment and more than 95 % reduction of multiplication after 48, 72, or 96 h of incubation. MICs were 0.5 μ g/ml for Mon, 2.5 μg/ml for Mad, 1 μg/ml for Sal, and 0.5 μg/ml for Las, as illustrated in Table 1. T-376 sporozoitesability to invade MDBK cells was sig- nificantly reduced in the first 24 h after application of MIC for all ionophores. Mon, Sal, and Las also affected ability of T-376 sporozoites to develop into mature mer- ozoites with an inhibition of more than 95 % after 96 h. In contrast, inhibition of Mad-treated T-376 strain spo- rozoites was lower with 89.3 % after 96 h. There were significant differences in T-376 extent of inhibition using Mon and Mad after 96 h compared with Houghton strain (Table 1 ).

Fig. 2 Standard curve for qPCR using pSCA-amp/kan plasmid. Standard curve generated from serially diluted plasmid DNA during testing concentration of unknown cell culture samples. (Unknown samples are from study 3: % of inhibition after treating Houghton strain with Tol- 5 μg/ml)

24 FAM Standards, RSq:0.999 22 FAM Unknowns FAM, Y = -3.354*LOG(X) + 32.87, Eff. =
24
FAM Standards,
RSq:0.999
22
FAM Unknowns
FAM, Y = -3.354*LOG(X) + 32.87, Eff. = 98.7%
20
18
16
14
12
10
8
6
1.0E+02
1.0E+03
1.0E+04
1.0E+05
1.0E+06
1.0E+07
1.0E+08
(dRn )Ct

Initial Quantity (copies)

16 14 12 10 8 6 1.0E+02 1.0E+03 1.0E+04 1.0E+05 1.0E+06 1.0E+07 1.0E+08 (dRn )Ct Initial

2160

Parasitol Res (2015) 114:21552163

Table 1 Reproduction inhibition assay (RIA) for Houghton and T-376 strains: Ionophore MICs were chosen based on Houghton strain results (more than 50 % of inhibition in sporozoite number at 24 h and more than 95 % of inhibition in 48, 72, and 96 h)

 

% of inhibition

 

24 h

48 h

72 h

96 h

Ionophores (μg/ml)

Houghton

T-376

Houghton

T-376

Houghton

T-376

Houghton

T-376

Mon (0.5)

64.4±1.3

78.6±6.9

a

97.5±0.9

91.9±6.6

99.7±0.1

94.6±1.6

99.5±0.3

97.9±0.3

a

Mad (2.5)

64.6±3.6

87.9±3.3

a

99.2±0.18

90.5±3.8

99.9±0.1

91.3±4.2

99.8±0.0

89.3±7.3

a

Sal (1)

54.5±15.9

84.9±10.4 a

98.2±0.1

87.1±7.2

99.5±0.2

92.9±1.4

99.7±0.0

96.1±2.7

Las (0.5)

73.6±12.8

87.5±4.3

97.6±2.0

80.9±11.6

99.6±0.3

85.3±5.1

99.8±0.0

96.5±0.7

% of inhibition=100×(1 E. tenella gene copies in treated sample / E. tenella gene copies in non-treated control)

a Significant difference compared to respective treatment group of Houghton strain sporozoites (P <0.05)

Study 2: sporozoite inhibition assay with ionophores

Houghton strain sporozoites exposed to MIC of ionophores for 2 and 4 h displayed significantly reduced invasion into MDBK cells. In the 2-h incubation experiment, there was a significant difference between microscopical counts of treated and non-treated groups. However, using qPCR, a significant difference was only observed between Mad and the non- treated control (Fig. 4a). In the 4-h incubation experiment, significant inhibition was detected in all ionophore-treated groups by either phase-contrast microscopy or qPCR as illus- trated in Fig. 4b. Incubating T-376 sporozoites with MIC for 4 h inhibited invasion of these sporozoites into MDBK cells. However, the percentage of inhibition of T-376 was signifi- cantly lower than for the Houghton strain sporozoites. Percentage of inhibition in Mad-treated sporozoites was lower than 50 % as illustrated in Fig. 4c. There was a strong corre- lation between the results of phase-contrast microscopy (Fig. 5 ) and qPCR in determining the number of invaded sporozoites incubated for either 2 or 4 h in both Houghton and T-376 strains. For Houghton strain, Spearmans rho (r s ) was 0.629 (P =0.003) after 2 h and 0.665 (P =0.001) after 4-h exposure, and for T-376, strain was 0.626 (P <0.001).

Study 3: reproduction inhibition assay with Tol

Tol was added to sporozoite-infected MDBK cells 48 h after infection, and cultures were further incubated with Tol for another 48 h. Gene copy numbers of Houghton strain deter- mined by qPCR 96 h after infection demonstrated that Tol at a concentration of 10, 5, 2.5, 1, 0.5, and 0.25 μg/ml caused a 95.9, 95, 87.6, 85.4, 74.3, and 72.7 % dose-dependent reduc- tion. Tol at a concentration 0.1 μ g/ml led to reduction of 10.5 % only, which was not statistically significant (Fig. 6). Therefore, a treatment concentration of 5 μg/ml was defined as MIC in terms of leading to a replication inhibition of at least 95 % in the chosen model. Incubation of T-376 sporozoites

95 % in the chosen model. Incubation of T-376 sporozoites with 5 μ g/ml Tol resulted

with 5 μg/ml Tol resulted in 86.5 % reduction of E. tenella replication after 48 h of infection compared to the T-376 spo- rozoite infected non-treated group (Fig. 6).

Discussion

Using a plasmid standard like the created pSCA-amp/kan plasmid is crucial for establishing the standard curve in order to validate the quality and quantity of each single assay and to deduce accurate results. Data generated from a serial dilution of this kind of positive control DNA are considered reliable to determine the overall performance of qPCR assay and sporo- zoite number. Although the prophylactic use of live vaccines is wide- spread and several anticoccidial agents in poultry feed were banned in many regions in the world; chemoprophylactic treatment is still leading in the control of chicken coccidiosis (Allen and Fetterer 2002) and polyether ionophores still play a major role in anticoccidial programs in poultry production in many regions of the world either alone or in shuttle programs (McDougald 1990). Traditionally, testing anticoccidial efficacy against Eimeria spp. is performed in vivo, entailing diagnostic section of a large number of chickens (Johnson and Reid 1970; Stephan et al. 1997). Cell culture assays are extensively studied as alternative tests to assess the infectivity and multiplication of Eimeria spp. under controlled and standardized conditions (Schmatz et al. 1986; Zhang et al. 1996). In our study, there were no fundamental differences between the laboratory strain (Houghton) and field strain (T-376) in their ability to infect and develop in MDBK cells in the absence of any anticoccidial agent (Fig. 3), which indicates the suitability of these cells to be used in an anticoccidial sensitivity assay. This finding is corroborated by previous studies stating that MDBKs are a very suitable epithelial line supporting E. tenella invasion and growth (Tierney and Mulcahy 2003).

Parasitol Res (2015) 114:21552163

2161

Fig. 4 Comparison between phase-contrast microscopy and qPCR results in determination of sporozoites inhibition assay (SIA) of Houghton and T-376 sporozoites by ionophores. a Inhibition of Houghton strain sporozoites after 2 h treatment period. b Inhibition of Houghton strain sporozoites after 4 h treatment period. c Inhibition of T-376 strain sporozoites after 4 h treatment period. *Statistically significant treatment effects compared with non-treated Houghton strain sporozoites (P <0.05). Significant difference in T-376 strain % of inhibition compared with Houghton strain inhibition after 4 h treatment period (P <0.05)

a

Houghton strain (2 hours)

100 90 Microscopy 80 qPCR * * * 70 * 60 * 50 40 30
100
90
Microscopy
80
qPCR
*
*
*
70
*
60
*
50
40
30
20
10
0
Mon (0.5)
Mad (2.5)
Sal (1)
Las (0.5)
% of inhibition

ionophores (µg/ml)

b Houghton strain (4 hours) Microscopy 100 * qPCR * * * * 90 *
b
Houghton strain (4 hours)
Microscopy
100
*
qPCR
*
*
*
*
90
*
*
*
80
70
60
50
40
30
20
10
0
Mon (0.5)
Mad (2.5)
Sal (1)
Las (0.5)
% of inhibition

ionophores (µg/ml)

c T-376 (4 hours) Microscopy qPCR 100 † 90 † † † 80 † 70
c
T-376 (4 hours)
Microscopy
qPCR
100
90
80
70
† †
60
50
40
30
20
10
0
Mon (0.5)
Mad (2.5)
Sal (1)
Las (0.5)
% of inhibition

Further field isolates should be tested and their sensitivity profile should be confirmed in vivo to determine suitability of this in vitro assay to estimate anticoccidial sensitivity. Recently, Jenkins et al. (2014) introduced an in vitro model using qPCR to test for salinomycin and monensin sensitivity in E. tenella isolates. They found that qPCR and semi-

ionophores-µg/ml

quantitative PCR are useful methods to test coccidial sensitiv- ity against ionophores and an incubation period for E. tenella sporozoites with ionophores for 24 h was optimal to determine sporozoite sensitivity. The present studies were conducted in order to establish a suitable and sensitive in vitro model to assess sensitivity of

The present studies were conducted in order to establish a suitable and sensitive in vitro model

2162

Parasitol Res (2015) 114:21552163

2162 Parasitol Res (2015) 114:2155 – 2163 Fig. 5 Intracellular E. tenella sporozoites after 4-h incubation

Fig. 5 Intracellular E. tenella sporozoites after 4-h incubation period in MDBK cells at 41 °C. Intracellular sporozoites are visualized using phase-contrast microscopy A at 400× and B at 1000× (white arrows)

E. tenella isolates toward anticoccidial agents in the laborato- ry. Houghton strain is the ideal reference strain, because of its history of no exposure to anticoccidial agents, and therefore, it was used to estimate MIC and to optimize test conditions. Ionophores affect mainly the cationic movement across spo- rozoite membranes and will also affect metabolic processes (Reed 1982). Based on ionophore mode of action, two criteria were taken into consideration in studies 1 and 2. Firstly, par- asite reproduction, i.e., the ability of sporozoites to develop into mature merozoites and multiply after treatment with dif- ferent ionophore concentrations for 24 h (study 1). Secondly, inhibition of invasion by previously incubated sporozoites was estimated by using two different evaluation methods, namely qPCR and phase-contrast microscopy (study 2). In study 1, it was noticed that for treated sporozoites of both strains, invasion of MDBK cells was reduced and further

development was almost completely inhibited. Inhibition of development was most obvious 96 h after infection, which appears the most suitable period for assessment. Incubation of Houghton sporozoites with ionophores for 4 h was superior to shorter treatment exposure to assess inhibition of the para- site. Results obtained by qPCR and phase-contrast microsco- py were similar for both Houghton and T-376 strains. However, slightly lower inhibition rates were measured by qPCR. This difference may be attributed to non-invasive spo- rozoites that are extracellularly attached to MDBK cells and were not removable by the washing procedure. Such parasites are quantified by qPCR but are neglectable during phase- contrast microscopy since they are obviously not invasive. Overestimation of viability by in vitro assays combined with qPCR is a common phenomenon in coccidiosis research (Rochelle et al. 2002); however, this is considered acceptable if the same reproducible method is always used. In fact, the correlation between both microscopy and qPCR was high, and thus, we concluded that sufficient reproducibility is given. The mode of action of Tol was studied by electron micros- copy, showing that it acts against all intracellular stages of coccidia by interfering with nuclear division and mitochondri- al activity (Vázquez and Vázquez 1990). In our experiment performed on Tol (study 3), firstly, Houghton sporozoites were incubated with toltrazuril for 24 h to investigate the efficacy of treatment on sporozoite viability. However, there was no marked effect using this approach (data not shown). This confirms the observations that Tol affects endogenous stages of E. tenella and has only a minimum effect on sporo- zoite activity (Köstelbauer et al. 2011). Following application of Tol 48 h after invasion, the T-376 strain showed lower percentage inhibition (86.5 %) with a significant difference compared to the Houghton strain (95 %). These results indi- cate a difference in sensitivity toward Tol between these two

Fig. 6 Comparison of inhibition of Houghton strain and T-376 gene copies after 48 h treatment with Tol. (*Statistically significant difference in % of inhibition compared with non- treated groups (P <0.05). Statistically significant difference in % of inhibition compared with Houghton strain (P <0.05))

of inhibition compared with Houghton strain ( P <0.05)) Houghton stain 100 * * T-376 *
Houghton stain 100 * * T-376 * 90 † * 80 * * 70 60
Houghton stain
100
*
*
T-376
*
90
*
80
*
*
70
60
50
40
30
20
10
0
Tol (10)
Tol (5)
Tol (2.5)
Tol (1)
Tol (0.5)
Tol (0.25)
Tol (0.1)
% of inhibition

toltrazuril (µg/ml)

Parasitol Res (2015) 114:21552163

2163

strains and may indicate reduction in Tol efficacy on the T-376 strain. However, whether this applies to in vivo conditions remains to be demonstrated. In conclusion, in vitro efficacy assays were established for different ionophore anticoccidials and toltrazuril using two strains of E. tenella. The chosen combination of in vitro cul- ture and qPCR appears promising to assess anticoccidial sen- sitivity of E. tenella and may thus be suited to replace animal experimentation. The qPCR is considered advantageous be- cause of its high reproducibility, comparably low hands-on time, and high throughput capacity. Calculations of the per- centage inhibition of sporozoites incubated for 4 h and of parasite replication at 96 h after infection are suitable param- eters and may provide elaboration of reliable E. tenella sensi- tivity profiles toward the tested anticoccidial agents. This would be most valuable considering the widespread develop- ment of anticoccidial resistance and the need of simple and reliable laboratory screening methods in search of alternative anticoccidial products.

References

Abbas R, Iqbal Z, Blake D, Khan M, Saleemi M (2011) Anticoccidial drug resistance in fowl coccidian: the state of play revisited. World Poult Sci J 67:337350

Allen P, Fetterer R (2002) Recent advances in biology and immunobiology

of Eimeria species and in diagnosis and control of infection with these

coccidian parasites of poultry. Clin Microbiol Rev 15:5865 Chapman H (1998) Evaluation of the efficacy of anticoccidial drugs against Eimeria species in the fowl. Int J Parasitol 28:11411144 Haberkorn A, Stoltefuss J (1987) Studies on the activity spectrum of toltrazuril, a new anti-coccidial agent. Vet Med Rev 1:2232 Jenkins M, Obrien C, Fuller L, Mathis G, Fetterer R (2014) A rapid method for determining salinomycin and monensin sensitivity in Eimeria tenella . Vet Parasitol S0304 4017(14):00502-0. doi: 10.1016/j.vetpar.2014.09.017

Johnson J, Reid W (1970) Anticoccidial drugs: lesion scoring techniques

in battery and floor-pen experiments with chickens. Exp Parasitol

28:3036

Kawahara F, Taira K, Nagai S, Onaga H, Onuma M, Nunoya T (2008) Detection of five avian Eimeria species by species-specific real-time polymerase chain reaction assay. Avian Dis 52:652656 Köstelbauer A, Teichmann K, Henikl S, Schatzmayr G (2011) A flow cytometric invasion inhibition assay for the screening of anti- eimerial phytogenics. Animal hygiene and sustainable livestock pro- duction. Proceedings of the XVth International Congress of the International Society for Animal Hygiene, Vienna, Austria, 3-7 July 2011, volume 3, pp 12951297 Mattiello R, Boviez J, McDougald L (2000) Eimeria brunette and E. necatrix in chickens of Argentina and confirmation of seven species of Eimeria. Avian Dis 44:711714

McDougald L (1982) Chemotherapy of coccidiosis (Chapter 9). In: Long

P (ed) The biology of the coccidiosis. University Park Press,

Baltimore, pp 373427

McDougald L (1990) Control of coccidiosis: chemotherapy. In: Long P (ed) Coccidiosis of man and domestic animals. CRC Press, Boca Raton, pp 307320 McDougald L, Fitz-Coy S (2013) Coccidiosis: protozoal infections. In:

Swayne DE (ed) Diseases of poultry, 13th edn. Blackwell, New

York, pp 11481166 McDougald L, Galloway R (1976) Anticoccidial drugs: effects on infec- tivity and survival intracellularly of Eimeria tenella sporozoites. Exp Parasitol 40:314319 McDougald L, Fuller L, Mattiello R (1997) A survey of coccidian on 43 poultry farms in Argentina. Avian Dis 41:923929 Mehlhorn H, Pooch H, Raether W (1983) The action of polyether ionophorous antibiotics (monensin, salinomycin, lasalocid) on de- velopmental stages of Eimeria tenella (Coccidia, Sporozoa) in vivo and in vitro: study by light and electron microscopy. Z Parasitenkd

69:457471

Mosmann T (1983) Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 65:5563 Peek H, Landman W (2003) Resistance to anticoccidial drugs of Dutch avian Eimeria spp. field isolates originating from 1996, 1999, 2001. Avian Pathol 32:391401 Pierce M (1980) A simple staining technique to demonstrate the sporozoite refractile globule in coccidian parasites. Parasitology 80:

551554

Raether W, Hofmann J, Uphoff M (1995) In vitro cultivation of avian Eimeria species: Eimeria tenella. In: Eckert J, Braun R, Shirley MW, Coudert P (eds) Biotechnology guidelines on techniques in coccidiosis. European Commission, Brussels, pp 7992 Reed P (1982) Biochemichal and biological effects of carboxylic acid ionophores. In: Westley JW (ed ) Polyether antibiotics. Marcel Dekker, New York, pp 185302 Rochelle P, Marshall M, Mead J, Johnson A, Korich D, Rosen J, De Leon

R (2002) Comparison of in vitro cell culture and a mouse assay for

measuring infectivity of Cryptosporidium parvum. Appl Environ Microbiol 68:38093817 Schmatz D, Crane M, Murray P (1984) Purification of Eimeria sporozoites by DE-52 anion exchange chromatography. J Protozool 31:181183 Schmatz D, Crane M, Murray P (1986) Eimeria tenella: parasite-specific incorporation of 3 H-uracil as a quantitative measure of intracellular

development. J Protozool 33:109114 Shirley M (1977) Development of some species and strains of Eimeria from single sporozoites and sporocyst. J Parasitol 24:A43A44 Smith C, Galloway R, White S (1981) Effect of ionophores on survival, penetration, and development of Eimeria tenella sporozoites

in vitro. J Parasitol 67:511516

Stephan B, Rommel M, Daugschies A, Haberkorn A (1997) Studies of resistance to anticoccidial in Eimeria field isolates and pure Eimeria

strains. Vet Parasitol 69:1929 Tierney J, Mulcahy G (2003) Comparative development of Eimeria tenella (Apicomplexa) in host cell in vitro. Parasitol Res 90:301304 Vázquez F, Vázquez R (1990) Toltrazuril: a new anticoccidial drug against all species of coccidia. In: Proceedings of the 39th Western Poultry Disease Conference, Sacramento, CA, pp 7475 Wang Z, Suo X, Xia X, Shen J (2006) Influence of monensin on cation influx and Na+-K+-ATPase activity of Eimeria tenella sporozoites

in vitro. J Parasitol 92:10921096

Zhang J, Wilson E, Yang S, Healey M (1996) Increasing the yield of Eimeria tenella oocysts in primary chicken kidney cells. Avian Dis

40:6367

Zhu G, McDougald L (1992) Characterization in vitro and in vivo of resistance to ionophores in a strain of Eimeria tenella. J Parasitol

78:10671073

in vitro and in vivo of resistance to ionophores in a strain of Eimeria tenella .