The Muscular

System
Facts, Figures, And New Perspectives On This Human System

By: Ryan Ackles, Calysta Aguilar, and Chris Tavares

How does the Muscular System impact athletes performance on an everyday basis?

The Basics
-

Muscular System: organ system with skeletal, smooth and cardiac

muscles, allows the body to move, preserves posture, and cycles blood
throughout the human system.

Connected to Skeletal System, 700 muscles equal half of humans weight

Organs made of tendons, nerves, blood vessels, skeletal muscle tissue

Muscles use contraction and relaxation

Contraction
-

Muscle fibers contract as a reaction to nerve stimuli in nervous system

Release calcium in the cells of the muscle fiber

In skeletal muscles, two types of proteins, myosin (thick filament) and

actin (thin filament) intertwine in hundreds of molecules to form muscle

Protein plate (Z disc) anchors the strong myosin-actin bond

Leads to shortening of singular muscle fibers

Contraction

Relaxation
-

Acetylcholinesterase releases between motor end plate (communicates

contraction/reaction from nervous system) and the muscle fibers

Every muscle has an opposing muscle

Once current muscle starts relaxation, counterpart contracts

Pulls initially contracting muscle back into its relaxed position

Visceral Muscles
-

Smooth muscles energized by uncontrolled movements

Flexible contraction/relaxation movements formed by impulses

Expand and relax as needed (ex: bladder system, digestive canal)

Helps eye adjust to view objects, circulates blood

Examples: Eye, Blood Vessel, Esophagus, Stomach, etc.

Cardiac Muscles
-

Only found in the heart, connected by intercalated disks

Cardiac muscle cells contract in wave-like motions

Moves blood through the entire body in under a minute

Cardiac muscle allows heart to beat with constant force for whole life

Has improved in rhythm, strength, and endurance over many years

Skeletal Muscles
-

Attach to and move bones, receive messages from nervous system

Have muscle fibers, which are bundles created by blood vessels

These fibers have a nerve endings and obtain brain impulses

This allows the muscle to perform certain actions

Examples: Fascicle, Blood Vessel, Motor Neuron, Muscle Fiber

CRISPR Technology
-

CRISPR technology can edit parts of the genome (add or delete)

RNA molecule that directs and instructs which sequence to cut.

Cas9 is an enzyme instructed by RNA to oscillate certain DNA sequences

Can cut and replace targeted sequences

A broken Cas9 only has the ability to cut targeted sequences

Become The CRISPR

-

Find the mutation

Highlight start and end of mutation
Cut highlighted lines with scissors (fingers in second part)
Tape two pieces of non-mutated sequences together

Unmutated Sequence: ATTGCCTTGGCTGCAAGCCAT

Reflection
- What is different between the two Cas9s?
- How might these Cas9s be used in gene therapy?

Possible Affected Genes

-

ACE: Allows you to climb 8,000-meter peaks without oxygen

SCN9A: Blocks pain pathways in nerves, allows athletes to push past pain

MSTN: Body grows double the current muscle mass when deactivated

PEPCK - Helps human create energy to run at top speed for 60% longer

LRP5 - Creates unbreakable bones by increasing skeletal density

Cerebral Palsy (CP)

-

Negatively impacts posture, balance, motor skills, muscle movement,

coordination, reflex, oral motor control, etc.

Initially caused by brain injury or slow development in the brain

May cause a spectrum of issues (tight hamstrings to paralyzation)

CP is incurable and permanent but not progressive nor life-threatening

Amyotrophic Lateral Sclerosis (ALS)

-

Progressive neurodegenerative condition

Disable voluntary movements and muscle control

Could lose the ability to speak, move, or eat

Initial challenges in these areas to paralysis

50% gene mutation inheritance rate to offspring

Compartment Syndrome
-

Muscle pressure exceeds normal level, dangerous

Swelling or bleeding may take place, oxygen deficiency to area

Often caused by a significant injury, everlasting damage if left untreated

Surgical treatment is available for this syndrome

Athlete Interview
Interview With Bryant Westbrook, Former NFL Player (DET, DAL, GB)
On how muscle condition affects athletic ability, Getting in the weight room, conditioning your muscles
helps prevent you from, especially playing football, helps to prevent injuries.
On how to train to combat muscular injuries, It takes a thousand reps to condition the mind. You just cant
do it one day. You have to continuously do something on a regular basis in order to help and affect your
body.
On how to improve performance in football, I think its work ethic, it all boils down to work ethic, it all boils
down to work ethic. Having a great mindset, working hard, trying to outwork the next person Thats what
gets you over the top to success and become great at whatever you want to do.

Researcher Interview
Interview With Girish C. Melkani PhD, SDSU - Research Assistant Professor
On the current project he is working on, Understanding of the impact of daily rhythms on cardiac and
skeletal muscle physiology, circadian rhythm, nutrition, sleep, obesity, diabetes, and other metabolic
disorders.
On tips to improve health, function, and mobility, Maintenance of daily feeding/fasting rhythms improves
cardiac and skeletal muscle function and dysregulation of metabolic rhythms is associated with obesity,
diabetes, and other metabolic disorders. Exercise and other physical activity also useful to keep muscular
system healthy.
On future interests and goals, My long-term research interest lies in understanding how genes and lifestyle
interact in determining predisposition toward cardiac, muscle and other metabolic diseases. To improve
health span associated with age, muscular system and cardiometabolic diseases.

Squat, Squat, Squat!!!

-

Hold an isometric squat for thirty seconds

Wait thirty seconds to provide buffering period
Complete twenty reps of a moving squat

Reflection
- How did these squat types compare? How were they different?
- Was the isometric squat or the moving squat more painful?
- Do these squat types use different muscles?

Slow-Twitch Muscles (Type I)

-

Slow muscle fibers affect and contribute to endurance exercises

Muscles rip apart when stretched to grow longer lasting muscle genes

Type I muscles transports oxygen in an effective manner

Contracts for a longer time using proteins, fats, and carbohydrates

Extremely helpful for distance running, swimming and bicycling.

Fast-Twitch Muscles (Type II)

-

Fast-twitch muscle fibers affect and contribute to quick exercises

Type I muscles tire out, Type II muscles kick in for short amount of time

Type II muscle has less protein-holding oxygen (myoglobin) and contracts

with speed, strength

Fast-twitch muscles have less stamina than slow-twitch muscles

Affects sprint and weightlifting abilities

Final Facts
-

Muscle makes up about 40% of the weight of all humans

Muscle tissue is 15% more dense in comparison to fat tissue

17 muscles to smile, 43 muscles to frown

Most enduring muscles: outer eye muscles, most strength: masseter (jaw)

Over the human lifespan, the cardiac muscle type does the most work

Additional Resources
YourGenome.org
FutureOf.org
ScienceKids.co
Nature.com
Labiotech.eu
Health.UCSD.edu
Musculoskeletal Diseases
BodyBuilding.com
Study.com

ScienceDaily.com
HealthyLiving.AzCentral.com
Ucl.Ac.uk
NewHealthAdvisor.com
CerebralPalsy.org
Alsa.org
Orthoinfo.Aaos.org
LiveStrong.com
Boundless.com